Modulating RNA Interactions with Polycomb Repressive Complex 1 (PRC1)
20200157537 ยท 2020-05-21
Inventors
Cpc classification
C12N15/113
CHEMISTRY; METALLURGY
C12N2310/3231
CHEMISTRY; METALLURGY
A61P37/06
HUMAN NECESSITIES
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
This invention relates to polycomb-associated RNAs, libraries and fragments of those RNAs, inhibitory nucleic acids and methods and compositions for targeting RNAs, and methods of use thereof.
Claims
1. A process of preparing an inhibitory nucleic acid that specifically binds, or is complementary to, a region of an RNA comprising a motif as shown in TABLE 1, wherein the RNA is known to bind to Polycomb repressive complex 1 (PRC1), selected from the group consisting of SEQ ID NOs:1 to 5893 (human), 5894 to 17415 (human), and 17416 to 36368 (mouse), the process comprising the step of designing and/or synthesizing an inhibitory nucleic acid of between 5 and 40 bases in length, that specifically binds to a region of the RNA that binds PRC1.
2. The process of claim 1, wherein the sequence of the designed and/or synthesized inhibitory nucleic acid is a nucleic acid sequence that is complementary to said region comprising a motif as described herein sequence that binds to PRC1, or is complementary to a portion thereof, said portion having a length of from 5 to 40 contiguous base pairs.
3. The process of claim 1, wherein the inhibitory nucleic acid modulates expression of a gene and the region of the RNA comprising the motif as described herein can be in 3UTR, 5UTR, coding region, or introns of a coding gene.
4. An inhibitory nucleic acid of about 10 to 50 bases in length that specifically binds, or is complementary to, a fragment of at least seven consecutive bases comprising a motif as shown in TABLE 1 within any of SEQ ID NOs:1 to 5893 (human) or 5894 to 17415 (human) or 17416 to 36368 (mouse), wherein the inhibitory nucleic acid comprises one or more modifications and modulates expression of a gene targeted by the RNA.
5. A composition comprising the inhibitory nucleic acid of claim 4.
6. The composition of claim 5, which is for parenteral administration.
7. The composition of claim 5, wherein the RNA sequence is in the 3UTR of a gene, and the inhibitory nucleic acid is capable of upregulating expression of a gene targeted by the RNA.
8. A method of modulating gene expression in a cell or a mammal comprising administering to the cell or the mammal the composition of claim 5.
9. The inhibitory nucleic acid of claim 4, wherein the inhibitory nucleic acid comprises one or more modifications comprising: a modified sugar moiety, a modified internucleoside linkage, a modified nucleotide and/or combinations thereof.
10. The inhibitory nucleic acid of claim 4, wherein the inhibitory nucleic acid is an antisense oligonucleotide, LNA molecule, PNA molecule, ribozyme or siRNA.
11. The inhibitory nucleic acid of claim 4, wherein the inhibitory nucleic acid is double stranded and comprises an overhang at one or both termini.
12. The inhibitory nucleic acid of claim 4, wherein the inhibitory nucleic acid is a single- or double-stranded RNA interference (RNAi) compound.
13. The inhibitory nucleic acid of claim 4, wherein the RNAi compound is selected from the group consisting of short interfering RNA (siRNA); or a short, hairpin RNA (shRNA); small RNA-induced gene activation (RNAa); and small activating RNAs (saRNAs).
14. The inhibitory nucleic acid of claim 9, wherein the modified internucleoside linkage comprises at least one of: alkylphosphonate, phosphorothioate, phosphorodithioate, alkylphosphonothioate, phosphoramidate, carbamate, carbonate, phosphate triester, acetamidate, carboxymethyl ester, or combinations thereof.
15. The inhibitory nucleic acid of claim 9, wherein the modified sugar moiety comprises a 2-O-methoxyethyl modified sugar moiety, a 2-methoxy modified sugar moiety, a 2-O-alkyl modified sugar moiety, or a bicyclic sugar moiety.
16. The inhibitory nucleic acid of claim 9, comprising: 2-OMe, 2-F, LNA, PNA, FANA, ENA or morpholino modifications.
17. A method for treating a subject with MECP2 Duplication Syndrome, the method comprising administering a therapeutically effective amount of an inhibitory nucleic acid targeting a PRC1-binding region comprising a motif as shown in TABLE 1 in Mecp2 RNA, preferably wherein the PRC1 binding region comprises SEQ ID NO:5876 or 5877.
18. The method of claim 17, comprising administering an inhibitory nucleic acid targeting a sequence comprising a motif as shown in TABLE 1 within the 3UTR of Mecp2.
19. A method for treating a subject with systemic lupus erythematosis, the method comprising administering a therapeutically effective amount of an inhibitory nucleic acid targeting a PRC1-binding region comprising a motif as shown in TABLE 1 in IRAK1 RNA, preferably wherein the PRC1 binding region comprises SEQ ID NO:5874 or 5875.
20. The method of claim 19, comprising administering an inhibitory nucleic acid targeting a sequence comprising a motif as described herein within the 3UTR of IRAK1.
21. The method of any claim 17, wherein the inhibitory nucleic acid comprises at least one locked nucleotide (LNA).
22. The method of any claim 19, wherein the inhibitory nucleic acid comprises at least one locked nucleotide (LNA).
Description
DESCRIPTION OF DRAWINGS
[0134] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0135]
[0136] (Panel A) Schematic workflow for dCLIP assay.
[0137] (Panel B) Representative dCLIP experiment. Left panel, autoradiography of dCLIP experiment. Right panel, Western blot with anti-CBX7 antibody for streptavidin pull-down samples. Lanes which contained input samples have been omitted for clarity. Red arrows, Biotagged-CBX7 signal. 3E and 6F are two clonal cell lines expressing physiological levels of Biotagged-CBX7. 3E and 6F are used as biological replicates for CBX7 dCLIP-seq libraries.
[0138] (Panel C) Representative CBX7 dCLIP and ChIP profiles for selected genes. DHS, DNAseI-hypersensitive sites from Vierstra et al (Vierstra et al., 2014). Orange boxes, LNA ASO cocktails. Red stars, primer pairs for ChIP-qPCR. Green hexagons, primer pairs for FAIRE-qPCR.
[0139] (Panel D) Strand-specific enriched peaks (called by PeakRanger) from three individual CLIP libraries were pooled and overlapped peaks were merged into longer regions in a strand-specific manner. Length distribution frequency of the enriched CLIP peaks, as well as mean, median, and standard deviation were calculated.
[0140] (Panel E) Comparison of metagene profiles for CBX7 dCLIP-seq peaks and CBX7 ChIP-seq peaks. TSS, transcriptional start site. TTS, transcriptional termination site.
[0141] (Panel F) Correlation between gene expression levels and CLIP signal. Black, expressed RefSeq genes with reproducible dCLIP signal. Green, genes with a highest CLIP signals. Red, expressed genes with no reproducible CLIP signals.
[0142]
[0143] (Panel A) Bioinformatics pipeline: Schematic workflow of search algorithm for CBX7 biding motifs.
[0144] (Panel B) Families of binding motifs identified for CBX7 dCLIP. Groups of motifs arranged into families according to similarity.
[0145] (Panel C) Abundance of motif families across different transcript features.
[0146] (Panel D) Box plot for FAM-occupancy ratios between number of CBX7 binding sites predicted by motif analysis and confirmed by a dCLIP data to a total number of putative binding sites predicted by motif analysis. Occupancy ratio of 1 indicates that all putative binding sites in a specific gene's genomic feature were validated as CBX7-binding sites based on CLIP-seq analysis. Black line depicts median. CDs, coding DNA sequences (coding exons).
[0147]
[0148] (Panel A) Nearest neighbor analysis for motif families. Note the strong tendency for FAM1 motifs to congregate next to each other.
[0149] (Panel B) Distance distribution between motif pairs. While certain motif pairs such as FAM3-FAM3 and FAM4-FAM4 occurred in a very close proximity, other motif pairs such as FAM4-FAM2 exhibited much broader spectra of inter-motif distances.
[0150] (Panel C) Histogram plotting the number of CBX7 footprints (dCLIP fibers) with indicated adjacent FAM motifs in the same footprint. Note a tendency of motifs to congregate.
[0151] (Panel D) The FAM occupancy ratio on CBX7 footprints with a single FAM (upper graph) versus those with clustered FAMs (lower graph). Congregation of motifs in the 3UTR regions is positively correlated with higher occupancy ratios, suggesting the possibility of cooperative binding.
[0152]
[0153] (Panel A) CBX7 binding motifs bear a significant similarity to the binding motifs of known RNA binding proteins. hPDI motifs were adopted from Xie et al (Xie et al., 2010). RNAcompete motifs were adopted from Ray et al (Ray et al., 2013).
[0154] (Panel B) Effect of RNA secondary structure probed in vivo and in vitro on CBX7 RNA binding. IcSHAPE profiles centered on the genomic sequences predicted as carrying CBX7 binding motifs. IcSHAPE analysis was adopted from Spitale et al (Spitale et al., 2015). Purified RNA molecules were subjected to treatment with icSHAPE reagent in vitro or isolated from cells exposed to icSHAPE reagent in cell culture (in vivo). Extent of RNA folding in particular region is determined by its accessibility to modification by icSHAPE reagent with higher icSHAPE signal representing more open structure. RealFAMdepicting sequences predicted by motif analysis and confirmed as actual CBX7 binding sites by dCLIP. PredictedFAMdepicting sequences predicted by motif analysis but lacking a dCLIP signal. Note that despite a marked similarity of the curves between binding and non-binding FAM sequences, average icSHAPE signal in actual binding sequences is significantly higher than in non-binding FAM sequences, reflecting more open overall structures.
[0155]
[0156] (Panel A) Validation of CBX7 dCLIP data for selected transcripts by nRIP-qPCR. Average fold-enrichment over IgG control is plotted, with standard devations (error bars). U1 small nuclear RNA, negative control.
[0157] (Panel B) RNA-EMSAs with purified CBX7 (5.6 M) and in vitro transcribed RNAs demonstrate direct RNA-protein interactions. Concentrations of RNA: 26.5 nM for Dcaf12l1, 62 nM for Dusp9, 37.9 nM for Calm2. Green arrows, unbound RNA probes. Red asterisks, bound and shifted RNA-protein complexes. Blue arrows, LNA-shifted probes. Red arrowheads, supershifted complexes after gene-specific LNA addition.
[0158] (Panel C) Representative EMSA showing titration of CBX7 protein against fixed concentration (40 nM) of the 3UTR fragment of Dcaf12l1. Red arrows, unbound probe. Black arrows, shifted CBX7-RNA complexes of different mobilities.
[0159] (Panel D) Competition assay: Shift of 40 nM Dcaf12l1 3UTR probe by 2.8 uM of CBX7 is competed away by excess cold Dcaf12l1. Red arrows, unbound probe. Black arrows, shifted CBX7-RNA complexes of different mobilities.
[0160] (Panel E) Binding curves for CBX7-3UTR interactions for selected transcripts. Kd's and Hill coefficients determined by fitting datapoints to sigmoidal plots by non-linear regression (STAR Methods).
[0161] (Panel F) RNA-EMSAs with purified CBX7 (5.6 M) and 100 nM of in vitro-transcribed wildtype oligos bearing a single FAM motif versus their mutated versions. Green arrows, unbound RNA probes. Red arrows, bound and shifted RNA-protein complexes.
[0162] (Panel G) FAM3 competition EMSA using 2.8 uM CBX7 and 100 nM labelled Nuck1-FAM3 RNA probe. Increasing concentrations of Nucks1-FAM3 cold competitor were added, as indicated. Green arrows, unbound RNA probes. Red arrows, bound and shifted RNA-protein complexes.
[0163]
[0164] (Panel A) LNA administration resulted in gene upregulation, as shown by RT-qPCR. LNA cocktails are used for each transcript (see
[0165] (Panel B) ChIP-qPCR for CBX7 localization H2AK119Ub levels after LNA administration as indicated. IgG for control ChIP pulldown. Data presented is average+/S.D of at least three biological replicates.
[0166] (Panel C) FAIRE-qPCR analysis of chromatin compaction in the promoter regions (DNAse-sensitive regions) versus regions corresponding to CBX7 ChIP peaks (DNAse-resistant regions) following LNA treatment. Values were normalized to the -actin locus (constant). Average+/S.D of at least three biological replicates shown.
[0167] (Panel D) RT-qPCR to determine effect of LNA administration on nascent transcripts (intronic primer pairs) compared to total mRNA (inter-exonic primer pairs) levels. Expression levels are relative to those of cells treated with scrambled LNA. P values determined by t-test from 3 biological replicates.
[0168] (Panel E) Dcaf12l1 upregulation after LNA treatment depends on CBX7. Relative Dcaf12l1 expression in Cbx7/ versus wildtype ES cells. RT-pPCR of nascent (intronic primer pairs) versus processed mRNA (inter-exonic primer pairs) is shown. P values determined by t-test from 3 biological replicates.
[0169] (Panel F). Probability density functions for CBX7-bound versus unbound transcripts. Relative FPKM values are determined from RNA-seq of the ES cells in which dCLIP was performed. Note that bound transcripts have a tendency towards higher expression.
[0170] (Panel G) Western immunoblot for DCAF12L1 and loading control CTCF protein. Western analysis is quantitative and showed linear response between 2.5-20.0 ul of extract for both proteins. Standard curve for the Western analysis displayed Squared correlation coefficients (R.sup.2) of approximately 1.0, suggesting an excellent fit of the curve to observed values.
[0171] (Panel H) One example of quantitative Western blot analysis for expression of DCAF12L1 protein following treatment with LNA oligomers. Densitometric analysis was performed and values are normalized to control-LNA-treated samples. Western immunoblots appearing in panels G and H, which were part of images generated by Chemidoc MP Imaging System (as described under STAR Methods) were cropped from their original context and recomposed into separate panels for presentation purposes.
[0172] (Panel I) Average of three biological replicates of quantitative Western blot analysis for DCAF12L1 protein. Values are fold-changes in protein signal compared to cells treated with scrambled LNA. P values determined by t-test from 3 biological replicates.
[0173]
[0174] (Panel A) Length distribution frequency of the enriched hCBX7 dCLIP peaks, as well as mean, median, and standard deviation.
[0175] (Panel B) Metagene profiles for hCBX7 dCLIP-seq peaks shows enrichment at the 3 end of mRNAs. TSS, transcriptional start site. TTS, transcriptional termination site.
[0176] (Panel C) Representative hCBX7 dCLIP profile. BMI1 analysis was performed on previous GRIP dataset (Ray et al., 2016).
[0177] (Panel D) Similarity analysis for families of binding motifs identified for hCBX7 and mCBX7 dCLIP. Groups of motifs arranged according to similarity. Note partial clustering of human and mouse motifs.
[0178] (Panel E) Validation of CBX7 dCLIP data for selected transcripts by dCLIP-qPCR. Average fold-enrichment over GFP control is plotted, with standard deviations (error bars). PES1 served as a negative control that did not exhibit significant binding to CBX7. P values were determined by t-test from 3 biological replicates.
[0179] (Panel F) hCBX7 motifs bear significant similarity to motifs of known RNA binding proteins. hPDI motifs were adopted from Xie et. al. (Xie et al., 2010). RNAcompete motifs were adopted from Ray et al (Ray et al., 2013).
[0180]
[0181] (Panel A) Representative autoradiography of CLIP experiment using specific antibodies against CBX7 and RYBP. Rabbit IgG and anti-Sox2 antibodies were used as a control. Expected sizes of CBX7 and RYBP proteins were marked by red and green arrowheads respectively. Note a strong background around 40 kDa, which were observed for both CBX7 and RYBP proteins and was not removable up to 1M salt washes as outlined in STAR Methods.
[0182] (Panel B) Representative autoradiography of CLIP experiment with anti-HA tag antibody, 6C and 12D are two clonal cell lines expressing physiological levels of HA-tagged-CBX7. Red arrowheadHA-CBX7 related signal. Note the presence of strong background with anti-HA antibody similar to anti-CBX7 and anti-RYBP CLIP in (A).
[0183]
[0184] (Panel A) Representative dCLIP experiment for RYBP protein. Left panel, autoradiography of dCLIP experiment. Right panel, Western blot with anti-RYBP antibody. Red arrows, Biotagged-RYBP signal. 1A and 3H are two clonal cell lines expressing physiological levels of Biotagged-RYBP.
[0185] (Panel B) Representative dCLIP experiment performed simultaneously for CBX7 and RYBP proteins. Note a much weaker signal for RYBP (green asterisk) compared to CBX7 (red asterisk).
[0186] (Panel C) Radioactively labeled RNA from dCLIP experiment was extracted out of nitrocellulose membrane and subjected to DNAse or RNAse treatment. Subsequently, denaturing PAGE electrophoresis was performed and resulting gel exposed to phosphoimaging screen. Note that radioactive signal was specifically eliminated by RNAse treatment, with DNAse treatment having no visible effect.
[0187]
[0188] Dusp9 RNA dCLIP profile in (Panel A) and Nucks1 RNA dCLIP profile in (Panel B) were examined to assess differences between two RNA extraction methodselution directly from beads vs. SDS-PAGE purification, nitrocellulose membrane transfer, with elution of RNA from membrane. Note that in both cases, RYBP presented a weaker signal compared to CBX7.
[0189]
[0190] (Panel A) A scatter plot of gene expression values derived from RNA-seq data of two control lines and two Biotag-CBX7 expressing lines. Note the lack of significant change in overall gene expression. Average FPKM values for endogenous CBX7 expression are 44.38 for control cells versus 46.03 for Biotag-CBX7 cells.
[0191] (Panel B) A genome-wide pairwise comparisons of enriched dCLIP peaks over 1 kb bins per three biological replicates (see STAR Methods for details). Note a positive correlation between individual replicates.
[0192] (Panel C) Probability density functions for CBX7-bound versus the bulk of expressed transcripts. Relative FPKM values are determined from RNA-seq of the ES cells in which dCLIP was performed. Note that bound transcripts have a tendency towards higher expression.
[0193]
[0194] Calm2 (Top Panel) mRNAs represents high binders (green,
[0195]
[0196] (Panel A) CEAS analysis for CBX7 dCLIP-seq peaks (right pie) with enrichment for each genomic feature shown relative to the overall ES transcriptome profile (left pie).
[0197] (Panel B) CEAS analysis for CBX7 ChIP-seq peaks (right pie) with enrichment for each genomic feature shown relative to the overall ES genomic profile (left pie).
[0198] (Panel C) Comparison between CBX7 enrichment in distinct genomic features in for CBX7 dCLIP-seq vs CBX7 ChIP-seq.
[0199] (Panel D) To assess the relationship between CBX7 binding to RNA vs. DNA, we determined the number of CBX7-bound loci and the number of CBX7-bound transcripts in ES cells. Among the 1,333 transcripts with CBX7 binding sites, only 12% were associated with a CBX7 ChIP peak in the same RefSeq locus, inclusive of promoter region. For bulk expressed transcripts in ES cells, the percentage was significantly greater. To compare the 1,333 transcripts to bulk transcripts, we performed 1,000 rounds of random sampling in each cohort. CBX7 binding to target transcripts is inversely correlated with recruitment of CBX7 to chromatin.
[0200]
[0201] IcSHAPE profiles centered on the genomic sequences predicted as carrying CBX7 binding motifs. IcSHAPE analysis was adopted from Spitale et al (Spitale et al., 2015). Purified RNA molecules were subjected to treatment with icSHAPE reagent in vitro or isolated from cells exposed to icSHAPE reagent in cell culture (in vivo). Extent of RNA folding in particular region is determined by its accessibility to modification by icSHAPE reagent with higher icSHAPE signal representing more open structure. FAM_Singdepicting single motif per a dCLIP fiber. FAM Multdepicting multiple motifs per a dCLIP fiber. Note that despite a marked similarity of the curves between single and multiple FAM sequences, average icSHAPE signal in FAM1 and FAM4 is significantly higher than in clustered motif sequences, reflecting more open overall structures.
[0202]
[0203] (Panel A) Western blotting with specific CBX7 antibody to confirm the absence of CBX7 protein in the knockout line. Beta-tubulin served as loading control.
[0204] (Panel B) Gene expression analysis Cbx7 knockout cells. RT-qPCR experiments with fold-change expression values in Cbx7/ cells compared to expression in Cbx7+/+ cells. While 5 region of Cbx7 mRNA was still expressed, the 3 region was absent, consistent with the knockout scheme described previously (Cheng et al., 2014). Cbx8 is a positive control. Notably, it is known that CBX8 is upregulated in ES cells when CBX7 is depleted, in order to maintain stem cell self-renewal (Morey et al., 2012; O'Loghlen et al., 2012) (
[0205]
[0206] (Panel A) Schematic domain structure of CBX7 protein. CD depicted chromodomain, which is involved in binding to methylated lysines and RNA. Note addition of 58aa between CD and PC-box domains in human isoform.
[0207] (Panel B) Clustal Omega protein sequence alignment between mouse and human CBX7 isoforms. Note that besides addition of 58aa to human CBX7 in the course of evolution, a very high degree of similarity in CD and PC-box domains still persisted.
[0208] (Panel C, Panel D) CEAS analysis for CBX7 CLIP-seq peaks (right pie) with enrichment for each genomic feature shown relative to the overall ES transcriptome profile (left pie).
[0209] Table 1Matrix of FBPs presented in
DETAILED DESCRIPTION
[0210] While it is now established that many chromatin-modifying complexes interact with RNA (Magistri et al., 2012), a major obstacle in understanding the regulation and function of such interactions has been the difficulty of identifying specific RNA motifs. For instance, interactions between RNA and Polycomb repressive complexes have served as a leading model in our understanding of RNA-protein interactions at the chromatin interface (Khalil et al., 2009; Zhao et al., 2010), but definitive RNA motifs have yet to be identified. Such motifs could exist in the primary RNA sequence or as specific 3D structures. At present, proposed motifs have come from either in vitro binding studies and have yet to be validated in vivo (Wang et al., 2017), or have been deduced from in vivo binding data that yielded whole transcripts or very large footprints of >1 kb (Beltran et al., 2016; Hendrickson et al., 2016; Kaneko et al., 2014a; Kaneko et al., 2014b; Kaneko et al., 2013).
[0211] Revealing binding motifs would require a high-fidelity method of generating RNA-binding footprints at a transcriptome-wide levelfootprints that represent the protein-binding site on the RNA. While current methodologies have been excellent for highly abundant proteins, including cytoplasmic RNA-binding proteins (Marchese et al., 2016), nuclear epigenetic complexes have presented a greater challenge because of their chromatin association and (hence) a less soluble nature, Such proteins also tend to exist in multi-subunit complexes, with the potential to have several points of contact within a long transcript. New, highly stringent methods that complement existing techniques are therefore much needed in order to obtain a well-rounded view of specific RNA-protein networks.
[0212] A major limitation of most existing methodologies is the reliance on antibodies for specific purification of protein-RNA complexes. The relatively low nanomolar affinities of antibody-antigen methods have direct consequences for antibody-based CLIP methods, as they constrain the stringency of washes during the purification step. Because washes must not disrupt the antibody-antigen interaction, nonspecific RNAs cannot be removed efficiently prior to elution. To solve this problem, here we develop dCLIP (denaturing CLIP) and provide proof-of-concept in two systems. We show that dCLIP can be applied to both mouse and human CBX7 protein to reveal specific RNA footprints, from which consensus motifs and functionally relevant binding sites can be deduced. We chose the CBX7 subunit of canonical PRC1 for its biological importance. CBX7 is highly expressed in embryonic stem (ES) cells and plays an essential role in maintaining stem cell pluripotency (Morey et al., 2012; O'Loghlen et al., 2012). Existing studies have hinted that CBX7's RNA-binding activity may be critical to its epigenomic function. It is known that CBX7 localization to chromatin depends on its RNA-binding domain, and one RNA (ANRIL) is known to negatively regulate the INK4a locus through CBX7 (Bernstein et al., 2006; Yap et al., 2010). Below we demonstrate that CBX7 interacts with a large family of messenger RNAs (mRNAs), identify short RNA footprints, and develop a bioinformatic pipeline to uncover specific functional motifs.
[0213] Here we have developed the denaturing CLIP (dCLIP) methodology and identified a large RNA interactome for CBX7 in human and mouse cells. Interestingly, CBX7 interacts predominantly with mRNAa somewhat unexpected finding given that previous work with the BMI1 subunit indicated a preference for noncoding RNA (Ray et al., 2016). However, CBX7 is unlike the other CBX isoforms (CBX2, 4, 6, 8) in that it lacks the signature polynucleosome compaction function (Grau et al., 2011). Indeed, our present analysis indicates that CBX7, when associated with the 3UTR of mRNAs, does not compact or modulate chromatin. Rather, CBX7 is paradoxically associated with a gene upregulatory function. Thus, the RNA-bound CBX7-containing form of PRC1 may not operate as a repressive complex in the same way as PRC1 complexes that contain compaction-competent CBX isoforms. Together, these observations raise the possibility that the immensely heterogeneous PRC1 complexes (as defined by their distinct subunit compositions) may bind different types of transcripts and serve diverse gene regulatory functions, both positive and negative in nature. Recent work with the EZH2 subunit of PRC2 has also revealed direct positive effects on gene regulation (Zovoilis et al., 2016). Thus, although Polycomb proteins have largely been associated with gene-repressive activities, they can serve gene-upregulatory functions in specific instances.
[0214] Our current work provides proof-of-concept for the dCLIP methodology. We suggest that dCLIP can complement a number of existing methods, each offering various pro's and con's. A recent popular method is eCLIP (Van Nostrand et al., 2016), which relies on antibody-antigen interactions for RNA precipitation and can be applied to any endogenous protein with good antibodies. Similarly, nRIP and fRIP can also be applied to a wide range of proteins without the need for construction of affinity tags (Hendrickson et al., 2016; Ray et al., 2016; Zhao et al., 2010). These methods have all provided valuable information regarding nuclear RNA-protein networks. What dCLIP offers is a complementary view with certain advantages. One key feature is the highly stringent conditions that enable separation (through denaturation) of tightly associated protein complexes into individual components, which therefore makes possible the assessment of RNA binding activities of a single component within the complex.
[0215] Another major advantage of dCLIP method is that it yields a high signal-to-noise ratio and generates reproducible footprints with median sizes of 171 nt (mouse) and 183 nt (human). The small footprints enabled us to identify consensus binding motifs in the RNA that are concordant between two species. We identified families of motifs that tend to co-cluster in the 3UTR and that share significant similarities between species (mCBX7, hCBX7). While the overall binding affinity of CBX7 to any one FAM is relatively low (Kd in the micromolar range), our data suggest a potential for positive cooperativity that could considerably boost binding dynamics in cells. First, icSHAPE analysis showed that FAM clustering predisposes to an open RNA conformation in vivo (
[0216] The mRNA upregulation following the administration of FAM-targeted LNAs is reminiscent of the RNA-upregulation seen after targeting PRC2-RNA interactions with LNAs against the long noncoding RNA, SMN-AS1, for human spinal muscular atrophy locus (Woo et al., 2017). In the case of SMN-AS1, the LNA blocked PRC2 from binding to the antisense regulatory transcript for SMN2 and thereby prevented the deposition of the repressive H3K27me3 mark. Interestingly, however, chromatin assays suggest that our CBX7-mediated upregulation was not due to reduced levels of the repressive H2AK119Ub mark, nor was it due to increased chromatin accessibility. These findings suggested a co-transcriptional and/or post-transcriptional effect. Indeed, the gene-specific LNAs can increase the steady state levels of both nascent and processed mRNA. Furthermore, Western blot analysis indicated that mRNA upregulation was accompanied by increased protein expression. Potential mechanisms include enhanced transcriptional elongation, RNA splicing, mRNA stability, improved export, or increased translation. One possible hint may come from the paradoxical finding that the mixmer LNAs enhanced (rather than blocked) the CBX7-3UTR interactions, producing a strong supershift in gel retardation assays. Thus, the binding of CBX7 to the 3UTR may play a role in transcript stabilization and processing, rather than in chromatin modulation. Notably, our data show that mRNAs bound by CBX7 have a higher probability of expression than transcripts not associated with CBX7 (
[0217] Methods of Modulating Gene Expression
[0218] The inhibitory nucleic acids and small molecules targeting (e.g., complementary to) a PRC1 binding RNA can be used to modulate gene expression in a cell, e.g., a cancer cell, a stem cell, or other normal cell types for gene or epigenetic therapy. The cells can be in vitro, including ex vivo, or in vivo (e.g., in a subject who has cancer, e.g., a tumor).
[0219] In various related aspects, including with respect to the targeting of RNAs by LNA molecule, PRC1-binding RNAs can include endogenous coding and non-coding cellular RNAs, including but not limited to those RNAs that are greater than 60 nt in length, e.g., greater than 100 nt, e.g., greater than 200 nt, have no positive-strand open reading frames greater than 100 amino acids in length, are identified as ncRNAs by experimental evidence, and are distinct from known (smaller) functional-RNA classes (including but not limited to ribosomal, transfer, and small nuclear/nucleolar RNAs, siRNA, piRNA, and miRNA). See, e.g., Lipovich et al., MacroRNA underdogs in a microRNA world: Evolutionary, regulatory, and biomedical significance of mammalian long non-protein-coding RNA Biochimica et Biophysica Acta (2010) doi:10.1016/j.bbagrm.2010.10.001; Ponting et al., Cell 136(4):629-641 (2009), Jia et al., RNA 16 (8) (2010) 1478-1487, Dinger et al., Nucleic Acids Res. 37 1685 (2009) D122-D126 (database issue); and references cited therein. ncRNAs have also been referred to as, and can include, long non-coding RNA, long RNA, large RNA, macro RNA, intergenic RNA, and NonCoding Transcripts.
[0220] The methods described herein can be used to target both coding and non-coding RNAs. Known classes of RNAs include large intergenic non-coding RNAs (lincRNAs, see, e.g., Guttman et al., Nature. 2009 Mar. 12; 458(7235):223-7. Epub 2009 Feb. 1, which describes over a thousand exemplary highly conserved large non-coding RNAs in mammals; and Khalil et al., PNAS 106(28)11675-11680 (2009)); promoter associated short RNAs (PASRs; see, e.g., Seila et al., Science. 2008 Dec. 19; 322(5909):1849-51. Epub 2008 Dec. 4; Kanhere et al., Molecular Cell 38, 675-688, (2010)); endogenous antisense RNAs (see, e.g., Numata et al., BMC Genomics. 10:392 (2009); Okada et al., Hum Mol Genet. 17(11):1631-40 (2008); Numata et al., Gene 392(1-2):134-141 (2007); and Rosok and Sioud, Nat Biotechnol. 22(1):104-8 (2004)); and RNAs that bind chromatin modifiers such as PRC2 and LSD1 (see, e.g., Tsai et al., Science. 2010 Aug. 6; 329(5992):689-93. Epub 2010 Jul. 8; and Zhao et al., Science. 2008 Oct. 31; 322(5902):750-6).
