METHOD OF DIFFERENTIATING HAIR FOLLICLE CELL INTO GERMLINE STEM CELL AND USE THEREOF
20200157496 ยท 2020-05-21
Inventors
Cpc classification
C12N5/0611
CHEMISTRY; METALLURGY
C12N2501/115
CHEMISTRY; METALLURGY
C12N2500/90
CHEMISTRY; METALLURGY
C12N5/0037
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to a method for differentiating hair follicle cells into germline stem cells, germline stem cells differentiated by the method, and use of the same germline stem cells. A method of differentiating hair follicle cells into germline stem cells according to the present invention can differentiate hair follicle cells into germline stem cells using culture conditions only, without genetic modification. Capable of inducing differentiation of cells of specific individual types, such as hair follicle cells, into cells of different types such as germline cells, the present invention is therefore expected to be usefully used for the understanding of reproductive biology and the clinical application thereof.
Claims
1. A method for differentiating hair follicle cells into germline stem cells, the method comprising: a step of culturing hair follicle cells on feeder cells using a spermatogonial stem cell differentiation medium containing a growth factor.
2. The method of claim 1, wherein the growth factor is a glial cell line-derived neurotrophic factor(GDNF), GDNF family receptor al(GFR1), and a basic fibroblast growth factor(bFGF).
3. The method of claim 1, wherein the spermatogonial stem cell differentiation medium is a mouse serum-free medium(mSFM).
4. The method of claim 1, wherein the feeder cells are STO cells.
5. The method of claim 1, wherein the hair follicle cells are cultured for 3 to 5 weeks.
6. Germline stem cells differentiated by the method of claim 1.
Description
DESCRIPTION OF DRAWINGS
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
MODES OF THE INVENTION
[0040] The present invention relates to a method for differentiating hair follicle cells into germline stem cells, germline stem cells differentiated by the method, and use of the same germline stem cells.
[0041] As a result of intensive studies on a method capable of differentiating hair follicle cells into germline stem cells, the present inventors established a differentiation method capable of differentiating hair follicle cells into germline stem cells without genetic modification and obtained germline stem cells by culturing hair follicle cells by the method, thereby completing the present invention based on this.
[0042] Thus, the present invention provides a method for differentiating hair follicle cells into germline stem cells, the method including: a step of culturing hair follicle cells on feeder cells using a spermatogonial stem cell differentiation medium containing a growth factor.
[0043] In the present invention, the growth factor may be a glial cell line-derived neurotrophic factor (GDNF), GDNF family receptor 1(GFR1), and a basic fibroblast growth factor (bFGF), but is not limited thereto.
[0044] The spermatogonial stem cell differentiation medium may be a mouse serum-free medium (mSFM), and may include a culture medium additive which may be typically used in the art.
[0045] As used herein, the feeder cells are known to secrete trophic factors which contribute to maintaining the undifferentiated state of embryonic stem cells and known to be associated with an undifferentiated maintenance mechanism mediated by cell contact. Signaling substances secreted from feeder cells contribute to regulating the undifferentiation maintenance or initiation of differentiation of embryonic stem cells. Examples of the substances secreted from feeder cells include a wingless-type MMTV integration site family (Wnt), bone morphogenetic proteins (BMPs), a transforming growth factor-beta (TGF-), an extracellular matrix, and the like. There have been reports of differentiation into embryonic stem cells or induced pluripotent stem cells using various mouse or human-derived feeder cells. In the present invention, as the feeder cell, STO cells may be used, but the feeder cell is not limited thereto.
[0046] In the present invention, hair follicle cells may be cultured under the culture conditions for 3 to 5 weeks, and thus may be induced to be differentiated into germline stem cells.
[0047] As used herein, the term germline stem cells is a type of adult stem cells, and includes spermatogonial stem cells (SSCs) or oocyte precursor stem cells, and particularly, spermatogonial stem cells refer to cells having the unipotency capable of producing sperm through self-proliferation and differentiation. Germline stem cells are very few in number, are present at rest in a safe place between feeder cells in the testicles, and are characterized in that proliferation and differentiation are regulated by interaction with external signals including feeder cells.
[0048] In the Examples of the present invention, it was confirmed that hair follicle cells are cultured by the differentiation method and are differentiated into germline stem cell-like cells expressing germline stem cell-like morphologies, sizes, and spermatogonia specific genes.
[0049] In some Examples of the present invention, in order to establish differentiation conditions capable of specifically differentiating hair follicle cells into germline stem cells, a culture medium, a growth factor, and a type of feeder cells capable of effectively improving the differentiation ability were determined, and an optimal differentiation method was established through the determination (see Examples 2 to 4).
