MVA-gH/gL-PC VACCINE DERIVED ANTIBODIES NEUTRALIZING HUMAN CYTOMEGALOVIRUS INFECTIVITY AND METHODS THEREOF

20200157191 ยท 2020-05-21

    Inventors

    Cpc classification

    International classification

    Abstract

    Disclosed are vaccine-derived neutralizing antibodies (NAbs) for CMV infections and small peptides which define precise recognition elements of the antigens by the NAbs. In certain embodiments, vaccine-derived NAbs may be produced by immunizing a subject with a gH/gL/UL128/UL130/UL131A pentameric glycoprotein complex (gH/gL-PC). In certain embodiments, vaccine-derived NAbs may have properties similar or identical to those of NAbs induced in a subject naturally infected with CMV. Native and non-native small peptides from UL128 and gH have been defined by mapping epitopes and deriving artificial sequences which are minimal recognition elements of vaccine-derived NAbs disclosed herein. These small peptides can be used to elicit vaccine-derived NAbs that prevent CMV entry into susceptible cell types and protect humans from infection and disease. Multivalent vaccines comprising these small peptides and/or epitopes are also disclosed. Kits and methods of using the vaccine-derived NAbs and small peptides disclosed herein including methods of treating or preventing CMV infection in a subject are also provided.

    Claims

    1. A vaccine-derived neutralizing antibody (NAb) against cytomegalovirus (CMV) comprising: a variable heavy region comprising a CDR1.sub.VH sequence, a CDR2.sub.VH sequence, and a CDR3.sub.VH sequence; and a variable light region comprising a CDR1.sub.VL sequence, a CDR2.sub.VL sequence, and a CDR3.sub.VL sequence; wherein the vaccine-derived NAb is produced in response to a recombinant CMV pentameric complex comprising gH, gL, UL128, UL130, and UL131A subunits.

    2. The vaccine-derived NAb of claim 1, wherein the vaccine-derived NAb is similar or identical to a NAb induced in a subject naturally infected with CMV in one or more properties selected from the group consisting of cell-type specificity, neutralization potency, minimal antigen recognition, and frequency to recognize antigenic sites.

    3. The vaccine-derived NAb of claim 1, wherein the vaccine-derived NAb prevents cell-to-cell spread of CMV, syncytia formation in epithelial cells, or both.

    4. The vaccine-derived NAb of claim 1, wherein the vaccine-derived NAb has a positive correlation between neutralizing potency and binding affinity of one or more cell surface subunits of the pentameric complex.

    5. The vaccine-derived NAb of claim 1, wherein the vaccine-derived NAb specifically binds one or more linear epitopes or to one or more conformational epitopes on the recombinant CMV pentameric complex.

    6. The vaccine-derived NAb of claim 5, wherein the linear epitope is on UL128 of the recombinant CMV pentameric complex.

    7. The vaccine-derived NAb of claim 6, wherein the linear epitope on UL128 comprises an amino acid sequence represented by SEQ ID NO: 177 (KRLDVCRAKMGYM).

    8. The vaccine-derived NAb of claim 5, wherein the linear epitope is on gH of the recombinant CMV pentameric complex.

    9. The vaccine-derived NAb of claim 8, wherein the vaccine-derived NAb neutralizes CMV infection of epithelial cells but not CMV infection of fibroblasts.

    10. (canceled)

    11. The vaccine-derived NAb of claim 1, wherein the vaccine-derived NAb specifically binds to one or more conformational epitopes composed of UL128/UL130/UL131A or UL130/UL131A subunits of the recombinant CMV pentameric complex.

    12. The vaccine-derived NAb of claim 11, wherein the vaccine-derived NAb neutralizes CMV infection of epithelial cells, endothelial cells, primary placental cytotrophoblast cells or a combination thereof.

    13. The vaccine-derived NAb of claim 1, wherein the vaccine-derived NAb specifically binds to one or more conformational epitopes on gH or gH/gL.

    14. The vaccine-derived NAb of claim 13, wherein the vaccine-derived NAb prevents CMV infection of fibroblasts, epithelial cells, endothelial cells, cytotrophoblasts or a combination thereof.

    15. The vaccine-derived NAb of claim 1, wherein the CDR1.sub.VH sequence is selected from the group consisting of SEQ ID NOs: 3, 11, 19, 27, 35, 43, 51, 59, 67, 75, 83, 91, 99, 107, 115, 123, 131, 139, 147, 155, 163, 171, and sequences sharing at least 90% identity to SEQ ID NOs: 3, 11, 19, 27, 35, 43, 51, 59, 67, 75, 83, 91, 99, 107, 115, 123, 131, 139, 147, 155, 163, 171.

    16. The vaccine-derived NAb of claim 1, wherein the CDR2.sub.VH sequence is selected from the group consisting of SEQ ID NOs: 4, 12, 20, 28, 36, 44, 52, 60, 68, 76, 84, 92, 100, 108, 116, 124, 132, 140, 148, 156, 164, 172, and sequences sharing at least 90% identity to SEQ ID NOs: 4, 12, 20, 28, 36, 44, 52, 60, 68, 76, 84, 92, 100, 108, 116, 124, 132, 140, 148, 156, 164, 172.

    17. The vaccine-derived NAb of claim 1, wherein the CDR3.sub.VH sequence is selected from the group consisting of SEQ ID NOs: 5, 13, 21, 29, 37, 45, 53, 61, 69, 77, 85, 93, 101, 109, 117, 125, 133, 141, 149, 157, 165, 173, and sequences sharing at least 90% identity to SEQ ID NOs: 5, 13, 21, 29, 37, 45, 53, 61, 69, 77, 85, 93, 101, 109, 117, 125, 133, 141, 149, 157, 165, 173.

    18. The vaccine-derived NAb of claim 1, wherein the CDR1.sub.VL sequence is selected from the group consisting of SEQ ID NOs: 6, 14, 22, 30, 38, 46, 54, 62, 70, 78, 86, 94, 102, 110, 118, 126, 134, 142, 150, 158, 166, 174 and sequences sharing at least 90% identity to SEQ ID NOs: 6, 14, 22, 30, 38, 46, 54, 62, 70, 78, 86, 94, 102, 110, 118, 126, 134, 142, 150, 158, 166, 174.

    19. The vaccine-derived NAb of claim 1, wherein the CDR2.sub.VL sequence is selected from the group consisting of SEQ ID NOs: 7, 15, 23, 31, 39, 47, 55, 63, 71, 79, 87, 95, 103, 111, 119, 127, 135, 143, 151, 159, 167, 175 and sequences sharing at least 90% identity to SEQ ID NOs: 7, 15, 23, 31, 39, 47, 55, 63, 71, 79, 87, 95, 103, 111, 119, 127, 135, 143, 151, 159, 167, 175.

    20. The vaccine-derived NAb of claim 1, wherein the CDR3.sub.VL sequence is selected from the group consisting of SEQ ID NOs: 8, 16, 24, 32, 40, 48, 56, 64, 72, 80, 88, 96, 104, 112, 120, 128, 136, 144, 152, 160, 168, 176 and sequences sharing at least 90% identity to SEQ ID NOs: 8, 16, 24, 32, 40, 48, 56, 64, 72, 80, 88, 96, 104, 112, 120, 128, 136, 144, 152, 160, 168, 176.

    21.-26. (canceled)

    27. A method of producing a vaccine-derived neutralizing antibody (NAb) against cytomegalovirus (CMV) comprising: administering to a subject an effective amount of a recombinant CMV pentameric complex comprising gH, gL, UL128, UL130, and UL131A subunits; deriving a hybridoma from the subject; and isolating the NAb from the hybridoma.

    28. (canceled)

    29. A method of treating or preventing CMV infection in a subject, comprising administering to the subject an effective amount of a composition comprising a vaccine-derived neutralizing antibody (NAb) against cytomegalovirus (CMV), which vaccine-derived NAb comprises: a variable heavy region comprising a CDR1.sub.VH sequence, a CDR2.sub.VH sequence, and a CDR3.sub.VH sequence; and a variable light region comprising a CDR1.sub.VL sequence, a CDR2.sub.VL sequence, and a CDR3.sub.VL sequence; wherein the vaccine-derived NAb is produced in response to a recombinant CMV pentameric complex comprising gH, gL, UL128, UL130, and UL131A subunits.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0021] FIG. 1 shows EpC and FBs neutralizing antibody titers on serum samples from immunized mice. Three Balb/C mice (X, RL and L) were vaccinated three times every four weeks by intraperitoneal (i.p.) route with MVA-gH/gL-PC. Mice were boosted with a fourth dose between week 48 and 72 and spleens collected 4 days later for NAbs derivation. HCMV-specific serum NAb titer (IC50) was determined at different time points post-vaccination on EpC (ARPE-19) and FBs (MRC-5) using TB40/E. Arrowheads indicate vaccinations. Vaccinations were performed on all the animals unless indicated under the arrowhead. Crosses represent the time of spleen collection for the different animals. Dotted line indicates the detection limit of the assay.

    [0022] FIG. 2A shows intracellular recognition of PC subunits by isolated NAb. Shown is FC staining by MVA-PC vaccine-derived NAb of permeabilized BHK-21 cells infected with different MVA vectors expressing one or more subunits of the PC.

    [0023] FIG. 2B shows cell surface recognition of PC subunits by isolated NAb. Shown is FC staining by MVA-PC vaccine-derived NAb of non-permeabilized BHK-21 cells infected with different MVA vectors expressing one or more subunits of the PC. Uninfected cells and cells infected with an MVA encoding for a fluorescent protein (Venus) were used as negative controls.

    [0024] FIG. 3 shows neutralization potency of vaccine-derived NAb. NAb derived from MVA-PC immunized mice were used in a microneutralization assay to determine the antibody concentrations required to prevent 50% infection (IC50) of ARPE-19 EpC, HUVEC EnC, and MRC-5 FB with HCMV strains TB40/E and TR. CMV-HIG was used as a reference. Dotted line indicates the highest antibody concentration used in the assay (25 g/ml).

    [0025] FIG. 4 shows inhibition of HCMV spread in EpC by NAb. ARPE-19 cells were infected with TB40/E or TR (MOI of 1), 24 hours later extensively washed, and incubated with serial dilutions of vaccine-derived NAb for 8 days. Cells were imaged for GFP quantification. The graph shows the NAb concentrations at which 50% reduction in the GFP positive area (IC50) in comparison to untreated controls was calculated. CMV-HIG was used as a control. The maximum evaluated antibody concentration is indicated by the dotted line.

    [0026] FIG. 5 shows NAbs mediated inhibition of TR and TB40/E cell-to-cell spread on EpCs. Shown are sequential pictures of TB40/E or TR infected cells in the presence or absence of NAb 1B2, 21E9 and 62-11 added at 200 g/ml. NAbs were added at day 1 post-infection (PI) and pictures were taken at the center of the wells at day 3, 6 and 8 PI. The same magnification (50) was used in all the pictures.

    [0027] FIGS. 6A-6C show correlation analyses between NAb binding affinity and neutralizing potency. FIG. 6A shows NAb EC50 and EpC IC50 values that were plotted, and two-tailed Pearson analysis resulted in a positive correlation (r=0.7432, p=0.014). FIG. 6B shows NAb that were grouped in PC specific NAb (UL) and anti-gH NAb based on their subunit recognition (FIG. 2 and Table 2). No statistically significant difference between the two groups was found using an unpaired t-test (p>0.05). FIG. 6C shows that the same groups as in FIG. 6B were analyzed based on their ARPE-19 IC50 values. As evaluated using an unpaired t-test, neutralizing potency of PC specific NAb was significantly different (p=0.0167) from that of gH NAb.

    [0028] FIGS. 7A and 7B show recognition of linear gH by vaccine derived gH-specific NAb. FIG. 7A shows immunoblot detection of gH expressed from Ad vectors in infected ARPE-19 EpC using vaccine-derived anti-gH NAb and anti-gH antibody AP86. Cells infected with Ad-tet were analyzed for control. Shown is chemiluminescence detection of gH after short (5 minutes) or long (1 hour) exposure of X-ray films to the immunoblot. MEK1/2 detection was performed as loading control. FIG. 7B shows immunoblot detection of gH from HCMV strains Towne (TO), TR, Davis (DA), AD169 (AD) or TB40/E (TB) in infected FB using 18F10 and AP86. Uninfected cells (U) were used as a control. For control, samples were analyzed with anti-pp65 antibody (23-103). Mass markers (kDa) are shown next to each panel.

    [0029] FIGS. 8A and 8B show neutralization of CTB infection by vaccine-derived NAb. FIG. 8A shows characterization of primary CTB. FSC vs. SSC dot plot on the left indicates the gated population of CTB analyzed. Histograms represent cytokeratin 7 (center) and vimentin (right) expression of the gated CTB population. FIG. 8B shows results from NAb that were tested for their ability to neutralize TB40/E infection of primary CTB isolated from term placentae. Shown are the IC50 values for each vaccine-derived NAb. CMV-HIG was used as a control. Dotted line indicates the highest antibody concentration used in the assay (50 g/ml).

    [0030] FIG. 9 shows an ELISA assay performed by coating the wells with L9L (2 g/mL), L10L (2 g/mL) or PBS and incubating with anti-gH NAbs 18F10 or AP86 (2 g/mL).

    [0031] FIGS. 10A-10D show results of studies related to the mapping of the NAb 13B5 minimal binding site. FIGS. 10A and 10B: C- and N terminal truncated peptides based on library peptide 40 were used in an ELISA to identify the shortest amino acid sequence needed for binding of NAb 13B5. FIG. 10C: ELISA to compare 13B5 binding to K13M comprising the minimal 13B5 epitope sequence and peptides based on K13M with one (H14M) or two (K15M) additional amino acid residues of UL128 added to the N-terminus. FIG. 10D: Alanine scanning based on peptide K13M to identify amino acid residues involved in 13B5 binding. Bars represent standard deviation of triplicate wells.

    [0032] FIGS. 11A-11C show binding and neutralizing antibody induction by peptides based on the 13B5 epitope sequence. FIG. 11A: Peptides based on the 13B5 binding site (K15M, K14CS and K16CS) and peptides containing only partial sequences of the 13B5 binding site (UL128 library peptide 38) were coupled to KLH and tested for binding to 13B5 antibody by ELISA. KLH alone was used as a control. Bars represent standard deviation of triplicate wells. FIGS. 11B and 11C: Balb/c mice (5 animals per group) were immunized three times four weeks apart with KLH-coupled peptides adjuvanted in Freund's adjuvant. FIG. 11B shows peptide-specific binding antibodies in sera of immunized mice were measured via ELISA 1 week before (1wp1st) and 3 weeks post first, second, and third immunization (3wp1st; 3wp2nd, 3wp3rd) by using the peptides as antigens that were used for the immunization. FIG. 11C shows serum neutralizing antibody titers (NT50) from immunized mice were measured against HCMV TB40/E on ARPE-19 EC using a standard microneutralization assay. Lines in B and C indicate the group mean.

    DETAILED DESCRIPTION

    I. Vaccine-Derived NAbs

    [0033] In one aspect, vaccine-derived neutralizing antibodies (NAbs) against cytomegalovirus (CMV) are provided herein. Human cytomegalovirus (HCMV) elicits neutralizing antibodies (NAbs) of varying potency and cell-type specificity to prevent HCMV entry into fibroblasts (FB) and epithelial/endothelial cells (EpC/EnC). NAbs targeting the major essential envelope glycoprotein complexes gB and gH/gL inhibit both FB and EpC/EnC entry. In contrast to FB infection, HCMV entry into EpC/EnC is additionally blocked by extremely potent NAbs to conformational epitopes of the gH/gL/UL128/UL130/UL131A pentamer complex (PC). A vaccine concept based on the delivery of a membrane tethered-PC by Modified Vaccinia virus Ankara (MVA) (36), a widely used, clinical viral vector platform that has been safely tested in over 120,000 humans (51, 52), was recently developed. This single vector, termed MVA-PC, can co-express all five PC subunits (the gH/gL/UL128/UL130/UL131A pentamer complex, or gH/gL-PC). MVA-PC induced high titer and sustained NAbs against EpC/EnC entry in mice and rhesus monkeys and less potent NAbs that blocked FB infection (36), which is consistent with the NAb responses induced by HCMV during natural infection (37-39).

    [0034] As provided herein, it was unexpectedly discovered that MVA-PC elicits PC- and gH-specific NAbs having properties (such as cell-type specificity, neutralization potency, minimal antigen recognition, and frequency to recognize antigenic sites) similar or identical to previously described NAbs isolated from human HCMV.sup.+ patients (32) or NAbs induced in a subject naturally infected with CMV. In addition, vaccine-derived PC-specific NAbs were shown to be significantly more potent than gH-specific NAbs in preventing HCMV spread in EpC and infection of primary cytotrophoblasts (CTBs) from term placentae, suggesting that NAbs recognizing the PC may play an important role in interfering with HCMV vertical transmission.

    [0035] As used herein, the term vaccine-derived antibody means that the antibody is produced by immunizing an animal using a vaccine in contrast to an antibody induced in a subject naturally infected with CMV. For example, an MVA vaccine for delivery of a UL128 complex and preventing CMV infection is described in PCT Publication No. WO 2014/018117 (the '117 publication), the content of which is incorporated by reference in its entirety. The vaccine described in the '117 publication, along with other recombinant complexes, may be used herein to immunize the animal from which the NAbs are derived. In certain embodiments, the animal may be a mouse.