[0221] Exemplary ncRNAs include XIST, TSIX, SRA1, and KCNQ1OT1. The sequences for more than 17,000 long human ncRNAs can be found in the NCode Long ncRNA Database on the Invitrogen website. Additional long ncRNAs can be identified using, e.g., manual published literature, Functional Annotation of Mouse (FANTOM3) project, Human Full-length cDNA Annotation Invitational (H-Invitational) project, antisense ncRNAs from cDNA and EST database for mouse and human using a computation pipeline (Zhang et al., Nucl. Acids Res. 35 (suppl 1): D156-D161 (2006); Engstrom et al., PLoS Genet. 2:e47 (2006)), human snoRNAs and scaRNAs derived from snoRNA-LBME-db, RNAz (Washietl et al. 2005), Noncoding RNA Search (Torarinsson, et al. 2006), and EvoFold (Pedersen et al. 2006).
[0222] A transcriptome of exemplary PRC1-binding RNAs that can be targeted with the present methods is described in WO 2016/149455, which is incorporated by reference herein in its entirety. See, e.g., Table 1 of WO 2016/149455: Human CBX7-RNA binding sites as determined by denaturing CLIP-seq analysis in Human 293 cells. All coordinates in hg19. The columns (c) correspond to: c1, SEQ ID Number. c2, Chromosome number. c3, Read start position. c4, Read end position. c5, chromosome strand that the transcript is made from (+, top or Watson strand; , bottom or Crick strand of each chromosome). C6, nearest gene name. c7, gene categories as defined in Example 2.
[0223] See also Table 2 of WO 2016/149455: Human LiftOver sequences corresponding to CBX7-RNA binding sites as determined by denaturing CLIP-seq analysis in mouse ES cells shown. All coordinates in hg19. CBX7-binding sites derived from CLIP-seq performed in the mouse ES cell line, 16.7, as shown in Table 3, are translated from mouse mm9 to human hg19 coordinates.
[0224] In addition, see Table 3 of WO 2016/149455: Mouse CBX7-RNA binding sites as determined by denaturing CLIP-seq analysis in ES cells derived from Mus musculus. All coordinates in mm9. CLIP-seq performed in the mouse ES cell line, EL 16.7. CBX7 binding sites in the RNA are shown.
[0225] Calculations of homology or sequence identity between sequences (the terms are used interchangeably herein) are performed as follows.
[0226] To determine the percent identity of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). The length of a reference sequence aligned for comparison purposes is at least 80% of the length of the reference sequence, and in some embodiments is at least 90% or 100%. The nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position (as used herein nucleic acid identity is equivalent to nucleic acid homology). The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.
[0227] For purposes of the present invention, the comparison of sequences and determination of percent identity between two sequences can be accomplished using a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.
[0228] The methods described herein can be used for modulating expression of oncogenes and tumor suppressors in cells, e.g., cancer cells. For example, to decrease expression of an gene (e.g., an oncogene or imprinted gene) in a cell, the methods include introducing into the cell an inhibitory nucleic acid or small molecule that specifically binds, or is complementary, to a PRC1-binding region of an RNA that increases expression of the gene, e.g., an oncogene and/or an imprinted gene, set forth in Tables 1-3. As another example, to increase expression of a gene, e.g., a tumor suppressor, in a cell, the methods include introducing into the cell an inhibitory nucleic acid or small molecule that specifically binds, or is complementary, to a PRC1-binding region of an RNA that decreases expression of the gene, e.g., of a tumor suppressor gene, set forth in Tables 1-3, e.g., in subjects with cancer, e.g., lung adenocarcinoma patients.
[0229] In general, the methods include introducing into the cell an inhibitory nucleic acid that specifically binds, or is complementary, to a region of an RNA that modulated expression of a gene as set forth in Tables 1-3.
[0230] In preferred embodiments, the inhibitory nucleic acid binds to a region within or near (e.g., within 100, 200, 300, 400, 500, 600, 700, 1K, 2K, or 5K bases of) a PRC1-binding region of the RNA as set forth in Tables 1-3. The empirically-identified peaks, which are believed to represent PRC1-binding regions are shown in Table 1, with 500 nts of sequence on each side, so that in some the methods can include targeting a sequence as shown in one of the sequences in Tables 1-3, or a sequence that is between 500 nts from the start and 500 nts of the end of a sequence shown in Tables 1-3, or between 400 nts from the start and 400 nts of the end, 300 nts from the start and 300 nts of the end, between 200 nts from the start and 200 nts of the end, or between 100 nts from the start and 100 nts of the end, of a sequence shown in Tables 1-3. A nucleic acid that binds specifically binds primarily to the target RNA or related RNAs to inhibit regulatory function of the RNA but not of other non-target RNAs. The specificity of the nucleic acid interaction thus refers to its function (e.g., inhibiting the PRC1-associated repression of gene expression) rather than its hybridization capacity. Inhibitory nucleic acids may exhibit nonspecific binding to other sites in the genome or other RNAs, without interfering with binding of other regulatory proteins and without causing degradation of the non-specifically-bound RNA. Thus this nonspecific binding does not significantly affect function of other non-target RNAs and results in no significant adverse effects.
[0231] These methods can be used to treat a cancer in a subject by administering to the subject a composition (e.g., as described herein) comprising a PRC1-binding fragment of an RNA as described herein and/or an inhibitory nucleic acid that binds to an RNA (e.g., an inhibitory nucleic acid that binds to an RNA that inhibits a tumor suppressor, or cancer-suppressing gene, or imprinted gene and/or other growth-suppressing genes in any of Tables 1-3). Examples of cellular proliferative and/or differentiative disorders include cancer, e.g., carcinoma, sarcoma, metastatic disorders or hematopoietic neoplastic disorders, e.g., leukemias. A metastatic tumor can arise from a multitude of primary tumor types, including but not limited to those of prostate, colon, lung, breast and liver origin.
[0232] As used herein, treating includes prophylactic treatment which means reducing the incidence of or preventing (or reducing risk of) a sign or symptom of a disease in a patient at risk for the disease, and therapeutic treatment, which means reducing signs or symptoms of a disease, reducing progression of a disease, reducing severity of a disease, in a patient diagnosed with the disease. With respect to cancer, treating includes inhibiting tumor cell proliferation, increasing tumor cell death or killing, inhibiting rate of tumor cell growth or metastasis, reducing size of tumors, reducing number of tumors, reducing number of metastases, increasing 1-year or 5-year survival rate.
[0233] As used herein, the terms cancer, hyperproliferative and neoplastic refer to cells having the capacity for autonomous growth, i.e., an abnormal state or condition characterized by rapidly proliferating cell growth. Hyperproliferative and neoplastic disease states may be categorized as pathologic, i.e., characterizing or constituting a disease state, or may be categorized as non-pathologic, i.e., a deviation from normal but not associated with a disease state. The term is meant to include all types of cancerous growths or oncogenic processes, metastatic tissues or malignantly transformed cells, tissues, or organs, irrespective of histopathologic type or stage of invasiveness. Pathologic hyperproliferative cells occur in disease states characterized by malignant tumor growth. Examples of non-pathologic hyperproliferative cells include proliferation of cells associated with wound repair.
[0234] The terms cancer or neoplasms include malignancies of the various organ systems, such as affecting lung (e.g. small cell, non-small cell, squamous, adenocarcinoma), breast, thyroid, lymphoid, gastrointestinal, genito-urinary tract, kidney, bladder, liver (e.g. hepatocellular cancer), pancreas, ovary, cervix, endometrium, uterine, prostate, brain, as well as adenocarcinomas which include malignancies such as most colon cancers, colorectal cancer, renal-cell carcinoma, prostate cancer and/or testicular tumors, non-small cell carcinoma of the lung, cancer of the small intestine and cancer of the esophagus.
[0235] The term carcinoma is art recognized and refers to malignancies of epithelial or endocrine tissues including respiratory system carcinomas, gastrointestinal system carcinomas, genitourinary system carcinomas, testicular carcinomas, breast carcinomas, prostatic carcinomas, endocrine system carcinomas, and melanomas. In some embodiments, the disease is renal carcinoma or melanoma. Exemplary carcinomas include those forming from tissue of the cervix, lung, prostate, breast, head and neck, colon and ovary. The term also includes carcinosarcomas, e.g., which include malignant tumors composed of carcinomatous and sarcomatous tissues. An adenocarcinoma refers to a carcinoma derived from glandular tissue or in which the tumor cells form recognizable glandular structures.
[0236] The term sarcoma is art recognized and refers to malignant tumors of mesenchymal derivation.
[0237] Additional examples of proliferative disorders include hematopoietic neoplastic disorders. As used herein, the term hematopoietic neoplastic disorders includes diseases involving hyperplastic/neoplastic cells of hematopoietic origin, e.g., arising from myeloid, lymphoid or erythroid lineages, or precursor cells thereof. Preferably, the diseases arise from poorly differentiated acute leukemias, e.g., erythroblastic leukemia and acute megakaryoblastic leukemia. Additional exemplary myeloid disorders include, but are not limited to, acute promyeloid leukemia (APML), acute myelogenous leukemia (AML) and chronic myelogenous leukemia (CML) (reviewed in Vaickus, L. (1991) Crit Rev. in Oncol./Hemotol. 11:267-97); lymphoid malignancies include, but are not limited to acute lymphoblastic leukemia (ALL) which includes B-lineage ALL and T-lineage ALL, chronic lymphocytic leukemia (CLL), prolymphocytic leukemia (PLL), hairy cell leukemia (HLL) and Waldenstrom's macroglobulinemia (WM). Additional forms of malignant lymphomas include, but are not limited to non-Hodgkin lymphoma and variants thereof, peripheral T cell lymphomas, adult T cell leukemia/lymphoma (ATL), cutaneous T-cell lymphoma (CTCL), large granular lymphocytic leukemia (LGF), Hodgkin's disease and Reed-Sternberg disease.
[0238] In some embodiments, specific cancers that can be treated using the methods described herein include, but are not limited to: breast, lung, prostate, CNS (e.g., glioma), salivary gland, prostate, ovarian, and leukemias (e.g., ALL, CML, or AML). Associations of these genes with a particular cancer are known in the art, e.g., as described in Futreal et al., Nat Rev Cancer. 2004; 4;177-83; and The COSMIC (Catalogue of Somatic Mutations in Cancer) database and website, Bamford et al., Br J Cancer. 2004; 91;355-8; see also Forbes et al., Curr Protoc Hum Genet. 2008; Chapter 10; Unit 10.11, and the COSMIC database, e.g., v.50 (Nov. 30, 2010).
[0239] In addition, the methods described herein can be used for modulating (e.g., enhancing or decreasing) pluripotency of a stem cell and to direct stem cells down specific differentiation pathways to make endoderm, mesoderm, ectoderm, and their developmental derivatives. To increase, maintain, or enhance pluripotency, the methods include introducing into the cell an inhibitory nucleic acid that specifically binds to, or is complementary to, a motif as described herein within a PRC1-binding site on a non-coding RNA as set forth in SEQ ID NOs:1 to 5893 (human), 5894 to 17415 (human), and 17416 to 36368 (mouse) or in any of Tables 1-3 of WO 2016/149455. Stem cells useful in the methods described herein include adult stem cells (e.g., adult stem cells obtained from the inner ear, bone marrow, mesenchyme, skin, fat, liver, muscle, or blood of a subject, e.g., the subject to be treated); embryonic stem cells, or stem cells obtained from a placenta or umbilical cord; progenitor cells (e.g., progenitor cells derived from the inner ear, bone marrow, mesenchyme, skin, fat, liver, muscle, or blood); and induced pluripotent stem cells (e.g., iPS cells).
[0240] Furthermore, the present methods can be used to treat Systemic Lupus erythematosus (SLE), an autoimmune disease that affects 1.5 million Americans (16,000 new cases per year). Ages 10-50 are the most affected, with more sufferers being female than male. SLE is a multi-organ disease; the effects include arthritis, joint pain & swelling, chest pain, fatigue, general malaise, hair loss, mouth sores, sensitivity to light, skin rash, and swollen lymph nodes. Current treatments include corticosteroids, immunosuppressants, and more recently belimumab (an inhibitor of B cell activating factor).
[0241] The causes of SLE are probably multiple, including HLA haplotypes. The interleukin 1 receptor associated kinase 1 (IRAK1) has been implicated in some patients. IRAK1 is X-linked (possibly explaining the female predominance of the disease) and is involved in immune response to foreign antigens and pathogens. IRAK1 has been associated with SLE in both adult and pediatric forms. Overexpression of IRAK1 in animal models causes SLE, and knocking out IRAK1 in mice alleviates symptoms of SLE. See, e.g., Jacob et al., Proc Natl Acad Sci USA. 2009 Apr. 14; 106(15):6256-61. The present methods can include treating a subject with SLE by administering an inhibitory nucleic acid that is complementary to a PRC1-binding region on IRAK1 RNA, e.g., an LNA targeting the 3 UTR as shown in
[0242] The present methods can also be used to treat MECP2 Duplication Syndrome in a subject. This condition is characterized by mental retardation, weak muscle tone, and feeding difficulties, as well as poor/absent speech, seizures, and muscle spasticity. There are more reported cases in males than in females; female carriers may have skewed XCI. There is a 50% mortality rate by age 25 associated with this condition, which accounts for 1-2% of X-linked mental retardation. The real rate of incidence is unknown, as many go undiagnosed. Genetically, the cause is duplication (even triplication) of MECP2 gene. There is no current treatment. The present methods can include treating a subject with MECP2 Duplication Syndrome by administering an inhibitory nucleic acid that is complementary to a motif as described herein within a PRC1-binding region on Mecp2 RNA, e.g., an LNA targeting the 3UTR of Mecp2 as shown in
[0243] In some embodiments, the methods described herein include administering a composition, e.g., a sterile composition, comprising an inhibitory nucleic acid that is complementary to a motif as described herein within a PRC1-binding region on an RNA, e.g., as set forth in SEQ ID NOs:1 to 5893 (human), 5894 to 17415 (human), and 17416 to 36368 (mouse) or in any of Tables 1-3 of WO 2016/149455. Inhibitory nucleic acids for use in practicing the methods described herein can be an antisense or small interfering RNA, including but not limited to an shRNA or siRNA. In some embodiments, the inhibitory nucleic acid is a modified nucleic acid polymer (e.g., a locked nucleic acid (LNA) molecule).
[0244] Inhibitory nucleic acids have been employed as therapeutic moieties in the treatment of disease states in animals, including humans. Inhibitory nucleic acids can be useful therapeutic modalities that can be configured to be useful in treatment regimes for the treatment of cells, tissues and animals, especially humans.
[0245] For therapeutics, an animal, preferably a human, suspected of having cancer is treated by administering an RNA or inhibitory nucleic acid in accordance with this invention. For example, in one non-limiting embodiment, the methods comprise the step of administering to the animal in need of treatment, a therapeutically effective amount of an RNA or inhibitory nucleic acid as described herein.
[0246] Inhibitory Nucleic Acids
[0247] Inhibitory nucleic acids useful in the present methods and compositions include antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, siRNA compounds, single- or double-stranded RNA interference (RNAi) compounds such as siRNA compounds, molecules comprising modified bases, locked nucleic acid molecules (LNA molecules), antagomirs, peptide nucleic acid molecules (PNA molecules), and other oligomeric compounds or oligonucleotide mimetics which hybridize to at least a portion of the target nucleic acid and modulate its function. In some embodiments, the inhibitory nucleic acids include antisense RNA, antisense DNA, chimeric antisense oligonucleotides, antisense oligonucleotides comprising modified linkages, interference RNA (RNAi), short interfering RNA (siRNA); a micro, interfering RNA (miRNA); a small, temporal RNA (stRNA); or a short, hairpin RNA (shRNA); small RNA-induced gene activation (RNAa); small activating RNAs (saRNAs), or combinations thereof. See, e.g., WO 2010040112.
[0248] In the present methods, the inhibitory nucleic acids are preferably designed to target a motif as described herein within a region of the RNA that binds to PRC1, e.g., as described in WO 2016/149455 (see Tables 1-3 thereof). The motifs are shown in
[0249] These inhibitory nucleic acids are believed to work by inhibiting the interaction between the RNA and PRC1, and as described herein can be used to modulate expression of a gene.
[0250] In some embodiments, the inhibitory nucleic acids are 10 to 50, 13 to 50, or 13 to 30 nucleotides in length. One having ordinary skill in the art will appreciate that this embodies oligonucleotides having antisense (complementary) portions of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length, or any range therewithin. It is understood that non-complementary bases may be included in such inhibitory nucleic acids; for example, an inhibitory nucleic acid 30 nucleotides in length may have a portion of 15 bases that is complementary to the targeted RNA. In some embodiments, the oligonucleotides are 15 nucleotides in length. In some embodiments, the antisense or oligonucleotide compounds of the invention are 12 or 13 to 30 nucleotides in length. One having ordinary skill in the art will appreciate that this embodies inhibitory nucleic acids having antisense (complementary) portions of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length, or any range therewithin.
[0251] Preferably the inhibitory nucleic acid comprises one or more modifications comprising: a modified sugar moiety, and/or a modified internucleoside linkage, and/or a modified nucleotide and/or combinations thereof. It is not necessary for all positions in a given oligonucleotide to be uniformly modified, and in fact more than one of the modifications described herein may be incorporated in a single oligonucleotide or even at within a single nucleoside within an oligonucleotide.
[0252] In some embodiments, the inhibitory nucleic acids are chimeric oligonucleotides that contain two or more chemically distinct regions, each made up of at least one nucleotide. These oligonucleotides typically contain at least one region of modified nucleotides that confers one or more beneficial properties (such as, for example, increased nuclease resistance, increased uptake into cells, increased binding affinity for the target) and a region that is a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. Chimeric inhibitory nucleic acids of the invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids or gapmers. Representative United States patents that teach the preparation of such hybrid structures comprise, but are not limited to, U.S. Pat. Nos. 5,013,830; 5,149,797; 5, 220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922, each of which is herein incorporated by reference.
[0253] In some embodiments, the inhibitory nucleic acid comprises at least one nucleotide modified at the 2 position of the sugar, most preferably a 2-O-alkyl, 2-O-alkyl-O-alkyl or 2-fluoro-modified nucleotide. In other preferred embodiments, RNA modifications include 2-fluoro, 2-amino and 2 O-methyl modifications on the ribose of pyrimidines, abasic residues or an inverted base at the 3 end of the RNA. Such modifications are routinely incorporated into oligonucleotides and these oligonucleotides have been shown to have a higher Tm (i.e., higher target binding affinity) than; 2-deoxyoligonucleotides against a given target.
[0254] A number of nucleotide and nucleoside modifications have been shown to make the oligonucleotide into which they are incorporated more resistant to nuclease digestion than the native oligodeoxynucleotide; these modified oligos survive intact for a longer time than unmodified oligonucleotides. Specific examples of modified oligonucleotides include those comprising modified backbones, for example, phosphorothioates, phosphotriesters, methyl phosphonates, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages. Most preferred are oligonucleotides with phosphorothioate backbones and those with heteroatom backbones, particularly CH.sub.2NHOCH.sub.2, CH, N(CH.sub.3)OCH.sub.2 (known as a methylene(methylimino) or MMI backbone], CH.sub.2ON(CH.sub.3)CH.sub.2, CH.sub.2N(CH.sub.3)N(CH.sub.3)CH.sub.2 and ON(CH.sub.3)CH.sub.2CH.sub.2 backbones, wherein the native phosphodiester backbone is represented as OPOCH,); amide backbones (see De Mesmaeker et al. Ace. Chem. Res. 1995, 28:366-374); morpholino backbone structures (see Summerton and Weller, U.S. Pat. No. 5,034,506); peptide nucleic acid (PNA) backbone (wherein the phosphodiester backbone of the oligonucleotide is replaced with a polyamide backbone, the nucleotides being bound directly or indirectly to the aza nitrogen atoms of the polyamide backbone, see Nielsen et al., Science 1991, 254, 1497). Phosphorus-containing linkages include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates comprising 3alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates comprising 3-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3-5 linkages, 2-5 linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3-5 to 5-3 or 2-5 to 5-2; see U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5, 177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455, 233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563, 253; 5,571,799; 5,587,361; and 5,625,050.
[0255] Morpholino-based oligomeric compounds are described in Dwaine A. Braasch and David R. Corey, Biochemistry, 2002, 41(14), 4503-4510); Genesis, volume 30, issue 3, 2001; Heasman, J., Dev. Biol., 2002, 243, 209-214; Nasevicius et al., Nat. Genet., 2000, 26, 216-220; Lacerra et al., Proc. Natl. Acad. Sci., 2000, 97, 9591-9596; and U.S. Pat. No. 5,034,506, issued Jul. 23, 1991. In some embodiments, the morpholino-based oligomeric compound is a phosphorodiamidate morpholino oligomer (PMO) (e.g., as described in Iverson, Curr. Opin. Mol. Ther., 3:235-238, 2001; and Wang et al., J. Gene Med., 12:354-364, 2010; the disclosures of which are incorporated herein by reference in their entireties).
[0256] Cyclohexenyl nucleic acid oligonucleotide mimetics are described in Wang et al., J. Am. Chem. Soc., 2000, 122, 8595-8602.
[0257] Additional modifications are possible as described in WO 2016/149455.
[0258] The inhibitory nucleic acids useful in the present methods are sufficiently complementary to the target RNA, e.g., hybridize sufficiently well and with sufficient biological functional specificity, to give the desired effect. Complementary refers to the capacity for pairing, through base stacking and specific hydrogen bonding, between two sequences comprising naturally or non-naturally occurring (e.g., modified as described above) bases (nucleosides) or analogs thereof. For example, if a base at one position of an inhibitory nucleic acid is capable of hydrogen bonding with a base at the corresponding position of an RNA, then the bases are considered to be complementary to each other at that position. 100% complementarity is not required. As noted above, inhibitory nucleic acids can comprise universal bases, or inert abasic spacers that provide no positive or negative contribution to hydrogen bonding. Base pairings may include both canonical Watson-Crick base pairing and non-Watson-Crick base pairing (e.g., Wobble base pairing and Hoogsteen base pairing). It is understood that for complementary base pairings, adenosine-type bases (A) are complementary to thymidine-type bases (T) or uracil-type bases (U), that cytosine-type bases (C) are complementary to guanosine-type bases (G), and that universal bases such as such as 3-nitropyrrole or 5-nitroindole can hybridize to and are considered complementary to any A, C, U, or T. Nichols et al., Nature, 1994; 369:492-493 and Loakes et al., Nucleic Acids Res., 1994; 22:4039-4043. Inosine (I) has also been considered in the art to be a universal base and is considered complementary to any A, C, U, or T. See Watkins and SantaLucia, Nucl. Acids Research, 2005; 33 (19): 6258-6267.
[0259] In some embodiments, the location on a target RNA to which an inhibitory nucleic acids hybridizes is defined as a region to which a protein binding partner binds, as shown in Tables 1-3. Routine methods can be used to design an inhibitory nucleic acid that binds to this sequence with sufficient specificity. In some embodiments, the methods include using bioinformatics methods known in the art to identify regions of secondary structure, e.g., one, two, or more stem-loop structures, or pseudoknots, and selecting those regions to target with an inhibitory nucleic acid. For example, methods of designing oligonucleotides similar to the inhibitory nucleic acids described herein, and various options for modified chemistries or formats, are exemplified in Lennox and Behlke, Gene Therapy (2011) 18: 1111-1120, which is incorporated herein by reference in its entirety, with the understanding that the present disclosure does not target miRNA seed regions.
[0260] While the specific sequences of certain exemplary target segments are set forth herein, one of skill in the art will recognize that these serve to illustrate and describe particular embodiments within the scope of the present invention. Additional target segments are readily identifiable by one having ordinary skill in the art in view of this disclosure. Target segments 5-500 nucleotides in length comprising a stretch of at least five (5) consecutive nucleotides within the protein binding region, or immediately adjacent thereto, are considered to be suitable for targeting as well. Target segments can include sequences that comprise at least the 5 consecutive nucleotides from the 5-terminus of one of the protein binding regions (the remaining nucleotides being a consecutive stretch of the same RNA beginning immediately upstream of the 5-terminus of the binding segment and continuing until the inhibitory nucleic acid contains about 5 to about 100 nucleotides). Similarly preferred target segments are represented by RNA sequences that comprise at least the 5 consecutive nucleotides from the 3-terminus of one of the illustrative preferred target segments (the remaining nucleotides being a consecutive stretch of the same RNA beginning immediately downstream of the 3-terminus of the target segment and continuing until the inhibitory nucleic acid contains about 5 to about 100 nucleotides). One having skill in the art armed with the sequences provided herein will be able, without undue experimentation, to identify further preferred protein binding regions to target with complementary inhibitory nucleic acids.
[0261] In the context of the present disclosure, hybridization means base stacking and hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases. For example, adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds. Complementary, as the term is used in the art, refers to the capacity for precise pairing between two nucleotides. For example, if a nucleotide at a certain position of an oligonucleotide is capable of hydrogen bonding with a nucleotide at the same position of a RNA molecule, then the inhibitory nucleic acid and the RNA are considered to be complementary to each other at that position. The inhibitory nucleic acids and the RNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides that can hydrogen bond with each other through their bases. Thus, specifically hybridizable and complementary are terms which are used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the inhibitory nucleic acid and the RNA target. For example, if a base at one position of an inhibitory nucleic acid is capable of hydrogen bonding with a base at the corresponding position of a RNA, then the bases are considered to be complementary to each other at that position. 100% complementarity is not required.
[0262] It is understood in the art that a complementary nucleic acid sequence need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable. A complementary nucleic acid sequence for purposes of the present methods is specifically hybridizable when binding of the sequence to the target RNA molecule interferes with the normal function of the target RNA to cause a loss of activity (e.g., inhibiting PRC1-associated repression with consequent up-regulation of gene expression) and there is a sufficient degree of complementarity to avoid non-specific binding of the sequence to non-target RNA sequences under conditions in which avoidance of the non-specific binding is desired, e.g., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed under suitable conditions of stringency. For example, stringent salt concentration will ordinarily be less than about 750 mM NaCl and 75 mM trisodium citrate, preferably less than about 500 mM NaCl and 50 mM trisodium citrate, and more preferably less than about 250 mM NaCl and 25 mM trisodium citrate. Low stringency hybridization can be obtained in the absence of organic solvent, e.g., formamide, while high stringency hybridization can be obtained in the presence of at least about 35% formamide, and more preferably at least about 50% formamide. Stringent temperature conditions will ordinarily include temperatures of at least about 30 C., more preferably of at least about 37 C., and most preferably of at least about 42 C. Varying additional parameters, such as hybridization time, the concentration of detergent, e.g., sodium dodecyl sulfate (SDS), and the inclusion or exclusion of carrier DNA, are well known to those skilled in the art. Various levels of stringency are accomplished by combining these various conditions as needed. In a preferred embodiment, hybridization will occur at 30 C. in 750 mM NaCl, 75 mM trisodium citrate, and 1% SDS. In a more preferred embodiment, hybridization will occur at 37 C. in 500 mM NaCl, 50 mM trisodium citrate, 1% SDS, 35% formamide, and 100 g/ml denatured salmon sperm DNA (ssDNA). In a most preferred embodiment, hybridization will occur at 42 C. in 250 mM NaCl, 25 mM trisodium citrate, 1% SDS, 50% formamide, and 200 g/ml ssDNA. Useful variations on these conditions will be readily apparent to those skilled in the art.
[0263] For most applications, washing steps that follow hybridization will also vary in stringency. Wash stringency conditions can be defined by salt concentration and by temperature. As above, wash stringency can be increased by decreasing salt concentration or by increasing temperature. For example, stringent salt concentration for the wash steps will preferably be less than about 30 mM NaCl and 3 mM trisodium citrate, and most preferably less than about 15 mM NaCl and 1.5 mM trisodium citrate. Stringent temperature conditions for the wash steps will ordinarily include a temperature of at least about 25 C., more preferably of at least about 42 C., and even more preferably of at least about 68 C. In a preferred embodiment, wash steps will occur at 25 C. in 30 mM NaCl, 3 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, wash steps will occur at 42 C. in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, wash steps will occur at 68 C. in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. Additional variations on these conditions will be readily apparent to those skilled in the art. Hybridization techniques are well known to those skilled in the art and are described, for example, in Benton and Davis (Science 196:180, 1977); Grunstein and Hogness (Proc. Natl. Acad. Sci., USA 72:3961, 1975); Ausubel et al. (Current Protocols in Molecular Biology, Wiley Interscience, New York, 2001); Berger and Kimmel (Guide to Molecular Cloning Techniques, 1987, Academic Press, New York); and Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York.
[0264] In general, the inhibitory nucleic acids useful in the methods described herein have at least 80% sequence complementarity to a target region within the target nucleic acid, e.g., 90%, 95%, or 100% sequence complementarity to the target region within an RNA. For example, an antisense compound in which 18 of 20 nucleobases of the antisense oligonucleotide are complementary, and would therefore specifically hybridize, to a target region would represent 90 percent complementarity. Percent complementarity of an inhibitory nucleic acid with a region of a target nucleic acid can be determined routinely using basic local alignment search tools (BLAST programs) (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656). Antisense and other compounds of the invention that hybridize to an RNA are identified through routine experimentation. In general the inhibitory nucleic acids must retain specificity for their target, i.e., either do not directly bind to, or do not directly significantly affect expression levels of, transcripts other than the intended target.
[0265] Target-specific effects, with corresponding target-specific functional biological effects, are possible even when the inhibitory nucleic acid exhibits non-specific binding to a large number of non-target RNAs. For example, short 8 base long inhibitory nucleic acids that are fully complementary to a RNA may have multiple 100% matches to hundreds of sequences in the genome, yet may produce target-specific effects, e.g. upregulation of a specific target gene through inhibition of PRC1 activity. 8-base inhibitory nucleic acids have been reported to prevent exon skipping with with a high degree of specificity and reduced off-target effect. See Singh et al., RNA Biol., 2009; 6(3): 341-350. 8-base inhibitory nucleic acids have been reported to interfere with miRNA activity without significant off-target effects. See Obad et al., Nature Genetics, 2011; 43: 371-378.
[0266] For further disclosure regarding inhibitory nucleic acids, please see WO 2016/149455 as well as US2010/0317718 (antisense oligos); US2010/0249052 (double-stranded ribonucleic acid (dsRNA)); US2009/0181914 and US2010/0234451 (LNA molecules); US2007/0191294 (siRNA analogues); US2008/0249039 (modified siRNA); and WO2010/129746 and WO2010/040112 (inhibitory nucleic acids).
[0267] Antisense
[0268] In some embodiments, the inhibitory nucleic acids are antisense oligonucleotides. Antisense oligonucleotides are typically designed to block expression of a DNA or RNA target by binding to the target and halting expression at the level of transcription, translation, or splicing. Antisense oligonucleotides of the present invention are complementary nucleic acid sequences designed to hybridize under stringent conditions to an RNA in vitro, and are expected to inhibit the activity of PRC1 in vivo. Thus, oligonucleotides are chosen that are sufficiently complementary to the target, i.e., that hybridize sufficiently well and with sufficient biological functional specificity, to give the desired effect.
