METHOD FOR BIOREMEDIATION OF HEAVY METAL CONTAMINATED SOIL
20200156126 ยท 2020-05-21
Inventors
Cpc classification
Y02E50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12P39/00
CHEMISTRY; METALLURGY
International classification
Abstract
A method of treating a heavy metal contaminated soil including contacting the contaminated soil with a bioremediation mixture for a predetermined time such that the contaminated soil is anaerobically digested, wherein the contaminated soil contains one or more heavy metals, and wherein the anaerobically digested soil contains a lesser amount of the one or more heavy metals than the contaminated soil.
Claims
1. A method of treating a heavy metal contaminated soil comprising: contacting the contaminated soil with a bioremediation mixture for a predetermined time such that the contaminated soil is anaerobically digested, wherein the contaminated soil contains one or more heavy metals, and wherein the anaerobically digested soil contains a lesser amount of the one or more heavy metals than the contaminated soil.
2. The method of claim 1, wherein the one or more heavy metals are one or more selected from the group consisting of As, Ba, Cd, Co, Cr, Hg, Ni and Pb.
3. The method of claim 1, wherein the bioremediation mixture includes bacteria, fungi, at least one nitrogen source and at least one carbon source.
4. The method of claim 3, wherein one of the at least one carbon sources is Lithothamnium calcareum.
5. The method of claim 1, wherein the predetermined time is a number of days within a range of from 5 days to 35 days.
6. The method of claim 1, wherein the lesser amount of the one or more heavy metals is an amount sufficient to grow one or more plants suitable for human consumption.
7. The method of claim 1, wherein the anaerobically digested soil contains a given heavy metal in an amount lower than a limit of quantification for the given heavy metal.
8. The method of claim 1, wherein the contacting the contaminated soil with the bioremediation mixture comprises mixing the contaminated soil with the bioremediation mixture in a bioreactor such that the contaminated soil is anaerobically digested.
9. The method of claim 3, wherein the at least one nitrogen source is one or more selected from the group consisting of fish, sugar cane juice and cow dung.
10. The method of claim 4, wherein, in addition to Lithothamnium calcareum, the at least one carbon source includes one or more selected from the group consisting of ash, bamboo, sawdust, trumpetwood, sugarcane bagasse and Brachiaria grass.
11. A method of providing verified, decontaminated soil comprising: anaerobically digesting a heavy metal contaminated soil by contacting the contaminated soil with a bioremediation mixture for a first predetermined time, planting at least one test crop in at least a portion of the anaerobically digested soil and allowing for crop maturation for a second predetermined time, testing at least a portion of the mature crop for a level of heavy metal contamination, and verifying that the anaerobically digested soil is decontaminated if the level of heavy metal contamination is zero or below a predetermined threshold.
12. The method of claim 11, wherein the heavy metal contaminated soil contains one ore more heavy metals selected from the group consisting of As, Ba, Cd, Co, Cr, Hg, Ni and Pb.
13. The method of claim 11, wherein the bioremediation mixture includes bacteria, fungi, at least one nitrogen source and at least one carbon source.
14. The method of claim 13, wherein one of the at least one carbon sources is Lithothamnium calcareum.
15. The method of claim 14, wherein, in addition to Lithothamnium calcareum, the at least one carbon source includes one or more selected from the group consisting of ash, bamboo, sawdust, trumpetwood, sugarcane bagasse and Brachiaria grass.
16. The method of claim 13, wherein the at least one nitrogen source is one or more selected from the group consisting of fish, sugar cane juice and cow dung.
17. The method of claim 11, wherein the first predetermined time is a number of days within a range of from 5 days to 35 days.
18. The method of claim 11, wherein the test crop is one or more of corn and crotalaria.
19. The method of claim 11, wherein the second predetermined time is a number of days within a range of from 45 days to 75 days.
20. The method of claim 11, wherein the predetermined threshold is equal to an amount suitable for human consumption.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0007] These and other features of this disclosure will be more readily understood from the following detailed description of the various aspects of the disclosure taken in conjunction with the accompanying drawings that depict various embodiments of the disclosure, in which:
[0008]
[0009]
[0010]
[0011]
[0012]
[0013] It is noted that the drawings of the disclosure are not necessarily to scale. The drawings are intended to depict only typical aspects of the disclosure, and therefore should not be considered as limiting the scope of the disclosure. In the drawings, like numbering represents like elements between the drawings.
DETAILED DESCRIPTION
[0014] Detailed embodiments of the claimed methods are disclosed herein; however, it can be understood that the disclosed embodiments are merely illustrative of the claimed methods that may be embodied in various forms. The subject matter of this disclosure may, however, be embodied in many different forms and should not be construed as limited to the exemplary embodiments set forth herein. Rather, these exemplary embodiments are provided so that this disclosure will be thorough and complete and will fully convey the scope of this disclosure to those skilled in the art.
[0015] In the interest of not obscuring the presentation of embodiments of the present disclosure, in the following detailed description, some processing steps or operations that are known in the art may have been combined together for presentation and for illustration purposes and, in some instances, may have not been described in detail. In other instances, some processing steps or operations that are known in the art may not be described at all. It should be understood that the following description is rather focused on the distinctive features or elements of various embodiments of the present disclosure.
[0016] The subject matter disclosed herein relates to bioremediation of contaminated soil. More specifically, various aspects described herein relate to methods for bioremediation of heavy metal contaminated soil.