    [0036] As used herein, the term neutralizing antibody or neutralizing antibody against CMV means that the antibody is capable of preventing or blocking CMV from infecting cells, such as epithelial cells, endothelial cells, primary placental cytotrophoblast cells, fibroblasts, cytotrophoblasts, or a combination thereof, in an animal, preferably in a mammal such as a human. The term can also mean that the antibody is capable of preventing the spread of CMV in cell culture and neutralizing heterologous CMV strains.

    [0037] The antibodies described herein may be monoclonal antibodies, recombinant antibodies or humanized antibodies.

    [0038] The vaccine-derived NAbs disclosed herein may comprise a variable heavy region comprising a CDR1.sub.VH sequence, a CDR2.sub.VH sequence, and a CDR3.sub.VH sequence; and a variable light region comprising a CDR1.sub.VL sequence, a CDR2.sub.VL sequence, and a CDR3.sub.VL sequence. Table 1 below lists exemplary vaccine-derived NAbs and their sequences. Also encompassed herein are vaccine-derived NAbs comprising a variable heavy region or a variable light region sharing at least 90% identity to the variable heavy region or the variable light region of the vaccine-derived NAbs disclosed herein, or a combination thereof. In certain embodiments, the vaccine-derived NAbs may comprise a variable heavy region or a variable light region sharing at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the variable heavy region or the variable light region of the vaccine-derived NAbs disclosed herein or both.

    TABLE-US-00001 TABLE1 SequencesofVaccine-DerivedNAbs NucleotideSequences AminoAcidSequences Description SEQIDNO Sequence SEQIDNO Sequence 1B2-VH 1 gaagtgcagctggtggagtctgggggaggc 89 EVQLVESGGVLVKP ttagtgaagcctggagggtccctgaaactct GGSLKLSCAASGFTF cctgtgcagcctctggattcactttcagtgact SDYYMYWVRQTPEK attacatgtattgggttcgccagactccggaa RLEWVATISDDGNYT aagaggctggagtgggtcgcaaccattagt NYPDSVKGRFTISRD gatgatggtaattacaccaactatccagaca NAKNNLYLQMSSLKS gtgtgaaggggcgattcaccatctccagag EDTAMYYCARGWLL acaatgccaagaacaatctttacctgcaaat PVFAYWGQGTLVTV gagcagtctgaagtctgaggacacagccat SA gtattactgtgcaagaggatggttactaccag tatttgcttactggggccaagggactctggtc actgtctctgctg 1B2-VL 2 gatattgtgctaactcagtctccagccaccct 90 DIVLTQSPATLSVTPG gtctgtgactccaggagatagcgtcagtcttt DSVSLSCRASQSIGN cctgcagggccagccagagtattggcaaca NLHWYQQKSHESPR acctacactggtatcaacaaaaatcacatg LLIKYTSQSISGIPSRF agtctccaaggcttctcatcaaatatacttccc SGSGSGTDFTLNINS agtccatctctggaatcccctccaggttcagt VETEDFGVYFCQQS ggcagtggatcagggacagatttcactctca NRWPWTFGGGTKLE atatcaacagtgtggagactgaagattttgg IK agtgtatttctgtcagcagagtaacagatggc cgtggacgttcggtggaggcaccaagctgg aaatcaaac 1B2-VH- 3 ggattcactttcagtgactatta 91 GFTFSDYY CDR1 1B2-VH- 4 attagtgatgatggtaattacacc 92 ISDDGNYT CDR2 1B2-VH- 5 gcaagaggatggttactaccagtatttgctta 93 ARGWLLPVFAY CDR3 ct 1B2-VL- 6 cagagtattggcaacaac 94 QSIGNN CDR1 1B2-VL- 7 tatacttcc 95 YTS CDR2 1B2-VL- 8 cagcagagtaacagatggccgtggacg 96 QQSNRWPWT CDR3 54E11-VH 9 cagatccagttggtgcagtctggacctgagc 97 QIQLVQSGPELKKPG tgaagaagcctggagagacagtcaagatct ETVKISCKASGYTFT cctgcaaggcttctggatataccttcacaagc SYGMNWVKQAPGK tatggaatgaactgggtgaagcaggctcca GLKWMGWINTYTGE ggaaagggtttaaagtggatgggctggata PTYADDFKGRFAFSL aacacctacactggagagccaacatatgct ETSASTAYLQINNLK gatgacttcaagggacggtttgccttctctttg NEDTATYFCAREHYY gaaacctctgccagcactgcctatttacagat GINPLLGCWGQGTTL caacaacctcaaaaatgaggacacggcta TVSS catatttctgtgcaagagaacattactacggt attaacccccttttaggctgctggggccaagg caccactctcacagtctcctcag 54E11-VL 10 gatatccagatgacacagactacatcctccc 98 DIQMTQTTSSLSASL tgtctgcctctctgggagacagagtcaccatc GDRVTISCSASQGIS agttgcagtgcaagtcagggcattagcaatt NYLNWYQQKPDGTV atttaaactggtatcagcagaaaccagatgg KLLIYDTSSLHSGVPS aactgttaaactcctgatctatgacacatcaa RFSGSGSGTDYSLTI gtttacactcaggagtcccatcaaggttcagt SNLEPEDIATYYCQQ ggcagtgggtctgggacagattattctctcac YSKLPYTFGGGTKLE aatcagcaacctggaacctgaagatattgc IK cacttactattgtcagcagtatagtaagcttcc ttacacgttcggaggggggaccaagctgga aataaaac 54E11-VH- 11 ggatataccttcacaagctatgga 99 GYTFTSYG CDR1 54E11-VH- 12 ataaacacctacactggagagcca 100 INTYTGEP CDR2 54E11-VH- 13 gcaagagaacattactacggtattaaccccc 101 AREHYYGINPLLGC CDR3 ttttaggctgc 54E11-VL- 14 cagggcattagcaattat 102 QGISNY CDR1 54E11-VL- 15 gacacatca 103 DTS CDR2 54E11-VL- 16 cagcagtatagtaagcttccttacacg 104 QQYSKLPYT CDR3 21F6-VH 17 cagatccagttggtgcagtctggacctgagc 105 QIQLVQSGPELKKPG tgaagaagcctggagagacagtcaagatct ETVKISCKASGYTFT cctgcaaggcttctggatataccttcacaagc SYGMNWVKQAPGK tatggaatgaactgggtgaagcaggctcca GLKWMGWINTYTGE ggaaagggtttaaagtggatgggctggata PTYADDFKGRFAFSL aacacctacactggagagccaacatatgct ETSASTAYLQINNLK gatgacttcaagggacggtttgccttctctttg NEDTATYFCAREHYY gaaacctctgccagcactgcctatttacagat GINPLLGCWGQGTTL caacaacctcaaaaatgaggacacggcta TVSS catatttctgtgcaagagaacattactacggt attaacccccttttaggctgctggggccaagg caccactctcacagtctcctcag 21F6-VL 18 gatatccagatgacacagactacatcctccc 106 DIQMTQTTSSLSASL tgtctgcctctctgggagacagagtcaccatc GDRVTISCSASQGIS agttgcagtgcaagtcagggcattagcaatt NYLNWYQQKPDGTV atttaaactggtatcagcagaaaccagatgg KLLIYDTSSLHSGVPS aactgttaaactcctgatctatgacacatcaa RFSGSGSGTDYSLTI gtttacactcaggagtcccatcaaggttcagt SNLEPEDIATYYCQQ ggcagtgggtctgggacagattattctctcac YSKLPYTFGGGTKLE aatcagcaacctggaacctgaagatattgc IK cacttactattgtcagcagtatagtaagcttcc ttacacgttcggaggggggaccaagctgga aataaaac 21F6-VH- 19 ggatataccttcacaagctatgga 107 GYTFTSYG CDR1 21F6-VH- 20 ataaacacctacactggagagcca 108 INTYTGEP CDR2 21F6-VH- 21 gcaagagaacattactacggtattaaccccc 109 AREHYYGINPLLGC CDR3 ttttaggctgc 21F6-VL- 22 cagggcattagcaattat 110 QGISNY CDR1 21F6-VL- 23 gacacatca 111 DTS CDR2 21F6-VL- 24 cagcagtatagtaagcttccttacacg 112 QQYSKLPYT CDR3 12E2-VH 25 gaagtgaagctggtggagtctgggggagg 113 EVKLVESGGGLVQP cttagtgcagcctggagggtccctgaaactct GGSLKLSCATSGFTF cctgtgcaacctctggattcactttcagtgact SDYYMFWVRQTPEK attacatgttttgggttcgccagactccagag KLEWVAYISNGGGST aagaagctggagtgggtcgcatacattagta YYPDTVKGRFTISRD atggtggtggtagcacctattatccagacact NDKNTLYLQMSRLKS gtaaagggccgattcaccatctccagagac DDTALYYCVRPKRDF aatgacaagaacaccctatacctgcaaatg QYLYAMDYWGQGTS agtcgtctgaagtctgacgacacagccttgt VTVSS attactgtgtaagaccgaaacgggactttca atacctctatgctatggactactggggtcaag gaacctcagtcaccgtctcctcag 12E2-VL 26 gacattgtgctgacacagtctcctgcttcctta 114 DIVLTQSPASLAVSL gctgtatctctggggcagagggccaccatct GQRATISCRASKSVS catgcagggccagcaaaagtgtcagtacat TSGYSYMHWYQQKP ctggctatagttatatgcactggtaccaacag GQSPKLLIYLASNLES aaaccaggacagtcacccaaactcctcatc GVPARFSGSGSGTD tatcttgcatccaacctagaatctggggtccct FTLNIHPVEDEDAAT gccaggttcagtggcagtgggtctgggaca YYCQHSRELPWTFG gacttcaccctcaacatccatcctgtggagg GGTKLEIK acgaggatgctgcaacctattactgtcagca cagtagggagcttccgtggacgttcggtgga ggcaccaagctggaaatcaaac 12E2-VH- 27 ggattcactttcagtgactattac 115 GFTFSDYY CDR1 12E2-VH- 28 attagtaatggtggtggtagcacc 116 ISNGGGST CDR2 12E2-VH- 29 gtaagaccgaaacgggactttcaatacctct 117 VRPKRDFQYLYAMD CDR3 atgctatggactac Y 12E2-VL- 30 aaaagtgtcagtacatctggctatagttat 118 KSVSTSGYSY CDR1 12E2-VL- 31 cttgcatcc 119 LAS CDR2 12E2-VL- 32 cagcacagtagggagcttccgtggacg 120 QHSRELPVVT CDR3 13B5-VH 33 caggttactctgaaagagtctggccctggga 121 QVTLKESGPGILKPS tattgaagccctcacagaccctcagtctgact QTLSLTCSFSGFSLT tgttctttctctgggttttcactgaccacttctggtt TSGLGVGWIRQPSG tgggtgtaggctggattcgtcagccttcaggg KGLEWLAHIWWDDD aagggtctggagtggctggcacacatttggt KYFNPSLRNQLTISK gggatgatgataaatactttaacccatccctg DTSRNQVFLEITSVTT aggaaccagctcacaatctccaaggatacc ADTATYYCVRSLYDY tccagaaaccaggtattcctcgagatcacca DEGYYFDSWGQGTT gtgtgaccactgcagatactgccacttactac LTVSS tgtgttcgaagcctttatgattacgacgaggg gtactactttgactcctggggccaaggcacc actctcacagtctcctcag 13B5-VL 34 gacattgtgatgactcagtctccagccaccct 122 EIVMIQSPATLSVNPG gtctgtgaatccaggagatagagtctctctct DRVSLSCRASQSISD cctgcagggccagccagagtattagcgact YLHWYQQKSHESPR acttacactggtatcaacaaaaatcacatga LLIKYASQSISGIPSR gtctccaaggcttctcatcaaatacgcttccc FSGSGSGSDFTLSIN aatccatctctgggatcccctccaggttcagt SVEPEDVGVYYCQN ggcagtggatcagggtcagatttcactctca GHTFPPTFGGGTKLE gtatcaacagtgtggaacctgaagatgttgg IK agtgtattattgtcaaaatggtcacacctttcct ccgacgttcggtggaggcaccaagctgga aatcaaac 13B5-VH- 35 gggttttcactgaccacttctggtttgggt 123 GFSLTTSGLG CDR1 13B5-VH- 36 atttggtgggatgatgataaa 124 IWWDDDK CDR2 13B5-VH- 37 gttcgaagcctttatgattacgacgaggggta 125 VRSLYDYDEGYYFDS CDR3 ctactttgactcc 13B5-VL- 38 cagagtattagcgactac 126 QSISDY CDR1 13B5-VL- 39 tacgcttcc 127 YAS CDR2 13B5-VL- 40 caaaatggtcacacctttcctccgacg 128 QNGHTFPPT CDR3 18F10-VH 41 cagattactcagaaagagtctggccctggg 129 QVTLKESGPGILQPS atattgcagccctcccagaccctcagtctgac QTLSLTCSFSGFSLS ttgttctttctctgggttttcactgagcacttatgg TYGIGIGWIRQPSGK tataggaataggctggattcgtcagccttcag GLEWLAHIWWNDNK ggaagggtctggagtggctggcacacatttg NYNTALKSRLTISKDP gtggaatgataataagaactataacacagc SNNQVFLKIASVDTA cctgaagagccggctcacaatctccaagga DTATYFCARTGYFDV tccctccaacaaccaggtattcctcaagatc WGAGTTVTVSS gccagtgtggacactgcagatactgccacat acttctgtgctcgaactgggtacttcgatgtct ggggcgcagggaccacggtcaccgtctcct cag 18F10-VL 42 gatgttgtgatgacccaaactccactctccct 130 DVVLTQTPLSLPVSL gcctgtcagtcttggagatcaagtctccatttct GDQVSISCSSSQSLV tgcagctctagtcagagccttgtgcacagta HSNGNTYIHWYLQKP atggaaacacctatatacattggtacctgca GQSPKLLIYTVSNRF gaaaccaggccagtctccaaagctcctgat SGVPDRFSGSGSGT ctacacagtttccaaccgattttctggggtccc DFTLKISRVEAEDLGL agacaggttcagtggcagtggatcagggac YFCSQSTHVPYTFG agatttcacactcaagatcagcagagtgga GGTKLEIK ggctgaggatctgggactttatttctgctctca aagtacacatgttccgtacacgttcggaggg gggaccaagctggaaataaaac 18F10-VH- 43 gggttttcactgagcacttatggtatagga 131 GFSLSTYGIG CDR1 18F10-VH- 44 atttggtggaatgataataag 132 IWWNDNK CDR2 18F10-VH- 45 gctcgaactgggtacttcgatgtc 133 ARTGYFDV CDR3 18F10-VL- 46 cagagccttgtgcacagtaatggaaacacc 134 QSLVHSNGNTY CDR1 tat 18F10-VL- 47 acagtttcc 135 TVS CDR2 18F10-VL- 48 tctcaaagtacacatgttccgtacacg 136 SQSTHVPYT CDR3 21E9-VH 49 cagatccagttggtgcagtctggacctgagc 137 QIQLVQSGPELKKPG tgaagaagcctggagagacagtcaagatct ETVKISCKASGYTFTI cctgcaaggcttctgggtataccttcacaatct YGMNWVKQAPGKGL atggaatgaactgggtgaagcaggctccag KWMGWINTYTGEPT gaaagggtttaaagtggatgggctggataa YADDFRGRFAFSLET acacctacactggagagccaacatatgctg SASTAYLQINNLKNE atgacttcaggggacggtttgccttctctttgg DTATYFCARKGYYG aaacctctgccagcactgcctatttgcagatc SSGYFDYWGQGTTL aacaacctcaaaaatgaggacacggctac TVSS atatttctgtgcaagaaaggggtactacggta gtagcgggtactttgactactggggccaagg caccactctcacagtctcctcag 21E9-VL 50 agtattgtgatgacccagactcccaaattcct 138 SIVMTQTPKFLLVSA gcttgtatcagcaggagacagggttaccata GDRVTITCKASQSVS acctgcaaggccagtcagagtgtgagtaat NDVSWYQQKPGQSP gatgtatcttggtaccaacagaagccaggg KLLIYYASNRYTGVP cagtctcctaaactgctgatatactatgcgtcc DRFTGSGYGTDFTFT aatcgctacactggagtccctgatcgcttcac ISTVQAEDLAVYFCQ tggcagtggatatgggacggatttcactttca QDYSSPWTFGGGTK ccatcagcactgtgcaggctgaagacctgg LEIK cagtttatttctgtcagcaggattatagctctcc gtggacgttcggtggaggcaccaagctgga aatcaaac 21E9-VH- 51 gggtataccttcacaatctatgga 139 GYTFTIYG CDR1 21E9-VH- 52 ataaacacctacactggagagcca 140 INTYTGEP CDR2 21E9-VH- 53 gcaagaaaggggtactacggtagtagcgg 141 ARKGYYGSSGYFDY CDR3 gtactttgactac 21E9-VL- 54 cagagtgtgagtaatgat 142 QSVSND CDR1 21E9-VL- 55 tatgcgtcc 143 YAS CDR2 21E9-VL- 56 cagcaggattatagctctccgtggacg 144 QQDYSSPWT CDR3 4A3-VH 57 caggtccaactgcagcagcctggggctgag 145 QVQLQQPGPELVRP ctggtgaggcctggggcttcagtgaaactgt GASVKLSCKASGYTF cctgcaaggcttctggctacaccttcaccatct TIYWMNWVKQRPGQ actggatgaactgggtgaagcagaggcctg GLEWIGMIDPSDSET gacaaggccttgaatggattggtatgattgat HYNQMFKDKATLTV ccttcactacacttgaaactcactacaatcaga DKSSSTAYMQLSSLT tgttcaaggacaaggccacattgactgtaga SEDSAVYYCASSGT caaatcctccagcactgcctacatgcagctc GAYWGQGTLLTVSA agcagcctgacatctgaggactctgcggtct attactgtgcaagttctgggacgggggcttac tggggccaagggactctgctcactgtctctgc ag 4A3-VL 58 gatgttgtgatgacccagactccactcactttg 146 DVVMTQTPLTLSVTI tcggttaccattggacaaccagcctccatctc GQPASISCKSSQSLL ttgcaagtcaagtcagagcctcttagatagtg DSDGKTYLNWLLQR atggaaagacatatttgaattggttgttacag PGQSPKRLIYLVSKL aggccaggccagtctccaaagcgcctgatc DSGVPDRFTGSGSG tatttggtgtctaaactggactctggagtccct TDFTLKISRLEAEDLG gacaggttcactggcagtggatcagggaca VYYCWQGTHFPYTF gatttcacactgaaaatcagcagattggaag GGGTKLEIK ctgaggatttgggagtttattattgctggcaag gtacacattttccgtacacgttcggaggggg gaccaagctggaaataaaac 4A3-VH- 59 ggctacaccttcaccatctactgg 147 GYTFTIYW CDR1 4A3-VH- 60 attgatccttcagacagtgaaact 148 IDPSDSET CDR2 4A3-VH- 61 gcaagttctgggacgggggcttac 149 ASSGTGAY CDR3 4A3-VL- 62 cagagcctcttagatagtgatggaaagacat 150 QSLLDSDGKTY CDR1 at 4A3-VL- 63 ttggtgtct 151 LVS CDR2 4A3-VL- 64 tggcaaggtacacattttccgtacacg 152 WQGTHFPYT CDR3 62-11-VH 65 caggtccaactgcagcagcctggggctgag 153 QVQLQQPGAELVRP ctggtgaggcctggggcttcagtgaagctgt GASVKLSCKASGYTF cctgcaaggcttctggctacaccttcaccagc TSYWMNWVKQRPG tactggatgaactgggtgaagcagaggcct QGLEWIGMIDPSDSE ggacaaggccttgaatggattggtatgattg THYNQMFKDKATLTV atccttcactacagtgaaactcactacaatca DKSSSTAYMQLSSLT aatgttcaaggacaaggccacattgactgta SEDSAVYYCSNGYS gacaaatcctccagcacagcctacatgcaa SFAYWGQGTLVTVS ctcagcagcctgacatctgaggactctgcgg V tctattactgttcaaatggttactcctcctttgctt actggggccaagggactctggtcactgtctct gtag 62-11-VL 66 gatgtccagatgacacagactacatcctccc 154 DVQMTQTTSSLSASL tgtctgcctctctgggagacagagtcaccatc GDRVTISCSASQGIS agttgcagtgcaagtcagggcattagcaatt NYLNWYQQKPDGTV atttaaactggtatcagcagaaaccagatgg KLLIYDTSSLHSGVPS aactgttaaactcctgatctatgacacatcaa RFSGSGSGTDYSLTI gtttacactcaggagtcccatcaaggttcagt SNLEPEDIATYYCQQ ggcagtgggtctgggacagattattctctcac YSKLPYTFGGGTKLE aatcagcaacctggaacctgaagatattgc IK cacttactattgtcagcagtatagtaagcttcc ctacacgttcggaggggggaccaagctgg aaataaaac 62-11-VH- 67 ggctacaccttcaccactctactgg 155 GYTFTSYW CDR1 62-11-VH- 68 attgatccttcactacacttgaaact 156 IDPSDSET CDR2 62-11-VH- 69 tcaaatggttactcctcctttgcttac 157 SNGYSSFAY CDR3 62-11-VL- 70 cagggcattagcaattat 158 QGISNY CDR1 62-11-VL- 71 gacacatca 159 DTS CDR2 62-11-VL- 72 cagcagtatagtaagcttccctacacg 160 QQYSKLPYT CDR3 62-100-VH 73 caggtccaactgcagcagcctggggctgag 161 QVQLQQPGAELVRP ctggtgaggcctggggcttcagtgaagctgt GASVKLSCKASGYTF cctgcaaggcttctggctacaccttcaccagc TSYWMNWVKQRPG tactggatgaactgggtgaagcagaggcct QGLEWIGMIDPSDSE ggacaaggccttgaatggattggtatgattg THYNQMFKDKATLTV atccttcactacagtgaaactcactacaatca DKSSSTAYMQLSSLT aatgttcaaggacaaggccacattgactgta SEDSAVYYCSNGYS gacaaatcctccagcacagcctacatgcaa SFAYWGQGTLVTVS ctcagcagcctgacatctgaggactctgcgg V tctattactgttcaaatggttactcctcctttgctt actggggccaagggactctggtcactgtctct gtag 62-100-VL 74 gatattgtgctaactcagtctccagccaccct 162 DIVLTQSPATLSVTPG gtctgtgactccaggagatagcgtcagtcttt DSVSLSCRASQSISN cctgcagggccagccaaagtattagcaaca NLHWYQQKSHESPR acctacactggtatcaacaaaaatcacatg LLIKYASQSISGIPSR agtctccaaggcttctcatcaagtatgcttccc FSGSGSGTDFTLSIN agtccatctctgggatcccctccaggttcagt SVETEDFGKYVCQQ ggcagtggatcagggacagatttcactctca SNSWPLTFGSGTKLE gtatcaacagtgtggagactgaagattttgg IK aaagtatgtctgtcaacagagtaacagctgg ccactcacgttcggctcggggacaaagttgg aaataaaac 62-100-VH- 75 ggctacaccttcaccactctactgg 163 GYTFTSYW CDR1 62-100-VH- 76 attgatccttcactacacttgaaact 164 IDPSDSET CDR2 62-100-VH- 77 tcaaatggttactcctcctttgcttac 165 SNGYSSFAY CDR3 62-100-VL- 78 caaagtattagcaacaac 166 QSISNN CDR1 62-100-VL- 79 tatgcttcc 167 YAS CDR2 62-100-VL- 80 caacagagtaacagctggccactcacg 168 QQSNSWPLT CDR3 2-80-VH 81 cagatccagttggtgcagtctggacctgagc 169 QIQLVQSGPELKKPG tgaagaagcctggagagacagtcaagatct ETVKISCKASGYTFT cctgcaaggcttctggatataccttcacaaac NFGMNWVKQAPGK tttggaatgaactgggtgaagcaggctccag GLKWMGWINTYTGE gaaagggtttaaagtggatgggctggataa PTYADDFKGRFAFSL acacctacactggagagccaacatatgctg ETSASTASLQINNLK atgacttcaagggacggtttgccttctctttgg NEDTATYFCARRGD aaacctctgccagcactgcctctttgcagatc GLYSMDYWGQGTSV aacaacctcaaaaatgaggacacggctac TVSS atatttctgtgcaagaaggggggatggcctct attctatggactactggggtcaaggaacctc agtcaccgtctcctcag 2-80-VL 82 gacattgtgctgacccaatctccagcttctttg 170 DIVLTQSPASLAVSL gctgtgtctctggggcagagggccaccatat GQRATISCRASESID cctgcagagccagtgaaagtattgatagttat SYGNSFMYWYQQKP ggcaatagttttatgtactggtaccagcagaa GQPPKLLIYRASNLE accaggacagccacccaaactcctcatctat SGIPARFSGSGSRTD cgtgcatccaacctagaatctgggatccctg FTLTINPVEADDVATY ccaggttcagtggcagtgggtctaggacag YCQQSNEDPLTFGA acttcaccctcaccattaatcctgtggaggct GTKLELK gatgatgttgcaacctattactgtcagcaaag taatgaggatcctctcacgttcggtgctggga ccaagctggagctgaaac 2-80-VH- 83 ggatataccttcacaaactttgga 171 GYTFTNFG CDR1 2-80-VH- 84 ataaacacctacactggagagcca 172 INTYTGEP CDR2 2-80-VH- 85 gcaagaaggggggatggcctctattctatgg 173 ARRGDGLYSMDY CDR3 actac 2-80-VL- 86 gaaagtattgatagttatggcaatagtttt 174 ESIDSYGNSF CDR1 2-80-VL- 87 cgtgcatcc 175 RAS CDR2 2-80-VL- 88 cagcaaagtaatgaggatcctctcacg 176 QQSNEDPLT CDR3