[0269] Modified Base, Including Locked Nucleic Acids (LNAs)
[0270] In some embodiments, the inhibitory nucleic acids used in the methods described herein comprise one or more modified bonds or bases. Modified bases include phosphorothioate, methylphosphonate, peptide nucleic acids, or locked nucleic acids (LNAs). Preferably, the modified nucleotides are part of locked nucleic acid molecules, including [alpha]-L-LNAs. LNAs include ribonucleic acid analogues wherein the ribose ring is locked by a methylene bridge between the 2-oxgygen and the 4-carboni.e., oligonucleotides containing at least one LNA monomer, that is, one 2-O,4-C-methylene--D-ribofuranosyl nucleotide. LNA bases form standard Watson-Crick base pairs but the locked configuration increases the rate and stability of the basepairing reaction (Jepsen et al., Oligonucleotides, 14, 130-146 (2004)). LNAs also have increased affinity to base pair with RNA as compared to DNA. These properties render LNAs especially useful as probes for fluorescence in situ hybridization (FISH) and comparative genomic hybridization, as knockdown tools for miRNAs, and as antisense oligonucleotides to target mRNAs or other RNAs, e.g., RNAs as described herein.
[0271] The modified base/LNA molecules can include molecules comprising 10-30, e.g., 12-24, e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in each strand, wherein one of the strands is substantially identical, e.g., at least 80% (or more, e.g., 85%, 90%, 95%, or 100%) identical, e.g., having 3, 2, 1, or 0 mismatched nucleotide(s), to a target region in the RNA. The modified base/LNA molecules can be chemically synthesized using methods known in the art.
[0272] The modified base/LNA molecules can be designed using any method known in the art; a number of algorithms are known, and are commercially available (e.g., on the internet, for example at exiqon.com). See, e.g., You et al., Nuc. Acids. Res. 34:e60 (2006); McTigue et al., Biochemistry 43:5388-405 (2004); and Levin et al., Nuc. Acids. Res. 34:e142 (2006). For example, gene walk methods, similar to those used to design antisense oligos, can be used to optimize the inhibitory activity of a modified base/LNA molecule; for example, a series of oligonucleotides of 10-30 nucleotides spanning the length of a target RNA can be prepared, followed by testing for activity. Optionally, gaps, e.g., of 5-10 nucleotides or more, can be left between the LNAs to reduce the number of oligonucleotides synthesized and tested. GC content is preferably between about 30-60%. General guidelines for designing modified base/LNA molecules are known in the art; for example, LNA sequences will bind very tightly to other LNA sequences, so it is preferable to avoid significant complementarity within an LNA molecule. Contiguous runs of three or more Gs or Cs, or more than four LNA residues, should be avoided where possible (for example, it may not be possible with very short (e.g., about 9-10 nt) oligonucleotides). In some embodiments, the LNAs are xylo-LNAs.
[0273] For additional information regarding LNA molecules see U.S. Pat. Nos. 6,268,490; 6,734,291; 6,770,748; 6,794,499; 7,034,133; 7,053,207; 7,060,809; 7,084,125; and 7,572,582; and U.S. Pre-Grant Pub. Nos. 20100267018; 20100261175; and 20100035968; Koshkin et al. Tetrahedron 54, 3607-3630 (1998); Obika et al. Tetrahedron Lett. 39, 5401-5404 (1998); Jensen et al., Oligonucleotides 14:130-146 (2004); Kauppinen et al., Drug Disc. Today 2(3):287-290 (2005); and Ponting et al., Cell 136(4):629-641 (2009), and references cited therein.
[0274] As demonstrated herein and previously (see, e.g., WO 2012/065143 and WO 2012/087983, incorporated herein by reference), LNA molecules can be used as a valuable tool to manipulate and aid analysis of RNAs. Advantages offered by an LNA molecule-based system are the relatively low costs, easy delivery, and rapid action. While other inhibitory nucleic acids may exhibit effects after longer periods of time, LNA molecules exhibit effects that are more rapid, e.g., a comparatively early onset of activity, are fully reversible after a recovery period following the synthesis of new RNA, and occur without causing substantial or substantially complete RNA cleavage or degradation. One or more of these design properties may be desired properties of the inhibitory nucleic acids of the invention. Additionally, LNA molecules make possible the systematic targeting of domains within much longer nuclear transcripts. Although a PNA-based system has been described earlier, the effects on Xi were apparent only after 24 hours (Beletskii et al., Proc Natl Acad Sci USA. 2001; 98:9215-9220). The LNA technology enables high-throughput screens for functional analysis of non-coding RNAs and also provides a novel tool to manipulate chromatin states in vivo for therapeutic applications.
[0275] In various related aspects, the methods described herein include using LNA molecules to target RNAs for a number of uses, including as a research tool to probe the function of a specific RNA, e.g., in vitro or in vivo. The methods include selecting one or more desired RNAs, designing one or more LNA molecules that target the RNA, providing the designed LNA molecule, and administering the LNA molecule to a cell or animal. The methods can optionally include selecting a region of the RNA and designing one or more LNA molecules that target that region of the RNA.
[0276] Aberrant imprinted gene expression is implicated in several diseases including Long QT syndrome, Beckwith-Wiedemann, Prader-Willi, and Angelman syndromes, as well as behavioral disorders and carcinogenesis (see, e.g., Falls et al., Am. J. Pathol. 154:635-647 (1999); Lalande, Annu Rev Genet 30:173-195 (1996); Hall Annu Rev Med. 48:35-44 (1997)). LNA molecules can be created to treat such imprinted diseases. As one example, the long QT Syndrome can be caused by a K+ gated Calcium-channel encoded by Kcnq1. This gene is regulated by its antisense counterpart, the long noncoding RNA, Kcnq1ot1 (Pandey et al., Mol Cell. 2008 Oct. 24; 32(2):232-46). Disease arises when Kcnq1ot1 is aberrantly expressed. LNA molecules can be created to downregulate Kcnq1ot1, thereby restoring expression of Kcnq1. As another example, LNA molecules could inhibit RNA cofactors for polycomb complex chromatin modifiers to reverse the imprinted defect.
[0277] From a commercial and clinical perspective, the timepoints between about 1 to 24 hours potentially define a window for epigenetic reprogramming. The advantage of the LNA system is that it works quickly, with a defined half-life, and is therefore reversible upon degradation of LNAs, at the same time that it provides a discrete timeframe during which epigenetic manipulations can be made. By targeting nuclear long RNAs, LNA molecules or similar polymers, e.g., xylo-LNAs, might be utilized to manipulate the chromatin state of cells in culture or in vivo, by transiently eliminating the regulatory RNA and associated proteins long enough to alter the underlying locus for therapeutic purposes. In particular, LNA molecules or similar polymers that specifically bind to, or are complementary to, PRC1-binding RNA can prevent recruitment of PRC1 to a specific chromosomal locus, in a gene-specific fashion.
[0278] LNA molecules might also be administered in vivo to treat other human diseases, such as but not limited to cancer, neurological disorders, infections, inflammation, and myotonic dystrophy. For example, LNA molecules might be delivered to tumor cells to downregulate the biologic activity of a growth-promoting or oncogenic long nuclear RNA (e.g., Gtl2 or MALAT1 (Luo et al., Hepatology. 44(4):1012-24 (2006)), a RNA associated with metastasis and is frequently upregulated in cancers). Repressive RNAs downregulating tumor suppressors can also be targeted by LNA molecules to promote reexpression. For example, expression of the INK4b/ARF/INK4a tumor suppressor locus is controlled by Polycomb group proteins including PRC1 and PRC1 and repressed by the antisense noncoding RNA ANRIL (Yap et al., Mol Cell. 2010 Jun. 11; 38(5):662-74). PRC1-binding regions described herein in ANRIL can be targeted by LNA molecules to promote reexpression of the INK4b/ARF/INK4a tumor suppressor. Some ncRNAs may be positive regulators of oncogenes. Such activating ncRNAs have been described recently (e.g., Jpx (Tian et al., Cell. 143(3):390-403 (2010) and others (rom et al., Cell. 143(1):46-58 (2010)). Therefore, LNA molecules could be directed at these activating ncRNAs to downregulate oncogenes. LNA molecules could also be delivered to inflammatory cells to downregulate regulatory ncRNA that modulate the inflammatory or immune response. (e.g., LincRNA-Cox2, see Guttman et al., Nature. 458(7235):223-7. Epub 2009 Feb. 1 (2009)).
[0279] In still other related aspects, the LNA molecules targeting PRC1-binding regions in RNAs described herein can be used to create animal or cell models of conditions associated with altered gene expression (e.g., as a result of altered epigenetics).
[0280] The methods described herein may also be useful for creating animal or cell models of other conditions associated with aberrant imprinted gene expression, e.g., as noted above.
[0281] In various related aspects, the results described herein demonstrate the utility of LNA molecules for targeting RNA, for example, to transiently disrupt chromatin for purposes of reprogramming chromatin states ex vivo. Because LNA molecules stably displace RNA for hours and chromatin does not rebuild for hours thereafter, LNA molecules create a window of opportunity to manipulate the epigenetic state of specific loci ex vivo, e.g., for reprogramming of hiPS and hESC prior to stem cell therapy. For example, Gtl2 controls expression of DLK1, which modulates the pluripotency of iPS cells. Low Gtl2 and high DLK1 is correlated with increased pluripotency and stability in human iPS cells. Thus, LNA molecules targeting Gtl2 can be used to inhibit differentiation and increase pluripotency and stability of iPS cells.
[0282] See also PCT/US11/60493, which is incorporated by reference herein in its entirety.
[0283] Interfering RNA, Including siRNA/shRNA
[0284] In some embodiments, the inhibitory nucleic acid sequence that is complementary to an RNA can be an interfering RNA, including but not limited to a small interfering RNA (siRNA) or a small hairpin RNA (shRNA). Methods for constructing interfering RNAs are well known in the art. For example, the interfering RNA can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense strands are self-complementary (i.e., each strand comprises nucleotide sequence that is complementary to nucleotide sequence in the other strand; such as where the antisense strand and sense strand form a duplex or double stranded structure); the antisense strand comprises nucleotide sequence that is complementary to a nucleotide sequence in a target nucleic acid molecule or a portion thereof (i.e., an undesired gene) and the sense strand comprises nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof Alternatively, interfering RNA is assembled from a single oligonucleotide, where the self-complementary sense and antisense regions are linked by means of nucleic acid based or non-nucleic acid-based linker(s). The interfering RNA can be a polynucleotide with a duplex, asymmetric duplex, hairpin or asymmetric hairpin secondary structure, having self-complementary sense and antisense regions, wherein the antisense region comprises a nucleotide sequence that is complementary to nucleotide sequence in a separate target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. The interfering can be a circular single-stranded polynucleotide having two or more loop structures and a stem comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof, and wherein the circular polynucleotide can be processed either in vivo or in vitro to generate an active siRNA molecule capable of mediating RNA interference.
[0285] In some embodiments, the interfering RNA coding region encodes a self-complementary RNA molecule having a sense region, an antisense region and a loop region. Such an RNA molecule when expressed desirably forms a hairpin structure, and is referred to herein as an shRNA. The loop region is generally between about 2 and about 10 nucleotides in length. In some embodiments, the loop region is from about 6 to about 9 nucleotides in length. In some embodiments, the sense region and the antisense region are between about 15 and about 20 nucleotides in length. Following post-transcriptional processing, the small hairpin RNA is converted into a siRNA by a cleavage event mediated by the enzyme Dicer, which is a member of the RNase III family. The siRNA is then capable of inhibiting the expression of a gene with which it shares homology. For details, see Brummelkamp et al., Science 296:550-553, (2002); Lee et al, Nature Biotechnol., 20, 500-505, (2002); Miyagishi and Taira, Nature Biotechnol 20:497-500, (2002); Paddison et al. Genes & Dev. 16:948-958, (2002); Paul, Nature Biotechnol, 20, 505-508, (2002); Sui, Proc. Natl. Acad. Sd. USA, 99(6), 5515-5520, (2002); Yu et al. Proc Natl Acad Sci USA 99:6047-6052, (2002).
[0286] The target RNA cleavage reaction guided by siRNAs is highly sequence specific. In general, siRNA containing a nucleotide sequences identical to a portion of the target nucleic acid are preferred for inhibition. However, 100% sequence identity between the siRNA and the target gene is not required to practice the present invention. Thus the invention has the advantage of being able to tolerate sequence variations that might be expected due to genetic mutation, strain polymorphism, or evolutionary divergence. For example, siRNA sequences with insertions, deletions, and single point mutations relative to the target sequence have also been found to be effective for inhibition. Alternatively, siRNA sequences with nucleotide analog substitutions or insertions can be effective for inhibition. In general the siRNAs must retain specificity for their target, i.e., must not directly bind to, or directly significantly affect expression levels of, transcripts other than the intended target.
[0287] Ribozymes
[0288] In some embodiments, the inhibitory nucleic acids are ribozymes. Trans-cleaving enzymatic nucleic acid molecules can also be used; they have shown promise as therapeutic agents for human disease (Usman & McSwiggen, 1995 Ann. Rep. Med. Chem. 30, 285-294; Christoffersen and Marr, 1995 J. Med. Chem. 38, 2023-2037). Enzymatic nucleic acid molecules can be designed to cleave specific RNA targets within the background of cellular RNA. Such a cleavage event renders the RNA non-functional.
[0289] In general, enzymatic nucleic acids with RNA cleaving activity act by first binding to a target RNA. Such binding occurs through the target binding portion of a enzymatic nucleic acid which is held in close proximity to an enzymatic portion of the molecule that acts to cleave the target RNA. Thus, the enzymatic nucleic acid first recognizes and then binds a target RNA through complementary base pairing, and once bound to the correct site, acts enzymatically to cut the target RNA. Strategic cleavage of such a target RNA will destroy its ability to direct synthesis of an encoded protein. After an enzymatic nucleic acid has bound and cleaved its RNA target, it is released from that RNA to search for another target and can repeatedly bind and cleave new targets.
[0290] Several approaches such as in vitro selection (evolution) strategies (Orgel, 1979, Proc. R. Soc. London, B 205, 435) have been used to evolve new nucleic acid catalysts capable of catalyzing a variety of reactions, such as cleavage and ligation of phosphodiester linkages and amide linkages, (Joyce, 1989, Gene, 82, 83-87; Beaudry et al., 1992, Science 257, 635-641; Joyce, 1992, Scientific American 267, 90-97; Breaker et al, 1994, TIBTECH 12, 268; Bartel et al, 1993, Science 261 :1411-1418; Szostak, 1993, TIBS 17, 89-93; Kumar et al, 1995, FASEB J., 9, 1183; Breaker, 1996, Curr. Op. Biotech., 1, 442). The development of ribozymes that are optimal for catalytic activity would contribute significantly to any strategy that employs RNA-cleaving ribozymes for the purpose of regulating gene expression. The hammerhead ribozyme, for example, functions with a catalytic rate (kcat) of about 1 min.sup.1 in the presence of saturating (10 MM) concentrations of Mg.sup.2+ cofactor. An artificial RNA ligase ribozyme has been shown to catalyze the corresponding self-modification reaction with a rate of about 100 min.sup.1. In addition, it is known that certain modified hammerhead ribozymes that have substrate binding arms made of DNA catalyze RNA cleavage with multiple turn-over rates that approach 100 min.sup.1.
[0291] Making and Using Inhibitory Nucleic Acids
[0292] The nucleic acid sequences used to practice the methods described herein, whether RNA, cDNA, genomic DNA, vectors, viruses or hybrids thereof, can be isolated from a variety of sources, genetically engineered, amplified, and/or expressed/generated recombinantly. If desired, nucleic acid sequences of the invention can be inserted into delivery vectors and expressed from transcription units within the vectors. The recombinant vectors can be DNA plasmids or viral vectors. Generation of the vector construct can be accomplished using any suitable genetic engineering techniques well known in the art, including, without limitation, the standard techniques of PCR, oligonucleotide synthesis, restriction endonuclease digestion, ligation, transformation, plasmid purification, and DNA sequencing, for example as described in Sambrook et al. Molecular Cloning: A Laboratory Manual. (1989)), Coffin et al. (Retroviruses. (1997)) and RNA Viruses: A Practical Approach (Alan J. Cann, Ed., Oxford University Press, (2000)).
[0293] Preferably, inhibitory nucleic acids of the invention are synthesized chemically. Nucleic acid sequences used to practice this invention can be synthesized in vitro by well-known chemical synthesis techniques, as described in, e.g., Adams (1983) J. Am. Chem. Soc. 105:661; Belousov (1997) Nucleic Acids Res. 25:3440-3444; Frenkel (1995) Free Radic. Biol. Med. 19:373-380; Blommers (1994) Biochemistry 33:7886-7896; Narang (1979) Meth. Enzymol. 68:90; Brown (1979) Meth. Enzymol. 68:109; Beaucage (1981) Tetra. Lett. 22:1859; U.S. Pat. No. 4,458,066; WO/2008/043753 and WO/2008/049085, and the refences cited therein.
[0294] Nucleic acid sequences of the invention can be stabilized against nucleolytic degradation such as by the incorporation of a modification, e.g., a nucleotide modification. For example, nucleic acid sequences of the invention includes a phosphorothioate at least the first, second, or third internucleotide linkage at the 5 or 3 end of the nucleotide sequence. As another example, the nucleic acid sequence can include a 2-modified nucleotide, e.g., a 2-deoxy, 2-deoxy-2-fluoro, 2-O-methyl, 2-O-methoxyethyl (2-O-MOE), 2-O-aminopropyl (2-O-AP), 2-O-dimethylaminoethyl (2-O-DMAOE), 2-O-dimethylaminopropyl (2-O-DMAP), 2-O-dimethylaminoethyloxyethyl (2-O-DMAEOE), or 2-ON-methylacetamido (2-ONMA). As another example, the nucleic acid sequence can include at least one 2-O-methyl-modified nucleotide, and in some embodiments, all of the nucleotides include a 2-O-methyl modification. In some embodiments, the nucleic acids are locked, i.e., comprise nucleic acid analogues in which the ribose ring is locked by a methylene bridge connecting the 2-O atom and the 4-C atom (see, e.g., Kaupinnen et al., Drug Disc. Today 2(3):287-290 (2005); Koshkin et al., J. Am. Chem. Soc., 120(50):13252-13253 (1998)). For additional modifications see US 20100004320, US 20090298916, and US 20090143326.
[0295] It is understood that any of the modified chemistries or formats of inhibitory nucleic acids described herein can be combined with each other, and that one, two, three, four, five, or more different types of modifications can be included within the same molecule.
[0296] Techniques for the manipulation of nucleic acids used to practice this invention, such as, e.g., subcloning, labeling probes (e.g., random-primer labeling using Klenow polymerase, nick translation, amplification), sequencing, hybridization and the like are well described in the scientific and patent literature, see, e.g., Sambrook et al., Molecular Cloning; A Laboratory Manual 3d ed. (2001); Current Protocols in Molecular Biology, Ausubel et al., eds. (John Wiley & Sons, Inc., New York 2010); Kriegler, Gene Transfer and Expression: A Laboratory Manual (1990); Laboratory Techniques In Biochemistry And Molecular Biology: Hybridization With Nucleic Acid Probes, Part I. Theory and Nucleic Acid Preparation, Tijssen, ed. Elsevier, N.Y. (1993).
[0297] Pharmaceutical Compositions
[0298] The methods described herein can include the administration of pharmaceutical compositions and formulations comprising inhibitory nucleic acid sequences designed to target an RNA.
[0299] In some embodiments, the compositions are formulated with a pharmaceutically acceptable carrier. The pharmaceutical compositions and formulations can be administered parenterally, topically, orally or by local administration, such as by aerosol or transdermally. The pharmaceutical compositions can be formulated in any way and can be administered in a variety of unit dosage forms depending upon the condition or disease and the degree of illness, the general medical condition of each patient, the resulting preferred method of administration and the like. Details on techniques for formulation and administration of pharmaceuticals are well described in the scientific and patent literature, see, e.g., Remington: The Science and Practice of Pharmacy, 21st ed., 2005.
[0300] The inhibitory nucleic acids can be administered alone or as a component of a pharmaceutical formulation (composition). The compounds may be formulated for administration, in any convenient way for use in human or veterinary medicine. Wetting agents, emulsifiers and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the compositions.
[0301] Formulations of the compositions of the invention include those suitable for intradermal, inhalation, oral/nasal, topical, parenteral, rectal, and/or intravaginal administration. The formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. The amount of active ingredient (e.g., nucleic acid sequences of this invention) which can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated, the particular mode of administration, e.g., intradermal or inhalation. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound which produces a therapeutic effect, e.g., an antigen specific T cell or humoral response.
[0302] Pharmaceutical formulations of this invention can be prepared according to any method known to the art for the manufacture of pharmaceuticals. Such drugs can contain sweetening agents, flavoring agents, coloring agents and preserving agents. A formulation can be admixtured with nontoxic pharmaceutically acceptable excipients which are suitable for manufacture. Formulations may comprise one or more diluents, emulsifiers, preservatives, buffers, excipients, etc. and may be provided in such forms as liquids, powders, emulsions, lyophilized powders, sprays, creams, lotions, controlled release formulations, tablets, pills, gels, on patches, in implants, etc.
[0303] Pharmaceutical formulations for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in appropriate and suitable dosages. Such carriers enable the pharmaceuticals to be formulated in unit dosage forms as tablets, pills, powder, dragees, capsules, liquids, lozenges, gels, syrups, slurries, suspensions, etc., suitable for ingestion by the patient. Pharmaceutical preparations for oral use can be formulated as a solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable additional compounds, if desired, to obtain tablets or dragee cores. Suitable solid excipients are carbohydrate or protein fillers include, e.g., sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxy-methylcellulose; and gums including arabic and tragacanth; and proteins, e.g., gelatin and collagen. Disintegrating or solubilizing agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate. Push-fit capsules can contain active agents mixed with a filler or binders such as lactose or starches, lubricants such as talc or magnesium stearate, and, optionally, stabilizers. In soft capsules, the active agents can be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycol with or without stabilizers.
[0304] Aqueous suspensions can contain an active agent (e.g., nucleic acid sequences of the invention) in admixture with excipients suitable for the manufacture of aqueous suspensions, e.g., for aqueous intradermal injections. Such excipients include a suspending agent, such as sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia, and dispersing or wetting agents such as a naturally occurring phosphatide (e.g., lecithin), a condensation product of an alkylene oxide with a fatty acid (e.g., polyoxyethylene stearate), a condensation product of ethylene oxide with a long chain aliphatic alcohol (e.g., heptadecaethylene oxycetanol), a condensation product of ethylene oxide with a partial ester derived from a fatty acid and a hexitol (e.g., polyoxyethylene sorbitol mono-oleate), or a condensation product of ethylene oxide with a partial ester derived from fatty acid and a hexitol anhydride (e.g., polyoxyethylene sorbitan mono-oleate). The aqueous suspension can also contain one or more preservatives such as ethyl or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents and one or more sweetening agents, such as sucrose, aspartame or saccharin. Formulations can be adjusted for osmolarity.
[0305] In some embodiments, oil-based pharmaceuticals are used for administration of nucleic acid sequences of the invention. Oil-based suspensions can be formulated by suspending an active agent in a vegetable oil, such as arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin; or a mixture of these. See e.g., U.S. Pat. No. 5,716,928 describing using essential oils or essential oil components for increasing bioavailability and reducing inter- and intra-individual variability of orally administered hydrophobic pharmaceutical compounds (see also U.S. Pat. No. 5,858,401). The oil suspensions can contain a thickening agent, such as beeswax, hard paraffin or cetyl alcohol. Sweetening agents can be added to provide a palatable oral preparation, such as glycerol, sorbitol or sucrose. These formulations can be preserved by the addition of an antioxidant such as ascorbic acid. As an example of an injectable oil vehicle, see Minto (1997) J. Pharmacol. Exp. Ther. 281:93-102.
[0306] Pharmaceutical formulations can also be in the form of oil-in-water emulsions. The oily phase can be a vegetable oil or a mineral oil, described above, or a mixture of these. Suitable emulsifying agents include naturally-occurring gums, such as gum acacia and gum tragacanth, naturally occurring phosphatides, such as soybean lecithin, esters or partial esters derived from fatty acids and hexitol anhydrides, such as sorbitan mono-oleate, and condensation products of these partial esters with ethylene oxide, such as polyoxyethylene sorbitan mono-oleate. The emulsion can also contain sweetening agents and flavoring agents, as in the formulation of syrups and elixirs. Such formulations can also contain a demulcent, a preservative, or a coloring agent. In alternative embodiments, these injectable oil-in-water emulsions of the invention comprise a paraffin oil, a sorbitan monooleate, an ethoxylated sorbitan monooleate and/or an ethoxylated sorbitan trioleate.
[0307] The pharmaceutical compounds can also be administered by in intranasal, intraocular and intravaginal routes including suppositories, insufflation, powders and aerosol formulations (for examples of steroid inhalants, see e.g., Rohatagi (1995) J. Clin. Pharmacol. 35:1187-1193; Tjwa (1995) Ann. Allergy Asthma Immunol. 75:107-111). Suppositories formulations can be prepared by mixing the drug with a suitable non-irritating excipient which is solid at ordinary temperatures but liquid at body temperatures and will therefore melt in the body to release the drug. Such materials are cocoa butter and polyethylene glycols.
[0308] In some embodiments, the pharmaceutical compounds can be delivered transdermally, by a topical route, formulated as applicator sticks, solutions, suspensions, emulsions, gels, creams, ointments, pastes, jellies, paints, powders, and aerosols.
[0309] In some embodiments, the pharmaceutical compounds can also be delivered as microspheres for slow release in the body. For example, microspheres can be administered via intradermal injection of drug which slowly release subcutaneously; see Rao (1995) J. Biomater Sci. Polym. Ed. 7:623-645; as biodegradable and injectable gel formulations, see, e.g., Gao (1995) Pharm. Res. 12:857-863 (1995); or, as microspheres for oral administration, see, e.g., Eyles (1997) J. Pharm. Pharmacol. 49:669-674.
[0310] In some embodiments, the pharmaceutical compounds can be parenterally administered, such as by intravenous (IV) administration or administration into a body cavity or lumen of an organ. These formulations can comprise a solution of active agent dissolved in a pharmaceutically acceptable carrier. Acceptable vehicles and solvents that can be employed are water and Ringer's solution, an isotonic sodium chloride. In addition, sterile fixed oils can be employed as a solvent or suspending medium. For this purpose any bland fixed oil can be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid can likewise be used in the preparation of injectables. These solutions are sterile and generally free of undesirable matter. These formulations may be sterilized by conventional, well known sterilization techniques. The formulations may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions such as pH adjusting and buffering agents, toxicity adjusting agents, e.g., sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate and the like. The concentration of active agent in these formulations can vary widely, and will be selected primarily based on fluid volumes, viscosities, body weight, and the like, in accordance with the particular mode of administration selected and the patient's needs. For IV administration, the formulation can be a sterile injectable preparation, such as a sterile injectable aqueous or oleaginous suspension. This suspension can be formulated using those suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation can also be a suspension in a nontoxic parenterally-acceptable diluent or solvent, such as a solution of 1,3-butanediol. The administration can be by bolus or continuous infusion (e.g., substantially uninterrupted introduction into a blood vessel for a specified period of time).
[0311] In some embodiments, the pharmaceutical compounds and formulations can be lyophilized. Stable lyophilized formulations comprising an inhibitory nucleic acid can be made by lyophilizing a solution comprising a pharmaceutical of the invention and a bulking agent, e.g., mannitol, trehalose, raffinose, and sucrose or mixtures thereof. A process for preparing a stable lyophilized formulation can include lyophilizing a solution about 2.5 mg/mL protein, about 15 mg/mL sucrose, about 19 mg/mL NaCl, and a sodium citrate buffer having a pH greater than 5.5 but less than 6.5. See, e.g., U.S. 20040028670.
[0312] The compositions and formulations can be delivered by the use of liposomes. By using liposomes, particularly where the liposome surface carries ligands specific for target cells, or are otherwise preferentially directed to a specific organ, one can focus the delivery of the active agent into target cells in vivo. See, e.g., U.S. Pat. Nos. 6,063,400; 6,007,839; Al-Muhammed (1996) J. Microencapsul. 13:293-306; Chonn (1995) Curr. Opin. Biotechnol. 6:698-708; Ostro (1989) Am. J. Hosp. Pharm. 46:1576-1587. As used in the present invention, the term liposome means a vesicle composed of amphiphilic lipids arranged in a bilayer or bilayers. Liposomes are unilamellar or multilamellar vesicles that have a membrane formed from a lipophilic material and an aqueous interior that contains the composition to be delivered. Cationic liposomes are positively charged liposomes that are believed to interact with negatively charged DNA molecules to form a stable complex. Liposomes that are pH-sensitive or negatively-charged are believed to entrap DNA rather than complex with it. Both cationic and noncationic liposomes have been used to deliver DNA to cells.
[0313] Liposomes can also include sterically stabilized liposomes, i.e., liposomes comprising one or more specialized lipids. When incorporated into liposomes, these specialized lipids result in liposomes with enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome comprises one or more glycolipids or is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. Liposomes and their uses are further described in U.S. Pat. No. 6,287,860.
[0314] The formulations of the invention can be administered for prophylactic and/or therapeutic treatments. In some embodiments, for therapeutic applications, compositions are administered to a subject who is need of reduced triglyceride levels, or who is at risk of or has a disorder described herein, in an amount sufficient to cure, alleviate or partially arrest the clinical manifestations of the disorder or its complications; this can be called a therapeutically effective amount. For example, in some embodiments, pharmaceutical compositions of the invention are administered in an amount sufficient to decrease serum levels of triglycerides in the subject.
[0315] The amount of pharmaceutical composition adequate to accomplish this is a therapeutically effective dose. The dosage schedule and amounts effective for this use, i.e., the dosing regimen, will depend upon a variety of factors, including the stage of the disease or condition, the severity of the disease or condition, the general state of the patient's health, the patient's physical status, age and the like. In calculating the dosage regimen for a patient, the mode of administration also is taken into consideration.
[0316] The dosage regimen also takes into consideration pharmacokinetics parameters well known in the art, i.e., the active agents' rate of absorption, bioavailability, metabolism, clearance, and the like (see, e.g., Hidalgo-Aragones (1996) J. Steroid Biochem. Mol. Biol. 58:611-617; Groning (1996) Pharmazie 51:337-341; Fotherby (1996) Contraception 54:59-69; Johnson (1995) J. Pharm. Sci. 84:1144-1146; Rohatagi (1995) Pharmazie 50:610-613; Brophy (1983) Eur. J. Clin. Pharmacol. 24:103-108; Remington: The Science and Practice of Pharmacy, 21st ed., 2005). The state of the art allows the clinician to determine the dosage regimen for each individual patient, active agent and disease or condition treated. Guidelines provided for similar compositions used as pharmaceuticals can be used as guidance to determine the dosage regiment, i.e., dose schedule and dosage levels, administered practicing the methods of the invention are correct and appropriate.
