PROGRAMMABLE TRANSCRIPTION FACTORS AND METHODS

20200157552 ยท 2020-05-21

    Inventors

    Cpc classification

    International classification

    Abstract

    This disclosure describes a programmable transcription factor system. Generally, the system includes a programmable transcription factor, a polynucleotide that includes a coding region whose expression is either required or toxic for cell viability, and a promoter operably linked to the polynucleotide and having a binding site for the programmable transcription factor. The programmable transcription factor generally includes a domain that specifically binds to a promoter and a domain that either activates transcription (if the polynucleotide encodes an essential product) or represses transcription (if the polynucleotide encodes a toxic product).

    Claims

    1. A programmable transcription activator system, the system comprising: a programmable transcription activator comprising: a domain that specifically binds to a promoter; and a transcriptional activator domain; a polynucleotide comprising a coding region whose expression is required for cell viability; and a promoter operably linked to the polynucleotide, the promoter comprising a binding site for the programmable transcription activator.

    2. The system of claim 1, wherein the transcription activator domain comprises VP64, VP16, VPR, p65, Rta, EDLL, Gal4, TAD, TV, or SunTag.

    3. The system of claim 1, wherein the domain that specifically binds to the promoter comprises dCas9, Cas9 combined with a gRNA, nuclease-inactive CPF1, or a transcription activator-like effector (TALE).

    4. The system of claim 1, wherein the promoter is further operably linked to a non-essential coding region.

    5. The system of claim 5, wherein the non-essential coding region encodes a polypeptide involved in cell growth, cell reproduction, producing a secondary metabolite, or modulating an immune response.

    6. A programmable transcription repressor system, the system comprising: a programmable transcription repressor comprising: a domain that specifically binds to a promoter; and a transcriptional repressor domain; a polynucleotide comprising a coding region whose expression is toxic to cell viability; a promoter operably linked to the polynucleotide, the promoter comprising a binding site for the programmable transcription repressor.

    7. The system of claim 6, wherein the transcriptional repressor domain comprises a KRAB domain.

    8. The system of claim 6, wherein the domain that specifically binds to the promoter comprises dCas9, Cas9 combined with a gRNA, nuclease-inactive CPF1, or a transcription activator-like effector (TALE).

    9. The system of claim 6, wherein the toxic coding region encodes a polypeptide that interferes with cell growth, interferes with central metabolism, interferes with cell reproduction, or interferes with an immune response.

    10. The system of claim 6, wherein the promoter is further operably linked to a non-essential coding region.

    11. A cell comprising the programmable transcription activator system of claim 1.

    12. A cell comprising the programmable transcription repressor system of claim 6.

    Description

    BRIEF DESCRIPTION OF THE FIGURES

    [0010] FIG. 1. Overview of positive selection modules. (A) Macromolecular components that constitute programmable transcription activators (top), and schematic illustration showing programmable transcription activator dependent expression of an essential coding region (middle) as well as other desired genes (bottom) using the same target sequence (B) Macromolecular components that constitute programmable transcription repressors (top), and schematic illustration showing repression of a toxic coding region (middle) as well as other desired genes (bottom) using the same target sequence.

    [0011] FIG. 2. Programmable-transcription-activator-dependent survival of host cell. (A) Schematics of tester plasmid (top) and control plasmid (bottom) The tester plasmid contains a minimal promoter, a dCas9-VP64 targeted sequence, and a KanMX (an aminoglycoside phosphotransferase conferring G418 sulfate resistance) coding region. The control plasmid lacks the dCas9-VP64 targeted sequence. (B) Detail of the KanMX promoter region under the control of a minimal promoter with (top, SEQ ID NO:5) or without (bottom, SEQ ID NO:6) an adjacent dCas9-VP64 targeted sequence. The sequences of SEQ ID NO:5 and SEQ ID NO:6 are shown in the reverse-complement orientation relative to SEQ ID NO:1 and SEQ ID NO:2, respectively. (C) Colony forming results from two independent experiments with yeast expressing dCas9-VP64 and a random or on-target sgRNA transformed with KanMX cassettes with or without a cognate target adjacent to the minimal promoter. (* indicates p<0.05, one-way ANOVA followed by Tukey's post-test, n=2 independent transformations, mean+/SEM)

    DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS

    [0012] Programmable transcriptional factors are proteins and/or nucleoproteins that can be used to alter expression of a transcriptional unit. A programmable transcriptional activator such as, for example, dCas9 fused to a transcriptional activator domain (e.g., VP64) or a programmable transcriptional repressor such as, for example, dCas9 fused to a repressor domain (e.g., KRAB) can be used to engineer synthetic transcriptional programs in a wide variety of organisms. These programs may increase production of a high value compound, introduce a block to unwanted gene-flow, protect an organism from biotic and/or abiotic stressors, or have other applications.

    [0013] A programmable transcription factor can be effective if it is functional and present in the cell at a sufficient concentration to affect the desired transcriptional program. Various mutations in a coding region that encodes a component of the programmable transcription factor may interfere witheven eliminatethe function of the programmable transcription factor. Unwanted silencing that reduces or eliminates transcription of the coding region also may interfere with the desired function of the programmable transcription factor. This can be particularly problematic when the programmable transcription factor is expected to function for multiple generations and organisms with defective programmable transcription factors have a growth advantage and may come to dominate the population.

    [0014] This disclosure describes methods and constructs that place programmable transcription factor machinery under positive selection. Organisms that express non-functional or low levels of the programmable transcription factor exhibit poor growth and/or die. This method can be applied to both programmable transcription activators (FIG. 1A) and programmable transcription repressors (FIG. 1B).

    [0015] In the case of activators, the system includes at least a programmable transcription activator, a coding region whose expression is essential to the survival of the organism, and a promoter controlling the expression of the essential coding region. The promoter binds the programmable transcription activator for expression of the essential coding region that allows the organism to either survive, reproduce, and/or have a normal growth rate. A mutation or silencing in any component of this system has a severely deleterious effect on the organism.

    [0016] The target sequence of the programmable transcription activator is present in the promoter of the essential coding region and also may be present in the promoter of one or more other coding regions whose transcriptional activation is desirable for some transcriptional program, but may not necessarily be an essential coding region. The essential coding region may encode a polypeptide that is involved in a central metabolic process, growth, reproduction, and/or whose expression is critical in a particular environment, such as a coding region that confers antibiotic or herbicide resistance. Examples of non-essential coding regions includes, for example, those involved in producing secondary metabolites, growth regulators, and/or immune system modulators.

    [0017] In the case of repressors, the system includes at least a programmable transcription repressor, a coding region whose expression is toxic to the organism, and a sequence within the promoter or coding region of the toxic coding region that requires programmable transcription repressor binding for transcriptional repression to mitigate the effects of the translation product of the toxic coding region. In some cases, it may be possible to target a programmable transcription activator in a way that results in transcriptional repression of the toxic coding region. A mutation or silencing of the programmable transcription repressor or the toxic coding region's programmable transcription repressor binding site is severely deleterious for the organism.

    [0018] Typically, the target sequence of the programmable transcription repressor is present in the promoter or coding sequence of other coding region(s) whose transcriptional repression is desirable although not necessarily essential for the organism. Examples may include coding regions involved in producing secondary metabolites, growth regulators, and immune system modulators. The toxic coding region may interfere with central metabolism, growth, reproduction, or immune response.

    [0019] While described herein in the context of an exemplary embodiment in which the programmable transcription activator is dCas9 fused to the activator domain VP64 and co-expressed with MCP-VP64, other programmable transcription activators may be used in the system. Exemplary alternative programmable transcription activators include, for example, fusions of dCas9, dxCas9, Cas9 (if combined with a short guide RNA), nuclease-inactive CPF1, and/or a TALE (e.g., a TALE to VP64, VP16, VPR, p65, Rta, EDLL, Gal4, TV, TAD, or SunTag). Various embodiments of the system can employ two or more programmable transcription activators. In the case of RNA-guided transcriptional regulators (e.g, dCas9-VP64), activation may be boosted by including aptamers in the RNA sequence that recruit aptamer binding protein such as, for example, transcription factor fusions, such as any combination of MS2/MCP, PCP, or COM fused to VP64, VP16, VPR, p65, Rta, EDLL, Gal4, TV or TAD.

