Method for detecting the presence of a hypervirulent <i>Clostridium difficile </i>strain
11566294 · 2023-01-31
Assignee
Inventors
Cpc classification
C12Q2537/143
CHEMISTRY; METALLURGY
C12Q2537/143
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention provides a nucleic acid amplification based method for detecting a hypervirulent Clostridium difficile strain in a biological sample. The present invention is based on the use of oligonucleotide primers and probes specific to negative and positive markers in hypervirulent Clostridium difficile genome.
Claims
1. A method of detecting the presence of a hypervirulent Clostridium difficile strain in a biological sample, the method comprising: performing a nucleic acid amplification reaction comprising DNA extracted from the biological sample as a template, a first oligonucleotide primer set specific for amplifying a target sequence in the C. difficile hydR gene in the reaction, wherein said hydR gene target sequence comprises at least part of the sequence set forth in SEQ ID NO: 1, and a second oligonucleotide primer set specific for amplifying at least part of the target sequence corresponding to C. difficile sequence set forth in SEQ ID NO:2 in the reaction.
2. The method according to claim 1, further comprising a step of detecting the presence of a hypervirulent Clostridium difficile strain in said biological sample, wherein the hypervirulent Clostridium difficile strain is detected in the sample, when the first oligonucleotide primer set does not amplify a specific product and the second oligonucleotide primer set amplifies a specific product.
3. The method according to claim 1, wherein the hypervirulent Clostridium difficile strain is Clostridium difficile strain 027 or a 027-ribotype-resembling Clostridium difficile strain.
4. The method according to claim 1, wherein the presence of C. difficile hydR gene DNA in said sample indicates that Clostridium difficile strain 027 is not present in the sample.
5. The method according to claim 1, wherein the C. difficile-specific target sequence for the first oligonucleotide primer set is a nucleotide region of an C. difficile hydR gene as set forth in SEQ ID NO: 1 and at least part of said nucleotide region is specifically amplified.
6. The method according to claim 5, wherein the first oligonucleotide primer set comprises an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO: 3 and an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO: 4.
7. The method according to claim 6, wherein the first oligonucleotide primer set comprises an oligonucleotide comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO: 3 and an oligonucleotide comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO: 4.
8. The method according to claim 1, wherein the presence of the target sequence amplified with the first oligonucleotide primer set is detected by the use of a probe comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO:7.
9. The method according to claim 8, wherein the presence of the target sequence amplified with the first oligonucleotide primer set is detected by the use of a probe comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO:7.
10. The method according to claim 1, wherein the second oligonucleotide primer set comprises an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in a nucleotide sequence as set forth in SEQ ID NO: 5 and an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in a nucleotide sequence as set forth in SEQ ID NO: 6.
11. The method according to claim 10, wherein the second oligonucleotide primer set comprises an oligonucleotide comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO: 5 and an oligonucleotide comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO: 6.
12. The method according to claim 1, wherein the presence of the target sequence amplified with the second oligonucleotide primer set is detected by the use of a probe comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO:8 or 9.
13. The method according to claim 1, wherein the amplification reaction further comprises a third oligonucleotide primer set specific for amplifying C. difficile toxin B gene (tcdB) in the reaction and at least part of nucleotide region as set forth in SEQ ID NO: 10 is specifically amplified in the reaction.
14. The method according to claim 13, wherein the third oligonucleotide primer set comprises an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO: 11 and an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO: 12.
15. The method according to claim 14, wherein the third oligonucleotide primer set comprises an oligonucleotide comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO: 11 and an oligonucleotide comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO: 12.
16. The method according to claim 13, wherein the presence of the target sequence amplified with the third oligonucleotide primer set is detected by the use of a probe comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO:13.
17. The method according to claim 16, wherein the presence of the target sequence amplified with the third oligonucleotide primer set is detected by the use of a probe comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO: 13.
18. The method according to claim 1, wherein the biological sample is a stool sample or a food sample.
19. The method according to claim 2, wherein the detection of hypervirulent Clostridium difficile strain is performed using a DNA chip, gel electrophoresis, a radiation measurement, a fluorescence measurement, or a phosphorescence measurement.
20. The method according to claim 1, wherein the method is performed as a real-time PCR assay.
21. The method according to claim 1, wherein the nucleic acid amplification reaction is a PCR reaction.
22. The method according to claim 21, wherein the PCR reaction is performed as a real-time PCR assay.
23. The method according to claim 1, wherein the first oligonucleotide primer set amplifies at least 50 contiguous nucleotides of SEQ ID NO:1.
24. The method according to claim 1, wherein the second oligonucleotide primer set amplifies at least 50 contiguous nucleotides of SEQ ID NO:2.
25. The method according to claim 6, wherein the oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO: 3 and the oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO: 4 are each less than 30 nucleotides in length.
26. The method according to claim 6, wherein at least one oligonucleotide of the first oligonucleotide primer set comprises a modification selected from the group consisting of a base modification, a sugar modification, and a backbone modification.
27. The method according to claim 26, wherein at least one oligonucleotide of the first oligonucleotide primer set comprises a modified nucleotide selected from the group consisting of a LNA nucleotide, a minor groove binder (MGB)-conjugated nucleotide, a nucleotide with a SuperBase, and a PNA nucleotide.
28. The method according to claim 10, wherein the oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in a nucleotide sequence as set forth in SEQ ID NO: 5 and the oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in a nucleotide sequence as set forth in SEQ ID NO: 6 are each less than 30 nucleotides in length.
29. The method according to claim 10, wherein at least one oligonucleotide of the second oligonucleotide primer set comprises a modification selected from the group consisting of a base modification, a sugar modification, and a backbone modification.
30. The method according to claim 29, wherein at least one oligonucleotide of the first oligonucleotide primer set comprises a modified nucleotide selected from the group consisting of a LNA nucleotide, a minor groove binder (MGB)-conjugated nucleotide, a nucleotide with a SuperBase, and a PNA nucleotide.