    [0039] In some embodiments, the vaccine-derived NAbs disclosed herein such as 1B2, 54E11, 21F6, 12E2, 13B5 and 4A3 are potent NAbs that are able to neutralize HCMV infection of epithelial cells, endothelial cells and primary placental cytotrophoblast cells at picomolar concentrations. These NAbs also prevent the spread of the virus in cell culture and neutralize heterologous HCMV strains with the same potency. Some PC-specific NAbs, such as 1B2, 54E11, 21F6, 12E2, and 4A3, specifically bind to conformational epitopes composed of UL128/UL130/UL131A or UL130/UL131A subunits of the gH/gL-PC. Some PC-specific NAbs such as 13B5 bind a linear epitope on UL128.

    [0040] In other embodiments, the NAbs disclosed herein such as 21E9, 62-11, 62-100, 2-80, 13B1, 6G2, 10G6, and 25H10 specifically bind to conformational epitopes on gH and prevent HCMV infection of fibroblasts, epithelial cells, endothelial cells and cytotrophoblasts with similar potency, even if less efficiently that the PC-specific NAbs targeting the UL subunits. Some NAbs, such as 18F10, bind to a linear epitope on gH and neutralize CMV infection of epithelial cells but not CMV infection of fibroblasts with potency comparable to other gH NAbs. All the NAbs tested showed binding affinity for the gH/gL-PC in the high nanomolar to low picomolar range.

    [0041] In some embodiments, the vaccine-derived NAbs disclosed herein potently interfere with HCMV cell-to-cell spread and/or syncytia formation in EpC. Previous reports have shown that CMV-HIG, which represents a pooled IgG antibody repertoire from over 1,000 HCMV.sup.+ individuals, potently prevents EpC spread of different HCMV strains (72). In contrast, Jacob et al. have shown that CMV-HIG and monoclonal NAb targeting gB, gH, or the PC are unable to prevent HCMV spread in EpC. However, Jacob et al. investigated spread inhibition in the presence of only very low antibody concentration (76). As disclosed herein, about 1,000-fold higher amounts of the vaccine-derived NAbs than that used by the prior art were shown to be effective in preventing HCMV cell-to-cell spread and/or syncytia formation in EpC of heterologous HCMV strains (Table 3). In addition, the vaccine-derived PC-specific NAbs disclosed herein were significantly more potent than the anti-gH NAbs disclosed herein or CMV-HIG to interfere with EpC spreading of HCMV. Hence, PC-specific NAbs induced by MVA-PC not only confer potent inhibition of HCMV entry, but also have potent ability to prevent HCMV spread and/or syncytia formation in EpC, suggesting that the anti-PC NAbs elicited by MVA-PC can limit cell-associated virus dissemination throughout the human host and transmission to the fetus.

    [0042] In some embodiments, the vaccine-derived NAbs disclosed herein demonstrate a positive correlation between antibody neutralizing potency and binding affinity of PC- and gH-specific NAbs recognizing cell surface PC. However, in contrast to the difference in neutralization potency of the vaccine-derived PC-specific NAbs and anti-gH NAbs disclosed herein, the difference in binding affinity between these two groups of NAbs was not significant. It is possible that the significant difference in neutralization potency between PC-specific NAbs and NAbs targeting gH/gL (or gB) may reflect the relative low amount of the UL128/130/131A subunits in HCMV virions compared to gH/gL. Hence, much lower antibody concentrations are required to interfere with PC-mediated entry than with the fusion function of gH/gL (77). In contrast, the difference in neutralizing potency of individual NAbs targeting the UL128/130/131A subunits of the PC may be a function of their binding affinity.

    II. Small Peptides Comprising Epitopes for Vaccine-Derived NAbs

    [0043] Two of the isolated NAbs, 13B5 and 18F10, showed recognition of linear epitopes on UL128 and gH respectively. No linear epitope on UL128 with neutralizing properties has been described in the prior art, thus the small peptides disclosed herein can represent the epitope as a surrogate for the whole gH/gL-PC in a peptide vaccine setting. In some embodiments, the small peptide comprises at least one cysteine residue such that a disulfide bridge between UL128 and gL can be formed. In some embodiments, the small peptide may have a size of 10 amino acids, 11 amino acids, 12 amino acids, 13 amino acids, 14 amino acids, 15 amino acids, 16 amino acids, 17 amino acids or 18 amino acids. Other examples include non-native derivatives of SEQ ID NO: 177, e.g. SEQ ID NOs: 180 and 181.

    [0044] By using 13B5 to bind to a UL128 peptide library in an ELISA assay, peptide K13M (KRLDVCRAKMGYM) (SEQ ID NO: 177) was identified as the minimum sequence required to have a strong binding of the NAb (FIGS. 10A-10B). Moreover, the longer peptides H14M (HKRLDVCRAKMGYM) (SEQ ID NO: 178) and K15M (KHKRLDVCRAKMGYM) (SEQ ID NO: 179) were efficiently recognized by 13B5 (FIG. 10C). The cysteine (Cys-162) residue centrally located in the recognized peptides has been indicated as the amino acid responsible for the disulfide bridge between UL128 and gL thus connecting gH/gL to the UL subunits. The involvement of Cys-162 in 13B5 binding to K13M was evaluated. When a new peptide in which Cys-162 was substituted with serine (K13MS, KRLDVSRAKMGYM) (SEQ ID NO: 182) was tested, 13B5 binding was not detected. When Cys was added to the end of peptide K13MS (i.e., K14CS, KRLDVSRAKMGYMC) (SEQ ID NO: 180)), 13B5 binding was completely restored. It was unexpected that the addition of a cysteine to the 3 end of peptide K13MS (SEQ ID NO: 182) to form peptide K14CS (i.e., SEQ ID NO: 180) would completely restore binding to 13B5 since no binding was detected with K13MS. Similarly, 13B5 binding is detected when Cys was added to the end of K15M and the Cys-162 substituted with serine (i.e., K16CS, KHKRLDVSRAKMGYMC) (SEQ ID NO:181),

    [0045] The small peptides comprising one or more linear epitopes on the gH/gL-PC disclosed herein can be used as peptide vaccines. In some embodiments, K15M (KHKRLDVCRAKMGYM, SEQ ID NO: 179), K14CS (KRLDVSRAKMGYMC, SEQ ID NO: 180), and K16CS (KHKRLDVSRAKMGYMC, SEQ ID NO:181) can be used as peptide vaccines. Upon administration to a subject, a peptide vaccine stimulates antibody production that is specific for CMV antigens on the surface of virus-infected cells or other cells that have incorporated the protein through various processing mechanisms. A peptide vaccine uses one or more small peptides as antigens to elicit an immune response. In order to induce PC specific NAbs the peptides can be coupled to a carrier protein such as Keyhole Limpet Hemocyanin (KLH), Tetanus and diphtheria toxoids (TT and DT respectively), Hepatitis B surface antigen (HBsAg). For example, in some embodiments, KLH-K15M (KLH-coupled SEQ ID NO: 179), KLH-K14CS (KLH-coupled SEQ ID NO: 180), or KLH-K16CS (KLH-coupled SEQ ID NO:181) can be used to elicit an immune response. Given the peptides low immunogenicity in vivo, adjuvants can be added. The peptide vaccine may further comprise one or more adjuvants to boost the immune response. Possible adjuvants include Freud's Complete and Incomplete (CFA, IFA), squalene-based oil-in-water nano-emulsions (MF59, AddaVax), aluminum hydroxide suspensions (Alum, Alhydrogel), toll like receptor agonists (monophosphoryl lipid A), pathogen associated molecular pattern (PAMP) agonists, and damage associated molecular pattern (DAMP) agonists. Other adjuvants in use are so-called oil-in-water emulsions, saponin, LPS, quil-A, Montanide, RIBI, and others that are known in the field. Emulsification of a peptide or peptides in the adjuvant is used as a subcutaneous injection that has benefits for protection against pathogens both in humans and in veterinary applications.

    [0046] It is desirable to develop effective peptide vaccines due to the ease and low cost for synthesizing small peptides, the effectiveness of the peptide vaccines in inducing immune response, and improved clinical safety in general. Peptides are synthetic molecules which are not live or propagating and have an overwhelming safety advantage. They can be produced using standard clinical manufacturing techniques to high precision and purity. They can be freeze-dried and transported easily and in that condition, avoid the necessity for cold chain. In regards to their specificity, because of the short sequence that defines the peptide vaccine disclosed herein, it has inherent specificity in regards to having limited sequence for the immune system to recognize and process to generate off-target antibodies or T cell responses. Other salutary benefits of peptide vaccines include the possibility of developing a multi-valent formula that is specific for different antigens or different key locations in an antigen that can cause the development of unique and non-overlapping neutralizing antibodies that can aid in protection against a pathogen.