    [0020] Similarly, while described herein in the context of an exemplary embodiment in which the programmable transcription repressor is dCas9 fused to a KRAB domain, other programmable transcription repressors may be used in the system. Exemplary alternative programmable transcription repressors include, for example, fusions of dCas9, dxCas9, Cas9 (if combined with a short guide RNA), nuclease-inactive CPF1, or a TALE fused to NK10, Ubx, REST, Egr-1, Mad, thyroid hormone receptor , or thyroid hormone receptor . Other embodiments may repress transcription by binding within the transcribed region of a coding region to interfere with RNA polymerase binding or transcript elongation and may or may not include a fused KRAB domain.

    [0021] Thus, this disclosure describes a positive selection module using programmable transcription activators in the model host cell, Saccharomyces cerevisiae Cen.PK (FIG. 2). A tester plasmid containing the KanMX coding region, which confers resistance to the antibiotic G418 Sulfate, was constructed under the control of a hybrid promoter containing a unique protospacer target sequence upstream of a minimal promoter that included a CYC1 TATA box region. The tester plasmid also contains an MCP-VP64 coding region. A control plasmid without the protospacer sequence also was constructed (FIG. 2A). A PCR product with 5 and 3 ends homologous to the lys2 locus and containing the KanMX and MCP-VP64 coding regions was used in lithium-acetate transformation of yeast strains expressing dCas9-VP64 guided by sgRNA containing MS2 aptamers to recruit MCP-VP64. The sgRNA contained a random targeting sequence or a targeting sequence specific for the protospacer target. Transformed yeast were plated onto YPD media containing 400 g/ml G418 sulfate. Colonies were only present when the yeast expressed a sgRNA targeting the programmable transcription activator to a target site present in the promoter of KanMX (FIG. 2C). This demonstrates that survival of the yeast in this media was dependent on the activity of the programmable transcription activator.

    [0022] While described above in the context of an exemplary embodiment in which the host cell is a yeast, Saccharomyces cerevisiae, the programmable transcription factors described herein can be introduced into any suitable cell, including the cells of a multicelled organism, where programmable control of transcription is desired. Thus, exemplary alternative hosts for the programmable transcription factors include, for example, plants (e.g., soy, corn, rice, sugar beet) whose herbicide resistance genes (e.g., for glyphosate, bialaphos, dicamba) can be made dependent on the presence of a programmable transcriptional activator; animals (e.g., mosquitoes, fruit flies, rodents, fish, molluscs) whose essential genes (e.g., cell cycle regulators, growth factors, cytoskeletal components) can be made dependent on the presence of a programmable transcriptional activator; or plants, animals, or microbes (e.g., yeast, bacteria, protists), where survival may be made dependent on the expression of a programmable transcriptional repressor preventing the expression of a toxic gene. In the latter case, a toxic gene can be either a foreign gene encoding a toxin or a native gene under the control of an engineered promoter that, when derepressed, drives deleterious overexpression.

    [0023] In the preceding description and following claims, the term and/or means one or all of the listed elements or a combination of any two or more of the listed elements; the terms comprises, comprising, and variations thereof are to be construed as open endedi.e., additional elements or steps are optional and may or may not be present; unless otherwise specified, a, an, the, and at least one are used interchangeably and mean one or more than one; and the recitations of numerical ranges by endpoints include all numbers subsumed within that range (e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.).

    [0024] In the preceding description, particular embodiments may be described in isolation for clarity. Unless otherwise expressly specified that the features of a particular embodiment are incompatible with the features of another embodiment, certain embodiments can include a combination of compatible features described herein in connection with one or more embodiments.

    [0025] For any method disclosed herein that includes discrete steps, the steps may be conducted in any feasible order. And, as appropriate, any combination of two or more steps may be conducted simultaneously.