Description
DETAILED DESCRIPTION OF THE INVENTION
(1) The purpose of the method of the present invention is to serve as a primary microbiological screening test for the qualitative identification of hypervirulent C. difficile, and a recurrent disease associated ribotype 027. The method is preferably performed from DNA extracted directly from a biological sample, such as a stool sample, without the use of an enrichment culture. Preferably, the method of the invention is a PCR-based C. difficile assay: such as a qPCR assay, or a qualitative multiplexed nucleic acid-based in vitro diagnostic test intended for detecting of nucleic acid markers corresponding to the detection and identification of hypervirulent Clostridium difficile and toxin producing 027 ribotype selective markers.
(2) As used herein, a “target sequence” present in a nucleic acid sample is a strand of C. difficile DNA to be primed and extended by a “primer”. A target sequence may be either single-stranded or in a duplex with its complementary sequence. Target sequence as defined in the present invention is preferably purified to some degree prior to the amplification reactions described herein.
(3) As used herein, the term “oligonucleotide” refers to any polymer of two or more of nucleotides, nucleosides, nucleobases or related compounds used as a reagent in the DNA amplification methods, such as primers and probes. The oligonucleotide may be DNA and/or RNA and/or analogs thereof. The term oligonucleotide does not denote any particular function to the reagent; rather, it is used generically to cover all such reagents described herein. Specific oligonucleotides of the present invention are described in more detail below. As used herein, an oligonucleotide can be virtually any length, limited only by its specific function in the DNA amplification reaction. Oligonucleotides of a defined sequence and chemical structure may be produced by techniques known to those of ordinary skill in the art, such as by chemical or biochemical synthesis, and by in vitro or in vivo expression from recombinant nucleic acid molecules, e.g., bacterial or viral vectors. Oligonucleotides may be modified in any way, as long as a given modification is compatible with the desired function of a given oligonucleotide. One of ordinary skill in the art can easily determine whether a given modification is suitable or desired for any given oligonucleotide of the present invention. Modifications include, but are not limited to base modifications, sugar modifications or backbone modifications. While design and sequence of oligonucleotides for the present invention depend on their function as described below, several variables must generally be taken into account. Among the most critical are: length, G/C content, melting temperature (Tm), Gibb free energy (G), specificity, self-complementarity and complementarity with other oligonucleotides in the system, polypyrimidine (T, C) or polypurine (A, G) stretches, and the 3′-end sequence. Controlling for these and other variables is a standard and well-known aspect of oligonucleotide design, and various computer programs are readily available to screen large numbers of potential oligonucleotides for optimal ones.
(4) As used herein, the term “PCR reaction”, “PCR amplifying” or “PCR amplification” refers generally to cycling polymerase-mediated exponential amplification of nucleic acids employing primers that hybridize to complementary strands, as described for example in Innis et al, PCR Protocols: A Guide to Methods and Applications, Academic Press (1990). Devices have been developed that can perform thermal cycling reactions with compositions containing fluorescent indicators which are able to emit a light beam of a specified wavelength, read the intensity of the fluorescent dye, and display the intensity of fluorescence after each cycle. The amplification product contains a sequence having sequence identity with a target nucleic acid sequence or its complement and can be detected with, for example, an intercalating dye or a detection probe having specificity for a region of the target nucleic acid sequence or its complement. The PCR reaction as defined in the present invention is preferably performed as a real-time PCR assay.
(5) As used herein, the term “probe” refers to any of a variety of signalling molecules indicative of amplification. For example, SYBR® Green and other DNA-binding dyes are detector probes. Some detector probes can be sequence-based, for example 5′ nuclease probes. Various detector probes are known in the art, for example TaqMan® probes (See U.S. Pat. No. 5,538,848). The melting temperature, Tm, of the probes can be increased by addition of modified nucleotides. The amount of modified nucleotides in one probe is preferably 1, 3, 4 or more. The modified nucleotide can be a LNA nucleotide (Exiqon A/S), minor groove binder (MGB™), SuperBase, or Peptide Nucleic Acid (PNA) or any other modification increasing the Tm of the probe.
(6) A person skilled in the art knows that amplified target sequences, i.e. amplicons, naturally vary in related strains. This minor variation can be taken into account while designing primers suitable to amplify said amplicons in the method of the present invention.
(7) Preferably, at least 50, 60, 70, 80, 90 or 100 nucleotides long sequence of each of the target amplicons selected from the group consisting of SEQ ID NOS:1, 2 and 10 is amplified in the method.
(8) Preferably, the primers and probes comprise the sequences as defined in the claims and are less than 30, 35, 40, 45, 50 or 55 nucleotides long, and more preferably, less than 50 nucleotides long. Each of the present primers and probes can also be defined as consisting of at least 10, 15, 16, 17, 18, 19 or 20 contiguous nucleotides present in any one of primer or probe sequences selected from the group consisting of SEQ ID NOS:3-9 and 11-13 or comprising a sequence selected from the group consisting of SEQ ID NOS:3-9 and 11-13.
(9) The present invention is directed to a method of detecting the presence of a hypervirulent Clostridium difficile strain in a biological sample. Preferably, the method is a real-time PCR assay. The method can be performed using a DNA chip, gel electrophoresis, a radiation measurement, a fluorescence measurement, or a phosphorescence measurement. A person skilled in the art may use the primers and probes of the invention also in other methods and platforms utilizing PCR or nucleic acid amplification. Said biological sample can be, e.g., a stool sample, an environmental sample or a food sample.
(10) The method comprises the step of:
(11) performing a nucleic acid amplification reaction comprising DNA extracted from the biological sample as a template, a first oligonucleotide primer set specific for amplifying a target sequence in the C. difficile hydR gene in the reaction, wherein said hydR gene comprises a sequence corresponding to SEQ ID NO:1, and a second oligonucleotide primer set specific for amplifying at least part of the target sequence corresponding to C. difficile sequence set forth in SEQ ID NO:2 in the reaction. Preferably, the method comprises a step of detecting the presence of a hypervirulent Clostridium difficile strain in said biological sample by any method capable of detecting amplified target sequences in the reaction.
(12) The hypervirulent Clostridium difficile strain is detected in the sample, when the first oligonucleotide primer set does not amplify a specific product, i.e. the target sequence in hydR gene is a negative marker for hypervirulent Clostridium difficile strain, and the second oligonucleotide primer set amplifies a specific product, i.e. the sequence targeted by the second primer set in C. difficile genome is a positive marker for hypervirulent Clostridium difficile strains.