[0050] In the other Examples of the present invention, through the fact that after hair follicle cells were cultured by the differentiation method according to the present invention, the expression level of various spermatogonia specific genes was increased and the expression of genes specific for other lineage cells, that is, hair follicle cells was not increased, it was confirmed that hair follicle cells were differentiated into germline stem cells. Further, through the observation by a microscope, it was confirmed that the differentiated cells exhibited a morphology similar to spermatogonial stem cells (see Examples 5 to 8).
[0051] From the foregoing, the differentiation method according to the present invention is expected to be capable of being very usefully used for differentiating hair follicle cells into germline stem cells.
[0052] Thus, the present invention provides germline stem cells differentiated by the differentiation method.
[0053] Hereinafter, preferred Examples for helping the understanding of the present invention will be suggested. However, the following Examples are provided only to more easily understand the present invention, and the contents of the present invention are not limited by the following Examples.
EXAMPLES
Example 1. Experimental Preparation and Experimental Method
[0054] 1-1. Experimental animal
[0055] B6CBA-Tg(Pou5f1-EGFP) 2Mnn (OG2) used in the experiment were purchased from Harlan Laboratories (Indianapolis, Ind., USA). WBB6F1-W/W.sup.v mice were purchased from Jackson Laboratory (Bar Harbor, Me., USA), and were used as recipients in the SSC quantification experiment. B6D2F1 (C57BL/6JDBA/2J F1 hybrid; Koatech) mice were used as oocyte donors in a sperm direct injection method (intracytoplasmic sperm injection, ICSI). The mice were provided with a standard diet ad libitum, and bred under conditions of 212 C., 5510% humidity, and a day/night cycle condition of 12 hours (lights on at 7 am and off at 7 pm). The animal experiments of the present invention were approved by the Laboratory Animal Care and Use Committee of Chung-Ang University, and were performed according to the Laboratory Animal Care and Use Manual issued by the National Institutes of Health.
[0056] 1-2. Isolation and collection of hair follicle cells
[0057] Hair follicle (HF) cells were collected from OG2 mice expressing an enhanced green fluorescent protein (EGFP) under the control of the POU domain, the class 5, the transcription factor 1, a promoter, and a distal enhancer. The isolation and culture of hair follicle cells were performed with minor modifications to a previously disclosed protocol (Nath, M., Offers, M., Hummel, M. & Seissler, J. Isolation and in vitro expansion of Lgr6-positive multipotent hair follicle stem cells. Cell and tissue research 344, 435-444, doi:10.1007/s00441-011-1165-y (2011).).
[0058] More specifically, after the dorsal skin was epilated by plucking, a piece of the dorsal skin (12 cm) was collected, treated with 2.5 mg/ml of dispase diluted with Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12, 1:1 mixture; Thermo Fisher Scientific, Waltham, Mass., USA), and cultured at 4 C. overnight. The next day, the whole hair follicles were plucked and isolated from the skin by a pair of elaborate tweezers, treated with a solution obtained by mixing 0.25% trypsin-EDTA (Thermo Fisher Scientific) and 7 mg/ml of DNase I (Roche, Basel, Switzerland) at 4:1 together with Dulbecco's Phosphate Buffered Saline (DPBS), cultured at 37 C. for 5 minutes, and then treated with 10% fetal bovine serum (FBS) to suppress the activity of trypsin. Thereafter, the cell suspension was filtered through a 40-m diameter perforated nylon mesh (BD Biosciences, San Jose, Calif., USA), and cell viability was measured using a trypan blue reagent.
[0059] 1-3. Culture and differentiation of hair follicle cells
[0060] The hair follicle cells isolated from the mouse dorsal skin were aliquoted at a density of 1.010.sup.6 per well in a 6-well plate, and cultured under the conditions of 37 C. and 5% CO.sub.2 using a DMEM/F12 (3:1) medium supplemented with 10% FBS, 20 l/ml of a B27 supplement, 20 ng/ml of a basic fibroblast growth factor (bFGF), 10 ng/ml of a glial cell line-derived neurotrophic factor (GDNF), 75 ng/ml of GDNF family receptor al (GFR1), and 1% penicillin/streptomycin.
[0061] In order to differentiate hair follicle cells into germline cells, the hair follicle cells were aliquoted at a density of 2.010.sup.5 per well in a 24-well plate containing mitotically inactivated SIM mouse embryo-derived thioguanine- and auabain-resistant feeder cells. Each cell was maintained in a mouse serum-free medium (mSFM) supplemented with 10 ng/ml of a glial cell line-derived neurotrophic factor (GDNF), 75 ng/ml of GDNF family receptor a1 (GFR1), and 1 ng/ml of a basic fibroblast growth factor (bFGF).