[0317] Single or multiple administrations of formulations can be given depending on for example: the dosage and frequency as required and tolerated by the patient, the degree and amount of therapeutic effect generated after each administration (e.g., effect on tumor size or growth), and the like. The formulations should provide a sufficient quantity of active agent to effectively treat, prevent or ameliorate conditions, diseases or symptoms.
[0318] In alternative embodiments, pharmaceutical formulations for oral administration are in a daily amount of between about 1 to 100 or more mg per kilogram of body weight per day. Lower dosages can be used, in contrast to administration orally, into the blood stream, into a body cavity or into a lumen of an organ. Substantially higher dosages can be used in topical or oral administration or administering by powders, spray or inhalation. Actual methods for preparing parenterally or non-parenterally administrable formulations will be known or apparent to those skilled in the art and are described in more detail in such publications as Remington: The Science and Practice of Pharmacy, 21st ed., 2005.
[0319] Various studies have reported successful mammalian dosing using complementary nucleic acid sequences. For example, Esau C., et al., (2006) Cell Metabolism, 3(2):87-98 reported dosing of normal mice with intraperitoneal doses of miR-122 antisense oligonucleotide ranging from 12.5 to 75 mg/kg twice weekly for 4 weeks. The mice appeared healthy and normal at the end of treatment, with no loss of body weight or reduced food intake. Plasma transaminase levels were in the normal range (AST 45, ALT 35) for all doses with the exception of the 75 mg/kg dose of miR-122 ASO, which showed a very mild increase in ALT and AST levels. They concluded that 50 mg/kg was an effective, non-toxic dose. Another study by Krtzfeldt J., et al., (2005) Nature 438, 685-689, injected anatgomirs to silence miR-122 in mice using a total dose of 80, 160 or 240 mg per kg body weight. The highest dose resulted in a complete loss of miR-122 signal. In yet another study, locked nucleic acid molecules (LNA molecules) were successfully applied in primates to silence miR-122. Elmen J., et al., (2008) Nature 452, 896-899, report that efficient silencing of miR-122 was achieved in primates by three doses of 10 mg kg-1 LNA-antimiR, leading to a long-lasting and reversible decrease in total plasma cholesterol without any evidence for LNA-associated toxicities or histopathological changes in the study animals.
[0320] In some embodiments, the methods described herein can include co-administration with other drugs or pharmaceuticals, e.g., compositions for providing cholesterol homeostasis. For example, the inhibitory nucleic acids can be co-administered with drugs for treating or reducing risk of a disorder described herein.
EXAMPLES
[0321] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.
[0322] Materials and Methods
[0323] The following materials and methods were used in the Examples set forth below.
[0324] Experimental Model and Subject Details
[0325] EL 16.7 (129/Cas) mouse female embryonic stem cells were described previously (Lee and Lu, 1999). Cbx7+/+ and Cbx7/ mouse embryonic stem cell lines were generated by Dr. Bo Cheng in the laboratory of Dr. T. Kerppola (University of Michigan) as described in (Cheng et al., 2014), and kindly provided by Dr. Xiaojun Ren (University of Colorado). All stem cell lines were routinely maintained in 500 U/ml LIF, DME, and 15% FCS on gamma-irradiated mouse embryonic fibroblasts feeder layer. For differentiation, 710.sup.5 cells were plated on pre-gelatinized 150 mm TC plates and grown in monolayer for 7 days in DME+15% FBS without LIF. HEK293 cells were routinely maintained in DME+10% FBS.
[0326] Stable Transfection
[0327] The following plasmid vectors were used for stable transfection into EL16.7 ES cells:
[0328] pCAGGSmouse CBX7-Flag-HA-IRES-Puro-GFP plasmid was used for stable expression of HA-tagged CBX7 for ChIP-seq experiments. pCAGGS-IRES-Puro-GFP plasmid was a kind gift from Dr. Mitinori Saitou (Kyoto University, Japan).
[0329] pEF1aBirAV5His plasmid was utilized for stable expression of V5-His-tagged BirA bacterial biotinylase in EL16.7 ES cells.
[0330] pEF1a-Flag-biotag-PGKpuro-mCBX7 and pEF1a-Flag-biotag-PGKpuro-mRYBP plasmids were employed for stable transfection of mouse CBX7 and RYBP carrying biotinylation tag in EL16.7 cells expressing BirA biotinylase.
[0331] pCAG-Avi-GFP-hCBX7-IRES-Puro plasmid was employed for stable transfection of human CBX7 carrying biotinylation tag in HEK293 cells expressing BirA biotinylase.
[0332] pEF1aBirAV5His and pEF1-Flag-Biotag plasmid vectors were a kind gift from Dr. Stuart Orkin (Harvard Medical School) and have been described previously by Kim et al (Kim et al., 2009).
[0333] pCAG-Avi-GFP-IRES-Puro plasmid was a kind gift from Dr. Mitinori Saitou, Department of Anatomy and Cell Biology, Graduate School of Medicine, Kyoto University.
[0334] To create mouse ES cells with stable expression of recombinant proteins, EL 16.7 mouse ES cells were grown to 70% confluence on embryonic feeder layer in T75 flasks. Cells were trypsinized and 210.sup.7 cells electroporated with 30 g of linearized vector in PBS using GenePulser II (Bio-Rad). Positive cells were selected using growth media supplemented with 1 g/ml Puromycin (Gibco) alone or in combination with 300 g/ml G418. To create HEK293 cells with stable expression of recombinant proteins, cells were grown to 70% confluence in T75 flasks. Cells were trypsinized and 110.sup.7 cells electroporated with 15 g of linearized vector in PBS using GenePulser II (Bio-Rad). Positive cells were selected using growth media supplemented with 1 g/ml Puromycin (Gibco) alone or in combination with 300 g/ml G418. Stable transfection and expression of recombinant proteins was confirmed by PCR genotyping and Western blotting with specific antibodies.
[0335] CLIP MethodSmall Scale
[0336] The conventional CLIP method was performed as described previously (Jeon and Lee, 2011). Cells were grown to full confluence in 15 cm tissue culture dishes. Medium was then aspirated and cells were washed with 10 ml ice-cold phosphate-buffered saline (PBS) (containing 8.1 mM Na.sub.2HPO.sub.4, 1.45 mM KH.sub.2PO.sub.4, 137 mM NaCl, 2.7 mM KCL, pH 7.4). To covalently cross-link protein-RNA complexes in vivo, ice-cold PBS (5 ml) was added to cells, lid was removed and cells were exposed to 400 mJ/cm.sup.2 irradiation in a wavelength of 254 nm. After adding 5 ml of ice-cold PBS, cross-linked cells were scraped and collected into 16 ml tubes. Cells were pelleted by 5 min centrifugation (1,000G) in 4 C. Supernatant was removed and cell pellets were shock-frozen in liquid nitrogen and stored in 80 C. Protein G Dynabeads (Life Technologies) were utilized for pre-clearing and immunoprecipitation. Beads were thoroughly resuspended, and a volume of beads corresponding to 20 l beadsnumber of samples+5 l was transferred into a clean 1.5 ml tube. Beads were then captured on magnetic separator. Pre-clearing beads were washed 3 times with 1 ml lysis buffer (PBS supplemented with 1 mM MgCl.sub.2, 0.1 mM CaCl.sub.2, 0.5% Nonidet-P-40, and 0.5% Sodium Deoxycholate). Beads were resuspended in 100 l lysis buffer per 20 l beads and 100 l portions transferred into 1.5 ml tubes. Beads for immunoprecipitation were washed 3 times with 1 ml lysis buffer (PBS supplemented with 1 mM MgCl.sub.2, 0.1 mM CaCl.sub.2, 0.5% Nonidet-P-40, and 0.5% Sodium Deoxycholate)+0.5% BSA. Beads were resuspended in 100 l lysis buffer per 20 l beads and 100 l portions transferred into 1.5 ml tubes. 400 l lysis buffer+0.5% BSA+5 g of specific antibody were added and beads incubated 4 hrs in 4 C. on a rotatory wheel. To prepare cell lysate, cell pellets (1 pellet for each cell type) were resuspended in 1.25 ml of ice-cold lysis buffer supplemented with 1 tablet of Complete-mini EDTA-free tablet (Roche), 40 u/ml protector RNAse inhibitor (Roche), 1 mM Dithiothreitol (DTT), and transferred into 2 ml tube followed by 25 min incubation in 4 C. on rotatory wheel. After a brief spin down, 25 l (50 U) of TurboDNAse (Life Technologies) were added to each tube. The entire content of each tube was then split equally between four 1.5 ml tubes. Two dilutions of RNAse I (Life Technologies) in lysis buffer containing additives were prepared: 10-fold (10 u/ml) and 100-fold (1 u/ml). Per each of the cell lines, three samples were prepared in growing concentrations of RNAse I: (1) undiluted RNAse I (1) (2) 10-fold diluted, and (3) 100-fold diluted. Volume of RNAse I solution corresponded to 1/100th of total sample volume. The final dilutions of RNAse I were correspondingly 100-fold, 1,000-fold and 10,000-fold. In parallel, a fourth sample, untreated with RNAse I, was prepared and used as immunoprecipitation control for Western Blotting. Samples were thoroughly mixed, incubated for 15 min in a 37 C. water bath, and were gently mixed every 5 min. After a brief spin-down, each sample received 6 l (12 U) of SuperRNAseIN (Life Technologies) 10-fold diluted in lysis buffer. Sodium dodecyl sulfate (SDS) concentrations per each sample were further brought up to 0.1% following by addition of 1/100th volume of 10% SDS. After 10 min 21,130G centrifugation in 4 C., supernatant was transferred into a clean 1.5 ml tube and sample was centrifuged for another 10 min 21,130G in 4 C. to remove remaining cell debris. 1.5 ml tubes supplemented with 100 l of pre-clearing beads were put on magnetic separator and lysis buffer was removed. The entire supernatant from the previous step was placed on the beads and samples were further incubated 1 hr in 4 C. on a rotatory wheel. After capturing pre-clearing beads on magnetic separator, pre-cleared lysate samples were transferred into 1.5 ml tubes with protein G-antibody complex and incubated for 16 hrs in 4 C. on a rotatory wheel. Samples were placed on a magnetic separator and supernatant was removed. Samples were washed twice with 1 ml high-salt buffer (PBS supplemented with 750 mM NaCl, 1% Nonidet-P-40, 0.5% NaDeoxycholate, and 0.1% SDS) and three times with 1 ml low-salt buffer (PBS supplemented with 150 mM NaCl, 1% Nonidet-P-40, 0.5% NaDeoxycholate, and 0.1% SDS) for 5 min at 4 C. on a rotatory wheel per every wash, following by supernatant removal on a magnetic separator. IP control samples received 40 l of NuPage 3 LDS sample buffer (Life Technologies), or alternatively, 40 l SDS sample buffer 1 (80 mM Tris pH 6.8, 2% SDS, 100 mM DTT, and 10% Glycerol). In the remaining RNAse-treated samples, beads were resuspended in 400 l 1 DNAse buffer (Life Technologies) and incubated for 5 min at 4 C. on a rotatory wheel followed by subsequent supernatant removal on a magnetic separator. Beads were resuspended in 40 l of DNAse mix (1 DNAse buffer, 0.1 u/l Turbo DNAse, 0.1 u/l SUPERasin (Life Technologies), 100-fold diluted EDTA-free protease inhibitors mix (Sigma), 0.4 u/l Protector RNAse inhibitor) and incubated at 37 C. for 30 min. After a brief spin down, beads were placed on a magnetic rack and supernatant was removed. One wash with 0.5 ml low-salt washing buffer was performed for 5 min at 4 C. placed on a rotatory wheel. Supernatant was removed on a magnetic separator. For phosphorylation of 5 ends, supernatant was removed on a magnetic separator and beads were washed once in 1 ml of PNK buffer (50 mM Tris pH 7.4, 10 mM MgCl.sub.2, 5 mM DTT, 0.5% Nonidet-P-40) for 5 min at 4 C. placed on a rotatory wheel. Beads were then resuspended in 20 l of PNK mix (per sample, 20 l PNK buffer, 1 l .sup.32P-gamma-ATP, 0.5 l (5 U) T4 Polynucleotide Kinase (PNK) (NEB)) and incubated at 37 C. for 20 min. Beads were captured and supernatant was removed on a magnetic separator. Beads were instantly washed 3 times with 0.5 ml of ice-cold PNK washing buffer (50 mM Tris pH 7.4, 150 mM NaCl, 0.5% Nonidet-P-40, 10 mM EDTA). After the last wash, beads were resuspended in 40 l of NuPage 3 LDS sample buffer (Life Technologies), or alternatively, in 40 l of SDS sample buffer 1 (80 mM Tris pH 6.8, 2% SDS, 100 mM DTT, 10% Glycerol). 3 LDS samples were incubated at 80 C. for 10 min. Samples with 1 SDS sample buffer were incubated at 95 C. for 5 min. Samples were then loaded on 1 mm NuPage 4%-12% Bis-Tris gradient gel (Life Technologies), and electrophoresis on 200V was performed using NuPage MOPS/SDS running buffer (50 mM Tris base, 50 mM MOPS, 0.1% SDS, 1 mM EDTA, pH 7.7). Transfer into nitrocellulose membranes was performed for 1 hr under 140 mA at 4 C., soaking in NuPage 1 transfer buffer (25 mM Bicine, 25 mM Bis-Tris (free base) 1 mM EDTA pH 7.2) supplemented with 12% methanol. Membrane was wrapped in saran plastic wrap and exposed to phosphoimager screen.
[0337] Denaturing CLIP MethodSmall Scale
[0338] To perform the denaturing CLIP method, we raised by DNA vectors transfection, following by antibiotic selection, several cell lines expressing (1) a bacterial biotin ligase BirA vector carrying a neomycin-resistance marker, along with (2) a puromycin resistance expression vector of mouse CBX7 fused to a biotinylation tag. An empty biotinylation vector was alternatively transfected for generating control cell lines. Cells were grown to full confluence in 15 cm tissue culture dishes. Medium was then aspirated and cells were washed with 10 ml ice-cold phosphate-buffered saline (PBS) (containing 8.1 mM Na.sub.2HPO.sub.4, 1.45 mM KH.sub.2PO.sub.4, 137 mM NaCl, 2.7 mM KCL, pH 7.4). To covalently cross-link protein-RNA complexes in vivo, ice-cold PBS (5 ml) was added to cells, lid was removed and cells were exposed to 400 mJ/cm.sup.2 irradiation in a wavelength of 254 nm. Day 7 differentiated cells grown in monolayer as well as HEK293 cells were exposed to 150 mJ/cm.sup.2 irradiation in a wavelength of 254 nm. After adding 5 ml of ice-cold PBS, cross-linked cells were scraped and collected into 16 ml tubes. Cells were pelleted by 5 min centrifugation (1,000G) in 4 C. Supernatant was removed and cell pellets were shock-frozen in liquid nitrogen and stored in 80 C. For performing protein pull-down, two types of magnetic beads were employed: (1) Protein G Dynabeads (for pre-clearing), and (2) Dynabeads MyOne Streptavidin C1 (for biotinylated protein pull-down)both bead types from Life Technologies. Beads were thoroughly resuspended, and a volume of beads corresponding to 20 l beadsnumber of samples+5 l was transferred into a clean 1.5 ml tube. Beads were then captured on magnetic separator. Pre-clearing beads were washed 3 times with 1 ml lysis buffer (PBS supplemented with 1 mM MgCl.sub.2, 0.1 mM CaCl.sub.2, 0.5% Nonidet-P-40, and 0.5% Sodium Deoxycholate). Streptavidin beads were washed 3 times with 1 ml lysis buffer containing 0.5% Bovine serum albumin (BSA). Beads were resuspended in 100 l lysis buffer per 20 l beads and 100 l portions transferred into 1.5 ml tubes. Cell lysate was prepared the following manner: Cell pellets (1 pellet for each cell type) were resuspended in 1.25 ml of ice-cold lysis buffer (supplemented with 1 tablet of Complete-mini EDTA-free tablet (Roche), 40 u/ml protector RNAse inhibitor (Roche), 1 mM Dithiothreitol (DTT)), and transferred into 2 ml tube following by 25 min incubation in 4 C. on rotatory wheel. After a brief spin down, 25 l (50 U) of TurboDNAse (Life Technologies) were added to each tube. The entire content of each tube was then split equally between four 1.5 ml tubes. Two dilutions of RNAse I (Life Technologies) in lysis buffer containing additives were prepared: 10-fold (10 u/ml) and 100-fold (1 u/ml). Per each of the cell lines, three samples were prepared in growing concentrations of RNAse I: (1) undiluted RNAse I (1) (2) 10-fold diluted, and (3) 100-fold diluted. Volume of RNAse I solution corresponded to 1/100th of total sample volume. The final dilutions of RNAse I were correspondingly: 100-fold, 1,000-fold and 10,000-fold. In parallel, a fourth sample, untreated with RNAse I, was prepared and used as a pull-down control for Western Blotting. Samples were thoroughly mixed, incubated for 15 min in a 37 C. water bath, and were gently mixed every 5 min. After a brief spin-down, each sample received 6 l (12 U) of SuperRNAseIN (Life Technologies) 10-fold diluted in lysis buffer. Sodium dodecyl sulfate (SDS) concentrations per each sample were further brought up to 0.1% following by addition of 1/100th volume of 10% SDS. After 10 min 21,130G centrifugation in 4 C., supernatant was transferred into a clean 1.5 ml tube and samples were centrifuged for another 10 min 21,130G in 4 C. to remove remaining cell debris. 1.5 ml tubes supplemented with 100 l of pre-clearing beads were put on magnetic separator and lysis buffer was removed. The entire supernatant from the previous step was placed on the beads and samples were further incubated for 1 hr in 4 C. on a rotatory wheel. 1.5 ml tubes containing streptavidin beads were placed on a magnetic separator and any excess of lysis buffer was removed. After capturing pre-clearing beads on magnetic separator, pre-cleared lysate samples were transferred into 1.5 ml tubes supplemented with streptavidin beads and incubated for 2 hrs in 4 C. on a rotatory wheel. Samples were placed on a magnetic separator and supernatant was removed. Samples were washed twice with 0.5 ml wash buffer 1 (PBS containing 8M Urea and 0.1% SDS) for 5 min at room temperature swirling on rotatory wheel. Supernatant was removed by employing magnetic separator each time. Samples were washed twice with 0.5 ml Urea wash buffer (PBS+8M urea+0.1% SDS) and twice with 0.5 ml SDS wash buffer (PBS+2% SDS) for 5 min at room temperature and were swirled on a rotatory wheel. Supernatant was removed on magnetic separator per each cycle. One wash was performed with 0.5 ml high-salt buffer (PBS supplemented with 750 mM NaCl, 1% Nonidet-P-40, 0.5% NaDeoxycholate, and 0.1% SDS) and one time with 0.5 ml low-salt buffer (PBS supplemented with 150 mM NaCl, 1% Nonidet-P-40, 0.5% NaDeoxycholate, and 0.1% SDS) for 5 min at 4 C. on a rotatory wheel per every wash, following by supernatant removal on a magnetic separator. IP control samples received 40 l of NuPage 3 LDS sample buffer (Life Technologies), or alternatively, 40 l SDS sample buffer 1 (80 mM Tris pH 6.8, 2% SDS, 100 mM DTT, and 10% Glycerol). In the remaining RNAse-treated samples, beads were resuspended in 400 l 1 DNAse buffer (Life Technologies) and incubated for 5 min at 4 C. on a rotatory wheel followed by subsequent supernatant removal on a magnetic separator. Beads were resuspended in 40 l of DNAse mix (1 DNAse buffer, 0.1 u/l Turbo DNAse, 0.1 u/l SUPERasin (Life Technologies), 100-fold diluted EDTA-free protease inhibitors mix (Sigma), 0.4 u/l Protector RNAse inhibitor) and incubated at 37 C. for 30 min. After a brief spin down, beads were placed on a magnetic rack and supernatant was removed. One wash with 0.5 ml low-salt washing buffer was performed for 5 min at 4 C. placed on a rotatory wheel. Supernatant was removed on a magnetic separator. For phosphorylation of 5 ends, supernatant was removed on a magnetic separator and beads were washed once in 0.5 ml of PNK buffer (50 mM Tris pH 7.4, 10 mM MgCl.sub.2, 5 mM DTT, 0.5% Nonidet-P-40) for 5 min at 4 C. placed on a rotatory wheel. Beads were then resuspended in 20 l of PNK mix (per sample, 20 l PNK buffer, 1 l .sup.32P-gamma-ATP, 0.5 l (5 U) T4 Polynucleotide Kinase (PNK) (NEB)) and incubated at 37 C. for 20 min. Beads were captured and supernatant was removed on a magnetic separator. Beads were instantly washed 3 times with 0.5 ml of ice-cold PNK washing buffer (50 mM Tris pH 7.4, 150 mM NaCl, 0.5% Nonidet-P-40, 10 mM EDTA). After the last wash, beads were resuspended in 40 l of NuPage 3 LDS sample buffer (Life Technologies), or alternatively, in 40 l of SDS sample buffer 1 (80 mM Tris pH 6.8, 2% SDS, 100 mM DTT, 10% Glycerol). 3 LDS samples were incubated at 80 C. for 10 min. Samples in 1 SDS sample were incubated at 95 C. for 5 min. Samples were then loaded on lmm NuPage 4%-12% Bis-Tris gradient gel (Life Technologies), and electrophoresis on 200V was performed using NuPage MOPS/SDS running buffer (50 mM Tris base, 50 mM MOPS, 0.1% SDS, 1 mM EDTA, pH 7.7). Transfer into nitrocellulose membranes was performed for 1 hr under 140 mA at 4 C., soaking in NuPage 1 transfer buffer (25 mM Bicine, 25 mM Bis-Tris (free base) 1 mM EDTA pH 7.2) supplemented with 12% methanol. Membrane was wrapped in saran plastic wrap and exposed to phosphoimager screen.
[0339] Denaturing CLIP MethodLarge Scale for Library Preparation.
[0340] For large-scale denaturing CLIP method, UV treatment of cells was performed as described above for small scale dCLIP method. Two kinds of magnetic beads were used for the experiment: Protein G Dynabeads (for Pre-clearing) and Dynabeads MyOne Streptavidin C1 (for a Pull-down of biotinylated protein). Beads were thoroughly resuspended and volume of beads corresponding to 80 l beadsnumber of cell pellets+5 l was transferred into clean 2 ml tubes. Beads were captured on magnetic separator. Pre-clearing beads were washed 3 times with 1 ml lysis buffer (PBS+1 mM MgCl.sub.2+0.1 mM CaCl.sub.2+0.5% Nonidet-P-40+0.5% Sodium Deoxycholate). Streptavidin beads were washed 3 times with 1 ml lysis buffer+0.5% Bovine serum albumin (BSA) Beads were resuspended in 150 l lysis buffer per 80 l beads and 150 l portions transferred into 2 ml tubes. Lysate was prepared the following way. Cell pellets (2 pellets for each cell type) were resuspended each in 1.25 ml of ice-cold lysis buffer supplemented with 1 tablet of Complete-mini EDTA-free tablet (Roche)+40 u/ml Protector RNAse inhibitor (Roche)+1 mM Dithiothreitol (DTT), delivered into 2 ml tubes and incubated for 25 min at 4 C. on rotatory wheel. After brief spin down, 25 l (50 u) of TurboDNAse (Life Technologies) were added to every tube. The entire content of the tube was transferred to the new 2 ml tube in order to estimate the volume. 2 dilutions of RNAse I (Life Technologies) in lysis buffer+additives were prepared: 100-fold (1 u/ml) and 500-fold (0.2 u/ml) For each cell type, one sample received 100-fold and one sample received 500-fold diluted RNAse I. Volume of RNAse I solution corresponded to 1/100th of total estimated sample. Samples were mixed well and incubated 15 min in 37 C. water bath with mixing up-and-down every 5 min. After brief spin-down, each sample received 24 l (48 u) of SuperRNAseIN (Life Technologies) diluted 10-fold in lysis buffer. In addition, the sodium dodecyl sulfate (SDS) concentration in each sample was brought up to 0.1% following addition of + 1/100th volume of 10% SDS. After 10 min 21,130G 4 C. centrifugation, sup was delivered into clean 2 ml tubes and samples centrifuged another 10 min 21,130G 4 C. to remove remaining cell debris. 2 ml tubes with 150 l of pre-clearing beads were placed on magnetic separator and lysis buffer removed. The entire sup from the previous step was placed on the beads and samples incubated 1 hr 4 C. on rotatory wheel. 2 ml tubes with Streptavidin beads were placed on magnetic separator and excess lysis buffer removed. After capturing pre-clearing beads on magnetic separator, pre-cleared lysate was transferred into 2 ml tubes with Streptavidin beads and incubated 2 hrs 4 C. on rotatory wheel. Samples were placed on magnetic separator and sup removed. Samples were washed 2 times with 1.2 ml Urea wash buffer (PBS+8M Urea+0.1% SDS) for 5 min on room temperature using rotatory wheel. Sup was removed on magnetic separator every time. Samples were washed 2 times with 1.2 ml SDS wash buffer (PBS+2% SDS) for 5 min on room temperature using rotatory wheel. Sup was removed on magnetic separator every time. One wash was performed with 1.2 ml high-salt buffer (PBS+750 mM NaCl+1% Nonidet-P-40+0.5% NaDeoxycholate+0.1% SDS) and one wash with low-salt buffer (PBS+150 mM NaCl+1% Nonidet-P-40+0.5% NaDeoxycholate+0.1% SDS), 5 min 4 C. on rotatory wheel for every wash with subsequent sup removal on magnetic separator. Beads were resuspended in 800 l 1 DNAse buffer, transferred into 1.5 ml tubes and incubated for 5 min 4 C. on rotatory wheel with subsequent sup removal on magnetic separator. Beads were resuspended in 160 l of DNAse mix (1 DNAse buffer, 0.1 u/l Turbo DNAse, 0.1 u/l SUPERasin (Life Technologies), 100-fold diluted EDTA-free protease inhibitors mix (Sigma), 0.4 u/l Protector RNAse inhibitor) and incubated at 37 C. on rotatory wheel for 30 min. After brief spin down, beads were placed on magnetic rack and sup removed. One wash with 1 ml low-salt wash buffer was performed 5 min 4 C. on rotatory wheel. Sup removed on magnetic separator. For 3ends dephosphorylation, beads were washed once in 1 ml of Low_pH_PNK buffer (70 mM Tris pH 6.5, 10 mM MgCl.sub.2, 5 mM DTT) 5 min 4 C. on rotatory wheel. Low-pH-PNK mix (per sample, 80 l Low_pH_PNK buffer, 2 l (20 u) T4 polynucleotide kinase (T4 PNK) (NEB), 2 l (80 u) Protector RNAse inhibitor) was prepared. Beads resuspended in 80 l of Low-pH-PNK mix and incubated at 37 C. for 20 min on Thermomixer, vortexing on 1,000RPM for 15 sec every 2 min. For subsequent phosphorylation of 5 ends, sup was removed on magnetic separator and beads washed once in 1 ml of PNK buffer (50 mM Tris pH 7.4, 10 mM MgCl.sub.2, 5 mM DTT, 0.5% Nonidet-P-40) 5 min 4 C. on rotatory wheel. Beads were resuspended in 80 l of PNK mix (per sample, 80 l PNK buffer, 4 l .sup.32P-gamma-ATP, 3 l (30 u) T4 PNK, 2 l (80 u) Protector RNAse inhibitor) and incubated at 37 C. for 10 min. After adding 8 l 10 mM ATP, samples were incubated additional 20 min at 37 C. Beads were captured and sup removed on magnetic separator. Beads were instantly washed 3 times with 1 ml of ice-cold PNK wash buffer (50 mM Tris pH 7.4, 150 mM NaCl, 0.5% Nonidet-P-40, 10 mM EDTA). After last wash, beads were resuspended in 85 l of 1 SDS sample buffer (80 mM Tris pH 6.8, 2% SDS, 100 mM DTT, 10% Glycerol) and incubated at 95 C. for 5 min. Samples were loaded on 1.5 mm NuPage 4%-12% Bis-Tris gradient gels (Life Technologies)40 l per lane, and electrophoresis on 200V was performed using NuPage MOPS/SDS running buffer (50 mM Tris base, 50 mM MOPS, 0.1% SDS, 1 mM EDTA, pH 7.7). Transfer into nitrocellulose membranes was performed for 1.5 hrs 140 mA on 4 C. in NuPage 1 transfer buffer (25 mM Bicine, 25 mM Bis-Tris (free base) 1 mM EDTA pH 7.2)+12% methanol. Membrane was wrapped in Saran plastic wrap and briefly exposed to phosphoimager screen.
[0341] Samples that were subjected for beads elution protocol, were treated with PNK mix supplemented with 8 l 10 mM ATP and incubated at 37 C. for 30 min. Samples were washed twice with 1 ml Urea wash buffer (PBS+8M Urea+0.1% SDS) and once with Proteinase K buffer (100 mM Tris pH 8.0, 200 mM NaCl, 5 mM EDTA, 0.1% SDS) for 5 min on room temperature using rotatory wheel. Beads were resuspended in 200 l Proteinase K mix (100 mM Tris pH 8.0, 200 mM NaCl, 5 mM EDTA, 0.1% SDS, lmg/ml Proteinase K (PCR grade, Roche, 20 mg/ml)) and incubated 30 min at 55 C. using rotatory wheel. After brief spin-down and beads capture on magnetic separator, eluted RNA from 2 combined samples (400 l total) was transferred into phase-lock gel 2 ml tubes (5 Prime) (pre-centrifuged 30 sec 16,000G to pellet gel), and 400 l acidic phenol-chloroform (Life Technologies) were added. After rigorous up-and-down shaking to mix the phases, samples were centrifuged 5 min 16,000G on room temperature. Another 400 l of acidic phenol-chloroform were added to the upper aqueous phase with subsequent rigorous up-and-down shaking to mix the phases and 5 min 16,000G centrifugation on room temperature. Upper phase was transferred into clean 1.5 ml tubes with 40 l 3M Sodium Acetate. After addition of 1 l Glycoblue (Life Technologies) and 1 ml 100% ethanol, samples were mixed by up-and-down shaking and incubated at least 16 hrs on 20 C.