(13) The most important hypervirulent Clostridium difficile strain detected by the present method is toxin producing Clostridium difficile strain 027. Thus, the present method is particularly directed to the detection of this Clostridium difficile strain. The presence of C. difficile hydR gene DNA in said sample, however, indicates that Clostridium difficile strain 027 is not present in the examined sample or that in addition to the presence of a toxin producing Clostridium difficile strain 027 there is also presence of another Clostridium difficile strain in the sample. A skilled person of the art is, however, aware that some of hypervirulent C. difficile strains are not classified as 027-ribotype strains, therefore, the present invention is also directed to the detection of hypervirulent 027-ribotype-resembling Clostridium difficile strains.
(14) Preferably, the first oligonucleotide primer set targets the C. difficile hydR gene and amplifies the hydR sequence set forth in SEQ ID NO:1 so that at least part of the sequence is specifically amplified in the amplification reaction. More preferably, the first oligonucleotide primer set comprises an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO: 3 and an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO: 4, said primers amplifying at least part of the hydR sequence set forth in SEQ ID NO:1. Most preferably, the first oligonucleotide primer set comprises an oligonucleotide comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO: 3 and an oligonucleotide comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO: 4.
(15) The presence of the target sequence amplified with the first oligonucleotide primer set can be detected by the use of a probe comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO:7, or preferably, by the use of a probe comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO:7.
(16) The target sequence of the second oligonucleotide primer set in C. difficile genome corresponds to a gene encoding a putative conjugative transposon DNA recombination protein. Preferably, said second oligonucleotide primer set comprises an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in a nucleotide sequence as set forth in SEQ ID NO: 5 and an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in a nucleotide sequence as set forth in SEQ ID NO: 6. More preferably, the second oligonucleotide primer set comprises an oligonucleotide comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO: 5 and an oligonucleotide comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO: 6.
(17) The probes for the second oligonucleotide primer set as defined in SEQ ID NO: 8 and 9 can be used as competitive probes in a same reaction to detect a G/A polymorphism in C. difficile genome in a position corresponding to position 12 in SEQ ID NO:8 or 9. The presence of the target sequence amplified with the second oligonucleotide primer set can be detected by the use of a probe comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO:7 so that said G/A polymorphism is detected. Preferably, the target sequence amplified with the second oligonucleotide primer set is detected by the use of a probe comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO:8 or 9.
(18) The amplification reaction as defined in the method may further comprise a third oligonucleotide primer set specific for amplifying C. difficile toxin B gene (tcdB). The third oligonucleotide primer set amplifies at least part of nucleotide region as set forth in SEQ ID NO: 10.
(19) Preferably, the third oligonucleotide primer set comprises an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO: 11 and an oligonucleotide comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO: 12.
(20) More preferably, the third oligonucleotide primer set comprises an oligonucleotide comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO: 11 and an oligonucleotide comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO: 12.
(21) The presence of the target sequence amplified with the third oligonucleotide primer set is detected by the use of a probe comprising or consisting of at least 10 contiguous nucleotides present in the nucleotide sequence as set forth in SEQ ID NO:13, preferably, by the use of a primer comprising or consisting of the nucleotide sequence as set forth in SEQ ID NO:13.
(22) The present invention is also directed to oligonucleotide primer sets, i.e. oligonucleotides, comprising primers as defined above for the first, second or third oligonucleotide primer set or a mix thereof. The primer sets may also comprise probes as defined above for use with each of the primer sets. The present invention is also directed to the use of these oligonucleotide primer sets for the detection of the presence of a hypervirulent Clostridium difficile strain in a biological sample, such as a stool sample or a food sample.
(23) The present invention also provides kits for detecting a hypervirulent Clostridium difficile strain in a biological sample, a kit may comprise the oligonucleotide primer set as defined above; and a reagent for performing amplification of a nucleic acid. Preferably, the reagent is selected from the group consisting of: DNA polymerase, dNTPs, and a buffer.
(24) Another embodiment of the invention is a method of detecting the presence of a hypervirulent Clostridium difficile strain in a biological sample using oligonucleotide primers and probes with modified nucleotides. Generally, the use of modified nucleotides renders possible shortening of an oligonucleotide primer or probe without compromising its specificity. The amount of modified nucleotides in one primer or probe is preferably 1, 2, 3, 4 or more. The modified nucleotide can be a LNA nucleotide (Exiqon A/S), minor groove binder (MGB™), SuperBase, or Peptide Nucleic Acid (PNA) or any other nucleotide modification having the same effect on the oligonucleotide. The method comprises essentially same steps as the method described above and in the claims but is performed with at least one modified primer or probe. One example of the primers and probes for such method is:
(25) Primer pair 1 (for the detection of hydR gene): SEQ ID NO: 3 and SEQ ID NO: 4 with probe having the sequence SEQ ID NO: 7.
(26) Primer pair 2 (for the detection of putative conjugative transposon, pct): SEQ ID NO: 5 and SEQ ID NO: 6 with a probe having the sequence CTG TAG ATT TCG GTA CGA (SEQ ID NO: 14), wherein underlined nucleotides are modified nucleotides such as LNA.
(27) Primer pair 3 (for the detection of tcdB gene): SEQ ID NO: 11 and SEQ ID NO: 12 with a probe having the sequence SEQ ID NO: 13.
(28) Accordingly, a person skilled in the art would understand that the length of any of the above primers or probes may be shortened in a similar way by using at least one modified nucleotide.
(29) The publications and other materials used herein to illuminate the background of the invention, and in particular, to provide additional details with respect to its practice, are incorporated herein by reference. The present invention is further described in the following example, which is not intended to limit the scope of the invention.
EXPERIMENTAL SECTION
Example 1
(30) In this example, the assay of the disclosed invention was used to detect both toxin-producing and non-toxin-producing C. difficile strains. A total of 48 characterized samples representing 37 different ribotypes were tested. This test excluded 027 or genetically very closely related ribotypes.