[0062] 1-4. Histological analysis and immunostaining
[0063] For a histological analysis, the testicles and the skin were fixed with a Bouin's solution (Sigma-Aldrich, St. Louis, Mo., USA). The fixed tissues were cut into a thickness of 4 m. After the cut tissues were deparaffinized, hematoxylin-eosin (H&E) staining was performed. The stained sections were fixed, and then observed with a Nikon TE2000 microscope using NIS Elements imaging software (Nikon, Tokyo, Japan).
[0064] For immunostaining, the cells were fixed with 4% paraformaldehyde and treated with 0.1% Triton X-100 diluted with DPBS at room temperature for 10 minutes in order to increase cell membrane permeability, and then a blocking process of suppressing non-specific bonding was performed by treating a 5% (w/v) bovine serum albumin (BSA, Sigma-Aldrich) solution at room temperature for 30 minutes. Next, the slide was reacted at 4 C. overnight by diluting primary antibodies, that is, rat anti-CD34 (BD Biosciences, 553731), mouse anti-promyelocytic leukemia zinc finger (PLZF; zinc finger and BTB domain containing 16 [Zbtb16], EMD Millipore, OP128), rabbit anti-GFR1 (Abcam, ab8026), mouse anti-CD9 (EMD Millipore, CBL162), goat anti-Ret (R&D Systems, AF482), rabbit anti-NCAM (EMD Millipore, AB5032), goat anti-Oct-4 (R&D Systems, AF1759), rabbit anti-DDX4 (Abcam, ab13840), rabbit anti-DAZL (Abgent, AF1303a), rabbit anti-SOX9 (Enogene, E18-6330), rabbit anti-CK15 (Abcam, ab52816), rabbit anti-CK19 (Abcam, ab15463), mouse anti-CD59 (Abcam, ab9183), mouse anti-C43 (EMD Millipore, MAB3067), rabbit anti-Nanog (Abcam, ab21603), mouse anti-CK14 (Abcam, ab7800), goat anti-c-kit (Santa Cruz Biotechnology), and mouse anti-Cd2 with a 5% BSA solution at 1:200. Thereafter, the slide was reacted with secondary antibodies, that is, Alexa Fluor 568-conjugated goat anti-mouse IgG, Alexa Fluor 568-conjugated goat anti-rat IgG, Alexa Fluor 568-conjugated donkey anti-goat IgG, Alexa Fluor 594-conjugated goat anti-mouse IgG (Thermo Fisher Scientific) or Tetramethylrhodamine (TRITC)-conjugated goat anti-rabbit IgG (Jackson ImmunoResearch) (1:200) at room temperature for 1 hour. After cells were washed with DPBS, counterstaining was performed using a Vectashield medium diluted with 4,6-diamidino-2-phenylindole (DAPI, Vector Laboratories, Burlingame, Calif.), and the extent of protein expression was evaluated by observing stained cells by a Nikon TE2000 fluorescence microscope (Nikon, Chiyoda-ku, Tokyo, Japan). The relative percentage of protein expression was measured by counting at least 5 images containing 10 or more cells and quantifying the total number of DAPI-stained nuclei per image.
[0065] 1-5. Microarray analysis of genes
[0066] RNA was isolated according to the manufacturer's instructions using TRIzol and the PureLink RNA mini kit (Thermo Fisher Scientific). Total RNA was purified and amplified using the Ambion Illumina RNA amplification kit (Ambion, Austin, USA) in order to produce biotinylated cRNA. In brief, 550 ng of the total RNA was reverse-transcribed into cDNA using a T7 oligo(dT) primer. Second strand cDNA was synthesized by T7 RNA polymerase, transcribed, and labeled with biotin-NTP. After purification, the cRNA was quantified using the ND-1000 spectrophotometer ((NanoDrop, Wilmington, USA). Labeled cRNA samples (750 ng) were respectively hybridized to a mouse WG6 expression v.4 bead array (Illumina, Inc., San Diego, USA) at 58 C. for 16 to 18 hours. Array signals were measured using Amersham fluorolink streptavidin-Cy3(GE Healthcare Life Sciences) by a method designated in the bead array manual. The array was scanned with an Illumina bead array reader according to the manufacturer's instructions.