[0017] The present disclosure relates generally to bioremediation of contaminated soil, and more particularly, to methods for bioremediation of heavy metal contaminated soil via anaerobic digestion. As mentioned above, advances in bioremediation technologies are needed, including the use of anaerobic digestion with specific bacteria/fungi consortiums to bioremediate soils contaminated with heavy metals. Methods for bioremediation of heavy metal contaminated soil via anaerobic digestion are described below and with reference to the Tables and Figures.
[0018] Embodiments of the present disclosure include methods to bioremediate heavy metals with the use of anaerobic digestion. In the instance of the Examples described below, bacteria and fungi were employed to digest soil contaminated with heavy metals (also referred to herein as sludge) wherein the sludge was obtained from the Bento Rodrigues dam spill in Brazil. As will be seen in the Examples, detailed molecular analysis of the organisms involved in the process of metal degradation, sequestration and inactivation of the sludge were performed. In addition, chemical analysis of heavy metals, trace minerals and soil nutrients of the contaminated sludge were performed, and analysis of physical indicators of soil quality was also performed.
[0019] Chemical, Nutrient Analysis of Contaminated Soil/Sludge
[0020] Before performing the anaerobic digestion of the methods of the disclosure, a physico-chemical and nutrient analysis of the contaminated sludge was performed. The following properties were determined: soil organic matter (OM), soil pH in H.sub.2O (pH), available phosphorus (P) and potassium (K.sup.+), exchangeable aluminum (Al.sup.3+), calcium (Ca.sup.2+) and magnesium (Mg.sup.2+), effective cation exchange capacity (CEC) and CEC at pH 7.0, base-saturation percentage (V %) and Al saturation percentage (m %). Chemical analysis were performed according to the methods described by Tedesco et al. (Anlise de solo, plantas e outros materiais. 2.ed. Porto Alegre, Universidade Federal do Rio Grande do Sul, 1995. 174p): pH measurement in water at a 1:1 soil/water ratio, extraction of exchangeable Ca.sup.2+ and Mg.sup.2+ with 1 mol.Math.L.sup.1 KCl and determination by atomic absorption spectrophotometry. The quantity of available P and K was estimated by Mehlich-1, analyzing K.sup.+ by flame photometry and P by colorimetry; extraction of exchangeable Al with 1 mol.Math.L.sup.1 KCl and titration analysis with 0.0125 mol.Math.L.sup.1 NaOH; and organic carbon was determined by the Walkley-Black combustion method. For OM (an indicator of nitrogen), the data of organic carbon were multiplied by 1.724. Based on the results of chemical analysis, the CEC, V % and m % were calculated. Table A shows the chemical characterization of baseline contaminated sludge for soil fertility parameters.
TABLE-US-00001 TABLE A Chemical characterization of un-treated contaminated sludge and soil fertility parameters Parameter OM pH (N) (H.sub.2O 1:1) P CEC Saturation g .Math. g .Math. mg .Math. K.sup.+ Al.sup.3+ Ca.sup.2+ Mg.sup.2+ CEC pH 7.0 V M Sludge dm.sup.3 dm.sup.3 dm.sup.3 cmole .Math. dm.sup.3 % Un-treated 1.54 6.8 3.88 0.07 0.06 3.1 0.11 3.34 4.26 76.94 1.78
[0021] The total mineral constituents of soil were analyzed, namely mineral nutrients macronutrients (P, K, Ca, Mg, B) and micronutrients (Zn, Cu, Fe, Mn)and heavy metals (As, Ba, Cd, Co, Cr, Hg, Ni, Pb). The results are shown in Tables B and C. For the experiments the limits of quantification (LOQ) for each element were: P (39.2 mg.Math.Kg.sup.1), K (5.4 mg.Math.Kg.sup.1), Ca (44.4 mg.Math.Kg.sup.1), Mg (15 mg.Math.Kg.sup.1), B (11.2 mg.Math.Kg.sup.1), Zn (3.2 mg.Math.Kg.sup.1), Cu (5.4 mg.Math.Kg.sup.1), Fe (4.6 mg.Math.Kg.sup.1), Mn (1.4 mg.Math.Kg.sup.1), As (0.05 mg.Math.Kg.sup.1), Ba (1.2 mg.Math.Kg.sup.1), Cd (1.2 mg.Math.Kg.sup.1), Co (1.8 mg.Math.Kg.sup.1), Cr (5.6 mg.Math.Kg.sup.1), Hg (0.12 mg.Math.Kg.sup.1), Ni (2.2 mg.Math.Kg.sup.1) and Pb (17 mg.Math.Kg.sup.1).
TABLE-US-00002 TABLE B Total mineral nutrients in the un-treated contaminated sludge. Analyte P K Ca Mg B Zn Cu Fe Mn Sludge mg .Math. Kg.sup.1 Un-treated 872.15 419.64 1077.56 <LOQ <LOQ 28.16 <LOQ 150714.46 1496.32
TABLE-US-00003 TABLE C Total heavy metals in the un-treated contaminated sludge. Analyte As Ba Cd Co Cr Hg Ni Pb Soil mg .Math. Kg.sup.1 Un-treated 6.8 169.6 96.63 <LOQ 31.46 <LOQ 151.52 92.33
[0022] Microbiological (Bacteria/Fungi) Analysis of Contaminated Soil/Sludge
[0023] Sample preparation and sequencing was performed by Neoprospecta Microbiome Technologies. Bacterial identification was performed using the V3-V4 region of rRNA 16S which was amplified with the following primers with Illumina adapters: primer 341F (CCTACGGGRSGCAGCAG)-, and primer 806R (GGACTACHVGGGTWTCTAAT)-. Fungi identification was performed using the ITS1 region with the following primers: primer ITS1 (GAACCWGCGGARGGATCA)-, and primer ITS2 (GCTGCGTTCTTCATCGATGC)-. Sequencing was performed by Illumina MiSeq, using a V2 kit, with a single-end 300nt run. The identification of bacterial and fungi sequences was performed using Neoprospecta proprietary database (Neopct/NeoRefDB) and the public domain GreenGenes (http://greengenes.lbl.gov).