(31) The assay contains one multiplex PCR reaction which amplifies the target panel (Table 1). Identification of toxin producing C. difficile and differentiation of hypervirulent C. difficile is based on combined detection of these markers. Toxin marker: tcdB gene encodes Toxin B, 027-negative marker: hydR encodes TetR family transcriptional regulator protein and 027-positive marker: pct encodes putative conjugative transposon DNA recombination protein. Primers and probes were as defined in Table 9.
(32) The C. difficile assay should give positive results from different toxin-producing C. difficile strains, and negative results for non-toxin-producing C. difficile strains. Inclusivity (analytical reactivity) is tested to account for potential genetic variation among the targets included in the panel. This example describes the results of the inclusivity of the C. difficile qPCR assay using well characterized strains.
(33) TABLE-US-00001 TABLE 1 C. difficile assay target panel Target gene Marker region Description Toxin B tcdB Detects cytotoxin (Toxin B) producing C. difficile Positive hypervirulent pct Positive hypervirulent marker is marker detected only from hypervirulent strains (ribotype 027) Negative hypervirulent hydR Negative marker is not detected marker from ribotype 027 strains, but is positive for other C. difficile strains
Materials and Methods
1.1 The List of the Bacterial Targets
(34) The C. difficile assay covers pathogens causing gastrointestinal infections. A total of 48 characterized samples representing 37 different ribotypes were tested in this inclusivity study covering non-toxinogenic C. difficile and Toxin B producing C. difficile. The list of strains is described in Table 2. This test excluded 027 or genetically very closely related ribotypes.
(35) Strains were collected from commercial available biobanks (ATCC, DSMZ, and Microbiologics). DNA samples were tested in concentrations less than 100 ng/μl.
(36) TABLE-US-00002 TABLE 2 Amplidiag C. difficile GE assays inclusivity test panel # Original code 1 ATCC 51695 2 ATCC 43599 3 ATCC 17857 4 ATCC BAA-1871 5 0329P (ATCC 9689) 6 ATCC BAA-1813 7 ATCC BAA-1874 8 ATCC BAA-1809 9 ATCC BAA-1810 10 ATCC BAA-1801 11 ATCC BAA-1382 12 ATCC 43596 13 ATCC 43600 14 AHS 56050 15 ATCC 43598 16 106222 17 ATCC BAA-1808 18 106216 19 ATCC BAA-1812 20 ATCC 43601 21 AKC 43602 22 0527P (ATCC 700057) 23 106210 24 ATCC BAA-1873 25 ATCC BAA-1804 26 ATCC BAA-1811 27 AHS 55375 28 0833P (ATCC 43593) 29 RHC 7722 30 AHS 26782 31 AHS 55985 32 ATCC BAA-1875 33 106090 34 ATCC 43603 35 ATCC 43255 36 AHS 56035 37 ATCC BAA-2156 38 RHC 7727 39 AHS 55868 40 106194 41 RHC 7758 42 ATCC BAA-1807 43 ATCC BAA-1872 44 ATCC BAA-1806 45 ATCC BAA-2155 46 ATCC BAA-1814 47 106073 48 AHS 56010
1.2 Reagents and Instruments
(37) gPCR Reagents:
(38) qPCR Mastermix, Mobidiag
(39) Assay mixture consisting of C. difficile qPCR primers and probes
(40) Devices:
(41) Stratagene MxPro 3000
(42) PCR Setup
(43) In reaction:
(44) TABLE-US-00003 10 μl 2 x Mastermix 5 μl 4 x Primer mix 5 μl sample/pos. control DNA mix/DNA extraction control/H2O 20 μl TOTAL
(45) PCR program:
(46) TABLE-US-00004 95° C. 10 min 95° C. 15 s 45x 60° C. 60 s
Results
(47) TABLE-US-00005 TABLE 3 Identification of markers toxB, pct and hydR in C. difficile strains. Identification of markers # Original code Ribotype Characterization toxB pct hydR Result 1 ATCC 51695 001 A+B+, Binary toxin cdtB− + − + ToxB+ 2 ATCC 43599 001 A+B+, Binary toxin cdtB− + − + ToxB+ 3 ATCC 17857 001 A+B+, Binary toxin cdtB− + − + ToxB+ 4 ATCC BAA-1871 001 A+B+, Binary toxin cdtB− + − + ToxB+ 5 0329P (ATCC 9689) 001 A+B+, Binary toxin cdtB− + − + ToxB+ 6 ATCC BAA-1813 002 A+B+, Binary toxin cdtB− + − + ToxB+ 7 ATCC BAA-1874 002 A+B+, Binary toxin cdtB− + − + ToxB+ 8 ATCC BAA-1809 009 A−B−, Binary toxin cdtB− − − + Negative 9 ATCC BAA-1810 009 A−B−, Binary toxin cdtB− − − + Negative 10 ATCC BAA-1801 010 A−B−, Binary toxin cdtB− − − + Negative 11 ATCC BAA-1382 012 A+B+, Binary toxin cdtB− + − + ToxB+ 12 ATCC 43596 012 A+B+, Binary toxin cdtB− + − + ToxB+ 13 ATCC 43600 014 A+B+, Binary toxin cdtB− + − + ToxB+ 14 AHS 56050 015 A+B+, Binary toxin−, tcdC 18 bp del + + + ToxB+ 15 ATCC 43598 017 A−B+, Binary toxin cdtB− + − + ToxB+ 16 106222 019 A+B+, Binary toxin+, tcdC 18 bp del + − + ToxB+ 17 ATCC BAA-1808 020 A+B+, Binary toxin cdtB− + − + ToxB+ 18 106216 023 A+B+, Binary toxin+ + − + ToxB+ 19 ATCC BAA-1812 024 A+B+, Binary toxin cdtB− + − + ToxB+ 20 ATCC 43601 031 A−B−, Binary toxin cdtB− − − + Negative 21 ATCC 43602 031 A−B−, Binary toxin cdtB− − − + Negative 22 0527P (ATCC 700057) 038 A−B−, Binary toxin cdtB− − − + Negative 23 106210 045 A+B+, Binary toxin+ + − + ToxB+ 24 ATCC BAA-1873 053 A+B+, Binary toxin cdtB− + − + ToxB+ 25 