[0067] The quality of hybridization and overall chip performance were monitored by visual inspection of both internal quality control checks and raw scanned data. Raw data was extracted using software provided by the manufacturer (Illumina GenomeStudio v2011.1 (Gene Expression Module v1.9.0)). Array probes were transformed to log scale and subjected to quantile normalization.
[0068] The statistical significance of expression data was measured using a LPE test, and the result thereof was shown as a mean fold change over control. The false discovery rate (FDR) was minimized by adjusting P values using a Benjamini-Hochberg algorithm. The DEG set was subjected to hierarchical cluster analysis using complete linkage and Euclidean distance as a measure of similarity. Gene-enrichment and functional annotation analysis were performed using DAVID (http://david.abcc.ncifcrfgov/home.jsp). Data analysis and visualization of all differentially expressed genes were performed using the R 3.0.2 program (www.r-project.org).
[0069] 1-6. Methylation analysis
[0070] The bisulfate treatment of DNA was performed using the EpiTect Bisulfite Kit (Qiagen, Spoorstraat, KJ Venlo, The Netherlands) according to the manufacturer's instructions. The bisulfate-converted DNA was amplified using a nested PCR approach. The primer sequences are shown in the following Table 1.
TABLE-US-00001 TABLE1 Gene.sup.a Forwardprimer5-3 Reverseprimer(5-3) H19 outer TAAGGAGATTATGTTTATTTTTGGA CCCCCTAATAACATTTATAACCCC inner AAGGAGATTATGTTTATTTTTGGA AAACTTAAATAACCCACAACATTACC Igf2 outer GGTTAGGTGAAGGTTTTGTGGGTAGTTATA ATATTCCCCTTTCAAATTCCAATCTACATC inner GGTGGTTTTTTAATGGATATTTTAAGGTGA CCAACCTCTATCCCTAACTTTTCTAACCTC Peg1 outer AATTTGGGGTTTAGGATTAGAGATTT ACAACAAAAACAACAAACAACAACT inner AGAGATTTATAAGGAAAGAGGGGGTAG ACAACAAAAACAACAAACAACAACT Peg3 outer TTTTGTAGAGGATTTTGATAAGGAG CATACTACAAAACAACCAAATAACC inner TGTAGAGGATTTTGATAAGGAGGTG CAATCTAATACACCCACACTAAACC .sup.aH19 (H19, imprinted maternally expressed transcript), Igf2 (insulin-like growth factor 2), Peg1 (paternally expressed gene 1), Peg3 (paternally expressed gene 3)
[0071] The external primer pair was used for 1-round PCR, and the internal primer pair was used for 2-round PCR. The cycle parameters are as follows. 45 cycles of 95 C. for 10 seconds, 60 C. for 30 seconds, and 72 C. for 60 seconds; denaturation at 94 C.; and final elongation at 72 C. for 10 minutes. The amplification products were confirmed on 1% agarose gel by electrophoresis. Desired PCR products were subcloned into pGEM-T Easy vectors (Promega, Madison, Wis.), and sequenced using a T7 primer. Visualization and quantification of bisulfate-sequencing data were analyzed using the BiQ Analyzer software (Max Planck Society, Germany).
[0072] 1-7. Karyotype analysis
[0073] A colcemid (Thermo Fisher Scientific) solution was added to a cell culture solution, and cells were cultured at 37 C. under 5% CO2 for 1 hour. The cells were lysed in 0.25% trypsin and harvested in 15-ml tubes. The collected cells were treated with a hypotonic solution (75 mM KCl) at 37 C. for 25 minutes, and fixed with Carnoy's fixative (methanol:acetic acid=3:1) for 20 minutes. Metaphase chromosome spreads were prepared according to the standard procedure, and slides were Giemsa-stained for GTC banding. The results were analyzed using the ChIPS-Karyo Chromosome Image Processing System (GenDix, Inc. Seoul, Korea).
[0074] 1-8. Transplantation
[0075] HF-derived germline stem cells (HFGSCs) and SSCs were collected, and each concentrated at a density of 5010.sup.6 cells/ml to 2.510.sup.6 cells/ml. The mice to be subjected to transplantation were anesthetized with ketamine (75 mg/kg b.w.) and medetomidine (0.5 mg/kg, b.w.) through intraperitoneal injection. 80% of the seminiferous tubules were filled by microinjecting about 2 to 3 L of a donor cell suspension into the seminiferous tubules of WBB6F1-W/Wv mice (6 to 12 weeks old) through an efferent duct.