[0024] The bioinformatics analysis was performed by Neoprospecta Microbiome Technologies. The primers and adapter sequences were trimmed from the reads, and only sequences with 275nt or more were used in downstream analysis. Then, all reads with one or more indeterminate bases N and truncated sequences with two or more consecutive bases with quality scores below to Q30, were eliminated. OTUs selection was performed using Blastn 2.2.28 against GreenGenes 13.8 database. Taxonomical classification was performed using stringent criteria and only for sequences with 99% identity over 99% of its length.
[0025] Surprisingly, the following most abundant microbial survivors (bacteria and fungi) were detected and were able to adapt to the noxious insults posed by heavy metal contamination (lesser abundant species not listed): uncultured bacterium, uncultured actinobacterium, uncultured Sediminibacterium sp., Kaistobacter terrae, uncultured bacterium SJA-149, uncultured delta proteobacterium, uncultured soil bacterium, Pantoea sp. A1133, and uncultured Acidobacteria bacterium; and fungal Endophyte sp. R32_3, Clonostachys rogersoniana, Podospora communis, Clonostachys rosea F. catenulata, Fusarium sp. FPGLXJ04, Fusarium sp. CS-PIF13, uncultured Mrakia, Pisolithus tinctorius, and fungal isolate from Newtonia buchananii wood. Also surprisingly, the soil directly in contact with the contaminated sludge (underneath) was found to have the following most abundant microbial survivors: uncultured bacterium, uncultured alpha proteobacterium, uncultured Sediminibacterium sp., Sphingobium sp. R8-587, Kaistobacter terrae, uncultured bacterium SJA-149, uncultured Phenylobacterium sp., uncultured soil bacterium, beta proteobacterium IMCC1729, and uncultured Erysipeiothrix sp.; and Fusarium sp. FPGLXJ04, Cylindrocladiella pseudoparva, fungal endophyte, Lasiodiplodia subglobosa, Scedosporium dehoogii, Ceratobasidium sp. AG-G, fungal sp. Griff. DX-FIR1, Stagonospora sp. AX113, Bartalinia robillardoides, Podospora communis, and Pseudallescheria fusoidea.
[0026] Bacteria, Fungi Cocktail & Microbiological Analysis
[0027] The initial bacterial/fungi inoculum was comprised of soil samples from 1) native forests of the States of Minas Gerais and Rio de Janeiro (cities of Bento Rodrigues and Terespolis, respectively); 2) wood rotters from wood debris and trees, building the foundation of forest ecosystems from Bento Rodrigues and Terespolis; 3) fungi growing on carton paper; and 4) fungi growing on wood debris that harbored termites. Table D includes the most abundant bacterial and fungi species detected in a mixture of soil samples and wood debris harboring bacteria and fungi. These bacterial/fungi communities along with other species that were less abundant (approximately 1900 bacterial species and over 280 fungal species) made up the cocktail that was part of the bioremediation mixture and inoculated into bioreactors that performed anaerobic digestion of the contaminated sludge.
TABLE-US-00004 TABLE D uncultured bacterium 48k Dioszegia zsoltii var. zsoltii 1.6k Lactococcus lactis subsp. lactis 10k uncultured soil fungus 1.5k Chryseobacterium jejuense 3.5k uncultured Mrakia 1.5k uncultered Acidobacteria bacterium 2k Bipolaris sorakiniana 1.2k Pseudomonas sp. 38_8 2.5k Epicaccum sorghinum 982 uncultured Caulobacterales bacterium 2k Pestalotiopsis coffese-arabicae 787 uncultured organism 1.9k Fusarium sp. FPGLXJ04 391 Clostridium sp. T5R32 1.8k Mucor bainieri 389 uncultured soil bacterium 1.8k Phaeosphaeria sp. HKC12 370 uncultured Pantoea sp. 1.7k Trichoderma spirale 344 uncultured alpha proteobacterium 1.1k Pestalotiopsis trachicarpicola 291 Clostridium intestinale 1.1k uncultured endophytic fungus 267 uncultured Treponema sp. 1.1k Penicillium brevicompactum 236 Fusarium graminearum 222
[0028] Bioreactors & Bioremediation Mixtures
[0029] Nine bioreactors (also referred to herein as biodigesters) were built to process contaminated sludge. The bioreactors were non-continuous input devices for generation of biogas and digester effluent (biofertilizer and digestate). The digester system included a bioremediation mixture which included a cocktail solution of bacteria and fungi as well as a nitrogen source and a carbon source for anaerobic digestion. The residence period (retention time) was 35 days for the following examples, however the residence period could be any number of days in the range of from 5 days to 35 days. For example, if heat were applied to a bioreactor, the number of days could be as low as 5, 6 or 7 days, for instance. If no heat were applied to a bioreactor, the number of days could be as high as 28 to 35 days, for instance. Examples 1 to 9 show the composition and constituents of the nine bioreactors.