ATCC BAA-1804 053 A+B+, Binary toxin cdtB− + − + ToxB+ 26 ATCC BAA-1811 057 A+B+, Binary toxin cdtB− + − + ToxB+ 27 AHS 55375 058 A+B+, Binary toxin+ + − + ToxB+ 28 0833P (ATCC 43593) 060 A−B−, Binary toxin cdtB− − − + Negative 29 RHC7722 063 A+B+, Binary toxin+, tcdC 18 bp del + − + ToxB+ 30 AHS 26782 unk. 67 A+B+, Binary toxin+, tcdC 18 bp del + − + ToxB+ 31 AHS 55985 075 A+B+, Binary toxin+, tcdC 18 bp del + − − ToxB+ 32 ATCC BAA-1875 078 A+B+, Binary toxin cdtB+ + − + ToxB+ 33 106090 080 A+B+, Binary toxin+, tcdC 18 bp del + − − ToxB+ 34 ATCC 43603 085 A−B−, Binary toxin cdtB− − − + Negative 35 ATCC 43255 087 A+B+, Binary toxin cdtB− + − + ToxB+ 36 AHS 56035 111 A+B+, Binary toxin+ + − + ToxB+ 37 ATCC BAA-2156 118 A+B+, Binary toxin cdtB− + − + ToxB+ 38 RHC 7727 122 A+B+, Binary toxin+, tcdC 18 bp del + − + ToxB+ 39 AHS 55868 unk. 122 A+B+, Binary toxin+ + − + ToxB+ 40 106194 126 A+B+, Binary toxin+ + − + ToxB+ 41 RHC 7758 131 A+B+, Binary toxin+, tcdC 18 bp del + − + ToxB+ 42 ATCC BAA-1807 140 A−B−, Binary toxin cdtB− − + + Negative 43 ATCC BAA-1872 207 A+B+, Binary toxin cdtB− + − + ToxB+ 44 ATCC BAA-1806 220 A+B+, Binary toxin cdtB− + − + ToxB+ 45 ATCC BAA-2155 251 A+B+, Binary toxin cdtB+ + − + ToxB+ 46 ATCC BAA-1814 251 A+B+, Binary toxin cdtB+ + − + ToxB+ 47 106073 254 A+B+, Binary toxin+ + − + ToxB+ 48 AHS 56010 308 A+B+, Binary toxin−, tcdC 18 bp del + − + ToxB+
Functionality of Controls Positive controls were detected as positive Negative control was detected as negative Internal Amplification Control was detected in all samples
Conclusions
(48) All 39 toxin-producing strains were identified correctly as ToxB+. All 9 non-toxin-producing strains were correctly identified as negative. No strain gave false positive identification of the 027 ribotype (toxB+, pct+, hydR+).
(49) Controls were detected as expected, which confirmed the reliability of the results.
Example 2
(50) In this example, the functionality of the disclosed invention to differentiate 027 ribotype detection was tested. Two very closely related ribotypes, namely 016 and 176, were included in the samples.
Materials and Methods
(51) DATA Extraction
(52) The DNA from C. difficile isolates were extracted as described below:
(53) A colony from bacterial cultures was suspended to the 1×PBS buffer in the final concentration ca. 1.5×10.sup.8 CFU/ml (ref. McFarlan standard 0.5). 100 μl of bacterial suspension was transferred to the off-board lysis step following the automated extraction with NucliSENS EasyMAG (bioMérieux) device according to the manufacturer's protocol for Generic 2.0.1 program. DNAs were eluted to the 100 μl of elution buffer. Extraction series contained Extraction Control i.e. C. difficile (non-toxin producing strain).
(54) Real-time PCR and Analysis
(55) The PCR reactions were conducted as defined in Example 1. Internal amplification control, Positive PCR control and Negative PCR control is included to the test series.
(56) A total of 18 different 027 ribotype strains, one 016 ribotype strain and one 176 ribotype strain were tested.
(57) TABLE-US-00006 TABLE 4 Identification of markers toxB, pct and hydR in C. difficile 027 strains. # Original code Ribotype Characterization toxB pct hydR Result 1 ATCC BAA-1805 027 A+B+, Binary toxin cdtB+ + + − 027+ 2 ATCC BAA-1803 027 A+B+, Binary toxin cdtB+ + + − 027+ 3 01048P (ATCC BAA- 027 A+B+, Binary toxin cdtB+ + + − 027+ 1870) 4 CD14-038 027 n/a + + − 027+ 5 CD13-177 027 n/a + + − 027+ 6 CD13-032 027 n/a + + − 027+ 7 CD13-221 027 n/a + + − 027+ 8 CD14-078 027 n/a + + − 027+ 9 CD14-072 027 n/a + + − 027+ 10 CD14-161 027 n/a + + − 027+ 11 CD13-097 027 n/a + + − 027+ 12 CD12-100 027 n/a + + − 027+ 13 CD13-305 027 n/a + + − 027+ 14 CD13-056 027 n/a + + − 027+ 15 CD13-004 027 n/a + + − 027+ 16 CD13-247 027 n/a + + − 027+ 17 CD13-245 027 n/a + + − 027+ 18 CD13-108 027 n/a + + − 027+ 19 AHS 55742 016 A+B+, Binary toxin+, tcdC 18bp + + − 027+ del 20 AHS 26967 176 A+B+, Binary toxin+, tcdC 18bp + + − 027+ del
(58) The assay gave a correct positive identification identification of all the 18 different 027 strains, and gave a positive identification of 016 and 176 ribotypes. Thus, the assay detects genetically closely related 016 and 176 ribotypes in addition to 027 ribotype as 027+.
Example 3
(59) In this example, the disclosed invention was compared to a prior art method for detecting a 027 presumptive positive C. difficile. The assay of the invention was compared to Xpert C. difficile/Epi (Cepheid) test.
(60) The Xpert C. difficile/Epi test uses the detection of a deletion in tcdC gene to report a positive 027 presumptive finding.
(61) A total of 11 different strains, representing 11 different ribotypes, were tested with both methods and the results were compared.