[0076] 1-9. Gamete collection
[0077] Sperm was obtained from the seminiferous tubules of W/Wv mice 3 months after transplantation of HF-derived germline stem cells (HFGSCs). In order to produce metaphase II stage oocytes, the excessive ovulation of B6D2F1 (C57BL/6 femaleDBA2 male F1 hybrid; Koatech) female mice was induced by intraperitoneally injecting 7.5 IU pregnant mare serum gonadotropin (PMSG; Sigma-Aldrich) and human chorionic gonadotropin (hCG) continuously at an interval of 48 hours, and cumulus-oocyte complexes were surgically isolated from the uterine tubes 13 to 14 hours after hCG injection.
[0078] Cumulus cells at the M2 stage were gently removed by 300 U/ml hyaluronidase, and oocytes were cultured in a potassium-modified simplex-optimized medium containing 0.4% BSA under 37 C. and 5% CO.sub.2 conditions until the oocytes were used.
[0079] 1-10. Intracytoplasmic sperm injection and embryo transfer
[0080] Intracytoplasmic sperm injection (ICSI) was performed in the metaphase II stage oocytes at room temperature using sperm, as previously known.
[0081] More specifically, adhesion was reduced by mixing a sperm solution with an M2 medium (Sigma-Aldrich) containing 10% (w/v) polyvinyl alcohol. Sperm heads were separated from their tails by mechanically applying various Piezo (Prime Tech) pulses, and loaded into an injection pipette (internal diameter, 7 mm). Subsequently, the zona pellucida was perforated using high Piezo pulses, and sperm heads were injected into the metaphase II cytoplasm using low Piezo pulses. Thereafter, after the resultant was cultured in the M2 medium for 15 minutes and recovered, ICSI-injected oocytes were cultured in KSOM-BSA under 37 C. and 5% CO.sub.2 conditions.
[0082] It was determined that the ICSI-injected fertilized oocyte was normally changed into a second polar body and two pronuclei 6 hours after the injection. The 2-cell stage embryos were transferred into the hydrosalpinx of 0.5 day post coitum pseudopregnant ICR females, or the rates of blastocyst formation and apoptosis were analyzed by culturing the 2-cell stage embryos in KSOM-BSA for an additional 3 days.
[0083] 1-11. TUNEL assay
[0084] In order to detect apoptotic blastomeres in blastocysts, a terminal deoxynucleotidyl transferase-mediated dUTP-digoxigenin nick end-labeling (TUNEL, Roche, 12-156-792-910) analysis was performed using an in-situ cell apoptosis detection kit (Roche). The blastocysts were harvested on day 4, washed three times with DPBS-PVA, and fixed in 4% paraformaldehyde at 4 C. overnight. The fixed blastocysts were permeabilized with DPBS containing 0.5% (v/v) Triton X-100 at room temperature for 60 minutes. Non-specific binding sites were blocked by culture with PBS containing 10 mg/ml BSA at constant temperature for 1 hour. Thereafter, the blastocysts were washed three times with PBS-PVA, stained with TUNEL at 37 C. for 1 hour, and then washed three times with DPBS-PVA again, and placed on a glass slide along with DAPI. The number of total cells and the number of apoptotic cells per blastocyst were determined by counting the nuclei with blue (DAPI) and red (TUNEL) signals under a fluorescence microscope (Olympus).
[0085] 1-12. Quantitative real-time polymerase chain reaction (RT-PCR)
[0086] Total RNA was prepared from each sample with the PureLink RNA Mini Kit (Thermo Fisher Scientific) and reverse-transcribed using a superscript III reverse transcriptase (Thermo Fisher Scientific) according to the manufacturer's instructions. A quantitative real-time polymerase chain reaction (qRT-PCR) was performed using the SYBR green PCR Master Mix (Applied Biosystems) in a 7500 real-time PCR system (Applied Biosystems). All gene expression levels were measured by qRT-PCR and normalized to GAPDH levels, and real-time PCR primer sequences are as shown in the following Table 2.