    [0047] In some embodiments, the small peptides can be administered to a subject, either alone or in combination with one or more adjuvants, to elicit an immune response against CMV infection of the subject. In some embodiments, the small peptides can be administered to a subject such as a mammal to produce NAbs against CMV. In certain embodiments, a method of producing NAbs against CMV may include administering a first dose of one or more small peptides to a subject and administering a second dose of one or more small peptides to the subject after administration of the first dose. In certain embodiments, the second dose may be administered to the subject about one week, about two weeks, about three weeks, about four weeks, or about five weeks after administration of the first dose. In certain embodiments, at least one of the first and second doses includes administering one or more small peptides, at least one of which is selected from SEQ ID NOs: 179, 180, and 181. In certain embodiments, the first dose includes administering one or more small peptides, at least one of which is selected from SEQ ID NOs: 179, 180, and 181. In certain embodiments, the first dose includes administering SEQ ID NO:179, SEQ ID NO: 180, or SEQ ID NO:181 and the second dose includes administering SEQ ID NO:179, SEQ ID NO: 180, or SEQ ID NO:181. In certain embodiments, the first and second doses include administering SEQ ID NO:179, SEQ ID NO: 180, or SEQ ID NO:181. Any combination of SEQ ID NOS 179, 180, and 181 may be used for the first and second doses. For example, the first dose and the second dose comprise at least one of SEQ ID NOS 179, 180, or 181, as shown in the table below:

    TABLE-US-00002 First Dose comprises: Second Dose comprises: SEQ ID NO: 179* SEQ ID NO: 179**** SEQ ID NO: 179* SEQ ID NO: 180***** SEQ ID NO: 179* SEQ ID NO: 181****** SEQ ID NO: 180** SEQ ID NO: 179**** SEQ ID NO: 180** SEQ ID NO: 180***** SEQ ID NO: 180** SEQ ID NO: 181****** SEQ ID NO: 181*** SEQ ID NO: 179**** SEQ ID NO: 181*** SEQ ID NO: 180***** SEQ ID NO: 181*** SEQ ID NO: 181****** *The first dose may also include SEQ ID NO: 180 and/or SEQ ID NO: 181 **The first dose may also include SEQ ID NO: 179 and/or SEQ ID NO: 181 ***The first dose may also include SEQ ID NO: 179 and/or SEQ ID NO: 180 ****The second dose may also include SEQ ID NO: 180 and/or SEQ ID NO: 181 *****The second dose may also include SEQ ID NO: 179 and/or SEQ ID NO: 181 ******The second dose may also include SEQ ID NO: 179 and/or SEQ ID NO: 180

    [0048] The NAbs can be used as a therapeutic agent against CMV infection, as discussed above.

    III. Therapeutic and Vaccine Compositions

    [0049] Based on the vaccine-derived NAbs and the small peptides described above, therapeutic or vaccine compositions for treating or preventing CMV infection are also provided. In some embodiments, a therapeutic composition may include one or more vaccine-derived NAbs described above. In certain embodiments, a vaccine composition may include one or more small peptides comprising one or more linear epitopes on the gH/gL-PC. The one or more linear epitopes may be any of the epitopes described above. In such embodiments, the vaccine composition can be a multivalent vaccine comprising two or more small peptides, each peptide comprising a different linear epitope. The linear epitopes may be derived from (i.e., the epitope sequence is part of) the same subunit or different subunits of the gH/gL-PC. In one aspect, a multivalent vaccine may comprise two or more small peptides, each of which comprise a different linear epitope on a single subunit of the gH/gL-PC. For example, the two or more linear epitopes may be derived from the UL128 subunit of the gH/gL-PC; the two or more linear epitopes may be derived from the gH subunit of the gH/gL-PC, the two or more linear epitopes may be derived from the gL subunit of the gH/gL-PC, the two or more linear epitopes may be derived from the UL130 subunit of the gH/gL-PC; or the two or more linear epitopes may be derived from the UL131A subunit of the gH/gL-PC. In another aspect, a multivalent vaccine may comprise two or more small peptides, wherein the two or more small peptides comprise different linear epitopes derived from two or more different subunits of the gH/gL-PC. For example, the multivalent vaccine may comprise two or more small peptides, each of which comprises one or more linear epitopes, wherein at least one of the linear epitopes on one of the small peptides is derived from the UL128 subunit of the gH/gL-PC and at least one of the linear epitopes on another small peptide is derived from the gH subunit of the gH/gL-PC. Such therapeutic or vaccine compositions can be administered to a subject to treat or prevent CMV infections, particularly HCMV infections.

    [0050] The therapeutic or vaccine compositions described above may also include one or more pharmaceutically acceptable carrier. A pharmaceutically acceptable carrier refers to a pharmaceutically acceptable material, composition, or vehicle that is involved in carrying or transporting a compound of interest from one tissue, organ, or portion of the body to another tissue, organ, or portion of the body. For example, the carrier may be a liquid or solid filler, diluent, excipient, solvent, or encapsulating material, or some combination thereof. Each component of the carrier must be pharmaceutically acceptable in that it must be compatible with the other ingredients of the formulation. It also must be suitable for contact with any tissue, organ, or portion of the body that it may encounter, meaning that it must not carry a risk of toxicity, irritation, allergic response, immunogenicity, or any other complication that excessively outweighs its therapeutic benefits.

    IV. Methods of Treating or Preventing CMV Infections

    [0051] The therapeutic or vaccine compositions described herein may be used to treat or prevent any HCMV infection that infects epithelial cells, endothelial cells, fibroblasts or a combination thereof. Examples of HCMV infections that may be treated or prevented using the methods described herein may include, but is not limited to, congenital HCMV infection, opportunistic HCMV infections in subjects with compromised immune system (e.g., organ and bone marrow transplant recipients, cancer patients and chemotherapy recipients, patients receiving immunosuppressive drugs and HIV-infected patients) and silent HCMV infections in otherwise healthy subjects.

    [0052] Passive administration of immunoglobulins (HCMV-HIG) has shown contrasting results in clinical trials. Vaccine-derived NAbs disclosed herein, once humanized, can be used as passive immunotherapy agents to lower the transmission rate of HCMV from the mother to the fetus in documented cases of HCMV primary infection or reactivation. In this setting, a humanized vaccine-derived NAb can be used either alone or in combination with a human derived NAb.

    [0053] In some embodiments, a method for treating or preventing CMV infection may include administering a therapeutically effective amount of a composition comprising one or more vaccine-derived NAbs, such as those described herein, to a subject.

    [0054] In some embodiments, a method for treating or preventing CMV infection may include administering a therapeutically effective amount of a composition comprising one or more small peptides, such as those described herein, to a subject. The small peptide comprises one or more epitopes recognized by one or more vaccine-derived NAbs.

    [0055] In certain embodiments, a method for treating or preventing CMV infection may include administering one or more doses of a therapeutically effective amount of a composition comprising one or more small peptides to a subject. In certain embodiments, a method for treating or preventing CMV infection may include administering a first dose of a therapeutically effective amount of a composition comprising one or more small peptides to a subject and administering a second dose of a therapeutically effective amount of a composition comprising one or more small peptides to the subject after administration of the first dose. In certain embodiments, the second dose may be administered to the subject about one week, about two weeks, about three weeks, about four weeks, or about five weeks after administration of the first dose. In certain embodiments, at least one of the doses includes administering a therapeutically effective amount of a composition comprising one or more small peptides, at least one of which is SEQ ID NO: 180. In certain embodiments, the first dose includes administering a therapeutically effective amount of a composition comprising one or more small peptides, at least one of which is SEQ ID NO: 180. In certain embodiments, the first dose includes administering a therapeutically effective amount of a composition comprising SEQ ID NO: 180 and the second dose includes administering a therapeutically effective amount of a composition comprising SEQ ID NO: 179. In certain embodiments, the first and second dose includes administering a therapeutically effective amount of a composition comprising SEQ ID NO: 180.

    [0056] Treating or treatment of a condition may refer to preventing the condition, slowing the onset or rate of development of the condition, reducing the risk of developing the condition, preventing or delaying the development of symptoms associated with the condition, reducing or ending symptoms associated with the condition, generating a complete or partial regression of the condition, curing the condition, or some combination thereof. Treatment may also mean a prophylactic or preventative treatment of a condition. Treatment using a vaccine may result in prevention of a disease or condition, but also may refer to the generation of a beneficial immune response that may not necessarily prevent the condition or treatment entirely. The treatment entails administering to a subject a therapeutically effective amount of a vaccine-derived NAb, a composition comprising one or more vaccine-derived NAbs, a small peptide, or a composition comprising one or more small peptides described herein.

    [0057] The term a therapeutically effective amount or an effective amount as used herein refers to an amount of a substance that produces a desired effect. For example, a population of cells may be contacted or an animal may be administered with an effective amount of the pentameric complex to produce a desired NAb. A therapeutically effective amount of a composition comprising an NAb or a vaccine composition comprising a small peptide disclosed herein may be used to produce a therapeutic effect in a subject, such as preventing or treating a target condition, alleviating symptoms associated with the condition, or producing a desired physiological effect. The precise effective amount or therapeutically effective amount is an amount of the composition that will yield the most effective results in terms of efficacy of treatment in a given subject or population of cells. This amount will vary depending upon a variety of factors, including but not limited to the characteristics of the substance (including activity, pharmacokinetics, pharmacodynamics, and bioavailability), the physiological condition of the subject (including age, sex, disease type and stage, general physical condition, responsiveness to a given dosage, and type of medication) or cells, the nature of the pharmaceutically acceptable carrier or carriers in the formulation, and the route of administration. Further, an effective or therapeutically effective amount may vary depending on whether the substance is administered alone or in combination with another compound, drug, therapy or other therapeutic method or modality. One skilled in the clinical and pharmacological arts will be able to determine an effective amount or therapeutically effective amount through routine experimentation, namely by monitoring a cell's or subject's response to administration of a substance and adjusting the dosage accordingly. For additional guidance, see Remington: The Science and Practice of Pharmacy, 21.sup.st Edition, Univ. of Sciences in Philadelphia (USIP), Lippincott Williams & Wilkins, Philadelphia, Pa., 2005, which is hereby incorporated by reference as if fully set forth herein.

    [0058] The therapeutic or vaccine compositions described herein may be administered by any suitable route of administration. A route of administration may refer to any administration pathway known in the art, including but not limited to aerosol, enteral, nasal, ophthalmic, oral, parenteral, rectal, transdermal (e.g., topical cream or ointment, patch), or vaginal. Parenteral refers to a route of administration that is generally associated with injection, including intraorbital, infusion, intraarterial, intracapsular, intracardiac, intradermal, intralingual, intramuscular, intraperitoneal, intrapulmonary, intraspinal, intrasternal, intrathecal, intrauterine, intravenous, subarachnoid, subcapsular, subcutaneous, transmucosal, or transtracheal. In one embodiment, the composition comprising a vaccine-derived NAb or a small peptide is administered by injection.

    V. Methods of Detecting CMV Infection

    [0059] Screening or testing for CMV infections is very important for pregnant women, newborns, and immunocompromised patients. Vaccine-derived NAbs may be used as a diagnostic tool to detect CMV antigens in humans or animals or other biological samples or to detect CMV in cell cultures inoculated with infected samples. In particular, NAbs binding to conserved epitopes, such as 13B5, which binds a linear epitope on UL128 present on all the clinical strains, are capable of detecting HCMV antigens independently of the strain.

    [0060] In certain embodiments, a vaccine-derived NAb may be used to detect CMV in a biological sample obtained from a subject by contacting the sample with the vaccine-derived NAb. The vaccine-derived NAb can be used both as a diagnostic tool and as prognostic tool. Once the subject is tested positive for CMV infection, the subject is administered a treatment for CMV infection and then subjected to additional tests to monitor the progress of the treatment.

    [0061] Also disclosed herein is an assay kit for diagnosing or prognosing CMV infection in a subject including a vaccine-derived NAb and one or more reagents for performing the assay. Optionally, the kit may include an instruction manual for performing the assay, a known CMV antigen as a positive control, and/or a negative control.

    VI. Methods of Identifying Small Peptides with Potential Use as Peptide Vaccines

    [0062] As disclosed above, small peptides binding to linear epitopes on subunits of the pentameric complex are particularly useful for developing peptide vaccine compositions for preventing CMV infections. Vaccine-derived NAbs disclosed herein can be used to identify additional small peptides comprising one or more epitopes on the pentameric complex.

    [0063] In some embodiments, a vaccine-derived NAb is used to bind to a peptide library constructed with one or more subunits of the pentameric complex in an ELISA assay. The peptides having strong binding affinity to the vaccine-derived NAbs are identified. Optionally, these peptides can be further modified by substituting, deleting, or adding one or more amino acid residues. The modified peptides may be tested for binding affinity to the vaccine-derived NAbs to select the peptides having improved binding affinity. Both the peptides without modification and the modified peptides can be used for developing peptide vaccines described above.

    [0064] The following examples are intended to illustrate various embodiments of the invention. As such, the specific embodiments discussed are not to be construed as limitations on the scope of the invention. It will be apparent to one skilled in the art that various equivalents, changes, and modifications may be made without departing from the scope of invention, and it is understood that such equivalent embodiments are to be included herein. Further, all references cited in the disclosure are hereby incorporated by reference in their entireties, as if fully set forth herein.

    EXAMPLES

    Materials and Methods

    [0065] Cells.

    [0066] ARPE-19 and MRC-5 (ATCC) were maintained in Dulbecco's minimal essential medium (DMEM, Corning, Corning, N.Y., USA) or minimal essential medium (MEM, Corning), respectively, supplemented with 10% fetal bovine serum (FBS, HyClone, Logan, Utah, USA). HUVEC (ATCC) were grown in VascuLife Basal Medium added with VascuLife EnGS LifeFactors (Lifeline Cell Technology, Frederick, Md., USA). BHK-21 cells (ATCC) were maintained in MEM with the addition of 10% FBS, 1 mM sodium pyruvate and 0.1 mM non-essential amino acids (Life Technologies, Grand Island, N.Y., USA).

    [0067] Isolation and Culture of CTB.

    [0068] With written informed consent, term (>37 weeks gestation) placentae from HIV-1 seronegative and Hepatitis B uninfected women (>18 years of age) were obtained immediately following elective caesarian section without labor from Emory Midtown Hospital in Atlanta, Ga. Approval of the study was granted by the Emory University Institutional Review Board (IRB). Written informed consent was obtained from donors, and samples were de-identified prior to handling by laboratory personnel. In order to isolate CTB, membrane-free villous was dissected from the placenta, as previously described (53-55). The tissue was thoroughly washed and mechanically dispersed in Hank's balanced salt solution (HBSS) to minimize peripheral blood contamination. Minced tissue fragments were then subjected to three sequential enzymatic digestions in a solution containing 0.25% trypsin (Mediatech Inc., Manassas, Va., USA), 0.2% DNase I (Roche Diagnostics, Mannheim, Germany), 25 mM HEPES, 2 mM CaCl.sub.2), and 0.8 mM MgSO.sub.4 in HBSS at 37 C. Following each digestion, the undigested tissue was removed by passage through a gauze and 100 m cell strainer (BD Biosciences, Franklin Lakes, N.J., USA) and washed with PBS. Supernatants from the second and third digestions were collected and the resulting cell pellets were resuspended in 1:1 DMEM/F12 supplemented with 10% FBS, 1 mM L-glutamine, and 1% pen/strep (Sigma-Aldrich, St. Louis, Mo., USA). The CTB were isolated on a discontinuous gradient of Percoll (GE Healthcare, Uppsala, Sweden) (50%/45%/35%/30%) by centrifugation. Cells migrating to the 35%/45% Percoll interface were recovered and immunopurified by negative selection with simultaneous treatment with anti-CD9 (to exclude EnC, FB, platelets, smooth muscle, extravillous trophoblast cells, B cells and monocytes) and anti-CD45RA (to exclude leucocytes) antibodies and magnetic beads (Miltenyi Biotech, Bergisch Gladbach, Germany) (56, 57). The purity of the CTB population was assessed by cytokeratin-7 staining and was on average >97%. Vimentin staining to quantify contamination from mesenchymal cells was on average <3% (56-58).

    [0069] Antibodies.

    [0070] Cytogam (CMV-HIG, 50 mg/ml) was obtained from the manufacturer (Baxter-Healthcare Corp., Irvine, Calif., USA). The isolation of anti-gH Ab AP86, anti-pp65 Ab 28-103, and anti-HCMV IE1 Ab (p63-27) has been described (59-61).