(62) TABLE-US-00007 TABLE 5 Comparison to Xpert C. difficile/Epi (Cepheid) test. Identification of disclosed Original Ribo- GeneXpert markers # code type Characterization toxB Binary TcdC Result toxB pct hydR Result 1 AHS 55742 016 A+B+, Binary toxin+, tcdC 18 bp del + + + toxigenic C. diff positive, 027 + + − 027+ presumptive positive 2 106222 019 A+B+, Binary toxin+, tcdC 18 bp del + + + toxigenic C. diff positive, 027 + − + ToxB+ presumptive positive 3 AHS 26782 unk. 67 A+B+, Binary toxin+, tcdC 18 bp del + + + toxigenic C. diff positive, 027 + − + ToxB+ presumptive positive 4 106090 080 A+B+, Binary toxin+, tcdC 18 bp del + + + toxigenic C. diff positive, 027 + − − ToxB+ presumptive positive 5 AHS 26967 176 A+B+, Binary toxin+, tcdC 18 bp del + + + toxigenic C. diff positive, 027 + + − 027+ presumptive positive 6 106210 045 A+B+, Binary toxin+ + + − toxigenic C. diff positive, 027 + − + ToxB+ presumptive negative 7 RHC 7722 063 A+B+, Binary toxin+, tcdC 18 bp del + + − toxigenic C. diff positive, 027 + − + ToxB+ presumptive negative 8 AHS 55985 075 A+B+, Binary toxin+, tcdC 18 bp del + + − toxigenic C. diff positive, 027 + − − ToxB+ presumptive negative 9 AHS 56035 111 A+B+, Binary toxin+ + + − toxigenic C. diff positive, 027 + − + ToxB+ presumptive negative 10 RHC 7727 122 A+B+, Binary toxin+, tcdC 18 bp del + + − toxigenic C. diff positive, 027 + − + ToxB+ presumptive negative 11 RHC 7758 131 A+B+, Binary toxin+, tcdC 18 bp del + + − toxigenic C. diff positive, 027 + − + ToxB+ presumptive negative
(63) The Xpert C. difficile/Epi test reported 5 strains to be toxigenic C. difficile positive, 027 presumptive positive, while none of the tested strains were actually ribotype 027. Of these 5 strains, the method of the present invention identified only 2 strains as 027 positive, so demonstrating an improved effect in differentiating between a 027 and non-027 ribotype compared to prior art. It is notable that these two C. difficile strains (016 and 176) have been shown to be highly related to hypervirulent C. difficile strains (Knetsch et al., 2011).
(64) The identification of the disclosed markers reported 9 strains correctly as ToxB+, but not 027+, as expected. In summary, the assay of the invention identified 9/11 strains correctly as 027−, while the Xpert C. difficile/Epi test reported 6/11 strains correctly with regard to the presumptive negativity of 027.
Example 4
(65) The workflow of the present invention consists of extraction of nucleic acids from stool samples (NucliSens easyMAG), real-time PCR amplification and detection of target gene regions and analysis of results.
(66) In this example, different toxin-producing C. difficile strains were tested as spiked samples in stool background. A total of 35 different strains were used. Each strain was spiked into a stool sample negative for C. difficile. DNA was extracted from stool samples, and gPCR reactions were prepared so that the strain was present in concentrations of either 7.5 CFU/reaction or 75 CFU/reactions as illustrated in Table 6. All samples were tested in duplicate reactions.
(67) The results demonstrate that that the strains were correctly identified as positive in all cases.
(68) TABLE-US-00008 TABLE 6 Detection of different toxin-producing C. difficile strains in spiked stool samples. Cq values of detection of markers Original Code CFU/rxn toxB 027+ 027− IC Result ATCC BAA-1870 7.5 37.14 36.13 n/a 28.32 027+ ATCC 9689 7.5 34.44 n/a 36.47 27.94 ToxB+ ATCC BAA-1382 7.5 36.37 n/a 37.44 27.77 ToxB+ ATCC 17858 7.5 35.32 n/a n/a 28.55 ToxB+ ATCC 43600 7.5 37.74 n/a 37.21 28.68 ToxB+ ATCC 43596 7.5 37 n/a n/a 28.29 ToxB+ ATCC 43594 7.5 37.89 n/a n/a 28.31 ToxB+ ATCC 43598 7.5 36.23 n/a n/a 28.7 ToxB+ ATCC BAA-1803 7.5 37.14 34.99 n/a 28.46 027+ ATCC BAA-1808 7.5 35.7 n/a 34.32 28.37 ToxB+ ATCC BAA-1811 7.5 35.66 n/a 35.92 28.5 ToxB+ ATCC BAA-1812 7.5 37.13 n/a 37.67 28.43 ToxB+ ATCC BAA-1813 7.5 38.07 n/a 37.5 28.43 ToxB+ ATCC BAA-1815 7.5 37.6 n/a 36.11 28.28 ToxB+ ATCC BAA-1872 7.5 35.38 n/a 36.6 28.36 ToxB+ ATCC BAA-1875 7.5 36.84 n/a 37.56 28.36 ToxB+ ATCC BAA-2155 7.5 35.85 n/a 35.74 28.59 ToxB+ ATCC BAA-2156 7.5 35.73 n/a 35.67 28.3 ToxB+ ATCC BAA-1804 7.5 37.37 n/a 35.5 28.46 ToxB+ ATCC BAA-1806 75 35.7 n/a 35.33 28.97 ToxB+ CD14-038 75 36.09 35.08 n/a 29.12 027+ CD13-177 75 34.53 34.21 n/a 29.05 027+ CD13-032 75 34.72 34.6 n/a 29.13 027+ CD13-221 75 36.09 37.14 n/a 29.42 027+ CD14-078 75 32.07 33.3 n/a 29.12 027+ CD14-072 75 32.9 27.53 43.92 27.52 027+ CD14-161 75 33.53 35.89 n/a 29.24 027+ CD13-097 75 32.72 33.83 n/a 29.14 027+ CD12-100 75 38.56 36.27 n/a 29.34 027+ CD13-305 75 35.97 39.19 n/a 29.43 027+ CD13-056 75 35.46 35.02 n/a 29.14 027+ CD13-004 75 33.22 34.07 n/a 28.93 027+ CD13-247 75 33.75 34.59 n/a 29.08 027+ CD13-245 75 33.08 34.24 n/a 29.02 027+ CD13-108 75 34.55 36.18 n/a 29.04 027+ IC = internal control, controls PCR inhibition CFU/rxn = colony forming units/reaction Two replicates per sample
Example 5
(69) This example describes results from a study of potential false positive results in the C. difficile PCR assay due to a cross-reaction. Sample material for this designed assay is stool sample. Therefore, pathogens (bacteria, viruses and parasites) associated with gastrointestinal infections, and which are not covered by assay panel, can cause potential cross-reaction. Also bacteria included to commensal flora may cross-react. Furthermore, pathogens including to the assay target panel are added to the cross-reaction study since only the target pathogen should be detected and no cross-reaction among other targets should happen.