TABLE-US-00002 TABLE2 Forwardprimer Reverseprimer Gene.sup.a (5-3) (5-3) Bcl6b CATTTTCGGCACAAGAGTCA TTAGATGGTGGGGACTCAGC Dnd1 CCCTAAATGGGTTAAGCAGA GGCAAGGTTCCTCACAACTAA GC AG Egr3 TTTGCCTGTGAGTTCTGTGG CCCCTTTCTCCGACTTCTTC Fos TACACTCCAAGCGGAGACAG TCCTTCTCCTTCAGCAGGTT Id4 GCTCGTGCCTACCATCCCGC GGTGGCGGCTGTCTCAGCAAA Nanos3 CAAGCCAAGTTCAGAAAGCC AGGACATGGGACTGATAGATG AGCA GCA Ret TCCCTTCCACATGGATTGA ATCGGCTCTCGTGAGTGGTA Sall4 AGCACTGCTGCACACGGTG GTCATGTAGTGTACCTTCAGG TG Thy1 TGGACTGCCGCCATGAGAAT TGGTGGTGAAGTTGGCTAGGG AACA TAA Dazl TCCTTGACTTGTGGTTGCTG CCACCTTCGAGGTTTTACCA Gapdh CTGACGTGCCGCCTGGAGAA CCCCGGCATCGAAGGTGGAA AC GAGT .sup.aBcl6b (previously known as Bazf, B-cell CLL/lymphoma 6, member B (zinc finger protein)), Dnd1 (DND microRNA-mediated repression inhibitor 1), Egr3 (early growth response 3), Fos (FBJ osteosarcoma oncogene), Id4 (Inhibitor of DNA binding 4), Nanos3 (nanos homolog 3), Ret (ret proto-oncogene), Sall4 (sal-like protein 4), Thy1 (thymus cell antigen 1), Dazl (deleted in azoospermia-like), Gapdh (glyceraldehyde 3-phosphate dehydrogenase)
[0087] 1-13. Genotyping
[0088] Genomic DNA identified from the tails of the offspring was PCR-amplified using primers (see Table 3). The PCR products were electrophoresed on agarose gel, and then stained with SYBR green (Thermo Fisher Scientific).
TABLE-US-00003 TABLE3 Forwardprimer Reverseprimer Gene.sup.a (5-3) (5-3) Gfp GCAAGCTGACCCTGAAGTTCA TCACCTTGATGCCGTTCTTCT Actb CGCCATGGATGACGATATCG CGAAGCCGGCTTTGCACATG .sup.aGfp (green fluorescent protein), Actb (beta-actin)
[0089] 1-14. Fluorescence-activated cell sorting analysis
[0090] Cultured hair follicle cells were stained with a rat anti-mouse CD34 antibody (BD Biosciences) on ice for 20 minutes. The cells were washed twice with PBS-S, and cultured along with an Alexa Fluor 568-conjugated anti-rat IgG (Thermo Fisher Scientific) secondary antibody on ice. The stained cells were washed twice with PBS-S, and re-suspended in PBS-S to which 1 g/ml of propidium iodide (PI) was added. FACS analysis and cell alignment were performed using a BD FACSAria II flow cytometer (BD Biosciences, Research Facility Center, Chung-Ang University), and at least 10,000 pieces of data were obtained. Data analysis was performed using BD FACS Diva software.
[0091] 1-15. Statistical analysis
[0092] All statistical analyses were performed using GraphPad Prism (Version 5). The difference in colony formation and in vitro fertilization among the treatment groups were evaluated using a two-tailed Student's t-test, and P<0.05 was considered to be statistically significant. In this case, when the sizes of the groups were not the same, calibration (Welch's correction) was performed. Quantification of protein expression by cell population and treatment conditions was evaluated using a one-way variance analysis (ANOVA) and Tukey's post-hoc, and P<0.05 was considered to be statistically significant.
Example 2. Production of Hair Follicle-Derived Germline Stem Cells (HFGSCs)
[0093] Oct4 known as POU5F1 is a homeodomain transcription factor of the POU family. Oct4 is a protein of 352 amino acids belonging to the POU protein V class, and is encoded by the POU5F1 gene in humans. Oct4 is a pluripotency-associated gene, plays an important regulatory role in an early mammalian embryo, and is expressed in the inner cell clumps of unfertilized ova and primordial germ cells. In particular, Oct4 is a core transcription factor regulating pluripotency as well as self-renewal in embryonic stem cells. Nanog/Oct4 binding to low-methylated DNA serves to maintain the state of a pluripotent and undifferentiated cell. Further, cells are differentiated into the somatic lineage along other pathways without Oct4, whereas Oct4-expressing cells have the potential to develop into germ cells.
[0094] Thus, in order to evaluate effects of general germline stem cell (GSC) culture conditions on the transdifferentiation of hair follicle cells into germline cells, hair follicle cells were cultured under a GSC culture condition consisting of a mouse serum-free medium (mSFM) supplemented with GDNF, GFR1, bFGF and inactivated STO feeder cells as described in Example 1-3, and after 3 to 5 weeks of culture, octamer-binding transcription factor 4 (Oct4)-GFP-expressing cells were observed by a fluorescence microscope.
[0095] As a result, as illustrated in
[0096] In addition, in order to confirm that the proliferation (growth rate) of cultured cells is different from that of hair follicle cells, the growth rate of the germline stem cell-like cells was measured for 1 week.