[0342] Elution of Protein-Bound RNAs from Membrane
[0343] For membrane elution, PK solution (100 mM Tris pH 7.4, 50 mM NaCl, 10 mM EDTA, 4 mg/ml Proteinase K (Roche)) was prepared and pre-incubated for 10-20 min at room temperature to eliminate possible RNAse contamination. All the solutions were filtered through 0.22 m membrane filter before adding Proteinase K. Membrane pieces were excised using a sterile scalpel starting from protein of interest size+10 kda (corresponding to approximately 30 bases of RNA fragments covalently linked to the protein of interest) up to the end of visible radioactive signal specific to the protein of interest. Addition of 10 kDa to the original protein size allows for binding of roughly 30 bases of RNA in complex with the protein of interest. The goal was to avoid purifying CBX7 crosslinked to RNAs shorter than 30 bases, as the shorter RNAs would be more difficult to sequence and align to the genome with high confidence level. Membrane pieces were further cut into smaller pieces and placed into low-binding 1.5 ml tubes. After addition of 200 l PK buffer, membrane pieces were incubated for 20 min at 55 C. in Thermomixer with constant vortexing on 1,200 RPM. Meanwhile, PK-urea solution was prepared (100 mM Tris pH 7.4, 50 mM NaCl, 10 mM EDTA, 7M urea). All the solutions except for urea were filtered through 0.22 M membrane filter before preparation. 200 l of PK-urea solution was further added to membrane pieces. Samples were incubated for 20 min at 55 C. in Thermomixer with constant vortexing on 1,200 RPM. After brief spin-down, the eluates were transferred into phase-lock gel 2 ml tubes (5 Prime) (pre-centrifuged 30 sec 16,000G to pellet gel), and 400 l acidic phenol-chloroform (Life Technologies) were added. After rigorous up-and-down shaking to mix the phases, samples were centrifuged 5 min 16,000G on room temperature. Another 400 l of acidic phenol-chloroform were added to the upper aqueous phase with subsequent rigorous up-and-down shaking to mix the phases and 5 min 16,000G centrifugation on room temperature. Upper phase was transferred into clean 1.5 ml tubes with 40 l 3M Sodium Acetate. After addition of 1 l Glycoblue (Life Technologies) and lml 100% ethanol, samples were mixed by up-and-down shaking and incubated at least 16 hrs on 20 C.
[0344] Library Preparation from Membrane-Eluted and Beads-Eluted Samples
[0345] Membrane-eluted or beads-eluted samples were centrifuged for 30 min 13,523G on 4 C. and sup removed. Pellets were washed once with 1 ml 75% ethanol in DEPC-treated water with subsequent 10 min 13,523G centrifugation on 4 C. After sup removal and short spin down, the remaining ethanol solution was carefully removed and pellets incubated 5-10 min with open cup on room temperature inside a PCR workstation under constant airflow. Pellets were eluted in 25 l DNAse mix and 2 samples that belonged to the same cell type with different RNAse concentrations combined into one sample (DNAse mix: per combined sample, 43 l nuclease-free DDW, 5 l 10 DNAse buffer, 1 l (40 u) Protector RNAse inhibitor, 1 l (2 u) of Turbo-DNAse (Life Technologies). Samples were incubated 30 min on 37 C. RNA was extracted using 950 l Trizol reagent (Life Technologies) according to the manufacturer instructions. 0.5 l Glycoblue were used for precipitation during Trizol extraction. RNA pellets were eluted with 8 l nuclease-free DDW. Samples were incubated for 2 min on 70 C. to reduce the secondary structure and then kept on ice. Multiplex Compatible NEBNext Small RNA Library Prep Set for Illumina (NEB) was used for library preparation according to manufacturer instructions with the following modifications. 7 l of eluted RNA were used for library preparation. All the adapters and primers used throughout a procedure were diluted 12-fold. SuperScript III Reverse Transcriptase (Life Technologies) and Protector RNAse inhibitor (Roche) replaced M-MuLV reverse transcriptase and Murine RNAse inhibitor respectively. 25 PCR amplification cycles were performed on the resulting cDNA using multiplexed primers with Illumina barcodesdistinct barcode for every cell type. Amplification was performed with LongAmp Taq 2 Master Mix (NEB). Amplified PCR products were subjected to PAGE electrophoresis on 6% TBE-acrylamide gel. The area between 160 bp and 520 bp was excised, gel pieces crushed into slurry with 1 ml syringe plunger and PCR products eluted by overnight incubation on room temperature in 400 l Gel elution buffer (NEB) inside a 1.5 ml low-binding tubes. One glass filter (Whatman, 1823010) was placed into Costar SpinX column (Cornig, 8161). The suspension from the previous step was placed on the column and centrifuged on 15,871G on room temperature for 1 min. Eluates were subjected to ethanol precipitation following addition of 40 l 3M Sodium Acetate, 1 l Glycoblue and lml 100% ethanol. After incubating for at least 30 min on 20 C., samples were centrifuged for 30 min 13,523G on 4 C. and sup removed. Pellets were washed once with 1 ml 70% ethanol with subsequent 10 min 13,523G centrifugation on 4 C. After sup removal and short spin down, the remaining ethanol solution was carefully removed and pellets incubated 5-10 min with open cap on room temperature inside a PCR workstation under constant airflow. Pellets were eluted in 12 l nuclease-free water. Size distribution of PCR products was determined by Bioanalyzer run with 1 l of each sample loaded on High Sensitivity DNA chip (Agillent). Quantification of PCR products was performed by Illumina Library Quantification kit (Kapa Biosystems). Equivalent amounts of multiplexed samples were pooled into final library1.5 nM-2 nM per multiplexed sample. Total of 3 to 5 samples were pooled into one library.
[0346] Gene Expression
[0347] RNA was extracted from cells with Trizol reagent (Life Technologies) according to manufacturer instructions. cDNA libraries were constructed using Superscript III reverse-transcriptase (Life Technologies) and qPCR was performed with primers spanning exon-exon junctions. For studies involving intronic primers (
TABLE-US-00001 TABLEa LNAASOoligomers,primers,andRNA-EMSAprobesusedinthisstudy. LNAOligomers TargetGene LNAI.D LNAsequence SEQIDNO. Dusp9 Dusp9-1-a CCTACAGTTCCAAGAAGTCTAA 36405 Dusp9-1-b GAAGCAGGAAGGAGTCTACACG 36406 Dusp9-2-a CAGTTTGACCACCCTCAGTCAC 36407 Dusp9-2-b AAAGAAACAGTCAGGGCACCAG 36408 Dusp9-3-a CACAGGTATTGCCAGCTCCAGG 36409 Dusp9-3-b CACACACACAGAGTCTACAACG 36410 Dcaf1211 Dcaf12I1-1 CCTGTCTGCCATACATTCTACA 36411 Dcaf12I1-2 GCTCAGACTTCTTCCTTTGCAC 36412 Dcaf12I1-3 GTAACAGATCTATTCTACTTGA 36413 Dcaf12I1-4-a CATTATCTCTATTTATCTGAAC 36414 Dcaf12I1-4-b GGAGAAAACCAATCTATCCGCA 36415 Calm2 Calm2-1-a GCCAGAGTAAGCCACATGCAAC 36416 Calm2-1-b TTAGATGTGCAGACGGGCTTAG 36417 Calm2-2-a TTACAGCTCCACACTTCAACAAC 36418 Calm2-2-b ACATGCTGACAGTTCCTAAAAG 36419 ControlLNAs LNA-Scr GTGTAACACGTCTATACGCCCA 36420 Negativecontrol TAACACGTCTATACGCCCA 36421 A NativeRIP-qPCRprimers Tug1_F CAGGTCTGTAGGCTGATGGAG SEQIDNO.36422 Tug1_R AAGTGAACTACGTCCCGTGC SEQIDNO.36423 Dusp9_4F TCACACAGCCACTGTTGGTT SEQIDNO.36424 Dusp9_4R GTCCTGCTGCCACAGGTATT SEQIDNO.36425 Calm2_F GCAGAACTGCAGGACATGAT SEQIDNO.36426 Calm2_R CAAACACACGGAATGCTTCT SEQIDNO.36427 U1-F GGAAATCATACTTACCTGGC SEQIDNO.36428 U1-R AAACGCAGTCCCCCACTACC SEQIDNO.36429 GeneExpressionprimers Dusp9_F GGGGATCCGTCTCCATGAAC SEQIDNO.36430 Dusp9_ChIP_R2 TGACCGACTCAGACTCTCCA SEQIDNO.36431 Calm2_F GCAGAACTGCAGGACATGAT SEQIDNO.36432 Calm2_R CAAACACACGGAATGCTTCT SEQIDNO.36433 Dcaf12I1-1F CCCAATGCGCTCTACACTCA SEQIDNO.36434 Dcaf12I1-1R ACTGGATACTCTGGGGCAGT SEQIDNO.36435 Intronicprimers Calm2_int_F GCCAAGCAAACTTGACTCCG SEQIDNO.36436 Calm2_int_R GACCACACTGCCATGGATCA SEQIDNO.36437 Dcaf12I1-1R ACTGGATACTCTGGGGCAGT SEQIDNO.36438 Dcaf12I1-int-R TGTAATTCATGTTGTGCATGCTGT SEQIDNO.36439 ChIP-qPCRprimers Calm2_ChIP_1F AGCTATATGCACCCACTCGG SEQIDNO.36440 Calm2_ChIP_1R TGGGCATTCGTTCGAAAGGG SEQIDNO.36441 Dcafl2I1_ChIPF CCAGAGTGGGCAACTGGTAG SEQIDNO.36442 Dcaf12I1_ChIPR GACCACATCATGCGCATTCC SEQIDNO.36443 FAIRE-qPCRprimers Calm2_ChIP_1F AGCTATATGCACCCACTCGG SEQIDNO.36444 Calm2_ChIP_1R TGGGCATTCGTTCGAAAGGG SEQIDNO.36445 Calm2_DNAse_1A_F GGGGACGGATGACGTAAGTG SEQIDNO.36446 Calm2_DNAse_1A_R AATCAGCAGCAAGCTCAACG SEQIDNO.36447 Dcaf12I1_ChIP_F CCAGAGTGGGCAACTGGTAG SEQIDNO.36448 Dcaf12I1_ChIP_R GACCACATCATGCGCATTCC SEQIDNO.36449 Dcaf12I1_DNAse_72F GTCGGCCTGACGCATGATA SEQIDNO.36450 Dcaf12I1_DNAse_72R GCTGATCGGTTGATCGCTCT SEQIDNO.36451 qPCRprimers-humangenes PES1-F GAGGAGAAGTGACTCTGGTCCAT SEQIDNO.36452 PES1-R AGAAGCGGAAAGCCCACGAT SEQIDNO.36453 IRAK1-F CACATTAGGCCAGCTCGCAG SEQIDNO.36454 IRAK1-R TGGCTGTAAGTCTCATGGTTCA SEQIDNO.36455 RNA-EMSAProbes Dusp9-EMSAprobe GGCCACTTTGACTCGTGTAGACTCCTTCCT SEQIDNO.36456 GCTTCTCTCACTAGGG CTTAGACTTCTTGGAACTGTAGGGTGTGA ACCCAGAGAC Dcaf12I1-EMSAprobe TCAAATAGAGGAGCTGGGGATTAAAAAG SEQIDNO.36457 ATAGGTCTGATTAAAG GACTGTGCAGTTCAGATAAATAGAGATAA TGGGATGCCGTGCGG ATAGATTGGTTTTCTCC Calm2-EMSAprobe GTAGCTTTTAGGAACTGTCAGCATGTTGTT SEQIDNO.36458 GTTGAAGTGTGGAGC TGTAACTCTGCGTGGACTGTGGACAGTCA ACAATATGTACTTAAAA GTTGCACTATTGCAA Larp1-FAM1-WT GGGAGGTATATGTGGACATAGAG SEQIDNO.36459 Larp1-FAM1-Mut GGGAGGTATATTCCACCATAGAG SEQIDNO.36460 Nucks1-FAM3-WT GGGtgtgcggacggaggtcagaaa SEQIDNO.36461 Nucks1-FAM3-Mut GGGtgtgcggaccctcctcagaaa SEQIDNO.36462
[0348] Native RNA Immunoprecipitation (Native-RIP)
[0349] EL16.7 cells were grown on T75 flask until 80% confluency. Cells were trypsinized and, after adding fresh growth media, counted and pelleted by 5 min 200G centrifugation. Cell pellets were resuspended in PBS and divided into 110.sup.7 cells aliquots. After another round of centrifugation, sup was removed and cells shock-frozen in LN2. After thawing, cells from single cell pellet were incubated in 1 ml of ice-cold hypothonic buffer A (10 mM HEPES pH 7.9, 1.5 mM MgCl.sub.2, 10 mM KCl)+1 mM AEBSF. Cells were incubated on ice for 20 min and nuclei were pelleted by 15 min 2,500G centrifugation on 4 C. Sup was removed and pellet resuspended in 1 ml of Polysomal lysis buffer (10 mM HEPES pH 7.0, 100 mM KCL, 5 mM MgCl.sub.2, 0.5% NP-40)+1 mM DTT+EDTA-free PI cocktail 1:100+100 u/ml RNAseIN (Promega). After adding 20 l (40 u) of TurboDNAse (Life Technologies), cell nuclei were incubated 30 min 4 C. on orbital shaker. After 10 min 16,000G 4 C. centrifugation, supernatant was transferred into 16 ml tube with 9 ml NT2 buffer (50 mM Tris pH 7.4, 150 mM NaCl, 1 mM MgCl.sub.2, 0.05% NP-40)+10 l 1M DTT+10 l RNAseIN (Promega)+1 tablet of Complete-mini EDTA-free protease inhibitors mix. On the same time, Protein G Dynabeads were prepared20 l per sample for pre-clearingnumber of samples+20 l per sample for immunoprecipitationnumber of samples. Beads were thoroughly resuspended, captured on magnetic separator and washed 31 ml NT2 buffer (50 mM Tris pH 7.4, 150 mM NaCl, 1 mM MgCl.sub.2, 0.05% NP-40). After final resuspension20 l beads/100 l NT2 volume, beads intended for immunoprecipitation were incubated with 5 g of specific antibody (anti-CBX7 (P-15), Santa Cruz Biotechnologies) or Rabbit IgG control (Abcam) in total volume of 500 l NT2 buffer. To prepare pre-cleared lysates, 1 ml aliquots of lysate were transferred into 1.5 ml tubes with 100 l beads suspension and incubated 1 hr 4 C. on rotatory shaker. Input samples were prepared by taking 100 l aliquots from lysate+900 l Trizol reagent. After capturing beads on magnetic separator, pre-cleared lysates were transferred into 1.5 ml tubes with beads-antibody complex (unbound antibody fraction was removed on magnetic separator). After 3 hrs 4 C. incubation on rotatory shaker, sup was removed and beads washed 51 ml NT2 buffer. After the last wash solution was removed on magnetic separator, beads were resuspended in 1 ml Trizol reagent. RNA was extracted according to manufacturer protocol, eluted in 20 l nuclease-free water and 2 l of eluted RNA was subjected to reverse transcription using SuperScript III (Life technologies) according to manufacturer instructions. qPCR assays were performed on CFX96 real-time PCR system (Bio-Rad). Specific primers are listed in Table a. Threshold cycle values were translated into initial template amount for each sample based on the standard curve prepared from known quantities of EL16.7 cDNA. Enrichment of specific RNA species was expressed as percentage of total input RNA for each reaction.
[0350] Chromatin Immunoprecipitation
[0351] Before the experiment, cells were grown on 15 cm feeder plates up to 80-90% confluence. Medium was removed and cells washed once with 20 ml PBS. After 10 min incubation on 37 C. in 3 ml trypsin-EDTA (Gibco), cells were passed twice through 200 l tip in 9 ml growth media using 13 ml pipette, transferred into 50 ml tubes with 18 ml growth media and counted. Cells were centrifuged 5 min 200G on room temperature. Sup was removed and cells resuspended in 40 ml fresh growth media and split into 215 cm tissue culture dishes20 ml per dish. Cells were incubated 45 min on 37 C. for feeder removal. Floating cells were collected into 50 ml tube and counted. Then, 1/10th volume of cross-linking solution (50 mM HEPES-KOH pH. 7.5, 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 11% Formaldehyde) were added and cells incubated 20 min room temperature on rotatory shaker followed by quenching with 1/20th volume of 2.5M Glycine solution. After 5 min 700G centrifugation on 4 C., cells were washed twice with 30 ml of ice-cold PBS and pellet resuspended in volume of ice-cold PBS according to 3 ml PBS/510.sup.6 cells ratio. Cells were divided into 3 ml portions in 16 ml tubes and centrifuged 5 min 700G 4 C. Sup was aspirated and pellets shock-frozen in liquid nitrogen and stored on 80 C. On the day of immunoprecipitation, cell pellets were pre-thawed on 4 C. and re-suspended in 1 ml Buffer#1 (50 mM HEPES-KOH pH 7.5, 140 mM NaCl, 1 mM EDTA, 10% Glycerol, 0.5% NP-40, 0.25% Triton-X-100) supplemented with protease inhibitors mix (Sigma). After 10 min 4 C. incubation on rotatory shaker, cells were spun 5 min 1400G 4 C. Sup was aspirated and pellets resuspended in 1 ml Buffer#2 (10 mM Tris pH 8.0, 200 mM NaCl, 1 mM EDTA, 0.5 mM EGTA) supplemented with protease inhibitors mix (Sigma). After 10 min 4 C. incubation on rotatory shaker, cells were spun 5 min 1,400G 4 C. Sup was aspirated and pellets resuspended in 1.2 ml of Buffer#3 (10 mM Tris pH 8.0, 1 mM EDTA, 0.5 mM EGTA) supplemented with protease inhibitors mix (Sigma). After 10 min 4 C. incubation on rotatory shaker, 70 l 10% N-lauroyl-sarcosine were added, cell nuclei suspension transferred into screw-cap 15 mm19 mm Covaris tubes and sonicated in Covaris E220 system with the following conditions: Duty10%, Peak Incident Power175, Cycles per burst200, Duration2400 sec (40 min). After sonication, cells were transferred into 1.5 ml tubes and centrifuged for 10 min 14,000G on 4 C. Sup was transferred into 1.5 ml tubes, 20 g of RNAse A (Roche) were added and samples incubated for 30 min on 37 C. After incubation, 55 l aliquots were taken from each sample for input control and the rest divided into 2550 l portions in 1.5 ml tubes. Input samples were stored on 20 C. 275 l of freshly prepared solution (3% Triton-X-100, 0.3% NaDeoxycholate, 3 mM EDTA)+protease inhibitors mix were added to 550 l samples along with specific antibody or matched isotype controls and samples incubated 16 hrs 4 C. on rotatory shaker. For recombinant CBX7-Flag-HA, 5 l of rabbit polyclonal anti-hemagglutinin tag antibody (H6908, Sigma) were used per reaction. For endogenous CBX7, 5 g of rabbit polyclonal anti-CBX7 antibody (ab21873, Abcam) were used per reaction. 5 g of Ubiquityl-Histone H2A (Lys119) (D27C4) #8240 antibody (Cell Signaling) were used for pull-down of ubiquitynated histone H2A. Meanwhile, magnetic protein G dynabeads (Life technologies)40 l per reaction, were washed twice with Buffer#1 using magnetic stand and blocked for 1 hr on 4 C. with 250 g/ml salmon sperm DNA (Life technologies). After two washes with Buffer#1, beads were resuspended in buffer#1 according to 40 l beads/100 l buffer ratio and divided into 1.5 ml tubes. After removal of buffer, immunoprecipitated samples were transferred to 1.5 ml tubes with protein G dynabeads for additional 2-3 hrs 4 C. incubation on rotatory shaker. Then, sup was removed and beads washed 30.5 ml RIPA-1 buffer (50 mM HEPES-KOH, pH 7.5, 0.5 m LiCl, 0.7% NaDeoxycholate, 1% NP-40, 10 mM EDTA) and 30.5 ml RIPA-2 buffer (50 mM HEPES-KOH, pH 7.5, 0.25 m LiCl, 0.7% NaDeoxycholate, 1% NP-40, 10 mM EDTA). Beads were resuspended manually on each step. After one wash with 0.5 ml TEN buffer (10 mM Tris pH 8.0, 50 mM NaCl, 1 mM EDTA), beads were resuspended in 0.2 ml TES buffer (50 mM Tris pH8.0, 10 mM EDTA, 1% SDS) and incubated 15 min 65 C. with occasional vortexing and subsequent spin down. 145 l of TES buffer were added to input samples. 40 g of Proteinase K (Roche) were then added to all samples and samples incubated 16 hrs on 65 C. Then, after addition of 0.2 ml of TE buffer, the entire volume was transferred to Phase-Lock Gel Heavy 2 ml tubes (5 Prime GmbH) and extracted with 0.4 ml of phenol:chlorophorm:isoamyl alcohol solution (25:24:1, USB) according to manufacturer protocol. The aqueous phase was collected and ethanol precipitated by adding 40 l of 3M NaAcetate, 25 g GlycoBlue reagent (Life technologies) and 2.5 volumes of 100% ethanol. Elution was performed with 50 l TE buffer pH 8.0. qPCR assays were performed on CFX96 real-time PCR system (Bio-Rad). Specific primers are listed in Table a. Threshold cycle values were translated into initial template amount for each sample based on the standard curve prepared from known quantities of genomic DNA. Enrichment of specific PCR amplicons was expressed as percentage of total input DNA for each reaction. ChIP-seq libraries were constructed using the NEBNext ChIP-Seq Library Prep Master Mix Set (NEB). Libraries were subjected to high-throughput sequencing using Illumina HiSeq 2000 apparatus according to manufacturer instructions. Approximately 40 million paired-end 50 bp reads were generated for every ChIP-seq sample.
[0352] LNA Nucleofection
[0353] LNA mixmers (Exiqon) were designed specifically against a CBX7 binding regions of selected genes (See Table a for the list of LNA oligomers) A total of 210.sup.6 EL16.7 cells, after feeder removal, were resuspended in 100 L of ES cell nucleofector solution (Lonza). LNA oligos were added to a final concentration of 2 M. The cells were transfected using the A-013 program on Amaxa Nucleofector II. 0.5 mL of culture medium were added and cell suspension was divided equally between two wells in gelatinized 6-well dish. For RT-qPCR, cells were harvested in 1 ml Trizol reagent 24 hrs after nucleofection, RNA extraction was performed according to manufacturer instruction. For Western Blotting, cells were scraped in 300 l of SDS sample buffer (50 mM Tris pH 6.8, 100 mM DTT, 2% SDS, 0.1% bromophenol blue, 10% glycerol) and resulting extracts boiled on 95 C. for 5 min. For ChIP and Formaldehyde-assisted Isolation of Regulatory Elements (FAIRE) assays, three nucleofection reactions were pooled into one gelatinized 10 cm dish and cells harvested for cross-linking according to the ChIP or FAIRE protocol.
[0354] Formaldehyde-assisted Isolation of Regulatory Elements (FAIRE) analysis FAIRE analysis of nucleofected cells was performed as described in Simon et al (Simon et al., 2012) with following modifications. 24 hours after nucleofection, cells growing on gelatin-coated 10 cm tissue culture dishes were trypsinized with 1 ml Trypsin-EDTA solution. After most of the cells detached from the surface, 9 ml growth media were added to the plate and cells passed 2 times through 200 l pipette tip. Then, 1/10.sup.th volume of cross-linking solution (50 mM HEPES-KOH pH. 7.5, 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 11% Formaldehyde) were added and cells subjected to 5 min incubation on room temperature with constant rotation followed by 5 min quenching with 1/20.sup.th volume of 2.5M Glycine solution. After 5 min 700G centrifugations on 4 C., cells were washed 3 times with 10 ml of ice-cold PBS. Sup was aspirated and pellets shock-frozen in liquid nitrogen and stored on 80 C. On the day of the assay, cell pellets were pre-thawed on 4 C. and re-suspended in 1 ml lysis buffer Buffer A (10 mM HEPES-KOH pH 7.5, 100 mM NaCl, 1 mM EDTA, 1% SDS, 2% TX-100) After 10 min 4 C. incubation on rotatory shaker, cells were delivered into screw-capped 1.3 ml Covaris 15 mm19 mm tubes and sonicated in Covaris E220 system in the following conditions: Duty10%, Peak Incident Power175, Cycles per burst200, Duration600 sec (10 min). After sonication, cells were transferred into 1.5 ml tubes and centrifuged for 5 min 20,000G on 4 C. to pellet cell debris. Sup was transferred into 1.5 ml tubes. 100 l aliquots from each sample were taken as input controls. Then, 2 aliquots of 300 l from each lysate were transferred to Phase-Lock Gel Heavy 1.5 ml tubes (pre-centrifuged for 30 sec on 16,000G), and extracted twice with 300 l of phenol:chlorophorm:isoamyl alcohol solution (25:24:1, USB) after vigorous shaking and 5 min 16,000G centrifugation on room temperature. The remaining phenol was removed by adding 150 l of 24:1 chloroform:isoamyl alcohol solution, 5 min 16,000G. The upper aqueous phase was transferred to 1.5 ml tube. Another 100 l of EB buffer (Qiagen) were added to Phase-Lock Gel Heavy 1.5 ml tube to collect the remaining upper phase and transferred to the same 1.5 ml tube with the rest of the upper phase. After adding 40 l of 3M Sodium Acetate, 1.5 l of GlycoBlue reagent (Life technologies) and 800 l ethanol, samples were incubated on 80 C. for at least 30 min. Samples were centrifuged 15 min 12,000G 4 C. Sup removed and pellets washed 10.5 ml 70% ethanol, 5 min 12,000G. Samples were eluted with 50 l EB buffer (Qiagen). 1 l of DNAse-free RNAse A (Sigma, 37 mg/ml) was added to every sample including input samples, 30 min 37 C. Then, 1 l (20 g) Proteinase K (Roche) were added and samples incubated for 1 hr on 55 C. and 16 hrs on 65 C. to reverse cross-linking. Then, samples were supplemented to 300 l with EB buffer. Phenol:chloroform:isoamyl alcohol extraction and ethanol precipitation were repeated exactly the same way it was performed in the first step. Samples eluted with 50 l EB buffer (100 l EB buffer for input samples). qPCR assays were performed on CFX96 real-time PCR system (Bio-Rad). Specific primers are listed in Table a. Threshold cycle values were translated into initial template amount for each sample based on the standard curve prepared from known quantities of genomic DNA. Enrichment of specific PCR amplicons was expressed as percentage of total input DNA for each reaction.
[0355] Protein Expression and Purification
[0356] Mouse CBX7 carrying Flag and HA tag on C-terminus was expressed in Sf9 insect cells using the bac-to-bac system (Invitrogen). Protein extract was prepared by resuspending cell pellet in lysis buffer F (20 mM HEPES-KOH [pH 7.9], 300 mM NaCl, 4 mM MgCl.sub.2, 1 mM DTT, 20% glycerol, and protease inhibitors mix [Sigma]). After 15 strikes with tight pestle on 15 ml Dounce homogenizer, cell suspension was supplemented with 0.1% Nonidet-P-40, 0.2% Triton-X-100, 5 u/ml TurboDNAse (Invitrogen) and 12.5 g/ml Heparin. After 30 min 4 C. incubation on orbital shaker, cell lysate was subjected to 2 rounds of 15 min 30,000G centrifugation on 4 C. Supernatant was collectedand snap-frozen in liquid nitrogen. M2 anti-FLAG beads (Sigma) were used for all purifications. Proteins were bound to M2 beads in lysis buffer for 2 hr at 4 C. Beads were washed twice with buffer F (500 mM NaCl), twice with buffer F (300 mM NaCl) and twice with elution buffer (50 mM Tris pH 7.4, 100 mM NaCl). Proteins were eluted twice by 1 hr incubations with 0.2 g/ml 3-FLAG peptide (Sigma). Protein concentrations were determined by SDS-page and Bradford assay using bovine serum albumin as a standard.
[0357] Electrophoretic Mobility Shift Assays
[0358] RNA-EMSA assays with CBX7 protein were performed as follows. Labeled RNAs were produced with MEGAscript T7 Transcription Kit (Life Technologies) and purified from 6% acrylamide TBE-urea gels. Labeled RNAs were prefolded in buffer TE+300 mM NaCl by incubating for 2 min at 95 C., followed by 20 min incubation on ice. Binding reactions were assembled with 20 l of binding mix (13 mM Tris pH 8.0, 0.2 mM EDTA, 68.8 mM NaCl, 20% Glycerol, 0.2 mg/ml Yeast tRNA, 4 mM DTT, 4 l 2500 cpm/l RNA probe). LNA oligonucleotides were added to binding mix at final concentration of 8 M and samples were pre-incubated on ice for 10 min. After pre-incubation, binding mix samples were combined with 60 l of purified protein in dialysis buffer (50 mM Tris pH 7.4, 5 mM MgCl.sub.2, 50 mM NaCl, 1 mM DTT, 10% Glycerol, 4 u/l Protector RNAse inhibitor (Roche)). Control experiments were performed with dialysis buffer only or control proteinsFlag-GFP or GST-Flag-HA, dissolved in dialysis buffer at the highest protein concentration in the particular experiment. After 30 min on ice, the sample was loaded onto a 5% 37:1 acrylamide (Bio-Rad) gel in 0.5 TBE buffer (45 mM Tris-Borate, 1 mM disodium EDTA) and run for 90 min at 250 V at 4 C. Gels were exposed to phosphorimager screens. For validation of motif sequences, labeled RNA probes were produced with MEGAshortscript T7 Transcription Kit (Life Technologies) and gel purified using 15% TBE-urea gels (Life technologies) Similar RNA-EMSA conditions were applied except 8% 37:1 acrylamide (Bio-Rad) gels replaced 5% gels. Sequences of RNA probes are given in Table a.
[0359] Western Blotting
[0360] 20 l of protein extracts were resolved on 4%-20% gradient SDS-PAGE gels (Bio-Rad) and proteins were transferred for 1 hr on 100V in transfer buffer (48 mM Tris, 39 mM Glycine, 20% methanol) to Immobilon-P 0.45 m PVDF membrane (Millipore) using Mini Protean Tetra transfer unit (Bio-Rad)). To detect CBX7 protein expression, Western blotting was performed with mouse monoclonal CBX7 Antibody (G-3) (Santa Cruz Biotechnologies, sc-376274) as primary antibody and goat-anti-mouse-HRP (Promega) as a secondary antibody. For quantitative Western blotting of DCAF12l1 protein, anti-WDR40B (Dcaf12l1) rabbit polyclonal antibody (Biorbit, orb155395) was used as a primary antibody along with anti-Ctcf rabbit polyclonal antibody (Cell Signaling Technologies, #2899) as a loading control. Goat-anti-rabbit-HRP (Promega) was employed as a secondary antibody. Protein bands were developed using Western Lightening Plus-ECL Kit (Perkin-Elmer) and the signal intensity was analyzed using Chemidoc MP Imaging System (Bio-Rad) and ImageLab Ver. 5.2.1 software (Bio-Rad). Exposures were captured on different times using ChemiDoc cumulative signal option to avoid signal saturation. Standard curves were prepared using increasing amounts of cell extract (
[0361] Quantification and Statistical Analysis of qPCR Data
[0362] Data represents the averagestandard deviation for at least 3 biological replicates as stated in the figure legends. P values were determined by unpaired two-tailed student t-test unless otherwise stated.
[0363] Quantitative Analysis of RNA-EMSA
[0364] Gels were exposed to phosphoimager screens and scanned using Typhoon laser scanner (GE Healthcare). Radioactive signal intensity was quantified by Image Quant 5.2 software (GE Healthcare). Fraction of bound RNA (signal intensity of the shifted bands divided by the total signal intensity in the particular lane) was computed for every protein concentration and plotted against corresponding protein concentration. To determine dissociation constant (Kd), the resulting binding curves were fitted to sigmoidal plots by non-linear regression using Prism software (Graphpad Software inc).