Materials and Methods
(70) Reagents, devices and samples
(71) qPCR Reagents:
(72) Mobidiag's qPCR Mastermix (MM)
(73) Assay mixture consisting of C. difficile qPCR primers and probes (see Table 9)
(74) Devices:
(75) Stratagene Mxp3000
(76) PCR Setup
(77) In reaction:
(78) TABLE-US-00009 10 μl 2 x MM 5 μl 4 x Primer mix 5 μl sample/pos. Control DNA mix/H2O 20 μl Pos. Control = template mix
(79) TABLE-US-00010 95° C. 10 min 95° C. 15 s 40x 60° C. 1 min
Samples:
(80) DNA (or RNA) extracted from 127 pathogens. Strains have been mainly collected from commercial available biobanks (ATCC, DSMZ, Microbiologics Qnostics and Vircell). Some strains are added from Mobidiag biobank and those strains have been originally purified from patient samples and characterized by HUSLAB (Helsinki University central hospital laboratory).
(81) The amount of DNA was determined by 16S rRNA assay or by NanoDrop.
(82) TABLE-US-00011 TABLE 7 Cross-reaction results. # Species Result # Species, cont. Result 1 Acinetobacter baumannii Negative 65 Haemophilus parainfluenzae Negative 2 Actinomyces actinomycetemcomitans Negative 66 Helicobacter mustelae Negative 3 Actinomyces israelii Negative 67 Helicobacter pylori Negative 4 Actinomyces naeslundii Negative 68 Helicobacter pylori Negative 5 Aspergillus fumigatus Negative 69 Human adenovirus 40 Negative 6 Astrovirus Negative 70 Human adenovirus 41 Negative 7 Bacillus cereus Negative 71 Human herpesvirus 2 Negative 8 Bacillus subtilis Negative 72 Kingella kingae Negative 9 Bacteroides fragilis Negative 73 Klebsiella oxytoca Negative 10 Bacteroides thetaiotaomicron Negative 74 Klebsiella pneumoniae subsp. pneumoniae Negative 11 Bacteroides vulgatus Negative 75 Kluyvera intermedia Negative 12 Campylobacter coli Negative 76 Lactobacillus acidophilus Negative 13 Campylobacter fetus Negative 77 Lactobacillus casei Negative 14 Campylobacter jejuni subsp. jejuni Negative 78 Lactococcus sp. Negative 15 Campylobacter lari Negative 79 Listeria monocytogenes Negative 16 Candida albicans Negative 80 Micrococcus luteus Negative 17 Candida glabrata Negative 81 Moraxella catarrhalis Negative 18 Candida krusei Negative 82 Morganella morganii subsp. morganii Negative 19 Chromobacterium violaceum Negative 83 Neisseria lactamica Negative 20 Citrobacter amalonaticus Negative 84 Neisseria sicca Negative 21 Citrobacter braakii Negative 85 Norovirus genogroup 1 Negative 22 Citrobacter freundii Negative 86 Norovirus genogroup 2 Negative 23 Citrobacter koserii Negative 87 Pasteurella multocida Negative 24 Clostridium histolyticum Negative 88 Peptostreptococcus micros Negative 25 Clostridium perfringens Negative 89 Plesiomonas shigelloides Negative 26 Clostridium septicum Negative 90 Porphyromonas gingivalis Negative 27 Clostridium sordellii Negative 91 Prevotella intermedia Negative 28 Clostridium sporogenes Negative 92 Prevotella loescheii Negative 29 Clostridium tetani Negative 93 Propionibacterium acnes Negative 30 Corynebacterium amycolatum Negative 94 Proteus mirabilis Negative 31 Corynebacterium diphtheriae Negative 95 Proteus vulgaris Negative 32 Cronobacter sakazakii Negative 96 Providencia rettqeri Negative 33 Cryptosporidiumn parvum Negative 97 Providencia stuartii Negative 34 Cytomegalovirus Negative 98 Pseudomonas aeruginosa Negative 35 Desulfovibrio sp. Negative 99 Raoutella ornithinolytica Negative 36 Dientamoeba fragilis Negative 100 Rhodococcus equi Negative 37 Edwardsiella tarda Negative 101 Rotavirus A Negative 38 Eggerthella lenta Negative 102 Saccharomyces kudriaczevii Negative 39 Elizabethkingia meningoseptica Negative 103 Salmonella bongori Negative 40 Entamoeba histolytica Negative 104 Salmonella enterica subsp. enterica, Typhimurium Negative 41 Enterobacter aerogenes Negative 105 Sapovirus Negative 42 Enterobacter cloacae Negative 106 Serratia liquefaciens Negative 43 Enterobacter hormaechei subsp. hormaechei Negative 107 Serratia marcescens subsp. marcescens Negative 44 Enterococcus casseliflavus Negative 108 Shigella boydii Negative 45 Enterococcus faecalis Negative 109 Staphylococcus aureus Negative 46 Enterococcus faecium Negative 110 Staphylococcus epidermidis Negative 47 Enterococcus gallinarum Negative 111 Staphylococcus lugdunensis Negative 48 Escherichia coli, non toxigenic Negative 112 Stenotrophomonas maltophilia Negative 49 Escherichia coli, EAEC Negative 113 Streptococcus agalactiae Negative 50 Escherichia coli, EHEC Negative 114 Streptococcus anginosus Negative 51 Escherichia coli, EIEC Negative 115 Streptococcus bovis Negative 52 Escherichia coli, EPEC Negative 116 Streptococcus dysgalactiae subsp. equisimilis Negative 53 Escherichia coli, ETEC Negative 117 Streptococcus oralis Negative 54 Escherichia fergusonii Negative 118 Streptococcus pneumoniae Negative 55 Escherichia hermanii Negative 119 Streptococcus pyogenes Negative 56 Escherichia vulneris Negative 120 Streptococcus salivarius Negative 57 Fusarium solani Negative 121 Streptococcus viridans Negative 58 Fusobacterium necrophorum subsp. necrophorum Negative 122 Streptococcus viridans Negative 59 Fusobacterium nucleatum subsp. nucleatum Negative 123 Streptomyces spp. Negative 60 Gardnerella vaginalis Negative 124 Vibrio parhaemolyticus Negative 61 Giardia lamblia Negative 125 Vibrio vulnificus Negative 62 Gordonia ssp. Negative 126 Yersinia enterocolitica subsp. enterocolitica Negative 63 Haemophilus ducreyi Negative 127 Yersinia pseudotuberculosis Negative 64 Haemophilus influenzae Negative
Functionality of Controls Positive controls were detected as positive Negative controls were detected as negative
Results
(83) The cross-reactivity test showed no false positives.