[0097] As a result, as illustrated in
[0098] As a result of combining the aforementioned contents, it could be seen that when hair follicle cells were maintained under the GSC culture conditions, the morphology and growth rate of hair follicle cells were altered so as to reflect the characteristics of GSCs, meaning that hair follicle-derived germline stem cells (HFGSCs) were produced.
Example 3. Phenotype Characteristics of Hair Follicle-Derived Germline Stem Cells (HFGSCs)
[0099] In order to analyze the characteristics of hair follicle-derived germline stem cells (HFGSCs) transdifferentiated from hair follicle cells, the expression of specific proteins in the cells was confirmed in order to compare the phenotypes of hair follicle cells, HFGSCs and GSCs.
[0100] As a result, as illustrated in
[0101] Next, the expression of CD34, which is present in a small number of hair follicle cells, and thus is presumed to be a stem cell marker, and PLZF, which is a transcriptional repressor expressed by undifferentiated spermatogonia, was confirmed.
[0102] As a result, as illustrated in
[0103] Further, after CD34-positive cells were isolated from cultured cells using fluorescence-activated cell sorting (FACS), the induction of HFGSCs was caused from each of CD34-positive and negative cells by spreading CD34-positive or negative cells again onto cell culture plates and changing the conditions into conditions corresponding to the GSC culture.
[0104] As a result, as illustrated in
[0105] Through these results, it could be seen that as the culture conditions were varied without genetic modification, germline stem cells could be produced from hair follicle cells.
Example 4. Confirmation of Effects of Growth Factor on Proliferation of Hair Follicle-Derived Germline Stem Cells (HFGSCs)
[0106] A glial cell-derived neurotrophic factor (GDNF) is originally one type of the transforming growth factor beta (TGF-) superfamily for stimulating the survival of midbrain dopaminergic neurons, but it has been revealed that GDNF regulates self-renewal of in vitro GSCs in the testicles and acts as an important growth factor for undifferentiated spermatogonia in vivo. In addition, it has been proved that GDNF activates an Src family kinase such as Src, Yes, Lyn, and Fyn by a RET-independent pathway, and the kinase plays an important role in self-renewal of GSCs. Furthermore, GDNF activates a phosphoinositide 3-kinase (PI3K)/Akt signal pathway which is a pathway associated with the GNDF-induced GSC self-renewal of in the GSC, and the PI3K/Akt signal pathway is specific for the GSC self-renewal and corresponds to an essential pathway for stimulating GSC survival, and the GDNF signal induces the activation of a Ras/ERK1/2 pathway in the GSC.
[0107] Thus, in order to confirm the effects of the growth factor on the proliferation of HFGSCs in vitro, parameters such as the formation, shape, and size of the colony were analyzed after HFGSCs were cultured with only GDNF and only bFGF or without any growth factor for 1 week by selectively treating the growth factor (the control (GDNF and bFGF) during the culture of HGGSCs.
[0108] As a result, as illustrated in
[0109] As a result of combining the aforementioned contents, it was shown that HFGSCs chemically depended on GDNF for normal growth under a serum-free condition (GSC condition), meaning that HFGSCs have phenotype characteristics similar to those of GSCs.
Example 5. Confirmation of Gene Expression Information on Hair Follicle-Derived Germline Stem Cells (HFGSCs)
[0110] In order to identify genetic information on hair follicle cells, HFGSCs, and GSCs, all cells were separately harvested and analyzed using an Illumina gene expression array, according to the method in Example 1-5, and accordingly, 45,281 genes were isolated, and 17,175 genes were confirmed.
[0111] As a result of a hierarchical cluster analysis, as illustrated in
TABLE-US-00004 TABLE 4 Gene expression Number Total processed genes 45,281 Total expressed genes by samples 17,175 Total genes regulated between HF and HFGSC 2-fold or greater 1,702 Total up-regulated between HF and HFGSC 2-fold or greater 1,037 Total down-regulated between HF and HFGSC 2-fold or greater 665 Total genes regulated between HF and GSC 2-fold or greater 2,784 Total up-regulated between HF and GSC 2-fold or greater 1,460 Total down-regulated between HF and GSC 2-fold or greater 1,324 Total genes regulated between HFGSC and GSC 2-fold or 30 greater Total up-regulated between HFGSC and GSC 2-fold or greater 9 Total down-regulated between HFGSC and GSC 2-fold or 21 greater HF: Hair follicle cells; HFGSC: Hair follide-derived germline stem cells; GSC: Germline stem cells
[0112] In addition, as a result of showing the analyzed genetic information using a Venn diagram in order to compare the inherent genetic information on hair follicle cells, HFGSCs, and GSCs, as illustrated in
Example 6. Genomic Imprinting and Karyotype Analysis of Hair Follicle-Derived Germline Stem Cells (HFGSCs)
[0113] In order to confirm the genomic imprinting pattern after the transdifferentiation of hair follicle cells, the methylation analysis in Example 1-6 was performed. The patterns of H19 and an insulin-like growth factor (Igf2), which are paternal genes of HFGSCs, and PEG1, Peg3, and Igf2r, which are maternal genes, were measured, and the patterns were compared with the methylation patterns of hair follicle cells and GSCs.