    [0026] The present invention is illustrated by the following examples. It is to be understood that the particular examples, materials, amounts, and procedures are to be interpreted broadly in accordance with the scope and spirit of the invention as set forth herein.

    EXAMPLES

    [0027] The integration cassettes were PCR amplified with a thermocycler (C1000 Touch, Bio-Rad Laboratories, Inc., Hercules, Calif.) using Q5 polymerase (New England BioLabs, Inc., Ipswich, Mass.) from the tester or control plasmid using primers MM_TA_LYS_uF and MM_SGTA_LYS_uR2 with an anneal temperature of 58 C. and an extension time of 2:30.

    TABLE-US-00001 TABLE1 PCRPrimers MM_TA_LYS_ GGCATCGCACAGTTTTAGCGAGGAAAACTCTTCAA uF TAGTTTTGCCAGCGGCATAGCTTCAAAATGTTTCT AC(SEQIDNO:3) MM_SGTA_LYS_ AATTCATATTTAATTATTGTACATGGACATATCAT uR2 ACGTAATGCTCAACCgagcggatacatatttgaag (SEQIDNO:4)

    [0028] The band was gel purified (Zymo Research, Irvine, Calif.) and 300 ng to 500 ng was used for lithium acetate transformation of the yeast. Yeast cells were given a three-hour period of outgrowth at 28 C. before plating on YPD G418 (10 g/L yeast extract, 20 g/L peptone, 20 g/L dextrose, and 400 g/ml G418 sulfate) and incubating at 28 C. After three days, colonies were counted and normalized to the amount of DNA used in the transformation reactions.

    TABLE-US-00002 TABLE 2 Yeast strains used in this study Name Genotype.sup.a Description YMM130 MATa ACT1-1 leu2dCas9-VP64 Random Random sgRNA sgRNA strain. YMM131 MATa ACT1-1 leu2dCas9-VP64 On target on target sgRNA sgRNA strain. .sup.aAll strains are derived from the CEN.PK background: ura3-52 trp1-289 1eu2-3_112 his3 1 MAL2-8C SUC2

    [0029] The complete disclosure of all patents, patent applications, and publications, and electronically available material (including, for instance, nucleotide sequence submissions in, e.g., GenBank and RefSeq, and amino acid sequence submissions in, e.g., SwissProt, PIR, PRF, PDB, and translations from annotated coding regions in GenBank and RefSeq) cited herein are incorporated by reference in their entirety. In the event that any inconsistency exists between the disclosure of the present application and the disclosure(s) of any document incorporated herein by reference, the disclosure of the present application shall govern. The foregoing detailed description and examples have been given for clarity of understanding only. No unnecessary limitations are to be understood therefrom. The invention is not limited to the exact details shown and described, for variations obvious to one skilled in the art will be included within the invention defined by the claims.

    [0030] Unless otherwise indicated, all numbers expressing quantities of components, molecular weights, and so forth used in the specification and claims are to be understood as being modified in all instances by the term about. Accordingly, unless otherwise indicated to the contrary, the numerical parameters set forth in the specification and claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and not as an attempt to limit the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

    [0031] Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. All numerical values, however, inherently contain a range necessarily resulting from the standard deviation found in their respective testing measurements.

    [0032] All headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading, unless so specified.