(84) TABLE-US-00012 TABLE 9 Oligonucleotide primers and probes. Internal mod- 5′ mod- 3′ mod- Oligo Sequence ifica- ifica- ifica- Name 5′ .fwdarw. 3′ tion tion tion F_tcdb_ GGAAGTGAA SEQ ID 01 TGTATATGA NO: 11 AAACC R_tcdb_ GCCATTTTT SEQ ID 01 TCTAACTGT NO: 12 TTTC P_tcdb_ AGAAAGGAG ZEN 6-FAM Iowa SEQ ID 01_dq GATATATAA Black ® NO: 13 AAGAGTTTT FQ AGC F_hyd_ CGAACTTCC SEQ ID 01 TCTATTAAA NO: 3 GC R_hyd_ GTGCAATGT SEQ ID 01 ATCATCACT NO: 4 TTA P_hyd_ AATCATTCG ROX Iowa SEQ ID 01 CACTATGAA Black ® NO: 7 CAACCAATT RQ F_pct_ ACGGAAACA SEQ ID 01 TCAAATAAC NO: 5 G R_pct_ GTACCTTTA SEQ ID 01 CCAATGTTA NO: 6 TTATATG P_pct_ TCTGTAGAT ZEN HEX Iowa SEQ ID 03_dq TTCGGTACG Black ® NO: 8 AAAACTTCA FQ S_pct_ TCTGTAGAT Iowa SEQ ID 03 TTTGGTACG Black ® NO: 9 AAAACTTCA FQ
(85) TABLE-US-00013 TABLE 10 Amplicons amplified by the oligonucleotide sets. Size Name Sequence 5′ .fwdarw. 3′ bp C.dif_ ACGGAAACATCAAATAACGAATTGA 119 SEQ ID pct_hypV CAATTTCTGTAGATTTCGGTACGAA NO: 2 AACTTCATGGGAAAGCAGCTTGGTA ACCCAATTAAATGAAATACCATATA ATAACATTGGTAAAGGTAC C.dif_ CGAACTTCCTCTATTAAAGCGAATG 232 SEQ ID hydR_01 GGATTTTTTCTAACCAGCTACAATG NO: 1 TACCATTTTTCTACGTGTGTAATCA TTCGCACTATGAACAACCAATTCTA TTATTTTTTCATTTGCTGTAAGGGT GTCATCAGCAACAAGATACTCTAAA AAATTATTCATTGTGAGTAAAGTTC TTTTGTGACACTTCTCAGTATATCT TCTTTAGTTTTAAAGTGATGATACA TTGCAC C.dif_ GGAAGTGAATGTATATGAAAACCTA 171 SEQ ID tcdB_ AGTAGATATTAGTATATTTTATAAA NO: 10 short TAGAAAGGAGGATATATAAAAGAGT TTTAGCATTTAGATGTAAAAATATT CAATAAAAATATTATAGTAAAGGAG AAAATTTTATGAGTTTAGTTAATAG AAAACAGTTAGAAAAAATGGC
REFERENCES
(86) Denéve, C., Janoira, C., Poilaneb, I., Fantinatob, C., and Collignon, A., New trends in Clostridium difficile virulence and pathogenesis, International Journal of Antimicrobial Agents, 2009 33:24-28.
(87) Eastwood, K., Else P., Charlett, A., and Wilcox, M H., Comparison of Nine Commercially Available Clostridium difficile Toxin Detection Assays, a Real-Time PCR Assay for C. difficile tcdB, and a Glutamate Dehydrogenase Detection Assay to Cytotoxin Testing and Cytotoxigenic Culture Methods, J. Clin. Microbiol., October 2009, p. 3211-3217.
(88) Hirvonen, J J., Mentula, S., Kaukoranta, S-S., Evaluation of a New Automated Homogeneous PCR Assay, GenomEra C. difficile, for Rapid Detection of Toxigenic Clostridium difficile in Fecal Specimens, J. Clin. Microbiol. 2013, 51 (9):2908. DOI: 10.1128/JCM.01083-13.
(89) Houser, B A., Hattel, A L., and Jayarao, B M., Real-Time Multiplex Polymerase Chain Reaction Assay for Rapid Detection of Clostridium difficile Toxin-Encoding Strains, Foodborne Pathogens And Disease, 2010, 7 (6):719-726.
(90) Knetsch, C W., Hensgens, M P M., Harmanus, C., van der Bijl, M W., Savelkoul, P H M., Kuijper, E J., Carver J., and van Leeuwen, H C., Genetic markers for Clostridium difficile lineages linked to hypervirulence, Microbiology (2011), 157, 3113-3123.
(91) Rupnik, M., Wilcox, M H. and Gerding, D N, Clostridium difficile infection:
(92) new developments in epidemiology and pathogenesis, Nature Reviews Microbiology 7, 526-536 (July 2009) p526, doi:10.1038/nrmicro2164.