    [0071] Viruses. MVA expressing all five PC subunits (MVA-PC), single PC subunits or subunit combinations were reconstituted from MVA-BAC as previously described (36, 62) and propagated on BHK-21 (63). For preparing MVA virus stocks, MVA was harvested from infected BHK-21, purified by 36% sucrose density ultracentrifugation, and resuspended in 1 mM Tris-HCl (pH 9) (36, 62, 64). MVA stocks were maintained at 80 C. Purified MVA was titrated on BHK-21 by standard procedure. HCMV strain TB40/E-GFP (TB40/E) was kindly provided by Christian Sinzger (Ulm University, Germany) (65). HCMV strain TR-GFP (TR) was a gift from Jay Nelson (Oregon Health & Sciences University, Portland, Oreg., USA). HCMV strains Davis, Towne and AD169 were kindly provided by John Zaia (Beckman Research Institute of the City of Hope, Duarte, Calif., USA) (64). Generation of HCMV stocks was performed as previously described (36). Briefly, ARPE-19 were infected with HCMV and re-seeded until 70-80% of the cells were GFP-positive. Virus particles were concentrated from clarified medium by ultracentrifugation (70,000g for one hour) over 20% sucrose (w/v) in Tris-buffered saline (0.1 M Tris-CI, pH 7.4, 0.1 M NaCl). Concentrated virus was resuspended in Tris-buffered saline and stored at 80 C. Virus titration was performed by adding serial dilution of the virus to ARPE-19, MRC-5, HUVEC and CTB, and by immunostaining for immediate-early-1 protein (IE-1) after 48 hours incubation. HCMV titer on CTB was on average three times lower than the one measured on ARPE-19.

    [0072] Mice and Immunizations.

    [0073] The Institutional Animal Care and Use Committee (IACUC) of the Beckman Research Institute of City of Hope approved protocol #98004 assigned for this study. All study procedures were carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals and Public Health Service Policy on the Human Care and Use of laboratory Animals. Methods of euthanasia followed Report of the AVMA Panel on Euthanasia (avma.org/kb/policies/documents/euthanasia.pdf). BALB/cJ mice (Jackson Laboratory, Bar Harbor, Me., USA) were vaccinated with MVA-PC as previously described (36) and boosted four days before the spleen was removed for hybridoma production.

    [0074] Hybridoma Derivation.

    [0075] Hybridomas were derived by conventional procedure (66). Briefly, myeloma partner cells (P3X63Ag8.653, ATCC) were maintained in RPMI-1640 (Corning) supplemented with 10% FBS. Splenocytes and myeloma cells were counted, and fusion was performed at a 1:5 ratio by adding 1 ml PEG 1500 (Sigma-Aldrich). After centrifugation, fused cells were resuspended in RPMI-1640 supplemented with 15% FBS, 10% UltraCruz Hybridoma Cloning Supplement (HCS, Santa Cruz Biotechnology, Santa Cruz, Calif., USA), HAT media supplement (Sigma-Aldrich) at a concentration of 510.sup.5 splenocytes/ml. Cells were seeded in 96 well plates and incubated in a 5% CO.sub.2, 37 C. incubator. Selected hybridoma clones were grown in RPMI-1640 supplemented with 15% FBS and 10% HCS. Each clone underwent 2 rounds of single cell subcloning to ensure the clonality of the antibody (66). Collected hybridoma supernatant was added with 20 mM sodium phosphate buffer (pH 7.0) and NAbs were purified using a HiTrap Protein G HP 5 ml column (GE Healthcare) according to the manufacturer's instructions. Ab concentration was verified with Bradford-Coomassie brilliant blue dye method using a bovine gamma globulin standard (Thermo Scientific/Pierce, Rockford, Ill., USA).

    [0076] Neutralization Assays.

    [0077] Cells were seeded at 1.510.sup.4 cells/well (ARPE-19, HUVEC and MRC-5) or 1.510.sup.5 cells/well (CTB) in a clear bottom 96-well plate (Corning). Around 24 hours later the medium in every plate was replaced with 50 l per well of fresh growth medium. Naturalization assays were performed as previously described (36). Briefly, serial two-fold dilutions of the purified NAbs were prepared in complete growth medium in a final volume of 75 l. NAb dilutions were mixed with 75 l of complete growth medium containing approximately 9000 PFU of HCMV TB40/E or TR and incubated for 2 h at 37 C. The mixture was transferred to the cells (50 l each, duplicate wells). After 48 hours, cells were fixed and IE-1 immunostaining performed as previously described (36). NAb concentration inhibiting 50% of the virus infectivity (IC50) was calculated as previously described (36).

    [0078] Antibody Purification.

    [0079] Hybridoma clones of interest were grown in RPMI-1640 supplemented with 15% FBS and 10% HCS. Each clone underwent 2 rounds of single cell cloning to ensure the monoclonality of the antibody. After cloning, the hybridomas were grown in RPMI-1640 supplemented with 15% FBS. Periodically, half of the medium was collected and replaced with fresh one. When the collected hybridoma supernatant was about 500 ml, 200 ml of 20 mM sodium phosphate buffer (pH 7.0) were added and the antibody was purified using a HiTrap Protein G HP 5 ml column (GE Healthcare, Piscataway, N.J., USA) according to the manufacturer's instructions. Concentration of the antibody was verified with Bradford-Coomassie brilliant blue dye method using a bovine gamma globulin standard (both Thermo Scientific/Pierce, Rockford, Ill., USA).

    [0080] NAb Binding Specificity.

    [0081] NAb subunit specificity was evaluated by staining BHK-21 cells infected with different MVA recombinants. One or more vectors were used to co-infect BHK-21 at an MOI of 5. The combinations analyzed were: UL128, UL130, UL131A, UL128/130, UL128/131A, UL130/131, UL128/130/131A, gH, gH/gL, gH/gL/UL128, gH/gL/UL130, gH/gL/UL131A, gH/gL/UL128/130, gH/gL/UL128/131A, gH/gL/UL130/131A and gH/gL/UL128/130/131A. Four hours post infection cells were fixed and permeabilized using Cytofix/Cytoperm solution (BD Biosciences). NAbs (1 mg/ml) were diluted 1:500 in perm/wash buffer (BD) and added to the cells for 1 hour at 4 C. After washing with perm/wash buffer, Alexa Fluor 647 Goat Anti-Mouse IgG (Life Technologies) was added at a dilution of 1:2,000. Cells were washed again and resuspended in PBS/0.1% BSA. Fifteen thousand events were collected using the Gallios Flow Cytometer (Beckman Coulter, Miami, Fla., USA) and analyzed with FlowJo Software (Tree Star, Ashland, Oreg., USA). Uninfected cells and cells infected with MVA-Venus were used as controls. GFP expression was analyzed for confirming MVA infection since all the constructs contain a GFP expression cassette (36, 62).

    [0082] Cell-to-Cell Spread Inhibition Assay.

    [0083] NAbs ability to inhibit cell-to-cell spread and/or syncytia formation was evaluated on EpC using TB40/E and TR. ARPE-19 cells were seeded on a black 96-well plate (Costar) and infected 24 hours later with HCMV TB40/E or TR (MOI of 1 as titrated on ARPE-19). After incubation for 24 hours, cells were extensively washed with PBS and two-fold serial dilutions of each NAb were added to the wells in a total volume of 200 l. After 8 days incubation, the plates were imaged with a Zeiss Axiovert fluorescence microscope (Carl Zeiss, Jena, Germany) and cellular GFP was quantified using ImagePro Premier Software (Media Cybernetics, Silver Spring, Md., USA). The percent of spread inhibition (IC) for each dilution was calculated as: IC=[1(fluorescence in infected wells incubated with NAb)/(fluorescence in infected wells without NAb)]100. 50% cell-to-cell spread inhibition (IC50) was calculated by determining the linear slope of the graph plotting IC versus NAb dilution by using the next higher and lower IC values that were closest to 50%.

    [0084] Antibody Binding Affinity.

    [0085] Antibody binding affinity was determined as described (67). Briefly, 10 mg of purified NAbs were biotinylated using EZ-Link NHS-PEG4-Biotin Biotinylation Kit (Thermo Scientific/Pierce) following manufacturer's instructions. BHK-21 cells were infected with MVA-PC at an MOI of 5. After an incubation of 4 hours at 37 C., the cells were dispensed at a concentration of 110.sup.5 cells/well in a 96-well V-bottom plate, followed by 2 hours incubation at 4 C. with two-fold serial dilutions of the biotinylated NAb in PBS/0.1% BSA. Dilutions ranged from 500 g/ml to 0.1 ng/ml. Cells were washed twice with PBS/0.1% BSA and incubated for 1 hour at 4 C. in the presence of streptavidin-DyLight 650 (Thermo Scientific) diluted 1:500 in PBS/0.1% BSA. After washing twice, cells were fixed with 4% paraformaldehyde. Fifteen thousand events were acquired with the Gallios Flow Cytometer and analyzed with FlowJo Software. The equilibrium binding constant (Kd) was derived by plotting fluorescence as a function of the logarithm of NAb concentration to obtain a sigmoidal curve analyzed with the 4 Parameter Logistic (4PL) nonlinear regression model (GraphPad Prism 6 Software, San Diego, Calif., USA).

    [0086] Competition Assay.

    [0087] NAb competition was evaluated as follows. BHK-21 cells were infected with MVA-PC at an MOI of 5 and 4 hours later treated with Cytofix/Cytoperm. Around 110.sup.5 cells were incubated for 2 hours with 20 to 100-fold excess unlabeled competitor NAb (from 100 to 200 g/ml). After washing with perm/wash buffer cells were incubated for 2 hours in the presence of 1 to 5 g/ml biotinilated NAbs. For every NAb, cells in which the unlabelled competitor was not added to the biotinilated NAbs were used to determine maximum binding. Cells were washed once with perm/wash buffer and incubated for 1 hour with streptavidin-DyLight 650 diluted 1:500. After a final washing step, cells were resuspended in PBS/0.1% BSA, acquired with Gallios Flow Cytometer and analyzed with FlowJo Software. For every antibody pair, the percentage of inhibition was calculated as: 100[(% fluorescent cells with competitor NAb/% fluorescent cells without competitor NAb)100]. The complete prevention of binding of a biotinilated NAb by its unlabelled counterpart was used as a validation of the assay.

    [0088] NAb Variable Heavy and Light Chain Sequence Characterization.

    [0089] Total RNA was extracted from hybridomas using the SV total RNA isolation system (Promega, Madison, Wis., USA). cDNA was generated by random hexamers (Qiagen GmbH, Hilden, Germany) and Superscript III reverse transcriptase (Life Technologies) following the manufacturer's instruction. The kappa variable genes were characterized by a 5RACE PCR in which the cDNA was tailed with poly dGTP by terminal transferase (New England BioLabs, Ipswich, Mass., USA). A 3 reverse gene-specific primer located in the kappa constant region near the variable region (TGGATGGTGGGAAGATGGATACAGT) (SEQ ID NO: 183) was adopted together with poly dCTP to amplify the kappa variable genes. For the gamma variable genes, a protocol from Fields et al. (68) was followed. VH and VL genes were amplified by Phusion high-fidelity DNA polymerase (Thermo Scientific) and cloned into pCR4Blunt-TOPO vector (Life Technologies) following the manufacturer's instruction. Three clones derived from each VH/VL genes were sequenced.

    [0090] Immunoblot.

    [0091] Immunoblot to determine NAbs binding to denaturated gH was performed using lysates from cells infected with a gH-expressing adenoviral vector (Ad-gH) as previously described (36). Anti-gH Ab AP86 (59), 18F10, 21E9, 62-11, 62-100 and 2-80 were employed at a dilution of 10 g/ml. Anti-MEK1/2 (Cell Signaling Technology, Danvers, Mass., USA) was diluted 1:1000. Immunoblot to evaluate 18F10 and AP86 binding to lysates from cells infected with different HCMV strains was performed as described above with the difference that lysates consisted in 2.510.sup.5 MRC-5 infected for 4 days with an MOI of 1 of HCMV strain Davis, Towne, AD169, TB40/E or TR. Anti-pp65 was used to show HCMV infection in all the samples independently from the strain used.

    Example 1. Isolation of Durable HCMV Specific NAbs from MVA-gH/gL-PC Vaccinated Mice

    [0092] It was previously demonstrated that mice vaccinated three times by four week interval with MVA-gH/gL-PC develop high titer EpC specific NAb responses that remained stable over at least one year (36). Remarkably, only two vaccinations with MVA-gH/gL-PC appeared to be sufficient to induce maximum high titer EpC NAb titers. In order to characterize in detail the specific activity of the antibody response induced by MVA-gH/gL-PC, a panel of monoclonal NAbs was isolated after induction of anamnestic responses by a fourth dose of vaccination forty-eight to seventy-two weeks after initial immunization. NAb titers after the fourth vaccination could be boosted to levels that were observed after the second or third boost with MVA-gH/gL-PC at week four and eight (FIG. 1), suggesting that vector immunity had only little influence on the ability of MVA-gH/gL-PC to boost NAbs to gH/gL-PC. Splenocytes were immortalized by conventional hybridoma technology (66) and hybridoma supernatants were screened directly by ARPE-19 EpC based microneutralization using HCMV strain TB40/E for infection. Ten NAbs (1B2, 54E11, 21F6, 12E2, 13B5, 18F10, 21E9, 62-11, 62-100 and 2-80) that blocked HCMV infection of ARPE-19 were identified. NAbs were subcloned, purified by affinity chromatography, and characterized as described below.

    Example 2. MVA-PC Vaccine-Derived NAbs Recognize Epitopes of the PC and gH

    [0093] PC-specific NAbs isolated from chronically infected HCMV.sup.+ individuals predominantly recognize conformational antigenic sites formed by UL130/131A and UL128/130/131A (32, 33). Only one human NAb has been published that recognizes an epitope within the UL128 subunit (32). A panel of NAbs from mice immunized with the MVA-PC vaccine was isolated by conventional hybridoma technology combined with screening for neutralization against TB40/E on ARPE-19 EpC. In order to determine the antigen specificity of the vaccine-derived NAbs, intracellular flow cytometry (FC) staining of permeabilized BHK-21 cells infected with MVA expressing single subunits or combinations of two or more subunits of the PC was evaluated. Consistent with human NAbs, four vaccine-derived PC-specific NAbs that recognized quaternary epitopes formed by UL130/UL131A or UL128/130/131A, and one NAb (13B5) with UL128 specificity were identified (FIG. 2 and Table 2). Staining with 1B2 and 12E2 NAbs was observed with UL128/130/131A or all five PC subunits. Expression of single subunits or any PC subunit combination with only one or two of the UL128/130/131A subunits did not result in binding of 1B2 and 12E2. In contrast, NAbs 54E11 and 21F6 showed binding with UL130/131A, the three UL128/130/131A subunits, or all five PC subunits. Single subunits or PC subunit combinations lacking UL130/131A failed to enable binding of 54E11 and 21F6. NAb 13B5 showed binding with UL128 alone or combined with other PC subunits, whereas binding of 13B5 was not observed in the absence of UL128. Based on the vaccine's ability to elicit both EpC/EnC and FB specific NAbs (36), NAbs with gH specificity were also identified. Staining by these NAbs was confirmed with gH alone, in combination with gL, or together with all other four PC subunits. Binding of these antibodies was not observed when gH was missing (FIG. 2 and Table 2). Hence, MVA-PC elicits PC- and gH-specific NAbs that have antigen recognition patterns similar to human NAbs isolated from chronically infected HCMV.sup.+ individuals.

    TABLE-US-00003 TABLE 2 NAb subunits recognition UL128 UL128 UL128 UL130 UL130 gH/gL UL128 UL130 UL131 UL130 UL131 UL131 UL131 gH gH/gL UL128 1B2 + 54E11 + + 21F6 + + 12E2 + 13B5 + + + + + 18F10 + + + 21E9 + + + 62-11 + + + 62-100 + + + 2-80 + + + 4A3 + 6G2 + + + 10G6 + + + 13B1 + + + 25H10 + + + gH/gL gH/gL gH/gL gH/gL UL128 gH/gL gH/gL UL128 UL128 UL130 UL130 UL130 UL131 UL130 UL131 UL131 UL131 1B2 + 54E11 + + 21F6 + + 12E2 + 13B5 + + + 18F10 + + + + + + 21E9 + + + + + + 62-11 + + + + + + 62-100 + + + + + + 2-80 + + + + + + 4A3 + 6G2 + + + + + + 10G6 + + + + + + 13B1 + + + + + + 25H10 + + + + + +

    Example 3. MVA-PC-Infected Cells Present PC- and gH-Specific Neutralizing Epitopes at the Cell Surface

    [0094] Although it was reported that the five PC subunits expressed from MVA-PC assemble with each other intracellularly, it was unclear whether the complexes were transported to the cell surface and presented PC-specific neutralizing epitopes. The vaccine-derived NAbs for cell surface FC staining of live non-permeabilized BHK-21 cells infected with MVA-PC was compared to MVA vaccine vectors expressing single subunits or different subunit subset combinations of the PC. When compared to intracellular staining (FIG. 2A), different cell surface recognition patterns with the vaccine-derived PC-specific NAbs were observed (FIG. 2B). Intensive cell surface staining by the PC-specific NAbs was confirmed with all five PC subunits (MVA-PC), whereas no or only minimal cell surface staining by NAbs was observed with single subunits or subunit subsets of the complex (FIG. 2B). As confirmed for intracellular staining (FIG. 2A), intense cell surface staining by all gH-specific NAbs with gH alone, together with gL, or combined with all other four PC subunits was observed. In contrast to intracellular staining, cell surface staining by the anti-gH NAbs was more intense with all five PC subunits when compared to gH alone or only gH/gL. In addition, compared to gH single expression, stronger binding of the anti-gH NAbs was observed with gH/gL (FIG. 2B). These results demonstrate that the five PC subunits expressed from MVA-PC efficiently assemble with one another and present conformational neutralizing epitopes of the UL128/130/131A subunits and gH at the cell surface.