    TABLE-US-00003 SequenceListingFreeText Sequenceoftesterplasmid(SEQIDNO:1): CATAGCTTCAAAATGTTTCTACTCCTTTTTTACTCTTCCAGATTTTCTCG GACTCCGCGCATCGCCGTACCACTTCAAAACACCCAAGCACAGCATACTA AATTTCCCCTCTTTCTTCCTCTAGGGTGTCGTTAATTACCCGTACTAAAG GTTTGGAAAAGAAAAAAGAGgCCGCCTCGTTTCTTTTTCTTCGTCGAAAA AGGCAATAAAAATTTTTATCACGTTTCTTTTTCTTGAAAATTTTTTTTTT GATTTTTTTCTCTTTCGATGACCTCCCATTGATATTTAAGTTAATAAACG GTCTTCAATTTCTCAAGTTTCAGTTTCATTTTTCTTGTTCTATTACAACT TTTTTTACTTCTTGCTCATTAGAAAGAAAGCATAGCAATCTAATCTAAGT TTTCTAGATGGCTTCAAACTTTACTCAGTTCGTGCTCGTGGACAATGGTG GGACAGGGGATGTGACAGTGGCTCCTTCTAATTTCGCTAATGGGGTGGCA GAGTGGATCAGCTCCAACTCACGGAGCCAGGCCTACAAGGTGACATGCAG CGTCAGGCAGTCTAGTGCCCAGAAgAGAAAGTATACCATCAAGGTGGAGG TCCCCAAAGTGGCTACCCAGACAGTGGGCGGAGTCGAACTGCCTGTCGCC GCTTGGAGGTCCTACCTGAACATGGAGCTCACTATCCCAATTTTCGCTAC CAATTCTGACTGTGAACTCATCGTGAAGGCAATGCAGGGGCTCCTCAAAG ACGGTAATCCTATCCCTTCCGCCATCGCCGCTAACTCAGGTATCTACagc gctGGAGGAGGTGGAAGCGGAGGAGGAGGAAGCGGAGGAGGAGGTAGCgg acctaagaaaaagaggaaggtggcggccgctGGTTCCGGACGGGCTGACG CATTGGACGATTTTGATCTGGATATGCTGGGAAGTGACGCCCTCGATGAT TTTGACCTTGACATGCTTGGTTCGGATGCCCTTGATGACTTTGACCTCGA CATGCTCGGCAGTGACGCCCTTGATGATTTCGACCTGGACATGCTGATTA ACTCTAGATGAgcggatctcttatgtctttacgatttatagttttcatta tcaagtatgcctatattagtatatagcatctttagatgacagtgttcgaa gtttcacgaataaaagataatattctactttttgctcccaccgcgtttgc tagcacgagtgaacaccatccctcgcctgtgagttgtacccattcctcta aactgtagacatggtagcttcagcagtgttcgttatgtacggcatcctcc aacaaacagtcggttatagtttgtcctgctcctctgaatcgagtccctcg atatttctcatactagttctagagatcgagctcgttttcgacactggatg gcggcgttagtatcgaatcgacagcagtatagcgaccagcattcacatac gattgacgcatgatattactttctgcgcacttaacttcgcatctgggcag atgatgtcgaggcgaaaaaaaatataaatcacgctaacatttgattaaaa tagaacaactacaatataaaaaaactatacaaatgacaagttcttgaaaa caagaatctttttattgtcagtactgattagaaaaactcatcgagcatca aatgaaactgcaatttattcatatcaggattatcaataccatatttttga aaaagccgtttctgtaatgaaggagaaaactcaccgaggcagttccatag gatggcaagatcctggtatcggtctgcgattccgactcgtccaacatcaa tacaacctattaatttcccctcgtcaaaaataaggttatcaagtgagaaa tcaccatgagtgacgactgaatccggtgagaatggcaaaagcttatgcat ttctttccagacttgttcaacaggccagccattacgctcgtcatcaaaat cactcgcatcaaccaaaccgttattcattcgtgattgcgcctgagcgaga cgaaatacgcgatcgctgttaaaaggacaattacaaacaggaatcgaatg caaccggcgcaggaacactgccagcgcatcaacaatattttcacctgaat caggatattcttctaatacctggaatgctgttttgccggggatcgcagtg gtgagtaaccatgcatcatcaggagtacggataaaatgcttgatggtcgg aagaggcataaattccgtcagccagtttagtctgaccatctcatctgtaa catcattggcaacgctacctttgccatgtttcagaaacaactctggcgca tcgggcttcccatacaatcgatagattgtcgcacctgattgcccgacatt atcgcgagcccatttatacccatataaatcagcatccatgttggaattta atcgcggcctcgaaacgtgagtcttttccttacccatggttgcgaattga tccggtaatttagtgtgtgtatttgtgtttgcgtgtctatagaagtatag taatttatgctacaaaggacctaatgtataaggaaagaatatttagagaa aagaagaaaacaagagttttatatacatacagagcacatgcatgccataT TTTATTTATGCAAGAGGACGTGGTCCttcaaatatgtatccgctcatgag acaataaccctgataaatgcttcaataatattgaaaaaggaagagtatga gtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgc cttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctga agatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcg gtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagc acttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgg gcaagagcaactcggtcgccgcatacactattctcagaatgacttggttg agtactcaccagtcacagaaaagcatcttacggatggcatgacagtaaga gaattatgcagtgctgccataaccatgagtgataacactgcggccaactt acttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcaca acatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaat gaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggc aacaacgttgcgcaaactattaactggcgaactacttactctagcttccc ggcaacaattaatagactggatggaggcggataaagttgcaggaccactt ctgcgctcggcccttccggctggctggtttattgctgataaatctggagc cggtgagcgtggctctcgcggtatcattgcagcactggggccagatggta agccctcccgtatcgtagttatctacacgacggggagtcaggcaactatg gatgaacgaaatagacagatcgctgagataggtgcctcactgattaagca ttggtaactgtcagaccaagtttactcatatatactttagattgatttaa aacttcatttttaatttaaaaggatctaggtgaagatcctttttgataaa tgggccgcgttgctggcgtttttccataggctccgcccccctgacgagca tcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactat aaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgtt ccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaag cgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtagg tcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgac cgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagaca cgacttatcgccactggcagcagccactggtaacaggattagcagagcga ggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggc tacactagaagaacagtatttggtatctgcgctctgctgaagccagttac cttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctg gtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaa ggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtg gaacgaaaactcacgttaagggattttggtcatga Sequenceofcontrolplasmid(SEQIDNO:2): CATAGCTTCAAAATGTTTCTACTCCTTTTTTACTCTTCCAGATTTTCTCG GACTCCGCGCATCGCCGTACCACTTCAAAACACCCAAGCACAGCATACTA AATTTCCCCTCTTTCTTCCTCTAGGGTGTCGTTAATTACCCGTACTAAAG GTTTGGAAAAGAAAAAAGAGgCCGCCTCGTTTCTTTTTCTTCGTCGAAAA AGGCAATAAAAATTTTTATCACGTTTCTTTTTCTTGAAAATTTTTTTTTT GATTTTTTTCTCTTTCGATGACCTCCCATTGATATTTAAGTTAATAAACG GTCTTCAATTTCTCAAGTTTCAGTTTCATTTTTCTTGTTCTATTACAACT TTTTTTACTTCTTGCTCATTAGAAAGAAAGCATAGCAATCTAATCTAAGT TTTCTAGATGGCTTCAAACTTTACTCAGTTCGTGCTCGTGGACAATGGTG GGACAGGGGATGTGACAGTGGCTCCTTCTAATTTCGCTAATGGGGTGGCA GAGTGGATCAGCTCCAACTCACGGAGCCAGGCCTACAAGGTGACATGCAG CGTCAGGCAGTCTAGTGCCCAGAAgAGAAAGTATACCATCAAGGTGGAGG TCCCCAAAGTGGCTACCCAGACAGTGGGCGGAGTCGAACTGCCTGTCGCC GCTTGGAGGTCCTACCTGAACATGGAGCTCACTATCCCAATTTTCGCTAC CAATTCTGACTGTGAACTCATCGTGAAGGCAATGCAGGGGCTCCTCAAAG ACGGTAATCCTATCCCTTCCGCCATCGCCGCTAACTCAGGTATCTACagc gctGGAGGAGGTGGAAGCGGAGGAGGAGGAAGCGGAGGAGGAGGTAGCgg acctaagaaaaagaggaaggtggcggccgctGGTTCCGGACGGGCTGACG CATTGGACGATTTTGATCTGGATATGCTGGGAAGTGACGCCCTCGATGAT TTTGACCTTGACATGCTTGGTTCGGATGCCCTTGATGACTTTGACCTCGA CATGCTCGGCAGTGACGCCCTTGATGATTTCGACCTGGACATGCTGATTA ACTCTAGATGAgcggatctcttatgtctttacgatttatagttttcatta tcaagtatgcctatattagtatatagcatctttagatgacagtgttcgaa gtttcacgaataaaagataatattctactttttgctcccaccgcgtttgc tagcacgagtgaacaccatccctcgcctgtgagttgtacccattcctcta aactgtagacatggtagcttcagcagtgttcgttatgtacggcatcctcc aacaaacagtcggttatagtttgtcctgctcctctgaatcgagtccctcg atatttctcatactagttctagagatcgagctcgttttcgacactggatg gcggcgttagtatcgaatcgacagcagtatagcgaccagcattcacatac