[0365] Analysis of CLIP-Seq Data
[0366] Libraries were subjected to high-throughput sequencing using Illumina HiSeq 2000 apparatus according to manufacturer instructions. Approximately 40 million paired-end 50 bp reads were generated per every CLIP-seq sample. Adaptor sequences were trimmed with either Trim Galore! V0.3.3 (http://www.bioinformatics.babraham.ac.uk/projects/trim_galore/) (for CLIP-seq; stringency 15 and allowed error rate 0.2), or cutadapt (v1.0) (https://pypi.python.org/pypi/cutadapt/) Identical genomic sequences (PCR duplicates) were removed by custom program prior to alignment. To account for the M. mus (mus)/M. castaneus (cas) hybrid character of mouse EL 16.7 ES cell line that was employed in a CLIP-seq studies, reads were first aligned to custom mus/129 and cas genomes, and then mapped back to the reference mm9 genome (Pinter et al., 2012). All alignments were performed by utilizing Tophat (v2.0.11) (Trapnell et al., 2012). Post-processing of alignments was performed with custom scripts using SAMtools (Li et al., 2009), and BEDtools v2.17.0 (Quinlan and Hall, 2010). These included accounting, alignment file-type conversion, extracting and reads sorting (SAMtools), and obtaining wig coverage files (SAMtools depth).
[0367] Fragment per million (fpm) wig files were then created by scaling uniquely aligned wig files to total number of fragments per million in each library (determined by SAMtools flagstat combining reads with itself and mate mapped and singletons). CLIP-seq enriched tag density wig files were viewed in UCSC genome browser (Kent et al., 2002) or Integrated Genome Browser (IGB) (Nicol et al., 2009). Then consecutive wig entries of equal coverage were merged forming bed files that were used for peak calling. The peak caller software PeakRanger (v.16) (Feng et al., 2011) was used. The software requires an even distribution of watson/crick entries, thus, prior to peak calling, strand specific bed file entries were randomized per each strand. PeakRanger was called with arguments ranger -p 0.01-format bed -gene_annot_file (mm9), -d experiment and -c mock-transfected control, to identify narrow peaks with p-value 0.01 or less.
[0368] For assessing dCLIP fragments footprints PeakRanger-enriched CLIP fragments from 3 libraries were pooled and merged in a strand-specific manner to create continuous CLIP fragments (in case of overlapping peaks). Length-frequency histogram of enriched CLIP fragments was obtained, along with mean, median, and SD.
[0369] RNA-Seq Analysis
[0370] For RNA-seq, RNA was extracted from cells used for dCLIP experiments. Starting amount of Total RNA was 4 g. RNA was depleted of ribosomal RNA using Ribominus kit (Life technologies). Strand-specific cDNA libraries were constructed using Superscript III reverse-transcriptase for first-strand synthesis, NEBNext mRNA Second Strand Synthesis Module supplemented with dUTP (NEB) for second-strand synthesis, and NEBNext ChIP-Seq Library Prep Master Mix Set for library preparation. Libraries were subjected to high-throughput sequencing using Illumina HiSeq 2000 apparatus according to manufacturer instructions. Approximately 40 million single-end 50 nt reads were generated for every RNA-seq sample. Data processing was performed essentially as described previously (Kung et al., 2015). Adaptor sequences were trimmed from libraries with Trim Galore! v0.3.3 (for dCLIP-seq and RNA-seq; stringency 15). PCR duplicates were removed by custom programs prior to alignment. To account for the M. mus (mus)/M. castaneus (cas) hybrid character of the ES cell lines, reads were first aligned to custom mus/129 and cas genomes, and then mapped back to the reference mm9 genome. RNA was aligned with Tophat (v2.0.8 or greater). Post-processing of mm9 alignments was performed with custom C and Perl programs and bash shell scripts, SAMtools v0.1.18, and BEDtools v2.17.0.
[0371] RNA-Seq vs CLIP-Seq Analysis
[0372] For RNA-seq analysis two CBX7 libraries were used and for CLIP-seq analysis three CBX7 libraries were used. We have performed the following analysis for both RNA-seq and CLIP libraries: By applying the Homer (http://homer.salk.edu/homer/motif/) suit's makeTagDirectory and makeUCSCfile algorithms we converted aligned SAM files into strand-specific bedGraph files. Reads were further filtered to eliminate mappable reads assigned to ribosomal DNA and mitochondrial DNA, and per each library read counts values were normalized to the corresponding 3.sup.rd quartile read counts value. Strand-specific wig files were then binned to 100 bp windows and subjected to Piranha peak analysis (http://smithlabresearch.org/software/piranha/) resulting in significantly (p<0.01) enriched peaks. Piranha CLIP peaks were further filtered to include only peaks that were considered enriched also based on the PeakRanger algorithm (see PeakRanger peak calling under STAR Methods' Analysis of CLIP-Seq data section). To compare between the resultant enriched CLIP signals and their corresponding enriched RNAseq signals, piranha peaks files (of both, CLIP libraries and RNAseq libraries) were processed by the Homer's makeTagDirectory algorithm, and subsequently parsed to genomic features by the Homer's analyzeRNA algorithm, generating a matrix of total read counts per gene normalized to the length of each gene. Next, a matrix holding only genes that manifested CLIP signals higher than zero in at least two out of three datasets was created. The log 2-transformed normalized read values of each of 2 or 3 CLIP libraries that had enriched signals were averaged to reflect an averaged CLIP signal per gene. The normalized values (per gene) of corresponding RNAseq libraries, similarly analyzed in parallel, were averaged in the same manner to reflect an average RNAseq signal per gene. This analysis resulted in a matrix containing 1,333 genes with positive CBX7 CLIP signal.
[0373] To focus on a gene cohort that represents genes with high CLIP and RNAseq signals we selected 10% of the CLIP'ed genes (135 genes circled by green ellipse, as shown in
TABLE-US-00002 TABLE d Related to FIG. 1G. List of 135 CBX7 high-binding transcripts. GeneID GeneSymbol NR_028540 Snord12 NR_002142 Rpphl NR_002865 Rnu11 NR_028572 Snora43 NR_031758 Snora26 NR_030451 Mir682 NR_037683 Snord42b NM_010106 Eef1a1 NR_030762 Snord17 NM_011401 Slc2a3 NM_007907 Eef2 NR_027885 Vaultrc5 NM_012053 Rpl8 NM_177099 Lefty2 NR_015531 Dancr NM_010240 Ftl1 NR_038063 Rplp2-ps1 NR_045289 Rab26os NM_018860 Rpl41 NM_001145804 Nucks1 NR_110499 Rpl14-ps1 NM_008774 Pabpc1 NM_024212 Rpl4 NM_029352 Dusp9 NM_012052 Rps3 NM_001078167 Srsf1 NM_152806 Ddx17 NR_003363 Gm6548 NM_009128 Scd2 NM_010202 Fgf4 NM_018796 Eef1b2 NM_008143 Gnb2l1 NM_029872 Hnrnpa0 NM_026147 Rps20 NM_001289828 Nanog NM_026242 Mrfap1 NM_010094 Lefty1 NM_018853 Rplp1 NM_021278 Tmsb4x NM_011562 Tdgf1 NM_016906 Sec61a1 NM_029767 Rps9 NM_010239 Fth1 NM_026055 Rpl39 NM_029701 Spcs3 NM_007451 Slc25a5 NM_007475 Rplp0 NR_027901 2900060B14Rik NM_011712 Wbp5 NM_019419 Arl6ip1 NM_009127 Scd1 NM_001204875 Set NM_010480 Hsp90aa1 NM_026155 Ssr3 NM_181401 Tmem64 NM_198006 Coa5 NM_172665 Pdk1 NM_001081164 Otud4 NM_009786 Cacybp NM_001039129 Hnrnpa1 NM_008468 Kpna6 NM_001190800 Ddx19b NM_026036 Cmtm6 NM_026521 Zfp706 NM_024166 Chchd2 NM_008019 Fkbp1a NM_008972 Ptma NM_001252260 Npm1 NM_001033474 Atxn7l3b NM_001081005 1500012F01Rik NM_001253857 Tet1 NM_001285412 Calu NM_025586 Rpl15 NM_145625 Eif4b NM_013725 Rps11 NM_001171035 Tmbim6 NM_011400 Slc2a1 NM_175403 Mlec NM_007984 Fscn1 NM_023755 Tfcp2l1 NM_001136069 Ldha NM_008568 Mcm7 NM_146012 Ctdsp2 NM_011296 Rps18 NM_013765 Rps26 NM_001134427 Cdv3 NR_027907 AI414108 NM_007478 Arf3 NM_020600 Rps14 NM_008251 Hmgn1 NM_026517 Rpl22l1 NM_009546 Trim25 NM_001142809 S1c6a8 NM_001159375 Eif4a1 NM_001293559 Cox4i1 NM_007748 Cox6a1 NM_009391 Ran NM_001030307 Dkc1 NM_028451 Larp1 NM_019647 Rpl21 NM_033561 Eif4h NM_008810 Pdha1 NR_002883 Gm5643 NM_009536 Ywhae NM_010193 Fem1b NM_033617 Atp6v0b NM_011404 Slc7a5 NM_024214 Tomm20 NM_009951 Igf2bp1 NM_009320 Slc6a6 NM_001253757 Anp32e NM_001164806 Bend4 NM_025881 Luc7l NM_178627 Poldip3 NM_011292 Rpl9 NM_001252292 Mest NM_011291 Rpl7 NM_001110499 Canx NM_144866 Etf1 NM_001004153 AU018091 NM_145833 Lin28a NM_016898 Cd164 NM_172467 Zc3havl1 NM_001142732 Ttll3 NM_133815 Lbr NM_001190718 Dcaf12l1 NM_001289599 Txndc5 NM_178111 Trp53inp2 NM_007589 Calm2 NM_011462 Spin1 NM_028261 Rian NM_153592 Erlin2 NM_045170 Gm10336 NM_021383 Rqcd1 NM_001276481 Dag1
[0374] To determine reproducibility among dCLIP peaks, we utilized deepTools (Ramirez et al., 2014) analysis, we averaged the significance values (log(p-value)) of strand-specific peaks enriched in at least two out of three replicates, per bin. 1-kb bin size was applied. Pairwise-Pearson correlation (PPC) analysis was performed for the 3 replicates. Scatter plots were generated (
[0375] We further utilized a matrix of total read counts per gene normalized to the length of each gene (as described above), and per all genes that manifest CLIP signal in at least two replicates, conducted three paired comparisons as follows: Replicate #1 vs. Replicate #2; Replicate #1 vs. Replicate #3; Replicate #2 vs. Replicate #3. Normalized data points were plotted and correlative patterns are presented as three scatterplots (
[0376] To characterized and summarize whole-genome occupancy pattern of peaks, we pooled and merged all piranha peaks (overlapping PeakRanger peaks) from three libraries into one continuous track (containing 8,578 peaks), and employed CEAS analysis (Ji et al., 2006; Shin et al., 2009), using the mm9 KnownGenes database, and as background dataset we used a merged transcriptome coverage track obtained from two RNA-seq experiments conducted in the same cell line that was employed for conducting CLIP experiments.
[0377] Chip-Seq Analysis
[0378] Data processing was performed as described previously (Kung et al., 2015). Normalization to input libraries was performed with window size 500 and step size 100. To obtain highly significant ChIP peaks, we used the software macs2 (version 2.1.0.20150603) (Zhang et al., 2008) with highly stringent constraints (p 0.01) to identified ChIP peaks verses input for the IP. Additionally, we compared the IP verses a control IP using PeakSeq (version 1.3) (Rozowsky et al., 2009) with stringent constraints (Enrichment_fragment_length 200, Enrichment_mapped_fragment_length 200, Background_model Simulated, max_Qvalue 0.1, target_FDR 0.05, N_Simulations 10, Minimum_interpeak_distance 200). Then we constrained the macs called ChIP peaks to only those that were also called against the control experiment. Finally, we limited the resulting peaks to those that intersect with IP enriched regions six-fold over the input. IP and input regions are obtained using smoothed coverage data using a 500 nucleotide window with 100 nucleotide steps. To assess the relationship between CBX7s binding to RNA vs. DNA we counted the number highly significant ChIP peaks that overlapped dCLIP-bound transcripts versus all expressed transcripts using non-parametric techniques (1,000 random selections with replacement). Overlap was counted if ChIP peak was located inside an open reading frame or a promoter region (2,000 nt upstream to transcription start site) of the corresponding transcript.
[0379] Motif Analysis of CLIP-Seq Data
[0380] Basing on three separate CLIP experiments that were performed, three mouse CBX7 CLIP-seq datasets were raised, containing the following numbers of PeakRanger enriched CLIP regions aligned to positive and negative strands, respectively (after excluding rDNA and mtDNA sequences): #1: (4,262, 4,225), #2: (4,254, 3,979), #3: (5,021, 5,009). To thoroughly analyze the biological information embedded within the three independent CBX7 CLIP-seq libraries of mouse we have defined three grouping categories on the basis of regions redundancy (overlapping) existing between the three independent libraries. We dubbed these categories: (1) Individuals: a category containing original, unfiltered, enriched CLIP regions; (2) OneOL: a category containing enriched CLIP regions that their span intersects with the span of at least another enriched CLIP region that was raised from another independent library; (3) TwoOL: a category composed of enriched CLIP regions that their span intersects with the span of enriched CLIP regions raised from two independent libraries. This approach was based on the presumption that CBX7 could have more than one consensus motif and that each library may not have sufficient depth to capture all CBX7-binding sites. Basing on these three categories we opted to take a parallel branched approach by classifying the enriched regions raised from the three independent CBX7 CLIP-seq libraries into nine datasets, namely: Individuals #1, Individuals #2, Individuals #3, OneOL #1, OneOL #2, OneOL #3, and TwoOL #1, TwoOL #2, TwoOL #3. In addition to identifying the boundaries of enriched CLIP regions, PeakRanger algorithm determines the summit position of each region (harboring the topmost CLIP signal), which manifests the strongest binding affinity towards CBX7. Thus, in order to pinpoint the most significant CBX7-RNA binding events we referred to the summit point of each enriched region as an anchoring position and stretched a 100 bp region around it (50 bp) (Ma et al., 2014). Per each of the nine datasets, summit-based 100 bp CLIP-enriched regions of positive and negative strands were combined into a single batch, resulting the following (number of enriched CLIP regions is indicated in parenthesis): (1) Individuals #1 (8,492); (2) Individuals #2 (8,237); (3) Individuals #3 (10,031); (4) OneOL #1 (3,422); (5) OneOL #2 (2,499); (6) OneOL #3 (3,182); (7) TwoOL #1 (1,125); (8) TwoOL #2 (1,083); (9) TwoOL #3 (1,088). In each of the nine datasets, enriched CLIP regions were sorted based on their FDR significance values as defined by PeakRanger. In order to discover novel binding motifs that may be enriched in each of the nine CLIP-seq datasets we employed MEME-ChIP tool that employs both, the MEME and DREME algorithms for identifying de-novo binding motifs (Bailey et al., 2009; Ma et al., 2014). Since the MEME-ChIP tool functions most efficiently when introduced with datasets containing up to 600 sequences (Ma et al., 2014), and due to the fact that 6 of our 9 datasets were 4-17 fold larger, we created a pipeline that receives a large-sized dataset of enriched CLIP regions, splits it into equal-sized batches (typically of 600 sequences per batch), and then, in parallel per each of the batches, fetched with Bedtools (Quinlan and Hall, 2010), the strand-specific FASTA sequences (100 bp around the summit point of each enriched region), and executes the MEME-ChIP tool in strand-specific mode (-norc). Given that enriched CLIP regions within each of the CLIP-seq datasets manifest a wide range of significance (FDR) values, each of the large-sized datasets was split based on equal-sized intervals across the FDR-sorted dataset, allowing an overall balanced representation of significance values of CLIP regions throughout all batches. Thus, the three Individuals CLIP-seq datasets (#1, #2, #3) were processed as 14, 13, and 16 batches, respectively, whereas the three OneOL CLIP-seq datasets (#1, #2, #3) were processed as 5, 4, and 5 batches, respectively. Each of the three TwoOL CLIP-seq datasets (containing 1,100 enriched regions) was processed as one batch.
[0381] Per each of the analyzed CLIP region batches MEME-ChIP tool determined the enrichment of several binding motifs. All novel motifs identified under each of the three categorical groups, namely, Individuals, OneOL, or TwoOL, were pooled together, yielding motif pools of 158, 48, and 19 motifs, respectively. Next, all de-novo motifs identified under each categorical group were subjected to multiple motif alignment analysis employed by the similarity-clustering tool, STAMP (Mahony and Benos, 2007). In each case, STAMP analysis, employed in strand-specific mode (-forwardonly), generated a phylogenetic newick tree that was constructed by comparing strand-specific similarity of binding motifs. Phylogenetic Newick trees were then depicted by employing the Molecular Evolutionary Genetics Analysis (MEGA) software (Tamura et al., 2013). In addition, our pipeline employed SeqLogo Bioconductor package (Bembom O. seqLogo: Sequence logos for DNA sequence alignments. R package version 1.34.0.) for generating a sequence logo for each of the enriched binding motifs. Next, we viewed the Newick tree of each of the categorical groups, and based on its branch structure grouped together neighboring motifs that share pattern similarity. We then re-subjected each of the groups containing similar motifs to STAMP analysis that generated a unique generalized FBP (Familial Binding Profile) model reflecting the general profile of all binding motifs within each group. FBP analysis was performed redundantly for each groupIndividuals, OneOL, and TwoOL. The individuals FBPs were seen to fall within FBPs identified by the OneOL and TwoOL groups, strongly suggesting that the motifs from Individuals datasets (obtained from a single library) resembled those arising from the OneOL and TwoOL (more inclusive) datasets. Altogether, STAMP analysis of the three categorical groups yielded 24 FBPs, namely, 10 Individuals FBPs, 7 OneOL FBPs, and 7 TwoOL FBPs (
[0382] To statistically analyze over-representation of 24 mouse CBX7 FBPs in each of the three original mouse CBX7 libraries, we first assembled a motif library of 24 position weight matrices (PWMs) by combining the all FBPs from three datasets. To enable further downstream the tracking of dataset that originally yielded each of the de-novo FBPs, in addition to being labeled by a serial number, FBPs were labeled as either Indiv., OneOL, or TwoOL.
[0383] By utilizing Bedtools, we fetched, per each of the three CLIP libraries, the FASTA sequences of the enriched CLIP region. Next, we used CLOVER (Frith et al., 2004) at a strand-specific mode (z=1) to detect binding motifs that were enriched in mouse CBX7 CLIP regions. Per each of the three CLIP libraries CLOVER determined the statistical enrichment of each mouse FBPs relative to two background sets that were constructed from the entire transcriptome coverage obtained from two separate RNA-seq experiments conducted in the same cell line that was employed for conducting CLIP experiments. Each of the reported binding motifs was given a score (raw score) based on its predicted binding energy, and two p-value significance scores, each corresponding to the one background file (Frith et al., 2004). FBPs with raw scores higher than 6 and two significant enrichment score (p0.05) were selected for further analysis.
[0384] In addition, we assembled a library of 1,179 Known PWMs, by combining the RNA-binding motifs in the compendium of RBP recognition motifs (Ray et al., 2013), together with DNA binding motifs in the JASPAR database (Sandelin et al., 2004), and those in recently reported sets of PWMs for mouse transcription factors (Badis et al., 2009) (Wei et al., 2010; Xie et al., 2010). By applying the same parameters used for detecting enrichment of FBPs, we employed CLOVER for identifying enrichment of known motifs within the CBX7 CLIP regions. Per each of the enriched FBPs and Known motifs we summarized the number of binding sites hits identified within each library, and by dividing this number by the total number of library's CLIP regions, we obtained a prevalence score for each of the FBPs and Known motifs. We combined the output parameters obtained from CLOVER analysis of three CLIP libraries into one database, and sorted FBPs and Known motifs based on four scoring criteria: (1) Number of libraries in which a motif was significantly enriched (p0.05); (2) Average significance score (p-value); (3) Average prevalence score; (4) Average raw score. We discard all FBPs and Known motifs that manifested an inverse significance relative to background datasets (p0.95) in at least one dataset, and all motifs that their average prevalence score was under 5%. Based on this sorting procedure all qualified motifs were ranked (with motif #1 represent the motif with the best scores). Altogether, 11 FBPs (out of the originally introduced 24 mouse FBPs), and 80 Known motifs were met our criteria and found significantly enriched in at least one of the mouse CBX7 CLIP datasets (for known motifs a literature survey that determined their previously suggested role in RNA metabolism and function was additionally implemented as part of the filtration procedure). Among the 11 qualified mouse FBPs, 8 were significantly enriched in 3 CLIP libraries, while 3 were enriched in 2 libraries. Among 80 known motifs, 29 (36%), 29 (36%), and 22 (27%) motifs were enriched in three, two, and single CLIP libraries, respectively. Interestingly, 53 of these enriched Known motifs were RNA-binding motifs that previously reported as part of the compendium of RBP recognition motifs (Ray et al., 2013).
[0385] In order to determine whether specific FBPs could be grouped together into a higher-ordered motif family, also dubbed as FAM (FBPs Association Module), by employing STAMP analysis over the 11 qualified mouse FBPs we obtained a phylogenetic tree that identified the presence of four highly-ordered FAMs, which we named: FAM1 (composed of FBP2_Indiv., FBP5_TwoOL, FBP7_OneOL, FBP2_TwoOL); FAM2 (composed of FBP4_TwoOL, FBP3_TwoOL); FAM3 (composed of FBP5_OneOL, FBP9_Indiv.); FAM4 (composed of FBP7_TwoOL, FBP10_Indiv., FBP6_OneOL).
[0386] Basing on two separate CLIP experiments that were performed, two human CBX7 CLIP-seq datasets were raised, containing the following numbers of PeakRanger enriched CLIP regions aligned to positive and negative strands, respectively (after excluding rDNA and mtDNA sequences): #1: (2,552, 2,125), #2: (399, 490). As described above, Peak summits were used as anchoring positions for stretching 100 bp strand-specific regions around them (50 bp). By applying identical computational tools and similar analytic steps as these described above for mouse CBX7-CLIP, we carried out identification of de novo binding motifs of Human-CBX7. Altogether, this analysis yielded 122 de novo binding motifs that were subsequently subjected to STAMP similarity-clustering analysis (see above), generating 27 human FBPs. We utilized CLOVER for determining the statistical enrichment of each of 27 human FBPs, in addition to 1,179 Known PWMs (see above) relative to two background sets that were constructed from the transcriptome of human HEK-293 cells. After filtering out motifs that were insignificantly enriched (p>0.05), or manifested presence lower than 5%, we obtained 9 human FBPs, and 50 Known motifs that met our criteria. Next, we utilized STAMP analysis (see above) for identifying motif similarities among 9 enriched Human FBPs and 11 enriched mouse FBPs. In parallel, we carried out STAMP matching analysis between 9 enriched Human FBPs and 50 Known binding motifs (Ray et al., 2013).
[0387] To define the global distribution of each of the four FAMs we extracted from CLOVER output data files of each of the three CLIP libraries, the genomic coordinates of all 11 qualified FBPs, grouped by FAMs. We then employed CEAS analysis (Ji et al., 2006; Shin et al., 2009), using the mm9 KnownGenes database, and as background dataset we used a merged transcriptome coverage track obtained from two RNA-seq experiments conducted in the same cell line that was employed for conducting CLIP experiments.
[0388] FAM-Occupancy in CLIP Regions Compare to Their Corresponding Full-Span Genomic Features
[0389] In order to determine the potential contribution of each of the four FAMs to transcripts binding to CBX7, we first pooled together the CLOVER output data of all three CLIP libraries and grouped them by FAM. By employing R packages (GenomicFeatures, Bsgenome.Mmusculus.UCSC.mm9, and NCBI37/mm9 knownGenes genome assembly), we extracted coordinates of genomic features (3UTR, 5UTR, coding sequences (CDs), and introns). We then annotated all FBPs (FAMs) overlapping with mouse genes to their corresponding genomic features. Next, we calculate per each CLIP transcript its FAM occupancy score. To this end, we aggregated per each gene, and per a given genomic feature, all FAM-hits that were detected within each of the transcripts that were obtained by CLIP. In case that the genomic feature was composed of multiple frames per a single gene (such in the case of introns that composed of multiple frames per a single gene), FBP-hits were aggregated from all frames that were retrieved by CLIP. Then, by dividing the total number of FAM-hits identified at a given CLIP fragment by the length of the genomic feature that CLIP FAM resides in, we generated per each gene a CLIP-associated FAM-occupancy score. Next, we calculated a full-length genomic feature-associated FAM-occupancy score. To this end, per each of the transcripts retrieved by CLIP, we mapped all putative FAM-hits across the entire span of the genomic feature. Thus, per a given genomic feature we mapped all real FAM-hits (overlapping with regions obtained by CLIP) in addition to predicted FAM-hits (excluded from regions obtained by CLIP) that reside within the full span of a genomic feature. Finally, we calculate FAM-occupancy Ratio per each CLIP transcripts by dividing CLIP FAM-occupancy score by genomic feature-associated FAM-occupancy score.
[0390] We summarized the results of this analysis by as a series of boxplots that describe the distribution of the FAM-occupancy ratio within the four FAM groups across each of the tested genomic features. The analysis indicated that FAM2, when integrated within CLIP transcripts provides in general higher potency for transcripts to bind CBX7, as compare to than all other FAMs. This potency of FAM2 was observed across all tested genomic features.
[0391] Analysis of FAMs that Reside within the Same CLIP Fragment
[0392] We noticed that some CLIP transcripts harbor more than one FAM per a fragment (as indicated by count histogram of number of FAMs residing adjacently on the same dCLIP fiber;
[0393] In the scope of a separated analysis we counted per all four FAMs that number of appearances within each genomic feature or outside any genomic feature (No Feature). We plotted these counts as a barplot, grouped by FAM type, and according to genomic features.
[0394] To assess the contribution of FAMs co-clustering on the same dCLIP transcript we split CLIP fragments into two batches, namely: Single FAMs per CLIP fiber (FAMs with zero adjacent FAMs on the same CLIP fiber), and Multiple FAMs per CLIP fiber (FAMs with one or more adjacent FAMs on the same CLIP fiber). Then, we analyzed separately the FAM-likelihood ratios per each of these two batches, for each of the four FAMs, within each genomic feature.
[0395] Metagene Analysis of FAM Pairs
[0396] To determine whether FAMs have a tendency to reside next to each other as pairs in preferential manner, we plotted per each of the four FAMs its distribution of distances from its center to the center of its paired FAM. We conducted this analysis on a single bp resolution, across a window of 200 bp (X-axis), presenting the count number for each FAM-pair on the Y-axis.