    Example 4. Vaccine-Derived PC-Specific NAbs are More Potent than gH-Specific NAb in Neutralizing HCMV

    [0095] In order to determine whether the vaccine-derived NAbs confer similar potency than previously described human NAbs (32) to prevent host cell entry, the inhibitory antibody concentration (IC50) that blocked 50% HCMV infection of ARPE-19 EpC, HUVEC EnC, or MRC-5 FB was evaluated using a standard microneutralization assay. Neutralization against HCMV strains TB40/E and TR was tested to evaluate whether sequence variation in the gH component influences the potency of the NAbs to neutralize HCMV (36, 69). Neutralization potency of HCMV hyperimmune globulin (CMV-HIG) was evaluated as a reference. All PC-specific NAbs blocked TB40/E or TR infection of ARPE-19 cells and HUVEC with potency that significantly exceeded (on average over 200-fold) that of anti-gH NAbs or CMV-HIG (FIG. 3 and Table 3). In contrast, most of the gH-specific NAbs inhibited HCMV infection of all investigated cell types with comparable potency, albeit with much lower potency than the PC-specific NAbs blocked ARPE-19/HUVEC entry. Neutralization potency of the anti-gH NAbs was similar to that determined for CMV-HIG. Neutralization with CMV-HIG on MRC-5 FB at the highest investigated concentration (25 g/ml) was not observed, which is consistent with observations obtained by others (37, 70). One gH-specific NAb (18F10) demonstrated inhibition potency comparable to the other anti-gH NAbs when measured on ARPE-19 cells and HUVEC, but it did not show ability to block HCMV infection of FB. The IC50 values of the vaccine-induced PC and gH-specific NAbs isolated were similar to published values determined for NAbs isolated from HCMV.sup.+ individuals (Table 3). In contrast to the other anti-gH NAbs, two of the gH-specific NAbs (62-11, 62-100) blocked TR infection less potently than infection of TB40/E (FIG. 3), suggesting that anti-gH NAbs 62-11 and 62-100 may target epitopes that are antigenically distinct in TB40/E and TR. These results show that the vaccine-derived PC- and gH-specific NAbs have neutralization potency comparable to that observed for NAbs from chronically HCMV infected individuals.

    TABLE-US-00004 TABLE 3 Potency of NAb in preventing HCMV TB40/E and TR infection of different cell types and epithelial cell-to-cell spread and their binding affinity to the PC TB40/E TR IC50 (g/ml) IC50 (g/ml) EC50 (M) Specificity/ IC50 (ng/ml) ARPE-19 IC50 (ng/ml) ARPE-19 Binding NAb ARPE-19 HUVEC MRC-5 CTB Spread ARPE-19 HUVEC MRC-5 Spread affinity UL 1B2 0.6 0.5 >25000 12.6 1 0.3 0.7 >25000 1.4 3.2E10 54E11 3.4 4.6 >25000 24.9 17 3.4 5.9 >25000 18 5.1E10 21F6 2.6 4.0 >25000 30.7 18 3.5 5.9 >25000 19 6.2E10 12E2 3.7 6.0 >25000 72.1 15 3.1 4.2 >25000 17 1.1E09 13B5 15 12 >25000 99.8 22 19.9 7.7 >25000 21 6.8E10 4A3 80.15 46.42 >25000 44.6 10.15 >25000 gH 18F10 763 1490 >25000 8800 95 885 675 >25000 78 6.5E09 21E9 1409 2374 5780 42362 157 926 2916 4141 262 1.8E08 62-11 185 102 182 2760 87 641 830 3346 395 1.7E09 62-100 270 156 293 3623 103 2126 1031 1983 337 3.3E09 2-80 1433 1405 1597 >50000 >400 2125 2540 1717 398 2.8E09 6G2 689 542 1255 6800 10G6 326 481 706 6315 13B1 3022 6993 25H10 188 602 1076 6235 CMV-HIG 1086 1124 >25000 5478 271 991 2413 >25000 299 ND gH AP86 1005 ND >25000 ND ND ND ND ND ND ND In ARPE-19, HUVEC and MRC-5 neutralization assays the maximum Ab concentration tested was 25 g/ml. In CTB neutralization assay the maximum Ab concentration tested was 50 g/ml. In cell-to-cell spread assay the maximum Ab concentration was 400 g/ml. ND = not done.

    Example 5. Vaccine-Derived NAbs Recognize Conformational Epitopes

    [0096] Most of the potent NAbs of HCMV.sup.+ individuals that block HCMV infection of EpCs target conformational epitopes constituted by two or more subunits of gH/gL-PC, but mainly epitopes formed by the UL128-UL131A subunits. In order to determine similar gH/gL-PC subunit specificity for the vaccine-derived NAbs, intracellular antibody recognition of single subunits, different combination of two or more subunits, or all five subunits of gH/gL-PC expressed from MVA was performed. Baby hamster kidney (BHK) cells that allow efficient MVA replication were infected with the different MVA constructs, fixed and permeabilized, and analyzed by flow cytometry (FC) for staining by the isolated NAbs. All potent EpC/EnC neutralizers recognized antigenic sites that required co-expression of more than one subunit of UL128-UL131A, except one antibody (13B5) that showed specificity for UL128 (FIG. 2 and Table 2). NAbs 1B2 and 12E2 showed minimal antigen recognition for UL128/UL130/UL131A. These antibodies stained BHK cells infected with MVA-gH/gL-PC or MVA co-expressing UL128, UL130, and UL131A, though single subunits or any other subunit combination of gH/gL-PC were undetected (FIGS. 1 and 4). EpC/EnC neutralizer 54E11 and 21F6 demonstrated minimal antigen specificity for UL130/UL131A. These antibodies recognized co-expression of all five gH/gL-PC subunits, UL128/UL130/UL131A, or UL130/UL131A, whereas cells infected with MVA expressing single subunits or other gH/gL-PC subunit combinations remained unstained (FIG. 2 and Table 2). Antibody 13B5 with specificity for UL128 recognized UL128 single expression or UL128 expression together with any other combination of gH/gLPC subunits, but did not stain cells infected with MVA expressing only UL130, UL131A, or gH/gL (FIG. 2 and Table 2). All the NAbs that blocked EpCs/EnCs and FBs HCMV infection (21E9, 62-11, 62-100, 2-80, 13B1, 6G2, 10G6 and 25H10) showed specificity for gH, gH/gL and all five gH/gL-PC subunits expressed from MVA, whereas no staining was observed when any combination of the UL128 to UL131A was expressed without gH (FIG. 2 and Table 2). These antigen recognition patterns are strikingly similar to that of natural NAbs to gH/gL-PC. Finally, despite unable to neutralize HCMV entry of FBs, NAb 18F10 showed a minimal binding specificity for gH, and also bound when cells were infected with MVA-gH/gL-PC. This result shows for the first time the existence of an NAb specific for gH but neutralizing only entry into EpCs/EnCs.

    Example 6. PC-Specific NAbs Limit HCMV Spread in EpC More Potently than Anti-gH NAbs

    [0097] HCMV replication is highly cell-associated and the virus predominantly spreads from cell to cell (71, 72). Inhibition of HCMV cell-to-cell spread and/or syncytia formation besides neutralization of cell-free HCMV entry may be an important antibody function to prevent dissemination. To test whether the MVA-PC vaccine-derived NAbs can block spread of HCMV, the potency to inhibit HCMV TB40/E or TR cell-to-cell spread and/or syncytia formation in ARPE-19 EpC was evaluated. As shown in FIG. 3 for the neutralization potency, significant differences in the potency of the PC- and gH-specific NAbs to prevent HCMV cell-to-cell spread were found (FIG. 4 and Table 3). All NAbs specific for PC subunits blocked TB40/E and TR spread in ARPE-19 cells with potency that significantly exceeded those of the anti-gH NAbs or CMV-HIG. In contrast, the anti-gH NAbs demonstrated only very low spread inhibition potency, or were even unable to prevent HCMV spread in ARPE-19 cells at a cut-off concentration of 400 g/ml. Most of the anti-gH NAbs demonstrated spread inhibition potency that was comparable to or only slightly higher than those of CMV-HIG. The ability of individual NAbs to block viral spread in ARPE-19 EpC was similar to their property to neutralize HCMV infection of these cells, with the variation that higher antibody amounts (1000-fold) were required to interfere with HCMV cell-to-cell spread than with HCMV entry (Table 3). Consistent with the neutralization by the anti-gH NAbs, less potent spread inhibition of HCMV TR than of TB40/E by two of the anti-gH NAbs (62-11 and 62-100) was observed, suggesting that sequence variation in the gH protein influences the ability of the NAb to prevent HCMV spread. FIG. 5 shows the effect of potent PC-specific NAb 1 B2 and anti-gH NAbs 21E9 and 62-11 compared to untreated controls to interfere with TB40/E and TR spread and/or syncytia formation in ARPE-19 cells. These results indicate that PC-specific NAbs are more potent than anti-gH NAbs to prevent HCMV spread in EpC.

    Example 7. Neutralization Potency of Vaccine-Induced NAbs May Correlate with Antibody Affinity

    [0098] It has been shown that a reduced risk for HCMV transmission to the fetus is associated with high affinity, highly neutralizing antibody responses (42, 73). Consequently, the affinity of the vaccine-induced NAbs to bind cell surface PC on MVA-PC infected BHK-21 cells was evaluated and whether the antibody affinity correlates with potency to neutralize HCMV was investigated. FIG. 6A shows a positive correlation between antibody affinity and neutralization potency taking into account all isolated NAbs (r=0.743, p=0.014). Consistent with the neutralization potency, higher binding affinity was observed with the PC-specific NAbs than with the anti-gH NAbs (FIG. 6A and Table 3). In addition, the highest affinity was observed with 1B2, which is the most potent NAb to block EpC/EnC entry identified (Table 3). However, despite a significant difference in neutralization potency between PC- and gH-specific NAbs (p=0.0167, FIG. 6C), the difference in binding affinity of the PC-specific NAbs and anti-gH NAbs was not significant (p>0.05, FIG. 6B). The EC50 values determined for the vaccine-derived NAbs were in the range of published values for HCMV NAbs observed by others (34). These findings provide evidence that the neutralization potency of vaccine-derived PC and gH-specific NAbs correlates with their ability to bind the PC.

    Example 8. Vaccine-Derived PC- and gH-Specific NAbs Recognize Different Antigenic Target Sites

    [0099] It has been reported that human NAbs recognizing the PC target at least seven distinct antigenic sites (32, 33). In order to determine whether the vaccine-induced NAbs bind overlapping or non-overlapping target sites of the PC, the ability to cross-compete for binding to PC expressed in MVA-PC infected BHK-21 cells was evaluated. As shown in Table 4, binding competition was observed between the two PC-specific NAbs 1B2 and 12E2, indicating that 1B2 and 12E2 recognize overlapping target sites formed by UL128/130/131A. The same result was obtained with the PC-specific NAbs 54E11 and 21F6, demonstrating that these NAbs target similar binding sites constituted by UL130/131A. UL128/130/131A-specific NAbs and UL130/131A-specific NAbs did not compete for binding with each other or with the anti-UL128 NAb 13B5. Binding competitions between the anti-gH NAbs 62-11 and 62-100 and between anti-gH NAbs 21 E9 and 2-80 were observed. Hence, 62-11 and 62-100 or 21 E9 and 2-80 target similar antigenic sites on gH. In addition, 62-11 and 62-100 demonstrated ability to partially compete for binding with 21E9 and 2-80, suggesting that 62-11 and 62-100 share partially overlapping binding sites on gH with 21E9 and 2-80. In contrast to all other isolated gH NAbs, NAb 18F10 was not able to compete with any of the gH-specific NAbs. Overall three antigenic sites on the UL128/130/131A subunits and three antigenic sites on gH were identified (Table 4). The VH and VL genes from each NAb was sequenced as follows: mRNA was isolated from hybridoma cells and reverse transcribed into cDNA. Next, VH and VL regions were amplified by PCR, gel purified, ligated into a standard cloning vector and clones selected from LB plates. Multiple clones were selected for sequencing and the final sequence was confirmed by at least three identical sequencing results. Complementarity determining regions (CDRs) sequencing revealed that EpC/EnC NAbs 54E11 and 21F6, both binding to the same antigenic site on UL130/131A, are encoded by the same sequence (Table 5).

    [0100] Although some of the NAbs competed for the same antigenic site, unique variable heavy (V.sub.H) and light (V.sub.L) chain sequences for most of the NAbs were determined (Table 5). Despite sharing the same antigenic binding site on UL128/130/131A, NAbs 1B2 and 12E2 have completely different CDR sequences. Of the gH NAbs competing for the same antigenic site, 62-11 and 62-100 share similar, but not identical, CDR sequences. Identical V.sub.H and V.sub.L sequences were only observed for the two UL130/131A-specific NAbs 21F6 and 54E11. It was confirmed that 54E11 and 21F6 have different isotypes (Table 5), suggesting that these NAbs were derived from the same centroblast B cell after class switch recombination (74). A very limited number of point mutations in V.sub.H and V.sub.L sequences of the NAbs when compared to germ line sequences were identified (Table 5), suggesting that, at least in immunized mice, potent HCMV NAbs are already encoded by the germline with very low influence of affinity maturation. This data indicate that vaccine-derived NAbs recognize predominantly distinct antigenic target sites on the UL128/130/131A subunits or gH.

    TABLE-US-00005 TABLE 4 NAb competition for binding to the PC Unlabelled Binding Inhibition (%) Biotinilated Abs Antigenic Ab 1B2 54E11 21F6 12E2 13B5 18F10 21E9 62-11 62-100 2-80 AP86 site* UL 1B2 100 0 0 100 0 0 ND ND ND ND ND 1 UL NAb 54E11 0 100 100 0 0 0 ND ND ND ND ND 2 UL 21F6 0 100 100 0 0 0 ND ND ND ND ND 2 UL 12E2 100 0 0 100 0 0 ND ND ND ND ND 1 UL 13B5 0 0 0 0 100 0 ND ND ND ND ND 3 UL gH 18F10 0 0 0 0 0 100 0 0 0 0 100 1 gH NAb 21E9 ND ND ND ND ND 0 100 32 28 100 0 2 gH 62-11 ND ND ND ND ND 0 46 100 100 54 0 3 gH 62-100 ND ND ND ND ND 0 51 100 100 57 0 3 gH 2-80 ND ND ND ND ND 0 100 43 40 100 0 2 gH AP86 ND ND ND ND ND 100 0 0 0 0 100 1 gH ND = not done; *antigenic site numbers are arbitrarily assigned based on cross-competition.

    TABLE-US-00006 TABLE 5 NAb binding affinity and sequence analysis Isotype (class Anti- and subclass, VL/VH CDR3 sequences VL % VH %* body Specificity light chain type) VL CDR3 VH CDR3 aa Mut aa % mut aa Mut aa % mut 1B2 UL128/130/131 IgG1, k QQSNRWPWT ARGWLLPVFAY 107 5 4.7 118 4 3.4 54E11 UL130/131 IgG1, k QQYSKLPYT AREHYYGINPLLGC 107 1 0.9 121 1 0.8 21F6 UL130/131 IgG2a, k QQYSKLPYT AREHYYGINPLLGC 107 1 0.9 121 1 0.8 12E2 UL128/130/131 IgG2a, k QHSRELPWT VRPKRDFQYLYAMDY 111 2 1.8 122 6 4.9 13B5 UL128 IgG2a, k QNGHTFPPT VRSLYDYDEGYYFDS 107 4 3.7 123 16 13.0 18F10 gH IgG1, k SQSTHVPYT ARTGYFDV 112 6 5.4 116 9 7.8 21E9 gH IgG2a, k QQDYSSPWT ARKGYYGSSGYFDY 107 1 0.9 121 2 1.7 62-11 gH IgG1, k QQYSKLPYT SNGYSSFAY 107 2 1.9 116 7 6.0 62-100 gH IgG1, k QQSNSWPLT SNGYSSFAY 107 2 1.9 116 7 6.0 2-80 gH IgG2a, k QQSNEDPLT ARRGDGLYSMDY 111 2 1.8 119 2 1.7 *Mutations brought in by the VH primers (68) were excluded.