Example 1
[0030]
TABLE-US-00005 Bioreactor 1 (80 L) component Qty Microbiome/Virome Complex Solution 8 L (batch of 5.2 L bacteria/fungi in 70 L water) Contaminated Sludge 20 L Sources of Nitrogen fish 7.5 L Sources of Carbon ash 100 g trumpetwood 2-3 flowers sugarcane bagasse 200 g Brachiaria grass 400 g bamboo 400 g sawdust 800 g
[0031] Biogas production was observed and documented on a daily basis for the residence period (35 days) (see
[0032] In addition, the most abundant bacterial and fungi species for the digestate (the solids) present in the bioreactor were determined to be: bacterium NLAE-z1-C230, bacterium NLAE-a1-P83, Bacteroides coprosuis DSM 18011, Methanofollis sp. YCM4, Sporanaerobacter sp. SN28, swine effluent bacterium CHNDP11, uncultured bacterium, uncultured Caloramator sp., uncultured compost bacterium and uncultured prokaryote for bacteria; and Chaetomium globosum, Coprinopsis calospora, fungal sp. 2686 YZ-2011, fungal sp. Griff. DX-FIR1, Ganoderma annulare, Geomyces sp. 12NJ08, Periconia sp. CY137, Phaeosphaeria sp. HKC12, Podospora communis and Scedosporium dehoogii for fungi.
Example 2
[0033]
TABLE-US-00006 Bioreactor 2 (80 L) component Qty Microbiome/Virome Complex Solution 8 L (batch of 5.2 L bacteria/fungi in 70 L water) Contaminated Sludge 20 L Sources of Nitrogen fish 7.5 L sugar cane juice 1 L Sources of Carbon ash 100 g trumpetwood 2-3 flowers sugarcane bagasse 200 g Brachiaria grass 400 g bamboo 400 g sawdust 800 g
[0034] Biogas production was observed and documented on a daily basis for the residence period (35 days) (see
[0035] In addition, the most abundant bacterial and fungi species for the digestate (the solids) present in the bioreactor were determined to be: Bacillus sp. SL168, bacterium NLAE-z1-C230, bacterium NLAE-z1-P83, Bacteroides coprosuis DSM 18011, Lactobacillus acidipiscis, swine effluent bacterium CHNDP11, uncultured bacterium, uncultured Bacteroidetes bacterium, uncultured Caloramator sp. And uncultured prokaryote for bacteria; and Cladosporium halotolerans, Clonostachys rogersoniana, Epicoccum sorghinum, fungal sp. 2686 YZ-2011, fungal sp. Griff. DX-FIR1, Meyerazyma caribbica, Mortierella exigua, Phaeosphaeria sp. HKC12, Preussia sp. BSH2.9 and Scedosporium dehoogii for fungi.
Example 3
[0036]
TABLE-US-00007 Bioreactor 3 (80 L) component Qty Microbiome/Virome Complex Solution 8 L (batch of 5.2 L bacteria/fungi in 70 L water) Contaminated Sludge 20 L Sources of Nitrogen cow dung 3 L fish 3 L Sources of Carbon ash 100 g trumpetwood 2-3 flowers sugarcane bagasse 200 g Brachiaria grass 400 g bamboo 400 g sawdust 800 g
[0037] Biogas production was observed and documented on a daily basis for the residence period (35 days) (see
[0038] In addition, the most abundant bacterial and fungi species for the digestate (the solids) present in the bioreactor were determined to be: Arcobacter butzleri ED-1, Arthrobacter sp. PD9, Bacteroides paurosaccharolyticus, Methanocorpusculum labreanum Z, Petrimonas sulfuriphila, uncultured Aquabacterium sp., uncultured bacterium, uncultured Bacteroidetes bacterium, uncultured Lysinibacillus sp. and uncultured soil bacterium for bacteria; and Aspergillus sp. F55, Cladosporium halotolerans, Epicaccum sorghinum, fungal sp. Griff. DX-FIR1, Geomyces sp. 12NJ08, Podospora decipiens, Preussia terricola and Zygosaccharomyces rouxii for fungi.
Example 4
[0039]
TABLE-US-00008 Bioreactor 4 (80 L) Component Qty Microbiome/Virome Complex Solution 8 L (batch of 5.2 L bacteria/fungi in 70 L water) Contaminated Sludge 20 L Sources of Nitrogen cow dung 3 L fish 3 L sugar cane juice L Sources of Carbon ash 100 g trumpetwood 200 g sugarcane bagasse 200 g Brachiaria grass 400 g bamboo 400 g sawdust 800 g
[0040] Biogas production was observed and documented on a daily basis for the residence period (35 days) (see
[0041] In addition, the most abundant bacterial and fungi species for the digestate (the solids) present in the bioreactor were determined to be: bacterium NLAE-z1-C156, Bacteroides coprosuis DSM 18011, Bacteroides graminisolvens, Bacteroides paurosaccharalyticus, iron-reducing bacterium enrichment culture clone HN-HF012, Petrimonas sulfuriphila, uncultured Anaerofilum sp., uncultured archaean, uncultured bacterium and uncultured Bacteroidetes bacterium for bacteria; and fungal sp. 2686 YZ-2011, fungal sp. Griff. DX-FIR1, Orpinomyces sp. NIANP57, Pleosporales sp. PANB1a0818P30CC484, Podospora communis, Podospora decipiens, Preussia sp. BSH2.9, Scedosporium dehoogii and uncultured Orpinomyces for fungi.