[0397] Metagene Analysis of FAM Sites for Profiling icSHAPE Signals
[0398] To determine whether CBX7 CLIP transcripts may adopt specific secondary RNA structures, we took advantage of the publically available RNA structural signatures established via in vivo and in vitro click selective 2-hydroxyl acetylation and profiling experiments (icSHAPE). The GRCm38/mm10 bigwig data files corresponding to in vivo and in vitro icSHAPE structural profiles were obtained from GEO database (record GSE60034) (Spitale et al., 2015), and converted to the NCBI37/mm9 assembly by employing UCSC tools, bigWigToBedGraph following by liftOver. Using in house codes, we calculated separate metagene structure profiles around an anchor position that was defined as the center of each of four FAM binding motifs. Individual structural profiles of in vivo and in vitro icSHAPE scores were generated, at single nucleotide resolution, by accumulating all icSHAPE scores detected within the limited scope of 25 nucleotides upstream and downstream. The average icSHAPE profile was then generated by division of the accumulative icSHAPE score per single nucleotide by the total number of 25 bp FAM regions containing a total icSHAPE score higher than zero (>0). Thus, 50 bp regions that harbor no icSHAPE signal around the center of FAM motif were excluded from this analysis. For contrasting the profiles of FAM motifs that were identified in CLIP regions (Real FAMs), against a control cohort of FAM motifs that were not identified in CLIP regions (Predicted FAMs), we took advantage of the previously established motif binding sites database that contains both real and predicted motifs. As described above, per each of the enriched CLIP regions that were found by our analysis to harbor FBP binding site, we scanned for predicted FBPs throughout the entire span of the genomic feature in which the real CLIP FBP was reside in. Thus, by employing the database of predicted FAM binding sites we matched per each of the 25 bp Real FAM regions an equivalent number of Predicted FAM regions (25 bp) that proved to harbor icSHAPE signal within the 50 bp detection window. By employing these analytic criteria, we contrasted icSHAPE profile of Real FBPs cohort against icSHAPE profile of equal-size Predicted FBPs cohort (
[0399] To further determine the contribution of co-clustering of FAMs within the same dCLIP transcript we split CLIP fragments into two batches, namely: Single FAMs per CLIP fiber (FAMs with zero adjacent FAMs on the same CLIP fiber), and Multiple FAMs per CLIP fiber (FAMs with one or more adjacent FAMs on the same CLIP fiber), and performed the distribution analysis of icSHAPE reactivity per each of these batches as depicted in
[0400] The Denaturing CLIP (dCLIP) Methodology
[0401] Our original goal was to identify RNA interactomes for both canonical and non-canonical PRC1. We therefore initially used both CBX7 (canonical) and RYBP (non-canonical) as bait using conventional CLIP methodologies and CBX7-specific or RYBP-specific antibodies for the pulldown. However, all initial attempts failed due to high background, as evidenced by multiple bands that span the length of SDS PAGE gel (transferred to a CLIP membrane;
[0402] We introduced bio-tagged CBX7 and RYBP into ES cells stably expressing BirA biotinylase and performed denaturing CLIP or dCLIP with these features (
[0403] Because of highly stringent denaturing conditions made possible with dCLIP, we asked if it were possible to skip the SDS-PAGE and membrane transfer steps entirely, as these steps partially served to eliminate RNA-protein interactions sensitive to denaturing SDS conditions as well. Furthermore, in principle, the exclusion of the additional steps could improve recovery of extremely limited quantities of RNA that are typically associated with epigenetic complexes. To test the possibility, we eluted RNAs directly from streptavidin beads using proteinase K treatment. However, we found that the purification by SDS-PAGE and membrane transfer was absolutely necessary in the dO ES cell samples, as direct elution from beads resulted in high background for some cellular samples (
[0404] Elution of RYBP-interacting RNAs also produced a heterogeneous population, but lower levels of RNA were eluted overall (
Example 1
dCLIP Defines RNA Footprints for CBX7
[0405] Peak-calling using PeakRanger Software (Feng et al., 2011) revealed 8,000-10,000 statistically significant peaks in three biological replicates (
[0406] We compared the dCLIP tags to expression level of the respective RefSeq transcripts (input RNA-seq). Among transcripts without reproducible dCLIP binding, we identified a cohort of 2,078 transcripts that possessed similar expression levels as 1,333 transcripts with reproducible CLIP tags (green and black dots;
[0407] We next examined how CBX7-binding sites in the RNA (dCLIP-seq) relate to CBX7's chromatin binding sites (ChIP-seq). Previous work demonstrated that CBX7 tends to to bind large number of genomic loci in mouse ES cells {Morey, 2012 #1198}. Therefore, CBX7-RNA interactions identified by dCLIP method might theoretically arise from non-specific cross-linking between chromatin-bound CBX7 and RNAs transcribed in the vicinity. To rule out this possibility, we performed CBX7 ChIP-seq using the same ES cells (
TABLE-US-00003 TABLE b Related to FIGS. 1E,F and FIG. 2. List of all genes for which CBX7 binds both the transcript (dCLIP) and the locus (ChIP). 1110038B12Rik; Acaca; Acsl4; Adad1; Ado; Aebp2; Agrn; Akap11; Alg11; Amfr; Arf6; Atp11a; Aurka; Bend4; Bmpr2; Bnc2; Calm2; Camk2b; Ccdc50; Ccng1; Cdc14b; Cfdp1; Chsy1; Clstn1; Col4a1; Cpne3; Dag1; Dcaf12l1; Dcakd; Ddah1; Dennd1b; Dlg3; Dnmt3a; Dpysl3; Dst; Dusp16; Dusp7; Dusp9; Egln1; Eif4e2; Esrrb; Exoc6b; Fam172a; Fam20b; Fbxl5; Fstl1; Gab1; Git1; Gm13152; Gm37013; Grik3; Gtpbp1; Hmgn1; Hsd17b12; Igf2bp3; Igf2r; Iqsec1; Ist1; Kars; Kcnq5; Kdm7a; Larp4; Lonrf1; Lrig1; Lrrc58; Macf1; Man2a1; Mapk4; Mcl1; Med13l; Meg3; Mest; Mief1; Mllt10; Ndrg1; Nkain1; Nmnat2; Nova2; Npcd; Nptx1; Nr6a1; Nudt4; Ostc; Pam; Pcdhga1; Pcdhga10; Pcdhga11; Pcdhga12; Pcdhga2; Pcdhga3; Pcdhga4; Pcdhga5; Pcdhga6; Pcdhga7; Pcdhga8; Pcdhga9; Pcdhgb1; Pcdhgb2; Pcdhgb4; Pcdhgb5; Pcdhgb6; Pcdhgb7; Pcdhgb8; Pcdhgc3; Pcdhgc4; Pcdhgc5; Pde4d; Peg10; Plec; Plekha2; Podxl; Ppp2r2c; Prkaa2; Prkaca; Prkar2a; Prkd3; Ptbp3; Pvrl1; Qk; Rac1; Rbm38; Reep1; Rere; Rimklb; Rnf187; Rsrc1; Scamp1; Sdc4; Sfmbt2; Sfrp1; Sh3pxd2a; Slc30a1; Slc38a1; Smg1; Snd1; Snn; Socs7; Sord; Sox2ot; Spen; Spock2; Spop; Ssh2; Stag2; Stox2; Stxbp5; Tbc1d16; Tfdp1; Tmem164; Tnfrsf21; Trim44; Trp53inp2; Tub; Ugcg; Uggt1; Usp31; Vat1; Xist; Yes1; Zfp318; Zic2; Zmat3;
[0408] This percentage was significantly lower than that for bulk expressed transcripts in the ES cells (
Example 2
Consensus Motifs Deduced from RNA Footprints
[0409] With a median footprint of 171 nt, the short and reproducible binding sites for CBX7 raised the possibility of defining consensus motifs for CBX7-containing PRC1 complexes. To deduce consensus motifs in the RNA, we performed comparative sequence analysis of CBX7-binding peaks from three dCLIP biological replicates (
[0410] If the deduced motifs represented a true CBX7 RNA-binding consensus, we should expect to see enrichment of the FAM motifs in the 3UTR. Indeed, consistent with CEAS analysis of the dCLIP peaks (
[0411] Another consideration is that CBX7 could have multiple contact points within one transcript, potentially contacting different faces of the RNA via different motifs. To test the latter possibility, we asked whether the motifs have a tendency to congregate on the same CLIP fragment. Analysis of all pairwise combinations of the FAMs revealed that they co-clustered, creating motif-pairs separated by 50 nt (
[0412] Given that both 5 and 3 UTRs are typically bound by large number of proteins (Glisovic et al., 2008), we asked how the CBX7 motifs might be related to binding motifs of known RNA-binding proteins. A similarity matching analysis of the 4 FAMs against a panel of >1,000 known binding motifs uncovered significant overlap (
[0413] We also asked whether the binding sites possess structural features by taking advantage of structural profiles established in mouse ES cells via click selective 2-hydroxyl acetylation and profiling experiments (icSHAPE) (Spitale et al., 2015). icSHAPE-seq allows probing of RNA secondary structure both in vivo and in vitro and favors single-stranded or flexible RNA regions. icSHAPE-seq also offers advantages over DMS-seq and Cirs-seq (Incarnato et al., 2014; Rouskin et al., 2014), as it is reactive to all four nucleotides, thereby enabling the capture of RNA secondary structures at a transcriptome-wide level at higher resolution (Spitale et al., 2015). For each of the four FAMs, icSHAPE profiles were markedly different from one another (
[0414] We then repeated the analysis for dCLIP fibers with clustered FAM motifs (
Example 3
Biochemical Validation of CBX7-Binding Sites
[0415] Next we turned to experimental systems to validate and understand the nature of the CBX7-3UTR interactions. First, we sought to confirm select interactions using a different method of in vivo RNA pulldown and using antibodies to a different epitope of the tagged protein (as opposed to using the biotin tag to pull down CBX7). Native RIP with qPCR confirmed the enrichment of Dusp9, Calm2, and Tug1 RNAs in multiple independent biological replicates (
[0416] Second, to confirm direct interactions between CBX7 and various 3UTRs, we performed RNA electrophoretic mobility shift assays (EMSA) using CBX7 protein purified from baculovirus and purified in vitro transcribed RNAs corresponding to dCLIP peaks. We tested three representative transcripts, Calm2, Dusp9, and Dcaf12l1 (
[0417] We next tested the relevance of the bioinformatically predicted FAM motifs. We turned to footprints with single FAMs in order to simplify the analysis. For the FAM3 motif in the 3UTR of Nucks1 mRNA, CBX7 shifted the RNA fragment and the shift was reduced by Nucks1 cold competitors (
Example 4
Targeting CBX7-Binding Sites In Vivo Results in Gene Upregulation
[0418] We explored potential functions of the CBX7-3UTR interactions. Given that PRC1 is generally involved in gene repression (Simon and Kingston, 2013), we asked whether the RNA-binding activity of CBX7 may be involved in recruiting PRC1 to silence genes. To test this idea, we attempted to block the CBX7-3UTR interactions and designed antisense oligonucleotides (ASO) comprising interspersed DNA bases and locked nucleic acids (LNA) bases to create LNA mixmers that are not subject to RNaseH-mediated target degradation and can therefore stably associate with target sequences (Sarma et al., 2010). For each transcript, we designed a pool of LNA mixmers to the corresponding 3UTR peaks (
[0419] The repressive activity of PRC1 has been linked to both the H2AK119 ubiquitylation function and to chromatin compaction (Simon and Kingston, 2013). To understand how LNA treatment enhanced gene activity, we performed ChIP-qPCR to ask whether there were locus-specific changes to CBX7 recruitment and H2AK119Ub. Interestingly, we observed no changes in CBX7 recruitment and H2AK119 ubiquitylation at either Calm2 or Dcaf12l1 after treatment with corresponding gene-specific LNAs (
[0420] Next, we examined the effect of LNA oligomers on CBX7 binding to target RNAs in vitro. Intriguingly, while RNA EMSA showed that pre-incubating RNA with gene-specific LNAs resulted in an upward shift of the transcripts, as expected (blue arrows,
[0421] To determine whether the LNA-mediated gene upregulation depended on CBX7 in vivo, we introduced the LNAs into wildtype versus Cbx7/ ES cells (Cheng et al., 2014; Zhen et al., 2016) (
[0422] The localization of CBX7 to the 3UTR (
Example 5
dCLIP Analysis of Human CBX7 (hCBX7) Identifies Shared Consensus Motifs
[0423] Next, we applied dCLIP methodology to human CBX7 protein to assess whether the human orthologue shares RNA binding potential and to determine whether consensus motifs can be independently deduced from the human RNA-protein interactions. Although hCBX7 and mouse CBX7 (mCBX7) share CD and PC boxes, hCBX7 is 58 amino acids longer than mCBX7 and is therefore epitopically different (
[0424] Finally, we examined the relationship between mCBX7/hCBX7 transcripts as defined by dCLIP and BMI1 transcripts as defined by gradient RNA immunoprecipitation (GRIP) in human HeLa cells (Ray et al., 2016). GRIP method involves formaldehyde cross-linking and gradient purification of chromatin fraction with subsequent immunoprecipitation of chromatin-bound RNAs using antibodies against the BMI1 subunit of PRC1. Despite substantial differences in methodology, there was considerable overlap, with 1,777 transcripts shared between hCBX7 and hBMI1 (Table C). This represented to nearly half of hCBX7-interacting transcriptsthe 3UTR of IRAK1 being one example (
TABLE-US-00004 TABLE c Related to FIG. 7. List of genes that produced specific dCLIP CBX7 binding in human HEK293 cells and GRIP BMI1 binding in human HeLa cells (GRIP data adopted from (Ray et al., 2016). Refseq Ensembl Gene Name NM_005885 ENSG00000145495 membrane associated ring finger 6 NM_006640 ENSG00000184640 septin 9 NM_004996 ENSG00000103222 ABCC1 NM_001171 ENSG00000091262 ABCC6 NM_018358 ENSG00000161204 ABCF3 NM_022437 ENSG00000143921 ABCG8 NM_198147 ENSG00000168792 ABHD15 NM_021214 ENSG00000136379 ABHD17C NM_025097 ENSG00000164074 ABHD18 NM_005470 ENSG00000136754 ABIl NM_005157 ENSG00000097007 ABL1 NM_005158 ENSG00000143322 ABL2 NM_002313 ENSG00000099204 ABLIM1 NM_001092 ENSG00000159842 ABR NM_145804 ENSG00000166016 ABTB2 NM_001093 ENSG00000076555 ACACB NM_000019 ENSG00000075239 ACAT1 NM_022735 ENSG00000182827 ACBD3 NM_014977 ENSG00000100813 ACIN1 NM_004457 ACSL3 NM_001101 ENSG00000075624 ACTB NM_024855 ENSG00000101442 ACTR5 NM_006988 ENSG00000154734 ADAMTS1 NM_012091 ADAT1 NM_182503 ENSG00000189007 ADAT2 NM_020247 ENSG00000163050 ADCK3 NR_110007 ENSG00000259456 ADNP-AS1 NR_040107 ENSG00000260898 ADPGK-AS1 NM_032550 ENSG00000169129 AFAP1L2 NM_005935 ENSG00000172493 AFF1 NM_012154 ENSG00000123908 AGO2 NM_017629 ENSG00000134698 AGO4 NM_020132 ENSG00000160216 AGPAT3 NM_024929 ENSG00000279355 AGPAT4-IT1 NM_015239 ENSG00000135049 AGTPBP1 NM_015328 ENSG00000158467 AHCYL2 NM_017651 ENSG00000135541 AHI1 NM_005858 ENSG00000105127 AKAP8 NM_014371 ENSG00000011243 AKAP8L NM_024595 ENSG00000174574 AKIRIN1 NR_002796 AKR7A2P1 NM_000034 ENSG00000149925 ALDOA NM_006982 ENSG00000180318 ALX1 NM_000479 ENSG00000104899 AMH NM_030943 ENSG00000166126 AMN NM_016238 ENSG00000196510 ANAPC7 NM_000037 ENSG00000029534 ANK1 NM_015114 ENSG00000176915 ANKLE2 NM_032217 ENSG00000132466 ANKRD17 NM_144994 ENSG00000163126 ANKRD23 NM_014915 ENSG00000107890 ANKRD26 NM_015199 ENSG00000206560 ANKRD28 NR_026844 ENSG00000214262 ANKRD36BP1 NM_016466 ENSG00000213337 ANKRD39 NM_152326 ENSG00000156381 ANKRD9 NM_006401 ENSG00000136938 ANP32B NM_030920 ENSG00000143401 ANP32E NM_004039 ENSG00000182718 ANXA2 NM_001153 ENSG00000196975 ANXA4 NM_001154 ENSG00000164111 ANXA5 NM_001158 ENSG00000131480 AOC2 NM_004068 ENSG00000161203 AP2M1 NM_003664 ENSG00000132842 AP3B1 NM_001163 ENSG00000107282 APBA1 NM_006051 ENSG00000113108 APBB3 NM_030642 ENSG00000128313 APOL5 NM_000484 ENSG00000142192 APP NM_015242 ENSG00000186635 ARAP1 NM_001658 ENSG00000143761 ARF1 NM_004308 ENSG00000175220 ARHGAP1 NM_021226 ENSG00000128805 ARHGAP22 NR_046816 ENSG00000230789 ARHGAP26-IT1 NM_004309 ENSG00000141522 ARHGDIA NM_033415 ENSG00000105676 ARMC6 NM_003976 ENSG00000117407 ARTN NM_139058 ENSG00000004848 ARX NM_019893 ENSG00000188611 ASAH2 NR_002765 ASAP1-IT1 NM_017873 ENSG00000148331 ASB6 NM_001672 ENSG00000101440 ASIP NM_004318 ENSG00000198363 ASPH NM_015338 ENSG00000171456 ASXL1 NM_032810 ENSG00000138138 ATAD1 NM_007041 ENSG00000107669 ATE1 NM_005171 ENSG00000123268 ATF1 NM_018179 ENSG00000171681 ATF7IP NM_033388 ENSG00000168010 ATG16L2 NM_006395 ENSG00000197548 ATG7 NM_001940 ENSG00000111676 ATN1 NM_024524 ENSG00000133657 ATP13A3 NM_000701 ENSG00000163399 ATP1A1 NM_032766 ENSG00000203865 ATP1A1-AS1 NM_001681 ENSG00000174437 ATP2A2 NM_001682 ENSG00000070961 ATP2B1 NM_014382 ENSG00000017260 ATP2C1 NM_000705 ENSG00000186009 ATP4B NM_001686 ENSG00000110955 ATP5B NM_001688 ATP5F1 NM_001685 ENSG00000154723 ATP5J NM_004889 ENSG00000241468 ATP5J2 NM_001697 ENSG00000241837 ATP5O NM_001694 ENSG00000185883 ATP6V0C NM_003945 ATP6V0E1 NM_000489 ENSG00000085224 ATRX NM_001698 ENSG00000148090 AUH NM_015060 ENSG00000105778 AVL9 NM_021732 ENSG00000119986 AVPI1 NM_003502 ENSG00000103126 AXIN1 NM_152490 ENSG00000162885 B3GALNT2 NM_012200 ENSG00000149541 B3GAT3 NM_004776 ENSG00000158470 B4GALT5 NM_020064 ENSG00000125492 BARHL1 NM_023005 ENSG00000009954 BAZ1B NM_013449 ENSG00000076108 BAZ2A NM_014567 ENSG00000050820 BCAR1 NM_003567 ENSG00000137936 BCAR3 NM_000633 BCL2 NM_014739 ENSG00000029363 BCLAF1 NM_004327 ENSG00000186716 BCR NM_004459 ENSG00000171634 BPTF NM_004333 ENSG00000157764 BRAF NM_014577 ENSG00000100425 BRD1 NM_023924 ENSG00000028310 BRD9 NM_032043 ENSG00000136492 BRIP1 NM_153252 ENSG00000165288 BRWD3 NM_014962 ENSG00000132640 BTBD3 NM_001207 ENSG00000145741 BTF3 NM_003939 ENSG00000166167 BTRC NM_004725 ENSG00000154473 BUB3 NM_032024 ENSG00000148655 C10orf11 NM_024541 ENSG00000120029 C10orf76 NM_170746 ENSG00000211450 C11orf31 NM_004894 ENSG00000156411 C14orf2 NM_032366 ENSG00000130731 C16orf13 NM_025108 ENSG00000162062 C16orf59 NM_181655 ENSG00000186665 C17orf58 NM_001085430 ENSG00000214226 C17orf67 NM_031446 ENSG00000141428 C18orf21 NM_024038 ENSG00000123144 C19orf43 NM_178830 ENSG00000160392 C19orf47 NM_138358 ENSG00000142444 C19orf52 NM_001025495 ENSG00000162913 C1orf145 NM_017891 ENSG00000131591 C1orf159 NM_001010979 C1orf189 NM_001212 ENSG00000108561 C1QBP NM_030945 C1QTNF3 NM_001014442 C1QTNF9B-AS1 NM_080828 ENSG00000125975 C20orf173 NM_018840 ENSG00000101084 C20orf24 NM_017874 ENSG00000101220 C20orf27 NM_058180 ENSG00000160298 C21orf58 NM_032561 ENSG00000128346 C22orf23 NM_017880 ENSG00000115998 C2orf42 NM_173649 ENSG00000239605 C2orf61 NM_023073 ENSG00000197603 C5orf42 NM_001277348 C5orf66 NM_178508 ENSG00000186577 C6orf1 NM_001029863 C6orf120 NM_030939 C6orf62 NM_001130929 ENSG00000243317 C7orf73 NM_001080482 C9orf172 NM_018956 ENSG00000165698 C9orf9 NM_138375 ENSG00000134508 CABLES1 NM_020898 ENSG00000012822 CALCOCO1 NM_004342 ENSG00000122786 CALD1 NM_001743 ENSG00000143933 CALM2 NM_005184 ENSG00000160014 CALM3 NM_033429 ENSG00000129007 CALML4 NM_001745 ENSG00000164615 CAMLG NM_015447 ENSG00000130559 CAMSAP1 NM_015215 ENSG00000171735 CAMTA1 NM_018448 CAND1 NM_001746 ENSG00000127022 CANX NM_000070 ENSG00000092529 CAPN3 NM_004291 ENSG00000164326 CARTPT NM_020764 ENSG00000167971 CASKIN1 NR_132322 ENST00000428155 CASP16P NM_005189 ENSG00000173894 CBX2 NM_014292 ENSG00000183741 CBX6 NM_145045 ENSG00000198003 CCDC151 NR_034089 CCDC18-AS1 NM_001282544 ENSG00000166329 CCDC182 NM_005436 ENSG00000108091 CCDC6 NM_001144995 CCDC85C NM_018318 ENSG00000123106 CCDC91 NM_052848 ENSG00000142039 CCDC97 NM_001243212 ENSG00000262484 CCER2 NM_005190 ENSG00000112237 CCNC NM_053056 ENSG00000110092 CCND1 NM_006835 ENSG00000118816 CCNI NM_003858 CCNK NM_030937 ENSG00000221978 CCNL2 NM_145012 ENSG00000108100 CCNY NM_006430 ENSG00000115484 CCT4 NM_012073 ENSG00000150753 CCT5 NM_006429 ENSG00000135624 CCT7 NM_006016 ENSG00000135535 CD164 NM_139286 ENSG00000176386 CDC26 NM_020240 ENSG00000158985 CDC42SE2 NM_080668 ENSG00000146670 CDCA5 NM_022124 ENSG00000107736 CDH23 NM_006201 ENSG00000102225 CDK16 NM_004642 ENSG00000111328 CDK2AP1 NM_016082 ENSG00000101391 CDK5RAP1 NM_001261 ENSG00000136807 CDK9 NM_017774 ENSG00000145996 CDKAL1 NM_003948 CDKL2 NM_003818 ENSG00000101290 CDS2 NM_004824 ENSG00000153046 CDYL NM_005195 CEBPD NM_001806 ENSG00000153879 CEBPG NM_006560 ENSG00000149187 CELF1 NM_018455 ENSG00000166451 CENPN NM_024322 ENSG00000138092 CENPO NM_018140 ENSG00000112877 CEP72 NM_013384 ENSG00000143418 CERS2 NM_013242 ENSG00000070761 CFAP20 NM_005507 ENSG00000172757 CFL1 NM_024111 ENSG00000128965 CHAC1 NM_001273 ENSG00000111642 CHD4 NM_015557 ENSG00000116254 CHD5 NM_020920 ENSG00000100888 CHD8 NM_001275 ENSG00000100604 CHGA NM_000390 ENSG00000188419 CHM NM_024591 ENSG00000176108 CHMP6 NM_152272 ENSG00000147457 CHMP7 NM_017444 ENSG00000104472 CHRAC1 NM_012125 CHRM5 NM_020402 ENSG00000129749 CHRNA10 NM_000748 ENSG00000160716 CHRNB2 NM_004273 ENSG00000122863 CHST3 NM_004804 CIAO1 NM_006384 ENSG00000185043 CIB1 NM_015125 ENSG00000079432 CIC NM_152480 CIRBP-AS1 NM_004143 ENSG00000125931 CITED1 NM_006825 ENSG00000136026 CKAP4 NM_001827 ENSG00000123975 CKS2 NM_015282 ENSG00000074054 CLASP1 NM_015097 ENSG00000163539 CLASP2 NM_005602 CLDN11 NM_014343 ENSG00000106404 CLDN15 NM_001111319 ENSG00000177300 CLDN22 NM_015226 ENSG00000038532 CLEC16A NM_001080511 ENSG00000236279 CLEC2L NM_014666 ENSG00000113282 CLINT1 NM_001291 ENSG00000176444 CLK2 NM_024769 CLMP NM_018941 ENSG00000182372 CLN8 NM_001833 ENSG00000122705 CLTA NM_001835 ENSG00000070371 CLTCL1 NM_144601 ENSG00000140931 CMTM3 NM_182553 ENSG00000174871 CNIH2 NM_016284 ENSG00000125107 CNOT1 NM_014515 ENSG00000111596 CNOT2 NM_018224 ENSG00000106603 COA1 NM_001008215 ENSG00000183513 COA5 NM_015198 ENSG00000106078 COBL NM_153603 ENSG00000168434 COG7 NM_032518 ENSG00000188517 COL25A1 NM_000495 ENSG00000188153 COL4A5 NM_024656 ENSG00000130309 COLGALT1 NM_000754 ENSG00000093010 COMT NM_016128 ENSG00000181789 COPG1 NM_144576 ENSG00000135469 COQ10A NM_001302 ENSG00000241563 CORT NM_016468 ENSG00000133983 COX16 NM_001865 ENSG00000112695 COX7A2 NM_014912 ENSG00000107864 CPEB3 NM_003915 ENSG00000214078 CPNE1 NR_002763 ENSG00000280837 CPS1-IT1 NM_006693 ENSG00000160917 CPSF4 NM_004380 ENSG00000005339 CREBBP NM_021212 CREBZF NM_016441 ENSG00000150938 CRIM1 NM_001312 ENSG00000182809 CRIP2 NM_015986 ENSG00000176390 CRLF3 NM_006371 ENSG00000170275 CRTAP NM_001316 ENSG00000124207 CSE1L NR_027320 CSNK1A1P1 NM_001893 ENSG00000141551 CSNK1D NM_001894 ENSG00000213923 CSNK1E NM_004384 ENSG00000151292 CSNK1G3 NM_006574 ENSG00000114646 CSPG5 NM_030809 ENSG00000110925 CSRNP2 NM_000100 CSTB NM_001326 ENSG00000176102 CSTF3 NM_001329 CTBP2 NM_003798 ENSG00000119326 CTNNAL1 NM_001904 ENSG00000168036 CTNNB1 NM_001331 ENSG00000198561 CTNND1 NM_005231 ENSG00000085733 CTTN NM_206833 ENSG00000178531 CTXN1 NM_003588 ENSG00000158290 CUL4B NM_015089 ENSG00000112659 CUL9 NM_001913 ENSG00000257923 CUX1 NM_018294 ENSG00000095485 CWF19L1 NM_019885 ENSG00000003137 CYP26B1 NM_000786 ENSG00000001630 CYP51A1 NM_001554 ENSG00000142871 CYR61 NM_004762 ENSG00000108669 CYTH1 NM_004393 ENSG00000173402 DAG1 NM_139179 ENSG00000164535 DAGLB NM_018114 ENSG00000178149 DALRD3 NR_130730 ENSG00000235244 DANT2 NM_018959 ENSG00000071626 DAZAP1 NR_027642 DCAF13P3 NM_024819 ENSG00000172992 DCAKD NM_152624 ENSG00000172795 DCP2 NM_004082 ENSG00000204843 DCTN1 NM_004398 ENSG00000178105 DDX10 NM_006386 ENSG00000100201 DDX17 NM_018332 ENSG00000168872 DDX19A NM_004728 ENSG00000165732 DDX21 NM_001356 ENSG00000215301 DDX3X NM_014829 ENSG00000145833 DDX46 NM_004396 ENSG00000108654 DDX5 NM_020936 ENSG00000111364 DDX55 NM_020664 ENSG00000242612 DECR2 NM_003472 ENSG00000124795 DEK NM_015213 ENSG00000184014 DENND5A NR_046909 ENSG00000255867 DENND5B-AS1 NM_024295 ENSG00000136986 DERL1 NM_198512 ENSG00000184210 DGAT2L6 NM_003648 ENSG00000077044 DGKD NM_014762 ENSG00000116133 DHCR24 NM_014681 ENSG00000134815 DHX34 NM_020865 ENSG00000174953 DHX36 NM_005219 ENSG00000131504 DIAPH1 NR_046539 ENSG00000227528 DIAPH3-AS1 NM_014388 ENSG00000117597 DIEXF NM_015151 ENSG00000160305 DIP2A NM_001931 ENSG00000150768 DLAT NM_005887 ENSG00000176124 DLEU1 NM_004087 ENSG00000075711 DLG1 NM_001364 ENSG00000150672 DLG2 NR_046586 ENSG00000231651 DLG3-AS1 NR_024585 DLG5-AS1 NM_001933 ENSG00000119689 DLST NM_001373 