    Example 9. NAb 18F10 Binds an Immunodominant Linear Epitope on gH

    [0101] Since all identified gH-specific NAbs showed binding to gH by intracellular and cell surface staining even in the absence of gL (FIG. 2 and Table 2), whether the anti-gH NAbs bind linear or conformational epitopes on the gH protein was investigated. Therefore, the NAb was tested to recognize gH expressed from adenoviral vectors (AdV) using immunoblot analysis under denaturing conditions. As a control, the well-characterized anti-gH antibody AP86 was used, which is known to bind the linear immunodominant neutralizing epitope of gH (34-LDPHAFHLLL-43) (SEQ ID NO: 184) (59). Compared to AP86, only anti-gH NAb 18F10 efficiently recognized denatured gH, while all other gH-specific NAbs demonstrated only minimal ability to react with the linear form of gH (FIG. 7A). Based on this observation, it is possible that 18F10 like AP86 binds the linear immunodominant epitope of gH. To obtain further evidence for the similar antigen recognition properties of AP86 and 18F10, the neutralization potency of 18F10 and AP86 to block TB40/E infection of MRC-5 FB or ARPE-19 EpC was determined. Different from previous reports (59), although comparable to what was observed for vaccine-derived anti-gH NAb 18F10, AP86 was unable to neutralize entry of TB40/E into MRC-5 FB (Table 3). However, AP86 had comparable potency to 18F10 to prevent entry of TB40/E into ARPE-19 cells (IC50 1 g/ml. Table 3). Since the AP86 epitope is present in most HCMV strains but not in Towne due to a gap and a point mutation (34-LD*KAFHLLL-43) (SEQ ID NO: 185) (59), 18F10 and AP86 for recognition of gH in Towne, T R, Davis, AD169 and TB40/E infected MRC-5 cells were evaluated via immunoblot. Both 18F10 and AP86 bound to gH from TR, Davis, AD169 and TB40, but they did not bind to Towne gH (FIG. 7B). Finally, cross competition of AP86 with 18F10 was evaluated and, as a control, also with all other gH-specific NAbs to recognize the PC in MVA-PC infected BHK-21 cells. Only 18F10 competed with AP86 for binding to the PC (Table 4). An ELISA assay was performed with the TB40 specific peptide, L10L, (i.e., (LDPHAFHLLL) (SEQ ID NO: 184)) that binds AP86 and with the Towne specific peptide, L9L, (i.e., (LD*KAFHLLL) (SEQ ID NO: 185)) that does not bind AP85. Results show that despite binding to the same antigenic site, 18F10 and AP86 did not bind the same epitope (see FIG. 9). Therefore 18F10 binds to a novel epitope that was not previously described. These data indicate that binding of the vaccine-derived anti-gH NAb 18F10 overlaps with the linear immunodominant epitope of HCMV gH and, hence, provides further evidence that the NAb responses induced by MVA-PC are similar to those induced during natural HCMV infection.

    Example 10. PC-Specific NAbs are More Potent than Anti-gH NAbs to Block HCMV Infection of Placental CTB

    [0102] CTB are thought to be the key placental cells HCMV utilizes to cross the fetal-maternal interface (40, 41, 46). In order to determine whether the vaccine-derived NAbs can block HCMV infection of CTB, a standard microneutralization assay was used to evaluate the neutralization potency against TB40/E using freshly prepared primary CTB from term placentae. As shown in FIG. 8A, the prepared cell populations were almost exclusively positive for cytokeratin 7 and negative for vimentin, showing that almost all cells were primary CTB, while only minor proportions accounted for mesenchymal cells (57, 58, 75). Consistent with the potency to neutralize HCMV entry and cell-to-cell spread, the neutralization potency of all PC NAbs measured on CTB was significantly higher than that of the NAbs targeting gH or CMV-HIG (FIG. 8B and Table 3). Compared to all NAbs isolated, the highest potency to block CTB infection was demonstrated with PC-specific NAb 1B2, which had also the most potent ability to inhibit HCMV entry into EpC and spreading in these cells. In contrast, anti-gH NAbs showed lower level neutralization potency against TB40/E on CTB that was only comparable to that of CMV-HIG. Some anti-gH NAbs were even unable to prevent TB40/E infection of CTB at the highest investigated antibody concentration (50 g/ml). These data demonstrated that NAbs specific for the UL128/130/131A subunits of the PC confer higher protection against HCMV infection of primary CTB from term placentae than NAbs targeting gH or antibody preparations from HCMV.sup.+ individuals.

    Example 11. NAb 13B5 Binding Site

    [0103] The NAb 13B5 Binding Site within UL128 is at Minimum 13 Amino Acids in Length.

    [0104] Linear B cell epitopes vary greatly in length and range from 5-22 amino acids (1, 2) with an average of 15 (3). In order to define the amino acid sequence within UL128 that constitute the 13B5 epitope, binding of 13B5 to N-terminal and C-terminal truncated sequences of peptide 40 of the UL128 peptide library was evaluated via ELISA. Peptide 40 is composed of amino acids 157-KRLDVCRAKMGYMLQ-171 of the UL128 protein, and demonstrated strongest binding to the 13B5 antibody and hence was likely to contain the minimal 13B5 binding sequence. Removal of the N-terminal amino acid K and sequential removal the four following amino acids (RLDV) from the C-terminus of peptide 40 resulted in dramatically reduced 13B5 binding. Complete loss of 13B5 binding was observed by removing six or more N-terminal amino acids from peptide 40 (FIG. 10A). Truncation of the two C-terminal amino acids LQ from peptide 40 did not show a reduction in 13B5 binding, though slightly decreased 13B5 binding was observed by additionally removing the M from the peptide 40 C-terminus (FIG. 10B). 13B5 binding was substantially decreased by removing the four C-terminal amino acids YMLQ from peptide 40, and was completely lost when five or more C-terminal amino acids of peptide 40 were removed (FIG. 10B). These results indicated that a 13 amino acids long peptide sequence ranging from K-157 to M-169 (KRLDVCRAKMGYM) of the UL128 protein is necessary and sufficient for efficient 13B5 binding. To investigate further whether additional amino acid residues localized at the N-terminus of K-157 of UL128 are critical for 13B5 recognition, 13B5 binding to peptides composed of the defined minimal 13B5 binding site was compared with peptides comprising the 13B5 binding site and one or two additional amino acids (K-155 and H-156) of UL128 added to the N-terminus. As shown in FIG. 10C, addition of the N-terminal amino acids (KH) to the 13B5 target sequence only minimally improved binding of 13B5 antibody, suggesting that these amino acids are not critical for 13B5 binding but they may slightly improve the interaction of the 13B5 antibody and its target site. In sum, these results suggest that NAb 13B5 targets a 13 amino acid long linear epitope sequence at the C-terminus of UL128 that is composed of residues 157-KRLDVCRAKMGYM-169 of the protein.

    [0105] Most Residues of the 13B5 Target Site within UL128 are Critical for Antibody Binding.

    [0106] In order to define the amino acid residues of the 13B5 target site within UL128 that are critical for antibody binding, each residue of the defined 13 amino acid long 13B5 binding site was serially substituted with alanine residues, and the influence of these changes on 13B5 binding was evaluated. FIG. 10D shows the individual sequences of the mutated peptides as well as the testing of 13B5 binding to these peptides via ELISA. Note that peptide K13M is identical to the original sequence of the 13B5 binding site within UL128 (157-KRLDVCRAKMGYM-169). This peptide comprises an internal alanine and hence was used as control in the ELISA for testing 13B5 binding. Consistent with results obtained with truncation libraries, alanine substitution of the N-terminal K and C-terminal Y or M of K13M significantly reduced binding of the 13B5 antibody. Similarly, substituting most of the internal amino acids (C, R, K, M, and G) of K13M with alanine residues resulted in dramatically reduced or complete loss of 13B5 binding. In contrast, 13B5 binding was not impaired when one of the internal residues L, D, and V of K13M were substituted. In addition, substitution of L or D within K13M slightly increased 13B5 binding when compared to the original K13M sequence, suggesting that these amino acid substitutions slightly improved the interaction of 13B5 and its target sequence. Interestingly, the internal C within K13M that appeared essential for 13B5 binding corresponds to amino acid C-162 of UL128 that has previously been shown to form a disulfide bridge with gL in the PC (4). This suggests that NAb 13B5 targets a sequence within UL128 that is critical for interaction of the PC subunits. In sum, these results indicate that most of the amino acids of the 13B5 target site within UL128 are directly involved in the interaction with the 13B5 antibody, while three residues within the target site appear not to be involved directly in 13B5 binding.

    Example 12. Validation of Small Peptides

    [0107] Peptide Construction Based on the 13B5 Binding Site to Test Antibody Induction.

    [0108] To determine whether the UL128 binding site of NAb 13B5 is a neutralizing determinant, keyhole limpet hemocyanin (KLH)-coupled peptides based on the 13B5 binding site were evaluated for immunogenicity to elicit NAb in mice. For this, three different KLH-coupled peptide constructs were generated based on the 13B5 target sequence. In one construct, termed KLH-K15M (i.e., KLH-coupled SEQ ID NO: 179), KLH was coupled to the minimal 13B5 target sequence (K13M) via the existing internal C-162, and two additional residues of UL128 were added to the peptide C-terminus, which appeared to increase slightly the binding of 13B5 antibody. The second construct named KLH-K14CS (i.e., KLH-coupled SEQ ID NO: 180) was generated by coupling of KLH via a C-terminally added C residue to K13M in which the internal C-162 of the minimal 13B5 target sequence was substituted with a serine. The third construct, termed KLH-K16CS (i.e., KLH-coupled SEQ ID NO: 181), was generated in a similar way as the second construct (KLH-K14CS), except that it comprised two additional amino acid residues of UL128 at the N-terminus similar to the first construct (KLH-K15M). C to S amino acid substitutions in the second and third construct (KLH-K14CS, KLH-K16CS) were chosen because of the similarity in steric occupancy between these two residues. As shown in FIG. 11A, all KLH construct showed strong binding of 13B5 antibody, indicating that the KLH coupling and amino substitutions did not alter the interaction of the 13B5 target sequence with the 13B5 antibody. In addition, serine substitution of the internal C-162 in peptide K13M with minimal 13B5 target sitenot coupled to KLHand subsequent addition of a C-terminal cysteine did not result in a decrease of 13B5 binding when compared with the original K13M peptide. However, C-162 to serine substitution in K13M without adding a C-terminal cysteine dramatically decreased 13B5 binding, which is consistent with our findings with the alanine scanning procedure (see FIG. 10D). This suggests that the cysteine residue of the 13B5 target site is essential for 13B5 binding, but its location within the target site at position 162 of the UL128 protein sequence might not be absolutely fundamental for the antibody binding. As control, a peptide construct C-terminally coupled to KLH (KLH-38) consisting of library peptide 38 that was only partially overlapping with the 13B5 target site was generated. This peptide was similar to a recently tested UL128 peptide that has failed to stimulate NAb in rabbits (5). KLH-38 was unable to bind 13B5 antibody, supporting its use as a control construct. In sum, these results indicated that all KLH-coupled peptide constructs presented intact 13B5 target sites.

    [0109] Peptides Based on the 13B5 Target Site have Ability to Elicit NAb in Mice.

    [0110] For testing whether the generated KLH coupled peptide constructs based on the 13B5 target site (KLH-K15M, KLH-K14CS, KLH-K16CS) have ability to elicit NAb in vivo, Balb/c mice were intraperitoneally immunized three times four weeks apart with the peptide constructs admixed in Freund's adjuvant. Serum binding antibodies and NAb were determined one week before and three weeks after each immunization. Binding antibodies of the individual groups were determined via ELISA using peptides as target antigens that were used for immunization (FIG. 11B). NAb titer at which 50% infection (NT50) was inhibited were determined by micro neutralization assay using ARPE-19 EC as cell substrate and HCMV strain TB40/E for infection (FIG. 11C). For control, mice were immunized with KLH only or KLH-38 with C-terminal UL128 peptide sequence that only partially overlapped with the 13B5 target site. As shown in FIG. 11B, all mice immunized with the peptide constructs developed binding antibodies against the peptide sequence with which they were vaccinated after the first immunization. These responses were not or only minimally boosted by a second and third immunization. In addition, Western Blot analysis of UL128 expressed from Ad vectors showed that mice immunized with KLH-K15M, KLH-K14CS, KLH-K16CS developed antibodies that recognized denatured UL128. NAb responses with NT50 titers ranging from 200 to 300 were detectable after the first immunization in only two out of five animals in each vaccine group immunized with KLH-K14CS or KLH-K16CS (FIG. 11C). These responses were boosted in only one animal in each of the KLH-K14CS or KLH-K16CS vaccine groups, reaching NT50 titers of 800 to 1200. These titers remained stable after the third immunization. In the two other animals that developed NAb after the first immunization, NAb declined and were undetectable after the booster immunizations. None of the animals immunized with the peptide construct KLH-K15M, control construct KLH-38, or KLH only developed NAb. These results indicate that peptides based on the 13B5 target site in which the internal cysteine residue was substituted by a serine and KLH was coupled via an additional cysteine residue to the C-terminus had ability to elicit NAb in mice. In contrast, peptides composed of the 13B5 target site that were coupled to KLH via the existing internal C-162 did not show immunogenicity for NAb induction. These results support that the identified 13B5 target site constitutes a neutralizing epitope within UL128.