Example 5
[0042]
TABLE-US-00009 Bioreactor 5 (80 L) component Qty Microbiome/Virome Complex Solution 8 L (batch of 5.2 L bacteria/fungi in 70 L water) Contaminated Sludge 20 L Sources of Nitrogen cow dung 3 L sugar cane juice 1 L Sources of Carbon ash 100 g trumpetwood 2-3 flowers sugarcane bagasse 200 g Brachiaria grass 400 g bamboo 400 g sawdust 800 g
[0043] Biogas production was observed and documented on a daily basis for the residence period (35 days) (see
[0044] In addition, the most abundant bacterial and fungi species for the digestate (the solids) present in the bioreactor were determined to be: bacterium enrichment culture clone Ecwsrb0, Bacteroides graminisolvens, Bacteroides paurosaccharolyticus, Methanocorpusculum labreanum Z, Petrimonas sulfuriphila, uncultured bacterium, uncultured Bacteroidetes bacterium, uncultured Porphyromonadaceae bacterium, uncultured soil bacterium and uncultured spirochete for bacteria; and Ceriporia melfea, Coprinellus brevisetulosus, fungal sp. Griff. DX-FIR1, Meyerozyma caribbica, nigrospora sp. TSS-151, Nigrospora sphaerica, Ogataea polymorpha, Orpinomyces sp. NIANP57, Podospora communis, Preussia sp. BSH2.9, Saccharomyces cerevisiae, Scedosporium apiospemum, Zygosaccharomyces rouxii and uncultured Orpinomyces for fungi.
Example 6
[0045]
TABLE-US-00010 Bioreactor 6 (120 L) component Qty Microbiome/Virome Complex Solution 12 L (batch of 5.2 L bacteria/fungi in 70 L water) Contaminated Sludge 20-30 L Sources of Nitrogen cow dung 10 L Sources of Carbon ash 200 g trumpetwood 2-3 flowers sugarcane bagasse 400 g Brachiaria grass 600 g bamboo 600 g sawdust 1.2 kg
[0046] Biogas production was observed and documented on a daily basis for the residence period (35 days) (see
Example 7
[0047]
TABLE-US-00011 Bioreactor 7 (120 L) component Qty Microbiome/Virome Complex Solution 12 L (batch of 5.2 L bacteria/fungi in 70 L water) Contaminated Sludge 20-30 L Sources of Nitrogen sugar cane juice 1.5 L Sources of Carbon ash 200 g trumpetwood 2-3 flowers sugarcane bagasse 400 g Brachiaria grass 600 g bamboo 600 g sawdust 1.2 kg
[0048] Biogas production was observed and documented on a daily basis for the residence period (35 days) (see
[0049] In addition, the most abundant bacterial and fungi species for the digestate (the solids) present in the bioreactor were determined to be: Bacteroides graminisolvens, Clostridium sp. 6-44, Desulfitobacterium sp. Enrichment culture clone AusD, Ilyobacter delafieldii, Petrimonas sulfuriphila, Rummeliibacillus pycnus, uncultured bacterium, uncultured Bacteroides sp., uncultured Bacteroidetes bacterium, uncultured Campylobacter sp. And uncultured Lysinibacillus sp. for bacteria; and fungal sp. Griff. DX-FIR1, Meyerozyma caribbica, Podospora communis, Rhodotorula mucilaginosa, Saccharomyces cerevisiae, Scedosporium apiospermum and Scedosporium dehoogii for fungi.
Example 8
[0050]
TABLE-US-00012 Bioreactor 8 (120 L) component Qty Microbiome/Virome Complex Solution 12 L (batch of 5.2 L bacteria/fungi in 70 L water) Contaminated Sludge 20-30 L Sources of Nitrogen sugar cane juice L cow dung 7 L Sources of Carbon Lithothamnium calcareum 200 g trumpet wood 2-3 flowers sugarcane bagasse 400 g Brachiaria grass 600 g bamboo 600 g sawdust 1.2 kg
[0051] Biogas production was observed and documented on a daily basis for the residence period (35 days) (see
[0052] In addition, the most abundant bacterial and fungi species for the digestate (the solids) present in the bioreactor were determined to be: Brevundimonas viscosa, Kaistobacter terrae, Lacibacter cauensis, Novosphingobium sp. SaMRH4, Pseudomonas sp. NTUIOB TPZ, Salimonas flava, uncultured bacterium, uncultured Sediminibacterium sp., uncultured soil bacterium and uncultured Xanthomonadaceae bacterium for bacteria; and Cercospora olivascens, Exophiala cancerae, Fonsecaea brasiliensis, fungal sp. 2686 YX-2011, Fusarium sp. CS-P/F13, Fusarium sp. FPGLXJ04, Fusarium sp. Mcp0910, Podospora communis, Pseudallescheria fusoidea, Scedosporium dehoogii and Zygosaccharomyces rouxii for fungi.