gattgacgcatgatattactttctgcgcacttaacttcgcatctgggcag atgatgtcgaggcgaaaaaaaatataaatcacgctaacatttgattaaaa tagaacaactacaatataaaaaaactatacaaatgacaagttcttgaaaa caagaatctttttattgtcagtactgattagaaaaactcatcgagcatca aatgaaactgcaatttattcatatcaggattatcaataccatatttttga aaaagccgtttctgtaatgaaggagaaaactcaccgaggcagttccatag gatggcaagatcctggtatcggtctgcgattccgactcgtccaacatcaa tacaacctattaatttcccctcgtcaaaaataaggttatcaagtgagaaa tcaccatgagtgacgactgaatccggtgagaatggcaaaagcttatgcat ttctttccagacttgttcaacaggccagccattacgctcgtcatcaaaat cactcgcatcaaccaaaccgttattcattcgtgattgcgcctgagcgaga cgaaatacgcgatcgctgttaaaaggacaattacaaacaggaatcgaatg caaccggcgcaggaacactgccagcgcatcaacaatattttcacctgaat caggatattcttctaatacctggaatgctgttttgccggggatcgcagtg gtgagtaaccatgcatcatcaggagtacggataaaatgcttgatggtcgg aagaggcataaattccgtcagccagtttagtctgaccatctcatctgtaa catcattggcaacgctacctttgccatgtttcagaaacaactctggcgca tcgggcttcccatacaatcgatagattgtcgcacctgattgcccgacatt atcgcgagcccatttatacccatataaatcagcatccatgttggaattta atcgcggcctcgaaacgtgagtcttttccttacccatggttgcgaattga tccggtaatttagtgtgtgtatttgtgtttgcgtgtctatagaagtatag taatttatgctacaaaggacctaatgtataaggaaagaatatttagagaa aagaagaaaacaagagttttatatacatacagagcacatgcatgccataT TGTGAAGAGTCTTATACAGTTCCttcaaatatgtatccgctcatgagaca ataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagta ttcaacatttccgtgtcgcccttattcccttttttgcggcattttgcctt cctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaaga tcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggta agatccttgagagttttcgccccgaagaacgttttccaatgatgagcact tttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggca agagcaactcggtcgccgcatacactattctcagaatgacttggttgagt actcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaa ttatgcagtgctgccataaccatgagtgataacactgcggccaacttact tctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaaca tgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaa gccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaac aacgttgcgcaaactattaactggcgaactacttactctagcttcccggc aacaattaatagactggatggaggcggataaagttgcaggaccacttctg cgctcggcccttccggctggctggtttattgctgataaatctggagccgg tgagcgtggctctcgcggtatcattgcagcactggggccagatggtaagc cctcccgtatcgtagttatctacacgacggggagtcaggcaactatggat gaacgaaatagacagatcgctgagataggtgcctcactgattaagcattg gtaactgtcagaccaagtttactcatatatactttagattgatttaaaac ttcatttttaatttaaaaggatctaggtgaagatcctttttgataaatgg gccgcgttgctggcgtttttccataggctccgcccccctgacgagcatca caaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaa gataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccg accctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgt ggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcg ttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgc tgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacga cttatcgccactggcagcagccactggtaacaggattagcagagcgaggt atgtaggcggtgctacagagttcttgaagtggtggcctaactacggctac actagaagaacagtatttggtatctgcgctctgctgaagccagttacctt cggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggta gcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaagga tctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaa cgaaaactcacgttaagggattttggtcatga