    REFERENCES

    [0111] The references, patents and published patent applications listed below, and all references cited in the specification above are hereby incorporated by reference in their entireties, as if fully set forth herein. [0112] 1. Ludwig A, Hengel H. 2009. Epidemiological impact and disease burden of congenital cytomegalovirus infection in Europe. Euro Surveill 14:26-32. [0113] 2. Manicklal S, Emery V C, Lazzarotto T, Boppana S B, Gupta R K. 2013. The silent global burden of congenital cytomegalovirus. Clin Microbiol Rev 26:86-102. [0114] 3. Ornoy A, Diav-Citrin O. 2006. Fetal effects of primary and secondary cytomegalovirus infection in pregnancy. Reprod Toxicol 21:399-409. [0115] 4. Cannon M J, Davis K F. 2005. Washing our hands of the congenital cytomegalovirus disease epidemic. BMC Public Health 5:70. [0116] 5. Britt W. 2015. Controversies in the natural history of congenital human cytomegalovirus infection: the paradox of infection and disease in offspring of women with immunity prior to pregnancy. Med Microbiol Immunol doi: 10.1007/s00430-015-0399-9. [0117] 6. Kenneson A, Cannon M J. 2007. Review and meta-analysis of the epidemiology of congenital cytomegalovirus (CMV) infection. Rev Med Virol 17:253-276. [0118] 7. Cannon M J, Westbrook K, Levis D, Schleiss M R, Thackeray R, Pass R F. 2012. Awareness of and behaviors related to child-to-mother transmission of cytomegalovirus. Prev Med 54:351-357. [0119] 8. Pass R F, Anderson B. 2014. Mother-to-Child Transmission of Cytomegalovirus and Prevention of Congenital Infection. J Pediatric Infect Dis Soc 3:S2-S6. [0120] 9. Lazzarotto T, Gabrielli L, Guerra B, Cervi F, Piccirilli G, Simonazzi G, Chiereghin A, Bellini F, Landini M P. 2014. Diagnosis and prognosis of congenital CMV infection: a case report and review of the literature. Scand J Clin Lab Invest Suppl 244:34-40; discussion 39. [0121] 10. Pereira L, Petitt M, Fong A, Tsuge M, Tabata T, Fang-Hoover J, Maidji E, Zydek M, Zhou Y, Inoue N, Loghavi S, Pepkowitz S, Kauvar L M, Ogunyemi D. 2014. Intrauterine growth restriction caused by underlying congenital cytomegalovirus infection. J Infect Dis 209:1573-1584. [0122] 11. La Rosa C, Diamond D J. 2012. The immune response to human CMV. Future Virol 7:279-293. [0123] 12. Khanna R, Diamond D J. 2006. Human cytomegalovirus vaccine: time to look for alternative options. Trends Mol Med 12:26-33. [0124] 13. Dasari V, Smith C, Khanna R. 2013. Recent advances in designing an effective vaccine to prevent cytomegalovirus-associated clinical diseases. Expert Rev Vaccines 12:661-676. [0125] 14. Stratton K R, Durch J S, Lawrence R S. 2000. Vaccines for the 21st Century: A Tool for Decisionmaking, Washington (DC). [0126] 15. Krause P R, Bialek S R, Boppana S B, Griffiths P D, Laughlin C A, Ljungman P, Mocarski E S, Pass R F, Read J S, Schleiss M R, Plotkin S A. 2013. Priorities for CMV vaccine development. Vaccine 32:4-10. [0127] 16. Griffiths P, Plotkin S, Mocarski E, Pass R, Schleiss M, Krause P, Bialek S. 2013. Desirability and feasibility of a vaccine against cytomegalovirus. Vaccine 31 Suppl 2:B197-203. [0128] 17. Pass R F, Zhang C, Evans A, Simpson T, Andrews W, Huang M L, Corey L, Hill J, Davis E, Flanigan C, Cloud G. 2009. Vaccine prevention of maternal cytomegalovirus infection. N Engl J Med 360:1191-1199. [0129] 18. Pass R F. 2009. Development and evidence for efficacy of CMV glycoprotein B vaccine with MF59 adjuvant. J Clin Virol 46 Suppl 4:S73-76. [0130] 19. Griffiths P D, Stanton A, McCarrell E, Smith C, Osman M, Harber M, Davenport A, Jones G, Wheeler D C, O'Beirne J, Thorburn D, Patch D, Atkinson C E, Pichon S, Sweny P, Lanzman M, Woodford E, Rothwell E, Old N, Kinyanjui R, Haque T, Atabani S, Luck S, Prideaux S, Milne R S, Emery V C, Burroughs A K. 2011. Cytomegalovirus glycoprotein-B vaccine with MF59 adjuvant in transplant recipients: a phase 2 randomised placebo-controlled trial. Lancet 377:1256-1263. [0131] 20. Bernstein D I. 2014. Safety and Efficacy of a Cytomegalovirus Glycoprotein B (gB) Vaccine in Adolescent Girls, abstr IDWeek2014 Philadelphia, Pa., Friday, Oct. 10, 2014. [0132] 21. Wang D, Shenk T. 2005. Human cytomegalovirus virion protein complex required for epithelial and endothelial cell tropism. Proc Natl Acad Sci USA 102:18153-18158. [0133] 22. Ryckman B J, Jarvis M A, Drummond D D, Nelson J A, Johnson D C. 2006. Human cytomegalovirus entry into epithelial and endothelial cells depends on genes UL128 to UL150 and occurs by endocytosis and low-pH fusion. J Virol 80:710-722. [0134] 23. Vanarsdall A L, Johnson D C. 2012. Human cytomegalovirus entry into cells. Curr Opin Virol 2:37-42. [0135] 24. Ryckman B J, Chase M C, Johnson D C. 2008. HCMV gH/gL/UL128-131 interferes with virus entry into epithelial cells: evidence for cell type-specific receptors. Proc Natl Acad Sci USA 105:14118-14123. [0136] 25. Hahn G, Revello M G, Patrone M, Percivalle E, Campanini G, Sarasini A, Wagner M, Gallina A, Milanesi G, Koszinowski U, Baldanti F, Gerna G. 2004. Human cytomegalovirus UL131-128 genes are indispensable for virus growth in endothelial cells and virus transfer to leukocytes. J Virol 78:10023-10033. [0137] 26. Wang D, Yu Q C, Schroer J, Murphy E, Shenk T. 2007. Human cytomegalovirus uses two distinct pathways to enter retinal pigmented epithelial cells. Proc Natl Acad Sci USA 104:20037-20042. [0138] 27. Wille P T, Knoche A J, Nelson J A, Jarvis M A, Johnson D C. 2010. A human cytomegalovirus gO-null mutant fails to incorporate gH/gL into the virion envelope and is unable to enter fibroblasts and epithelial and endothelial cells. J Virol 84:2585-2596. [0139] 28. Vanarsdall A L, Chase M C, Johnson D C. 2011. Human cytomegalovirus glycoprotein gO complexes with gH/gL, promoting interference with viral entry into human fibroblasts but not entry into epithelial cells. J Virol 85:11638-11645. [0140] 29. Ciferri C, Chandramouli S, Donnarumma D, Nikitin P A, Cianfrocco M A, Gerrein R, Feire A L, Barnett S W, Lilja A E, Rappuoli R, Norais N, Settembre E C, Carfi A. 2015. Structural and biochemical studies of HCMV gH/gL/gO and Pentamer reveal mutually exclusive cell entry complexes. Proc Natl Acad Sci U S A 112:1767-1772. [0141] 30. Li G, Nguyen C C, Ryckman B J, Britt W J, Kamil J P. 2015. A viral regulator of glycoprotein complexes contributes to human cytomegalovirus cell tropism. Proc Natl Acad Sci USA 112:4471-4476. [0142] 31. Zhou M, Lanchy J M, Ryckman B J. 2015. Human cytomegalovirus gH/gL/gO promotes the fusion step of entry into all cell types whereas gH/gL/UL128-131 broadens virus tropism through a distinct mechanism. J Virol doi:10.1128/JVI.01325-15. [0143] 32. Macagno A, Bernasconi N L, Vanzetta F, Dander E, Sarasini A, Revello M G, Gerna G, Sallusto F, Lanzavecchia A. 2010. Isolation of human monoclonal antibodies that potently neutralize human cytomegalovirus infection by targeting different epitopes on the gH/gL/UL128-131A complex. J Virol 84:1005-1013. [0144] 33. Kabanova A, Perez L, Lilleri D, Marcandalli J, Agatic G, Becattini S, Preite S, Fuschillo D, Percivalle E, Sallusto F, Gerna G, Corti D, Lanzavecchia A. 2014. Antibody-driven design of a human cytomegalovirus gHgLpUL128L subunit vaccine that selectively elicits potent neutralizing antibodies. Proc Natl Acad Sci USA 111:17965-17970. [0145] 34. Freed D C, Tang Q, Tang A, Li F, He X, Huang Z, Meng W, Xia L, Finnefrock A C, Durr E, Espeseth A S, Casimiro D R, Zhang N, Shiver J W, Wang D, An Z, Fu T M. 2013. Pentameric complex of viral glycoprotein H is the primary target for potent neutralization by a human cytomegalovirus vaccine. Proc Natl Acad Sci USA 110:E4997-5005. [0146] 35. Wen Y, Monroe J, Linton C, Archer J, Beard C W, Barnett S W, Palladino G, Mason P W, Carfi A, Lilja A E. 2014. Human cytomegalovirus gH/gL/UL128/UL130/UL131A complex elicits potently neutralizing antibodies in mice. Vaccine 32:3796-3804. [0147] 36. Wussow F, Chiuppesi F, Martinez J, Campo J, Johnson E, Flechsig C, Newell M, Tran E, Ortiz J, La Rosa C, Herrmann A, Longmate J, Chakraborty R, Barry P A, Diamond D J. 2014. Human cytomegalovirus vaccine based on the envelope gH/gL pentamer complex. PLoS Pathog 10:e1004524. [0148] 37. Cui X, Meza B P, Adler S P, McVoy M A. 2008. Cytomegalovirus vaccines fail to induce epithelial entry neutralizing antibodies comparable to natural infection. Vaccine 26:5760-5766. [0149] 38. Gerna G, Sarasini A, Patrone M, Percivalle E, Fiorina L, Campanini G, Gallina A, Baldanti F, Revello MG. 2008. Human cytomegalovirus serum neutralizing antibodies block virus infection of endothelial/epithelial cells, but not fibroblasts, early during primary infection. J Gen Virol 89:853-865. [0150] 39. Revello M G, Gerna G. 2010. Human cytomegalovirus tropism for endothelial/epithelial cells: scientific background and clinical implications. Rev Med Virol 20:136-155. [0151] 40. Pereira L, Maidji E, McDonagh S, Tabata T. 2005. Insights into viral transmission at the uterine-placental interface. Trends Microbiol 13:164-174. [0152] 41. Pereira L, Maidji E. 2008. Cytomegalovirus infection in the human placenta: maternal immunity and developmentally regulated receptors on trophoblasts converge. Curr Top Microbiol Immunol 325:383-395. [0153] 42. Maidji E, McDonagh S, Genbacev O, Tabata T, Pereira L. 2006. Maternal antibodies enhance or prevent cytomegalovirus infection in the placenta by neonatal Fc receptor-mediated transcytosis. Am J Pathol 168:1210-1226. [0154] 43. McDonagh S, Maidji E, Chang H T, Pereira L. 2006. Patterns of human cytomegalovirus infection in term placentas: a preliminary analysis. J Clin Virol 35:210-215. [0155] 44. Tabata T, McDonagh S, Kawakatsu H, Pereira L. 2007. Cytotrophoblasts infected with a pathogenic human cytomegalovirus strain dysregulate cell-matrix and cell-cell adhesion molecules: a quantitative analysis. Placenta 28:527-537. [0156] 45. Trincado D E, Munro S C, Camaris C, Rawlinson W D. 2005. Highly sensitive detection and localization of maternally acquired human cytomegalovirus in placental tissue by in situ polymerase chain reaction. J Infect Dis 192:650-657. [0157] 46. Fisher S, Genbacev O, Maidji E, Pereira L. 2000. Human cytomegalovirus infection of placental cytotrophoblasts in vitro and in utero: implications for transmission and pathogenesis. J Virol 74:6808-6820. [0158] 47. Yamamoto-Tabata T, McDonagh S, Chang H T, Fisher S, Pereira L. 2004. Human cytomegalovirus interleukin-10 downregulates metalloproteinase activity and impairs endothelial cell migration and placental cytotrophoblast invasiveness in vitro. J Virol 78:2831-2840. [0159] 48. Rauwel B, Mariame B, Martin H, Nielsen R, Allart S, Pipy B, Mandrup S, Devignes M D, Evain-Brion D, Fournier T, Davrinche C. 2010. Activation of peroxisome proliferator-activated receptor gamma by human cytomegalovirus for de novo replication impairs migration and invasiveness of cytotrophoblasts from early placentas. J Virol 84:2946-2954. [0160] 49. Zydek M, Petitt M, Fang-Hoover J, Adler B, Kauvar L M, Pereira L, Tabata T. 2014. HCMV infection of human trophoblast progenitor cells of the placenta is neutralized by a human monoclonal antibody to glycoprotein B and not by antibodies to the pentamer complex. Viruses 6:1346-1364. [0161] 50. Kauvar L M, Liu K, Park M, DeChene N, Stephenson R, Tenorio E, Ellsworth S L, Tabata T, Petitt M, Tsuge M, Fang-Hoover J, Adler S P, Cui X, McVoy M A, Pereira L. 2015. A high-affinity native human antibody neutralizes human cytomegalovirus infection of diverse cell types. Antimicrob Agents Chemother 59:1558-1568. [0162] 51. Meyer H, Sutter G, Mayr A. 1991. Mapping of deletions in the genome of the highly attenuated vaccinia virus MVA and their influence on virulence. J Gen Virol 72 (Pt 5):1031-1038. [0163] 52. Harrer E, Bauerle M, Ferstl B, Chaplin P, Petzold B, Mateo L, Handley A, Tzatzaris M, Vollmar J, Bergmann S, Rittmaier M, Eismann K, Muller S, Kalden J R, Spriewald B, Willbold D, Harrer T. 2005. Therapeutic vaccination of HIV-1-infected patients on HAART with a recombinant HIV-1 nef-expressing MVA: safety, immunogenicity and influence on viral load during treatment interruption. Antivir Ther 10:285-300. [0164] 53. Johnson E L, Chakraborty R. 2012. Placental Hofbauer cells limit HIV-1 replication and potentially offset mother to child transmission (MTCT) by induction of immunoregulatory cytokines. Retrovirology 9:101. [0165] 54. Tang Z, Tadesse S, Norwitz E, Mor G, Abrahams V M, Guller S. 2011. Isolation of hofbauer cells from human term placentas with high yield and purity. Am J Reprod Immunol 66:336-348. [0166] 55. Johnson E L, Chu H, Byrareddy S N, Spearman P, Chakraborty R. 2015. Placental Hofbauer cells assemble and sequester HIV-1 in tetraspanin-positive compartments that are accessible to broadly neutralizing antibodies. J Int AIDS Soc 18:19385. [0167] 56. Maldonado-Estrada J, Menu E, Roques P, Barre-Sinoussi F, Chaouat G. 2004. Evaluation of Cytokeratin 7 as an accurate intracellular marker with which to assess the purity of human placental villous trophoblast cells by flow cytometry. J Immunol Methods 286:21-34. [0168] 57. Manoussaka M S, Jackson D J, Lock R J, Sooranna S R, Kumpel B M. 2005. Flow cytometric characterisation of cells of differing densities isolated from human term placentae and enrichment of villous trophoblast cells. Placenta 26:308-318. [0169] 58. Potgens A J, Gaus G, Frank H G, Kaufmann P. 2001. Characterization of trophoblast cell isolations by a modified flow cytometry assay. Placenta 22:251-255. [0170] 59. Urban M, Britt W, Mach M. 1992. The dominant linear neutralizing antibody-binding site of glycoprotein gp86 of human cytomegalovirus is strain specific. J Virol 66:1303-1311. [0171] 60. Britt W J, Auger D. 1985. Identification of a 65 000 dalton virion envelope protein of human cytomegalovirus. Virus Res 4:31-36. [0172] 61. Andreoni M, Faircloth M, Vugler L, Britt W J. 1989. A rapid microneutralization assay for the measurement of neutralizing antibody reactive with human cytomegalovirus. J Virol Methods 23:157-167. [0173] 62. Wussow F, Yue Y, Martinez J, Deere J D, Longmate J, Herrmann A, Barry P A, Diamond D J. 2013. A vaccine based on the rhesus cytomegalovirus UL128 complex induces broadly neutralizing antibodies in rhesus macaques. J Virol 87:1322-1332. [0174] 63. Wang Z, Martinez J, Zhou W, La Rosa C, Srivastava T, Dasgupta A, Rawal R, Li Z, Britt W J, Diamond D. 2010. Modified H5 promoter improves stability of insert genes while maintaining immunogenicity during extended passage of genetically engineered MVA vaccines. Vaccine 28:1547-1557. [0175] 64. Wang Z, La Rosa C, Maas R, Ly H, Brewer J, Mekhoubad S, Daftarian P, Longmate J, Britt W J, Diamond D J. 2004. Recombinant modified vaccinia virus Ankara expressing a soluble form of glycoprotein B causes durable immunity and neutralizing antibodies against multiple strains of human cytomegalovirus. J Virol 78:3965-3976. [0176] 65. Sinzger C, Hahn G, Digel M, Katona R, Sampaio K L, Messerle M, Hengel H, Koszinowski U, Brune W, Adler B. 2008. Cloning and sequencing of a highly productive, endotheliotropic virus strain derived from human cytomegalovirus TB40/E. J Gen Virol 89:359-368. [0177] 66. Zhang C. 2012. Hybridoma technology for the generation of monoclonal antibodies. Methods Mol Biol 901:117-135. [0178] 67. Even-Desrumeaux K, Chames P. 2012. Affinity determination of biotinylated antibodies by flow cytometry. Methods Mol Biol 907:443-449. [0179] 68. Fields C, O'Connell D, Xiao S, Lee G U, Billiald P, Muzard J. 2013. Creation of recombinant antigen-binding molecules derived from hybridomas secreting specific antibodies. Nat Protoc 8:1125-1148. [0180] 69. Boppana S B, Rivera L B, Fowler K B, Mach M, Britt W J. 2001. Intrauterine transmission of cytomegalovirus to infants of women with preconceptional immunity. N Engl J Med 344:1366-1371. [0181] 70. Fouts A E, Chan P, Stephan J P, Vandlen R, Feierbach B. 2012. Antibodies against the gH/gL/UL128/UL130/UL131 complex comprise the majority of the anti-cytomegalovirus (anti-CMV) neutralizing antibody response in CMV hyperimmune globulin. J Virol 86:7444-7447. [0182] 71. Scrivano L, Sinzger C, Nitschko H, Koszinowski U H, Adler B. 2011. HCMV spread and cell tropism are determined by distinct virus populations. PLoS Pathog 7:e1001256. [0183] 72. Cui X, Lee R, Adler S P, McVoy M A. 2013. Antibody inhibition of human cytomegalovirus spread in epithelial cell cultures. J Virol Methods 192:44-50. [0184] 73. Boppana S B, Britt W J. 1995. Antiviral antibody responses and intrauterine transmission after primary maternal cytomegalovirus infection. J Infect Dis 171:1115-1121. [0185] 74. Li Z, Woo C J, Iglesias-Ussel M D, Ronai D, Scharff M D. 2004. The generation of antibody diversity through somatic hypermutation and class switch recombination. Genes Dev 18:1-11. [0186] 75. Frank H G, Genbacev O, Blaschitz A, Chen C P, Clarson L, Evain-Brion D, Gardner L, Malek A, Morrish D, Loke Y W, Tarrade A. 2000. Cell culture models of human trophoblastprimary culture of trophoblasta workshop report. Placenta 21 Suppl A:S120-122. [0187] 76. Jacob C L, Lamorte L, Sepulveda E, Lorenz I C, Gauthier A, Franti M. 2013. Neutralizing antibodies are unable to inhibit direct viral cell-to-cell spread of human cytomegalovirus. Virology 444:140-147. [0188] 77. Buscher N, Paulus C, Nevels M, Tenzer S, Plachter B. 2015. The proteome of human cytomegalovirus virions and dense bodies is conserved across different strains. Med Microbiol Immunol 204:285-293. [0189] Van Regenmortel M H. 2006. Immunoinformatics may lead to a reappraisal of the nature of B cell epitopes and of the feasibility of synthetic peptide vaccines. J Mol Recognit 19:183-187. [0190] Singh H, Ansari H R, Raghava G P. 2013. Improved method for linear B-cell epitope prediction using antigen's primary sequence. PLoS One 8:e62216. [0191] Kringelum J V, Nielsen M, Padkjaer S B, Lund O. 2013. Structural analysis of B-cell epitopes in antibody:protein complexes. Mol Immunol 53:24-34. [0192] Ciferri C, Chandramouli S, Donnarumma D, Nikitin P A, Cianfrocco M A, Gerrein R, Feire A L, Barnett S W, Lilja A E, Rappuoli R, Norais N, Settembre E C, Carfi A. 2015. Structural and biochemical studies of HCMV gH/gL/gO and Pentamer reveal mutually exclusive cell entry complexes. Proc Natl Acad Sci USA 112:1767-1772. [0193] Saccoccio F M, Sauer A L, Cui X, Armstrong A E, Habib el S E, Johnson D C, Ryckman B J, Klingelhutz A J, Adler S P, McVoy M A. 2011. Peptides from cytomegalovirus UL130 and UL131 proteins induce high titer antibodies that block viral entry into mucosal epithelial cells. Vaccine 29:2705-2711.