Example 9
[0053]
TABLE-US-00013 Bioreactor 9 (120 L) component Qty Microbiome/Virome Complex Solution 12 L (batch of 5.2 L bacteria/fungi in 70 L water) Contaminated Sludge 20-30 L Sources of Nitrogen sugar cane juice L cow dung 7.5 L Sources of Carbon ash 200 g trumpetwood 2-3 flowers sugarcane bagasse 400 g Brachiaria grass 600 g bamboo 600 g sawdust 1.2 kg
[0054] Biogas production was observed and documented on a daily basis for the residence period (35 days) (see
[0055] In addition, the most abundant bacterial and fungi species for the digestate (the solids) present in the bioreactor were determined to be: Bradyrhizobium sp. RITF 522, uncultured Acidobacteria bacterium, uncultured alpha proteobacterium, uncultured bacterium, uncultured Bacteroidetes bacterium, uncultured Chloroflexi bacterium, uncultured Kaistobacter sp., uncultured proteobacterium, uncultured soil bacterium and uncultured Sphingomonadaceae bacterium for bacteria; and fungal endophyte, fungal sp. 2686 YZ-2011, Fusarium acutatum, Fusarium sp. FPGLXJ04, Geomyces sp. 12NJ08, Mortierella amoeboidea, Mortierella exigua, Mucor racemosus F. racemosus, Scedosporium dehoogii and uncultured soil fungus for fungi.
[0056] Biogas
[0057] As can be seen from
[0058] Digested Soil Plantation
[0059] The digestate obtained from a given bioreactor was used as an indicator of soil suitability for plantation of test crops, for example crotalaria and corn. Crotalaria and corn seeding was performed in quadruplicate for each bioreactor. In addition, existing soil from a field laboratory was used as an additional control. Sixty-days after the end of anaerobic digestion and the start of soil plantation, plant height was deemed as an indicator of soil quality. It is noted here that the sixty days may be altered to a number of days with a range of from 45 to 75 days. Table E shows the results of the best plant beds based on plant height attributes.
[0060] It can be seen from Table E that the best indicators of soil quality were bioreactors 1 and 8 and the control. Bioreactor 8 was deemed the best among the three best. Notably, this was the only bioreactor that had Lithothamnium calcareum (a red marine algae) in its bioremediation mixture.
[0061] Test Crop and Soil Chemical, Nutrient Analysis & Soil Microbiological Analysis
[0062] Soil chemical analysis was performed to check the efficiency of the biodigestion process. Table F shows the chemical characterization of the untreated soil and the results of the 9 biodigesters (1 to 9) and a control (10) for soil fertility parameters. The following properties were determined: soil organic matter (OM), soil pH in H.sub.2O (pH), available phosphorus (P) and potassium (K.sup.+), exchangeable aluminum (Al.sup.3+), calcium (Ca.sup.2+) and magnesium (Mg.sup.2+), effective cation exchange capacity (CEC) and CEC at pH 7.0, base-saturation percentage (V %) and Al saturation percentage (m %). Chemical analysis was performed according to the methods described by Tedesco et a1. (1995): pH measurement in water at a 1:1 soil/water ratio, extraction of exchangeable Ca.sup.2+ and Mg.sup.2+ with 1 mol.Math.L.sup.1 KCl and determination by atomic absorption spectrophotometry. The quantity of available P and K was estimated by Mehlich-1, analyzing K.sup.+ by flame photometry and P by colorimetry; extraction of exchangeable Al with 1 mol.Math.L.sup.1 KCl and titration analysis with 0.0125 mol.Math.L.sup.1 NaOH; and organic carbon was determined by the Walkley-Black combustion method. For OM, the data of organic carbon were multiplied by 1.724. Based on the results of chemical analysis, the CEC, V % and m % were calculated.
TABLE-US-00014 TABLE F Chemical characterization of un-treated and post-treated soil (soil 1 to 10) from soil fertility parameters Parameter pH OM (H2O 1:1) P CEC Saturation g .Math. g .Math. mg .Math. K.sup.+ Al.sup.3+ Ca.sup.2+ Mg.sup.2+ CEC pH 7.0 V M Soil dm.sup.3 dm.sup.3 dm.sup.3 cmole .Math. dm.sup.3 % Untreated 1.54 6.8 3.88 0.07 0.06 3.1 0.11 3.34 4.26 76.94 1.78 1 4.69 6 127.84 0.18 0.00 9.92 1.16 11.26 13.45 83.73 0.00 2 2.69 6.2 47.16 0.15 0.00 7.45 0.67 8.27 10.01 82.62 0.00 3 4.56 6.1 102.73 0.30 0.00 9.22 1.06 10.58 13.04 81.16 0.00 4 3.69 6.2 81.36 0.30 0.00 8.74 1.03 10.07 12.82 78.52 0.00 5 4.88 6.3 83.30 0.20 0.00 9.63 1.39 11.21 13.66 82.03 0.00 6 3.69 6.4 98.98 0.83 0.00 8.82 1.20 10.85 12.40 87.49 0.00 7 2.86 6.3 76.25 0.15 0.00 8.56 0.90 9.61 11.56 83.12 0.00 8 2.98 6.1 62.50 0.31 0.00 8.03 1.04 9.38 11.33 82.77 0.00 9 2.43 6.1 56.59 0.21 0.00 8.19 0.92 9.32 11.51 80.98 0.00 10 2.69 6.3 97.16 0.44 0.00 9.72 1.32 11.47 14.56 78.78 0.00
[0063] Generally, the results in Table F show an increase in soil fertility after the biodigestion process, with variations according to biodigester. An improvement was observed in the levels of organic matter from low to medium or good. The untreated soil showed a high pH value, and post-treated soil exhibited pH values considered acceptable for agronomic purposes. With respect to available phosphorus (P) and potassium (K), the P levels increased to very good levels (>45 mg.Math.dm.sup.3) in all treated soils, while there was an increase in the content of exchangeable potassium in all treated soil. The ion exchange capacity (CEC) of the soil is the gradual release capacity of various nutrients, favoring the maintenance of fertility for a long time. A good soil for agronomic purposes presented effective CEC occupied by essential cations such as Ca.sup.2+, Mg.sup.2+ and K.sup.+ as it was observed in treated soils (1 to 10). On the other hand, in a poor soil the effective CEC is occupied by potentially toxic cations such as Al.sup.3+ and it has a low value of CEC indicating that the soil has small capacity to retain cations in exchangeable form. The base saturation (V %) is an excellent indicator of the general conditions of soil fertility, and high values of V % represent fertile soil. A good productivity was observed for the great majority of cultures when the soil has a V % value between 50-80% and a pH value between 6.0-6.5.