[0114] As a result, as illustrated in
[0115] Further, in order to confirm the change in chromosomes of HFGSCs during the metaphase stage, as a result of performing a karyotype analysis according to the method in Example 1-7, as illustrated in
[0116] As a result of combining the aforementioned contents, it was confirmed that the cultured HFGSCs were chromosomally stable, had a noticeable difference in imprinting pattern from hair follicle cells, and exhibited a change in genome imprinting similar to that of GSCs.
Example 7. Confirmation of Spermatogenesis of Hair Follicle-Derived Germline Stem Cells (HFGSC)
[0117] In order to evaluate the spermatogenic ability of donor-derived stem cells in the recipient testicles, cultured HFGSCs were transplanted through the seminiferous tubules of WBB6F1-W/W.sup.vmutant mice incapable of intrinsic spermatogenesis due to the lack of Kit signals, meaning that all the spermatogenesis of recipient WBB6F1-W/W.sup.v mutant mice entirely depends on donor stem cells after the transplantation. 2 to 3 months after the transplantation, the presence of Oct4-GFP-expressing donor-derived colonies was observed through a fluorescence microscope by sacrificing the recipient mice and isolating the testicles thereof.
[0118] As a result, as illustrated in
Example 8. Confirmation of Fertility of Hair Follicle-Derived Germline Stem Cells (HFGSCs)
[0119] In order to confirm the fertility of recipient mice, spermatids of the HFGSC-derived colonies were collected and used in the intracelltoplasmic sperm injection (ICSI).
[0120] As a result, as illustrated in
[0121] In addition, as shown in
TABLE-US-00005 TABLE 5 No. of No. of oocytes Origin of oocyte forming No. of embryos developed to the following stages (%) spermatozoa inseminated pronucleus 2-cell 4-cell Morula Blastocyst WT 247 202 199 188 177 170 (98.5 2.6) (93.1 4.3) (87.6 6.3) (84.2 6.2) HFGSC 241 187 182 176 168 157 (97.3 2.8) (94.1 5.3) (89.8 8.2) (84.0 11.6)
[0122] Performed three times in total.
[0123] WT: Wild type, HFGSC: Hair follicle-derived germline stem cells.
[0124] In addition, as illustrated in
[0125] Finally, offspring production efficiency was evaluated by implanting 82 HFGSC-derived zygotes into 4 female mice, and as a result, as illustrated in
TABLE-US-00006 TABLE 6 No. of No. of oocytes No. of No. of No. of Origin of oocyte forming 2-Cell embryos No. of live pups spermatozoa inseminated pronucleus embryos transferred recipients (male/female) HFGSC 104 84 82 82 4 21 (1417)
[0126] Performed twice in total.
[0127] HFGSC: Hair follicle-derived germline stem cells.
[0128] As a result of combining the aforementioned contents, it was confirmed that CD34.sup.+ hair follicle cells cultured under the in vitro conditions of the present invention could acquire GSC-like characteristics while requiring no modification of exogenous genes. Furthermore, the ability of HFGSCs to be differentiated into functional sperm and produce viable offspring was confirmed, which is expected to be able to restore spermatogenesis and restore male fertility by providing a powerful approach to reproductive technology.
[0129] The above-described description of the present invention is provided for illustrative purposes, and those skilled in the art to which the present invention pertains will understand that the present invention can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. Therefore, it should be understood that the above-described Examples are illustrative only in all aspects and are not restrictive.
INDUSTRIAL APPLICABILITY
[0130] The present invention relates to a method for differentiating hair follicle cells into germline stem cells, germline stem cells differentiated by the method, and use of the same germline stem cells, and since it is possible to induce differentiation of cells of specific individual types, such as hair follicle cells, into cells of different types such as germline cells without genetic modification according to the present invention, the present invention is expected to be usefully used for the understanding of reproductive biology and the clinical application thereof.