[0064] The total mineral constituents of soil were also analyzed, namely mineral nutrients macronutrients (P, K, Ca, Mg, B) and micronutrients (Zn, Cu, Fe, Mn)and heavy metals (As, Ba, Cd, Co, Cr, Hg, Ni, Pb). The results are shown in Tables G and H. For the experiments, the limits of quantification (LOQ) for each element were: P (39.2 mg.Math.Kg.sup.1), K (5.4 mg.Math.Kg.sup.1), Ca (44.4 mg.Math.Kg.sup.1), Mg (15 mg.Math.Kg.sup.1), B (11.2 mg.Math.Kg.sup.1), Zn (3.2 mg.Math.Kg.sup.1), Cu (5.4 mg.Math.Kg.sup.1), Fe (4.6 mg.Math.Kg.sup.1), Mn (1.4 mg.Math.Kg.sup.1), As (0.05 mg.Math.Kg.sup.1), Ba (1.2 mg.Math.Kg.sup.1), Cd (1.2 mg.Math.Kg.sup.1), Co (1.8 mg.Math.Kg.sup.1), Cr (5.6 mg.Math.Kg.sup.1), Hg (0.12 mg.Math.Kg.sup.1), Ni (2.2 mg.Math.Kg.sup.1) and Pb (17 mg.Math.Kg.sup.1).
TABLE-US-00015 TABLE G Total mineral nutrients in the untreated and post-treated soil (soil 1 to 10). Analyte P K Ca Mg B Zn Cu Fe Mn Soil mg .Math. Kg.sup.1 Untreated 872.15 419.64 1077.56 <LOQ <LOQ 28.16 <LOQ 150714.46 1496.32 1 771.8 488.1 799.2 532.6 12.02 15.2 <LOQ 26247.1 249.3 2 618.25 292.2 722.4 360.1 <LOQ 20.4 <LOQ 12919.2 145.7 3 698.0 422.9 796.9 433.9 <LOQ 24.9 <LOQ 26446.6 215.1 4 791.8 390.4 859.9 490.0 12.8 20.5 <LOQ 35633.5 324.4 5 709.3 371.1 735.4 453.2 <LOQ 25.8 <LOQ 17064.2 156.8 6 977.8 636.8 1000.3 634.7 <LOQ 38.8 <LOQ 21485.5 225.7 7 774.1 432.3 763.9 475.5 33.6 19.4 <LOQ 46755.4 380.0 8 893.7 505.5 1114.6 608.3 <LOQ 30.1 <LOQ 25647.4 208.2 9 725.1 462.0 583.3 515.1 <LOQ 25.5 <LOQ 12098.3 147.7 10 945.9 565.2 739.3 579.3 <LOQ 28.6 <LOQ 15353.4 175.9
TABLE-US-00016 TABLE H Total heavy metals in the untreated and post-treated soil (soil 1 to 10). Analyte As Ba Cd Co Cr Hg Ni Pb Soil mg .Math. Kg.sup.1 Untreated 6.8 169.6 96.63 <LOQ 31.46 <LOQ 151.52 92.33 1 <LOQ 25.69 <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ 2 <LOQ 22.1 <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ 3 <LOQ 23.5 <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ 4 <LOQ 31.2 <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ 5 <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ 6 <LOQ 35.0 <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ 7 <LOQ 37.4 <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ 8 <LOQ 30.3 <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ 9 <LOQ 26.4 <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ 10 <LOQ 32.0 <LOQ <LOQ <LOQ <LOQ <LOQ 11.5
[0065] In relation to heavy metals (Table H) it was observed that the biodigestion process was effective, varying according to the biodigester (1 to 10). The levels of heavy metals were lower in all the treated soils in relation the untreated soil, having lower levels than the limits of quantification (LOQ) in most of the soils. These results were satisfactory since the heavy metals can promote damage to human health and plant germination.
[0066] Two different plants were cultivated in post-treated soils namely crotalaria (Crotalaria ledermannii) and corn (Zea mays). The data of the total mineral nutrients of the plants are shown in Table I. In the same plant, variations in mineral levels were observed across soil samples. Comparisons between two plants showed a substantial variation only in the level of Ca.
TABLE-US-00017 TABLE I Total mineral nutrients in plants cultivated in post-treated soils. Analyte P K Ca Mg B Zn Cu Fe Mn Soil Plant mg .Math. Kg.sup.1 1 Crotalaria 4359.79 10779.39 18369.42 2876.96 <LOQ 13.09 <LOQ 121.02 98.86 Corn 4341.71 16217.39 4723.46 2774.7 <LOQ <LOQ <LOQ 265.88 72.19 2 Crotalaria 5204.97 10754.54 17854.37 2716.17 <LOQ 22.97 <LOQ 67.4 53.67 Corn 5666.29 15114.01 6322.43 3563.13 <LOQ <LOQ <LOQ 155.47 49.03 3 Crotalaria 3648.49 12009.4 20977.2 2944.26 <LOQ 17.21 <LOQ 152.36 63.97 Corn 3517.58 10915.01 5568.61 3165.7 <LOQ <LOQ <LOQ 206.48 49.52 4 Crotalaria 4086.17 10336.48 19300.41 2732.33 <LOQ 20.07 <LOQ 121.6 75.4 Corn 3849.17 2893.71 7637.56 4147.09 <LOQ <LOQ <LOQ 95.24 74.61 5 Crotalaria 4914.45 12494.72 21730.14 2728.76 <LOQ 17.09 <LOQ 120.8 62.36 Corn 4057.7 10124.37 8193.58 4689.77 <LOQ <LOQ <LOQ 253.33 103.6 6 Crotalaria 4350.62 11973.19 22402.96 2523.76 <LOQ 17.15 <LOQ 141.46 129.66 Corn 5074.73 13492.98 5645.55 3503.69 <LOQ <LOQ <LOQ 164.1 49.61 7 Crotalaria 3195.64 11905.94 17220.27 3082.17 <LOQ 21.79 <LOQ 85.05 73.24 Corn 4296.26 11783.0 7314.68 3372.72 <LOQ <LOQ <LOQ 300.59 99.16 8 Crotalaria 3327.67 10586.27 25545.1 2897.39 <LOQ 18.98 <LOQ 171.66 133.07 Corn 4490.48 10770.18 6444.54 3299.36 <LOQ <LOQ <LOQ 98.42 84.7 9 Crotalaria 5446.21 11476.8 24115.48 2621.56 <LOQ 28.14 <LOQ 81.16 125.58 Corn 4103.22 12791.6 5796.83 2628.99 <LOQ <LOQ <LOQ 120.75 55.0 10 Crotalaria 4501.07 10537.75 24560.32 3217.85 <LOQ 46.31 <LOQ 143.24 270.09 Corn 3205.46 11668.52 5630.84 2313.39 <LOQ <LOQ <LOQ 154.71 90.52
[0067] Total heavy metal analysis (Table J) showed lower levels than the limits of quantification (LOQ) for most of the samples, in accordance with the data from the post-treatment of soils.
TABLE-US-00018 TABLE J Total heavy metals in plants cultivated in post-treated soils. Analyte As Ba Cd Co Cr Hg Ni Pb Soil Plant mg .Math. Kg.sup.1 1 Crotalaria <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ Corn <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ 2 Crotalaria <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ Corn <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ 3 Crotalaria <LOQ 3.26 <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ Corn <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ 4 Crotalaria <LOQ 20.58 <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ Corn <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ 5 Crotalaria <LOQ 22.23 <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ Corn <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ 6 Crotalaria <LOQ 48.22 <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ Corn <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ 7 Crotalaria <LOQ 33.71 <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ Corn <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ 8 Crotalaria <LOQ 17.26 <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ Corn <LOQ 7.46 <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ 9 Crotalaria <LOQ 24.82 <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ Corn <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ 10 Crotalaria <LOQ 58.51 <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ Corn <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ <LOQ
[0068] In light of the foregoing and as mentioned above, the present disclosure's methods for bioremediation of heavy metal contaminated soil via anaerobic digestion provide an unexpected but needed advancement in the current bioremediation technologies.
[0069] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the disclosure. As used herein, the singular forms a, an and the are intended to include the plural forms as well, unless the context clearly indicates otherwise. It will be further understood that the terms comprises and/or comprising, when used in this specification, specify the presence of stated features, integers, steps, operations, elements, and/or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and/or groups thereof.
[0070] Approximating language, as used herein throughout the specification and claims, may be applied to modify any quantitative representation that could permissibly vary without resulting in a change in the basic function to which it is related. Accordingly, a value modified by a term or terms, such as about, approximately and substantially, are not to be limited to the precise value specified. In at least some instances, the approximating language may correspond to the precision of an instrument for measuring the value. Here and throughout the specification and claims, range limitations may be combined and/or interchanged, such ranges are identified and include all the sub-ranges contained therein unless context or language indicates otherwise. Approximately or about as applied to a particular value of a range applies to both values, and unless otherwise dependent on the precision of the instrument measuring the value, may indicate +/10% of the stated value(s).
[0071] The corresponding structures, materials, acts, and equivalents of all means or step plus function elements in the claims below are intended to include any structure, material, or act for performing the function in combination with other claimed elements as specifically claimed. The description of the present disclosure has been presented for purposes of illustration and description, but is not intended to be exhaustive or limited to the disclosure in the form disclosed. Many modifications and variations will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the disclosure. The embodiments were chosen and described in order to best explain the principles of the disclosure and the practical application, and to enable others of ordinary skill in the art to understand the disclosure for various embodiments with various modifications as are suited to the particular use contemplated.