ENSG00000185842 DNAH14 NM_001539 DNAJA1 NM_005494 ENSG00000105993 DNAJB6 NM_003315 ENSG00000168259 DNAJC7 NM_005223 DNASE1 NM_032482 ENSG00000104885 DOT1L NM_080750 DPH3P1 NM_013379 ENSG00000176978 DPP7 NM_145038 ENSG00000157856 DRC1 NM_013235 ENSG00000113360 DROSHA NM_024918 ENSG00000149636 DSN1 NM_021907 ENSG00000138101 DTNB NM_022156 DUS1L NM_030640 ENSG00000111266 DUSP16 NM_001394 ENSG00000120875 DUSP4 NM_001376 ENSG00000197102 DYNC1H1 NM_005225 ENSG00000101412 E2F1 NM_001949 ENSG00000112242 E2F3 NM_203394 ENSG00000165891 E2F7 NM_018029 ENSG00000255423 EBLN2 NM_003797 ENSG00000074266 EED NM_001960 ENSG00000104529 EEF1D NM_018100 ENSG00000096093 EFHC1 NM_001962 ENSG00000184349 EFNA5 NM_004429 ENSG00000090776 EFNB1 NM_017555 ENSG00000269858 EGLN2 NM_014601 ENSG00000024422 EHD2 NM_001039765 ENSG00000281796 EHMT1-IT1 NM_014335 ENSG00000255302 EID1 NM_001008394 ENSG00000255150 EID3 NM_003758 ENSG00000104131 EIF3J NM_001417 ENSG00000063046 EIF4B NM_004095 ENSG00000187840 EIF4EBP1 NM_003760 ENSG00000075151 EIF4G3 NM_024930 ENSG00000164181 ELOVL7 NM_006067 ENSG00000131148 EMC8 NM_000117 ENSG00000102119 EMD NM_152463 ENSG00000154920 EME1 NM_001423 EMP1 NM_001424 ENSG00000213853 EMP2 NM_020193 ENSG00000158636 EMSY NM_001242699 ENSG00000188316 ENO4 NM_017512 ENSG00000132199 ENOSF1 NM_004436 ENSG00000143420 ENSA NM_004437 ENSG00000159023 EPB41 NM_013333 ENSG00000063245 EPN1 NM_178039 ENSG00000082805 ERC1 NM_000122 ENSG00000163161 ERCC3 NM_015966 ENSG00000125991 ERGIC3 NM_207332 ENSG00000104714 ERICH1 NM_006459 ERLIN1 NM_024896 ENSG00000099219 ERMP1 NM_015292 ENSG00000139641 ESYT1 NM_031279 ENSG00000164089 ETNPPL NM_018166 ENSG00000142694 EVA1B NM_015189 ENSG00000144036 EXOC6B NM_014285 ENSG00000130713 EXOSC2 NM_058219 EXOSC6 NM_004456 ENSG00000106462 EZH2 NR_102425 EZR-AS1 NM_182705 ENSG00000183688 FAM101B NM_019018 FAM105A NM_144635 ENSG00000175182 FAM131A NM_152789 ENSG00000234545 FAM133B NM_014883 ENSG00000138640 FAM13A NM_015159 ENSG00000054965 FAM168A NM_001009993 ENSG00000152102 FAM168B NM_001105282 ENSG00000164556 FAM183BP NM_032130 ENSG00000135436 FAM186B NM_003704 ENSG00000125386 FAM193A NM_207368 ENSG00000225663 FAM195B NM_001039762 ENSG00000188916 FAM196A NM_207318 ENSG00000123575 FAM199X NM_015224 ENSG00000163946 FAM208A NM_017782 ENSG00000108021 FAM208B NM_021806 ENSG00000071889 FAM3A NM_001013622 ENSG00000174137 FAM53A NR_120630 FAM53B-AS1 NM_016255 ENSG00000137414 FAM8A1 NM_000135 ENSG00000187741 FANCA NM_152633 ENSG00000181544 FANCB NM_018062 ENSG00000115392 FANCL NM_014808 ENSG00000006607 FARP2 NM_004104 ENSG00000169710 FASN NM_005245 ENSG00000083857 FAT1 NM_022452 ENSG00000156860 FBRS NM_012158 ENSG00000005812 FBXL3 NM_032807 ENSG00000134452 FBXO18 NR_003136 FBXO22-AS1 NM_012176 ENSG00000151876 FBXO4 NM_012347 ENSG00000112146 FBXO9 NM_022039 ENSG00000107829 FBXW4 NM_138782 ENSG00000157107 FCHO2 NM_004111 ENSG00000168496 EEN1 NM_002005 ENSG00000182511 FES NM_004113 ENSG00000114279 FGF12 NM_004114 ENSG00000129682 FGF13 NM_000142 ENSG00000068078 FGFR3 NM_001449 ENSG00000022267 FHL1 NM_007076 ENSG00000198855 FICD NR_026975 ENSG00000213468 FIRRE NM_021939 ENSG00000141756 FKBP10 NM_004470 ENSG00000173486 FKBP2 NM_002014 ENSG00000004478 FKBP4 NM_024301 ENSG00000181027 FKRP NM_001456 ENSG00000196924 FLNA NM_001457 ENSG00000136068 FLNB NM_052905 ENSG00000157827 FMNL2 NM_002024 ENSG00000102081 FMR1 NM_014923 ENSG00000102531 FNDC3A NM_004514 ENSG00000141568 FOXK2 NM_005197 ENSG00000053254 FOXN3 NM_002015 ENSG00000150907 FOXO1 NM_020875 ENSG00000138759 FRAS1 NM_174938 ENSG00000172159 FRMD3 NM_032135 ENSG00000189139 FSCB NM_002032 ENSG00000167996 FTH1 NM_003902 ENSG00000162613 FUBP1 NM_032664 ENSG00000172728 FUT10 NM_005087 ENSG00000114416 FXR1 NM_002040 ENSG00000154727 GABPA NM_015973 ENSG00000069482 GAL NM_022087 ENSG00000178234 GALNT11 NM_052917 ENSG00000144278 GALNT13 NM_002046 ENSG00000111640 GAPDH NM_006478 ENSG00000185340 GAS2L1 NM_032638 ENSG00000179348 GATA2 NM_017660 ENSG00000167491 GATAD2A NM_004564 ENSG00000059691 GATB NM_176818 ENSG00000257218 GATC NM_020944 ENSG00000070610 GBA2 NM_001485 ENSG00000168505 GBX2 NM_005811 ENSG00000135414 GDF11 NM_000514 ENSG00000168621 GDNF NM_015044 ENSG00000103365 GGA2 NR_130107 ENSG00000281189 GHET1 NM_021081 ENSG00000118702 GHRH NR_004431 ENSG00000240288 GHRLOS NM_006541 ENSG00000108010 GLRX3 NM_006877 ENSG00000137198 GMPR NM_007353 ENSG00000146535 GNA12 NM_004297 ENSG00000156049 GNA14 NM_002072 ENSG00000156052 GNAQ NM_000516 ENSG00000087460 GNAS NM_006098 ENSG00000204628 GNB2L1 NM_019067 GNL3L NM_017600 ENSG00000238105 GOLGA2P5 NM_005895 ENSG00000090615 GOLGA3 NM_014498 ENSG00000173905 GOLIM4 NM_022130 ENSG00000113384 GOLPH3 NM_015530 ENSG00000115806 GORASP2 NM_004871 ENSG00000108587 GOSR1 NM_002079 ENSG00000120053 GOT1 NM_004488 GP5 NM_016363 ENSG00000088053 GP6 NM_174931 ENSG00000152133 GPATCH11 NM_018040 ENSG00000092978 GPATCH2 NM_017926 ENSG00000089916 GPATCH2L NM_001002909 GPATCH8 NM_170699 ENSG00000179921 GPBAR1 NM_022913 ENSG00000062194 GPBP1 NM_004466 ENSG00000179399 GPC5 NM_001505 ENSG00000164850 GPER1 NM_014373 ENSG00000173890 GPR160 NM_000581 ENSG00000233276 GPX1 NM_001012642 ENSG00000175318 GRAMD2 NM_181711 ENSG00000161835 GRASP NM_012203 ENSG00000137106 GRHPR NM_017551 ENSG00000182771 GRID1 NR_033368 ENSG00000156273 GRIK1-A52 NM_014619 ENSG00000149403 GRIK4 NM_002087 ENSG00000030582 GRN NM_014615 ENSG00000131149 GSE1 NM_144675 ENSG00000169181 GSG1L NM_002093 ENSG00000082701 GSK3B NM_001512 ENSG00000170899 GSTA4 NM_001514 ENSG00000137947 GTF2B NM_002095 ENSG00000197265 GTF2E2 NM_002097 ENSG00000122034 GTF3A NM_012341 GTPBP4 NM_176791 ENSG00000124196 GTSF1L NM_033553 ENSG00000197273 GUCA2A NM_207331 ENSG00000183666 GUSBP1 NM_002105 ENSG00000188486 H2AFX NM_004893 ENSG00000113648 H2AFY NR_002315 H3F3AP4 NM_001010915 HACD4 NM_021175 HAMP NM_005333 ENSG00000004961 HCCS NR_046608 HCFC1-AS1 NM_001194 ENSG00000099822 HCN2 NM_015401 ENSG00000061273 HDAC7 NM_018486 ENSG00000147099 HDAC8 NM_005336 ENSG00000115677 HDLBP NM_018063 ENSG00000119969 HELLS NM_004667 ENSG00000128731 HERC2 NM_138820 ENSG00000146066 HIGD2A NM_003325 ENSG00000100084 HIRA NM_005319 ENSG00000187837 HIST1H1C NM_005321 ENSG00000168298 HIST1H1E NM_021063 ENSG00000158373 HIST1H2BD NM_080593 HIST1H2BK NM_003530 HIST1H3D NM_003545 ENSG00000276966 HIST1H4E NM_003543 ENSG00000158406 HIST1H4H NM_002114 ENSG00000095951 HIVEP1 NM_024567 ENSG00000147421 HMBOX1 NM_144655 ENSG00000148357 HMCN2 NM_002129 HMGB2 NR_002944 HNRNPA1P10 NM_002137 ENSG00000122566 HNRNPA2B1 NM_004499 ENSG00000197451 HNRNPAB NM_002138 HNRNPD NM_005463 ENSG00000152795 HNRNPDL NM_005520 ENSG00000169045 HNRNPH1 NM_004501 ENSG00000153187 HNRNPU NM_007040 ENSG00000105323 HNRNPUL1 NR_037946 ENSG00000234857 HNRNPUL2-BSCL2 NR_033201 ENSG00000233101 HOXB-AS3 NM_016287 ENSG00000127483 HP1BP3 NM_012262 ENSG00000153936 HS2ST1 NM_005114 HS3ST1 NM_147175 ENSG00000171004 HS6ST2 NM_005348 ENSG00000080824 HSP90AA1 NM_006597 ENSG00000109971 HSPA8 NM_006644 ENSG00000120694 HSPH1 NM_031407 ENSG00000086758 HUWE1 NM_006389 ENSG00000149428 HYOU1 NM_016400 ENSG00000140264 HYPK NM_015325 ENSG00000164151 ICE1 NM_012405 ENSG00000116237 ICMT NM_002166 ENSG00000115738 ID2 NM_004907 ENSG00000160888 IER2 NM_001170820 ENSG00000244242 IFITM10 NM_000629 ENSG00000142166 IFNAR1 NM_001550 ENSG00000006652 IFRD1 NM_016004 ENSG00000101052 IFT52 NM_006546 ENSG00000159217 IGF2BP1 NM_006547 ENSG00000136231 IGF2BP3 NM_018725 ENSG00000056736 IL17RB NM_144717 ENSG00000174564 IL20RB NM_152899 ENSG00000104951 IL4I1 NM_033416 ENSG00000136718 IMP4 NM_032727 ENSG00000148798 INA NM_020238 ENSG00000149503 INCENP NM_016162 ENSG00000111653 ING4 NM_017759 ENSG00000114933 INO80D NM_019892 ENSG00000148384 INPP5E NM_005542 ENSG00000186480 INSIG1 NM_020748 ENSG00000108506 INTS2 NM_016291 ENSG00000068745 IP6K2 NM_002271 ENSG00000065150 IPO5 NR_121669 IQCJ-SCHIP1-AS1 NM_014869 ENSG00000144711 IQSEC1 NM_001569 ENSG00000184216 IRAK1 NM_182972 ENSG00000168264 IRF2BP2 NM_032643 ENSG00000128604 IRF5 NM_001572 ENSG00000185507 IRF7 NM_003749 ENSG00000185950 IRS2 NM_003604 ENSG00000133124 IRS4 NM_024710 ENSG00000063241 ISOC2 NM_000419 ENSG00000005961 ITGA2B NM_012278 ENSG00000147166 ITGB1BP2 NM_002223 ENSG00000123104 ITPR2 NM_003024 ENSG00000205726 ITSN1 NM_006469 ENSG00000116679 IVNS1ABP NM_004973 ENSG00000008083 JARID2 NR_034097 JAZF1-AS1 NM_004241 ENSG00000171988 JMJD1C NM_006694 ENSG00000143543 JTB NM_005354 ENSG00000130522 JUND NM_030929 KAZALD1 NR_126346 ENSG00000253696 KBTBD11-OT1 NM_016506 ENSG00000123444 KBTBD4 NM_003636 ENSG00000069424 KCNAB2 NM_012284 ENSG00000135519 KCNH3 NM_002247 ENSG00000156113 KCNMA1 NM_024076 ENSG00000153885 KCTD15 NM_016121 ENSG00000136636 KCTD3 NM_198404 KCTD4 NM_006801 ENSG00000105438 KDELR1 NM_006855 ENSG00000100196 KDELR3 NM_014663 ENSG00000066135 KDM4A NM_002035 ENSG00000119537 KDSR NM_006559 ENSG00000121774 KHDRBS1 NM_014686 ENSG00000166398 KIAA0355 NM_001080398 ENSG00000136813 K1AA0368 NM_020910 ENSG00000122778 KIAA1549 NM_030650 ENSG00000144320 KIAA1715 NM_032435 ENSG00000143674 KIAA1804 NM_153369 KIAA1919 NM_133465 ENSG00000165185 KIAA1958 NM_015074 ENSG00000054523 KIF1B NM_194313 ENSG00000186638 KIF24 NM_018012 ENSG00000162849 KIF26B NM_006845 ENSG00000142945 KIF2C NM_012310 ENSG00000090889 KIF4A NM_004521 ENSG00000170759 KIF5B NM_005552 ENSG00000126214 KLC1 NM_007249 ENSG00000118922 KLF12 NM_016270 ENSG00000127528 KLF2 NM_014997 ENSG00000128607 KLHDC10 NM_014315 ENSG00000165516 KLHDC2 NM_017566 ENSG00000104731 KLHDC4 NM_018143 KLHL11 NM_014851 ENSG00000162413 KLHL21 NM_032775 ENSG00000099910 KLHL22 NM_025067 ENSG00000119771 KLHL29 NM_017415 ENSG00000146021 KLHL3 NM_005933 ENSG00000118058 KMT2A NM_014727 ENSG00000272333 KMT2B NM_021230 ENSG00000055609 KMT2C NM_003482 ENSG00000167548 KMT2D NM_002265 KPNB1 NM_015478 ENSG00000185513 L3MBTL1 NM_002286 ENSG00000089692 LAG3 NM_018407 ENSG00000104341 LAPTM4B NM_004737 ENSG00000133424 LARGE NM_015155 ENSG00000107929 LARP4B NR_048543 LARS2-AS1 NM_004690 ENSG00000131023 LATS1 NM_002296 ENSG00000143815 LBR NM_182551 ENSG00000172954 LCLAT1 NM_003893 ENSG00000198728 LDB1 NM_002300 ENSG00000111716 LDHB NM_002301 ENSG00000166796 LDHC NM_004338 ENSG00000168675 LDLRAD4 NM_181336 ENSG00000161904 LEMD2 NM_198988 ENSG00000275183 LENG9 NM_005567 ENSG00000108679 LGALS3BP NM_014564 ENSG00000107187 LHX3 NR_037642 ENSG00000230124 LHX4-AS1 NM_002311 ENSG00000005156 LIG3 NR_033947 LIMD1-AS1 NM_022165 ENSG00000104863 LIN7B NR_033376 ENSG00000203801 LINC00222 NR_103753 LINC00491 NR_033876 ENSG00000227036 LINC00511 NR_027103 ENSG00000224514 LINC00620 NR_038970 ENSG00000258441 LINC00641 NR_028138 ENSG00000271614 LINC00936 NR_038292 ENSG00000281706 LINC01012 NR_024423 ENSG00000250056 LINC01018 NR_132375 LINC01078 NM_178529 ENSG00000279873 LINC01126 NR_103791 LINC01127 NR_015360 ENSG00000245937 LINC01184 NR_110616 LINC01355 NR_109928 LINC01424 NR_033917 ENSG00000230176 LINC01433 NR_110218 ENSG00000237877 LINC01473 NM_175616 ENSG00000236882 LINC01554 NR_039999 ENSG00000262468 LINC01569 NR_120371 ENSG00000245479 LINC01585 NR_125410 ENSG00000272138 LINC01607 NM_001256373 ENSG00000257242 LINC01619 NM_032808 ENSG00000169783 LINGO1 NM_004140 ENSG00000131899 LLGL1 NR_110945 ENSG00000260439 LMF1-AS1 NM_005572 ENSG00000160789 LMNA NM_005573 ENSG00000113368 LMNB1 NM_005358 ENSG00000136153 LMO7 NR_027406 LOC100129034 NR_045112 LOC100129617 NM_001242698 LOC100130357 NM_001272086 LOC100130370 NR_046285 LOC100130744 NM_001243523 LOC100130880 NR_024594 ENSG00000267882 LOC100131496 NR_027069 ENSG00000231609 LOC100132215 NM_001242885 LOC100287036 NR_033175 LOC100289673 NR_038333 ENSG00000246422 LOC100505658 NR_038982 LOC100507346 NR_038244 ENSG00000235652 LOC100507557 NM_001278082 ENSG00000275765 LOC100652758 NR_110102 ENSG00000242687 LOC101927550 NR_110808 ENSG00000266100 LOC101927557 NR_110931 LOC101927817 NR_125892 LOC101928279 NR_125858 LOC101928461 NR_110092 ENSG00000258274 LOC101928731 NR_105012 LOC101929154 NR_123739 ENSG00000230550 LOC101929441 NR_120366 LOC101929679 NR_120665 ENSG00000227495 LOC102724009 NR_120674 ENSG00000231964 LOC102724323 NR_120684 ENSG00000260917 LOC103344931 NR_131227 LOC105616981 NR_033921 ENSG00000265533 LOC643542 NR_034179 ENSG00000231305 LOC653712 NR_003671 LOC728024 NM_004793 ENSG00000196365 LONP1 NM_031490 LONP2 NM_006726 ENSG00000198589 LRBA NM_153377 ENSG00000139263 LRIG3 NM_002335 ENSG00000162337 LRP5 NM_002336 ENSG00000070018 LRP6 NM_052888 ENSG00000185158 LRRC37B NM_018103 ENSG00000171492 LRRC8D NM_006309 ENSG00000093167 LRRFIP2 NM_024652 ENSG00000154237 LRRK1 NM_152344 ENSG00000161654 LSM12 NM_012321 ENSG00000130520 LSM4 NM_019839 ENSG00000213906 LTB4R2 NM_000428 ENSG00000119681 LTBP2 NM_021070 ENSG00000168056 LTBP3 NM_032860 ENSG00000135521 LTV1 NM_016019 ENSG00000146963 LUC7L2 NM_005583 ENSG00000104903 LYL1 NM_020466 ENSG00000083099 LYRM2 NM_003550 ENSG00000002822 MAD1L1 NR_002819 ENSG00000251562 MALAT1 NM_014757 ENSG00000161021 MAML1 NM_006699 ENSG00000198162 MAN1A2 NM_022818 ENSG00000140941 MAP1LC3B NM_030662 ENSG00000126934 MAP2K2 NM_004721 ENSG00000073803 MAP3K13 NM_003188 ENSG00000135341 MAP3K7 NM_024871 ENSG00000180834 MAP6D1 NM_004759 ENSG00000162889 MAPKAPK2 NM_012325 ENSG00000101367 MAPRE1 NM_023009 ENSG00000175130 MARCKSL1 NM_002380 ENSG00000132561 MATN2 NM_021038 ENSG00000152601 MBNL1 NM_018388 ENSG00000076770 MBNL3 NM_022132 ENSG00000131844 MCCC2 NM_006739 ENSG00000100297 MCM5 NM_005915 ENSG00000076003 MCM6 NM_005916 ENSG00000166508 MCM7 NM_005918 ENSG00000146701 MDH2 NM_002393 ENSG00000198625 MDM4 NM_004991 ENSG00000085276 MECOM NM_004992 ENSG00000169057 MECP2 NM_032286 ENSG00000133398 MED10 NM_005121 ENSG00000108510 MED13 NM_005481 ENSG00000175221 MED16 NM_004269 ENSG00000160563 MED27 NM_015955 ENSG00000162959 MEMO1 NM_000244 ENSG00000133895 MEN1 NM_006838 ENSG00000111142 METAP2 NM_001010977 ENSG00000139780 METTL21C NM_024109 ENSG00000067365 METTL22 NM_019852 ENSG00000165819 METTL3 NM_016626 ENSG00000176624 MEX3C NM_203304 ENSG00000181588 MEX3D NM_004225 ENSG00000147324 MFHAS1 NM_001120 ENSG00000109736 MFSD10 NM_033055 ENSG00000156875 MFSD14A NM_002413 ENSG00000085871 MGST2 NM_033386 ENSG00000100139 MICALL1 NM_139162 ENSG00000177427 MIEF2 NM_002415 MIF NM_021933 ENSG00000116691 MIIP NR_031611 MIR1206 NR_031595 ENSG00000221585 MIR1226 NR_031596 ENSG00000221411 MIR1227 NR_036262 MIR1244-2 NR_031658 ENSG00000221417 MIR1257 NR_031692 MIR1279 NR_029682 ENSG00000207708 MIR141 NR_029525 ENSG00000198987 MIR16-2 NR_038975 ENSG00000224020 MIR181A2HG NR_031750 ENSG00000253030 MIR2116 NR_036056 ENSG00000276326 MIR2909 NR_036068 ENSG00000264358 MIR3122 NR_036075 ENSG00000265396 MIR3128 NR_036091 ENSG00000265623 MIR3139 NR_036117 ENSG00000265014 MIR3160-1 NR_036152 ENSG00000266189 MIR3186 NR_130463 ENSG00000265306 MIR3195 NR_039851 ENSG00000265371 MIR3198-2 NR_029506 ENSG00000207698 MIR32 NR_029896 MIR324 NR_029507 ENSG00000207932 MIR33A NR_037415 ENSG00000264944 MIR3620 NR_037424 ENSG00000281156 MIR3651 NR_037425 ENSG00000265072 MIR3652 NR_037427 MIR3654 NR_037430 ENSG00000266370 MIR3657 NR_037431 MIR3658 NR_037450 ENSG00000263813 MIR3679 NR_037465 ENSG00000264818 MIR3714 NR_039667 ENSG00000263361 MIR378H NR_037486 ENSG00000264897 MIR3921 NR_037498 ENSG00000266509 MIR3934 NR_030398 MIR421 NR_036177 ENSG00000264763 MIR4295 NR_036197 ENSG00000265195 MIR4312 NR_039624 MIR4426 NR_039626 ENSG00000266262 MIR4428 NR_039646 ENSG00000263721 MIR4444-1 NR_039662 ENSG00000263670 MIR4457 NR_039664 ENSG00000265421 MIR4459 NR_039666 ENSG00000263963 MIR4461 NR_039676 ENSG00000271899 MIR4466 NR_039685 ENSG00000264941 MIR4474 NR_039719 ENSG00000266704 MIR4498 NR_030255 ENSG00000207726 MIR455 NR_039787 ENSG00000266245 MIR4644 NR_039790 ENSG00000265700 MIR4647 NR_039814 ENSG00000266315 MIR4668 NR_039819 ENSG00000263979 MIR4672 NR_039849 ENSG00000265455 MIR4700 NR_039902 ENSG00000263409 MIR4747 NR_039903 ENSG00000265879 MIR4748 NR_039915 ENSG00000265329 MIR4758 NR_039964 ENSG00000265080 MIR4800 NR_039967 ENSG00000264099 MIR4803 NR_039968 ENSG00000263593 MIR4804 NR_030166 MIR491 NR_039912 MIR499B NR_039969 ENSG00000266241 MIR5047 NR_049816 ENSG00000266307 MIR5093 NR_039973 ENSG00000266270 MIR5096 NR_036088 ENSG00000265981 MIR544B NR_030258 ENSG00000207820 MIR545 NR_039621 ENSG00000264419 MIR548AC NR_039629 ENSG00000265301 MIR548AD NR_049853 MIR548AU NR_031677 ENSG00000221537 MIR548H1 NR_036071 ENSG00000265056 MIR548S NR_036103 ENSG00000265520 MIR548V NR_049846 ENSG00000263540 MIR5582 NR_049851 ENSG00000263629 MIR5586 NR_049866 ENSG00000264056 MIR5685 NR_049880 ENSG00000266721 MIR5695 NR_106713 ENSG00000276162 MIR5739 NR_030305 ENSG00000207956 MIR579 NR_030313 ENSG00000207769 MIR586 NR_030318 ENSG00000207973 MIR589 NR_030321 ENSG00000207741 MIR590 NR_030324 ENSG00000207588 MIR593 NR_030333 ENSG00000207693 MIR602 NR_106718 ENSG00000278433 MIR6070 NR_030343 ENSG00000273834 MIR612 NR_106745 ENSG00000273500 MIR6129 NR_106748 ENSG00000275870 MIR6132 NR_030351 ENSG00000207967 MIR620 NR_030356 ENSG00000207766 MIR626 NR_030366 ENSG00000207556 MIR636 NR_030374 ENSG00000207997 MIR644A NR_106997 ENSG00000281678 MIR6516 NR_106773 ENSG00000275466 MIR6716 NR_106778 ENSG00000275859 MIR6720 NR_106786 ENSG00000274258 MIR6728 NR_106805 ENSG00000276102 MIR6747 NR_106824 ENSG00000275101 MIR6766 NR_106840 ENSG00000275107 MIR6782 NR_106841 ENSG00000278223 MIR6783 NR_106845 ENSG00000275505 MIR6787 NR_106850 ENSG00000273657 MIR6792 NR_106854 ENSG00000275652 MIR6796 NR_106865 ENSG00000275924 MIR6807 NR_106877 ENSG00000278420 MIR6819 NR_106909 ENSG00000274673 MIR6850 NR_106914 ENSG00000276124 MIR6855 NR_106916 ENSG00000278204 MIR6857 NR_106929 ENSG00000276741 MIR6869 NR_106937 ENSG00000273932 MIR6877 NR_106938 MIR6878 NR_106940 ENSG00000275967 MIR6880 NR_106946 ENSG00000273892 MIR6886 NR_106948 ENSG00000275141 MIR6888 NR_106949 ENSG00000274552 MIR6889 NR_106960 ENSG00000275891 MIR7110 NR_106981 ENSG00000278571 MIR7161 NR_031757 ENSG00000211524 MIR718 NR_106988 MIR7641-2 NR_107030 ENSG00000277202 MIR8063 NR_107035 ENSG00000273912 MIR8068 NR_107042 ENSG00000277942 MIR8075 NR_024391 ENSG00000267374 MIR924HG NR_030760 ENSG00000216083 MIR936 NR_030637 MIR941-1 NR_030640 ENSG00000215930 MIR942 NR_030641 ENSG00000216105 MIR943 NR_029484 ENSG00000208012 MIRLET7F2 NM_018353 ENSG00000129534 MIS18BP1 NM_002417 ENSG00000148773 MKI67 NM_020831 ENSG00000196588 MKL1 NM_017572 ENSG00000099875 MKNK2 NM_014160 ENSG00000075975 MKRN2 NM_014730 ENSG00000110917 MLEC NM_000249 ENSG00000076242 MLH1 NM_014381 ENSG00000119684 MLH3 NM_004641 ENSG00000078403 MLLT10 NM_032951 ENSG00000009950 MLXIPL NR_102705 MMP24-AS1 NM_198468 ENSG00000146263 MMS22L NM_002430 ENSG00000169184 MN1 NM_006791 ENSG00000185787 MORF4L1 NM_012286 ENSG00000123562 MORF4L2 NM_020963 ENSG00000155363 MOV10 NM_002434 ENSG00000103152 MPG NM_005792 ENSG00000135698 MPHOSPH6 NM_138701 MPLKIP NM_001932 ENSG00000161647 MPP3 NM_015134 ENSG00000133030 MPRIP NM_033296 ENSG00000179010 MRFAP1 NM_152301 ENSG00000178988 MRFAP1L1 NM_018270 MRGBP NM_014078 ENSG00000172172 MRPL13 NM_032111 ENSG00000180992 MRPL14 NM_024540 ENSG00000143314 MRPL24 NR_002208 MRPL42P5 NM_016640 ENSG00000112996 MRPS30 NM_020662 ENSG00000124532 MRS2 NM_001012982 MSANTD1 NM_006745 ENSG00000052802 MSMO1 NM_002444 ENSG00000147065 MSN NR_024117 MSTO2P NM_002451 ENSG00000099810 MTAP NM_025198 ENSG00000120832 MTERF2 NM_007358 ENSG00000143033 MTF2 NM_138419 ENSG00000146410 MTFR2 NM_015440 ENSG00000120254 MTHFD1L NM_145808 ENSG00000105887 MTPN NM_000254 ENSG00000116984 MTR NM_138383 ENSG00000132613 MTSS1L NM_020749 ENSG00000129422 MTUS1 NR_046378 MTUS2-AS1 NM_005961 ENSG00000184956 MUC6 NM_005115 ENSG00000013364 MVP NM_002466 ENSG00000101057 MYBL2 NM_002467 ENSG00000136997 MYC NR_046716 ENSG00000236051 MYCBP2-AS1 NM_002474 ENSG00000133392 MYH11 NM_021019 ENSG00000092841 MYL6 NM_018657 ENSG00000085274 MYNN NM_005379 ENSG00000166866 MYO1A NM_004145 ENSG00000099331 MYO9B NM_025146 ENSG00000121579 NAA50 NM_005594 ENSG00000196531 NACA NM_052876 ENSG00000160877 NACC1 NM_199461 ENSG00000188613 NANOS1 NM_004537 ENSG00000187109 NAP1L1 NM_145201 ENSG00000147813 NAPRT NM_024662 ENSG00000135372 NAT10 NM_145117 ENSG00000166833 NAV2 NM_198945 ENSG00000144426 NBEAL1 NM_022346 ENSG00000109805 NCAPG NM_017760 ENSG00000146918 NCAPG2 NM_018553 NCBP3 NM_016453 ENSG00000213672 NCKIPSD NM_014071 ENSG00000198646 NCOA6 NM_030808 ENSG00000166579 NDEL1 NM_014434 ENSG00000188566 NDOR1 NM_020465 ENSG00000103034 NDRG4 NM_016013 ENSG00000137806 NDUFAF1 NR_002802 NEAT1 NM_018090 ENSG00000157191 NECAP2 NM_133494 ENSG00000151414 NEK7 NM_004713 NEMF NM_018092 ENSG00000171208 NETO2 NR_120675 ENSG00000235470 NEURL1-AS1 NM_004555 ENSG00000072736 NFATC3 NM_003204 ENSG00000082641 NFE2L1 NR_104180 ENSG00000237853 NFIA-AS1 NM_005597 ENSG00000141905 NFIC NM_002501 ENSG00000008441 NFIX NM_002504 ENSG00000086102 NFX1 NM_015514 ENSG00000129460 NGDN NM_014380 ENSG00000166681 NGFRAP1 NM_016350 ENSG00000100503 NIN NM_015384 ENSG00000164190 NIPBL NM_020202 NIT2 NM_173522 ENSG00000233382 NKAPP1 NM_016231 ENSG00000087095 NLK NM_002512 ENSG00000011052 NME2 NM_022787 ENSG00000173614 NMNAT1 NM_005386 ENSG00000053438 NNAT NM_022451 ENSG00000173145 NOC3L NM_016167 NOL7 NM_004741 ENSG00000166197 NOLC1 NM_003703 ENSG00000087269 NOP14 NM_002517 ENSG00000130751 NPAS1 NM_000271 ENSG00000141458 NPC1 NM_015392 ENSG00000107281 NPDC1 NM_017921 ENSG00000182446 NPLOC4 NM_002520 ENSG00000181163 NPM1 NM_002522 ENSG00000171246 NPTX1 NM_021724 ENSG00000126368 NR1D1 NM_005126 ENSG00000174738 NR1D2 NM_003889 ENSG00000144852 NR1I2 NR_024046 NRADDP NM_002524 ENSG00000213281 NRAS NM_002525 ENSG00000078618 NRDC NM_005011 ENSG00000106459 NRF1 NM_173685 ENSG00000156831 NSMCE2 NM_014595 ENSG00000125458 NT5C NM_020201 ENSG00000205309 NT5M NM_173474 ENSG00000157045 NTAN1 NM_014064 ENSG00000148335 NTMT1 NM_030952 ENSG00000163545 NUAK2 NR_046633 ENSG00000235191 NUCB1-AS1 NM_022731 ENSG00000069275 NUCKS1 NM_032869 ENSG00000120526 NUDCD1 NM_015332 NUDCD3 NM_020772 ENSG00000108256 NUFIP2 NM_015231 ENSG00000030066 NUP160 NM_024923 ENSG00000132182 NUP210 NM_005085 ENSG00000126883 NUP214 NM_007172 ENSG00000093000 NUP50 NM_138459 ENSG00000153989 NUS1 NM_006362 ENSG00000162231 NXF1 NM_022463 ENSG00000167693 NXN NM_004152 ENSG00000104904 OAZ1 NM_015311 ENSG00000124006 OBSL1 NM_152635 ENSG00000138315 OIT3 NM_025136 ENSG00000125741 OPA3 NM_001708 ENSG00000128617 OPN1SW NM_000607 ENSG00000229314 ORM1 NM_014182 ORMDL2 NR_049771 ENSG00000232490 OSBPL10-AS1 NM_017670 ENSG00000167770 OTUB1 NM_002560 ENSG00000135124 P2RX4 NM_002568 ENSG00000070756 PABPC1 NM_030979 PABPC3 NM_004643 PABPN1 NM_145048 ENSG00000163138 PACRGL NM_000430 ENSG00000007168 PAFAH1B1 NM_016480 ENSG00000120727 PAIP2 NM_000919 ENSG00000145730 PAM NM_006999 ENSG00000112941 PAPD7 NM_173462 ENSG00000100767 PAPLN NM_019619 ENSG00000148498 PARD3 NM_018622 ENSG00000175193 PARL NM_001618 ENSG00000143799 PARP1 NM_017851 ENSG00000138617 PARP16 NM_013327 ENSG00000188677 PARVB NM_002583 PAWR NM_022129 ENSG00000108187 PBLD NM_002585 ENSG00000185630 PBX1 NM_006195 ENSG00000167081 PBX3 NM_025245 ENSG00000105717 PBX4 NR_109828 PCBP2-OT1 NM_018929 ENSG00000240764 PCDHGC5 NM_032373 ENSG00000180628 PCGF5 NM_020357 ENSG00000081154 PCNP NM_006031 ENSG00000160299 PCNT NM_032346 ENSG00000126249 PDCD2L NM_004708 ENSG00000105185 PDCD5 NM_013374 ENSG00000170248 PDCD6IP NM_002599 ENSG00000186642 PDE2A NM_000921 ENSG00000172572 PDE3A NM_002605 ENSG00000073417 PDE8A NM_006849 ENSG00000185615 PDIA2 NM_015200 ENSG00000121892 PDS5A NM_003681 ENSG00000160209 PDXK NM_173791 PDZD8 NM_002567 ENSG00000089220 PEBP1 NM_138575 ENSG00000247077 PGAM5 NM_000291 PGK1 NM_006667 ENSG00000101856 PGRMC1 NM_024419 ENSG00000087157 PGS1 NM_014660 ENSG00000106443 PHF14 NM_015651 ENSG00000119403 PHF19 NM_005392 ENSG00000197724 PHF2 NM_016436 ENSG00000025293 PHF20 NM_024297 ENSG00000040633 PHF23 NM_006608 ENSG00000116793 PHTF1 NM_174933 ENSG00000175287 PHYHD1 NM_153370 ENSG00000164530 PI16 NM_017933 ENSG00000153823 PID1 NM_002645 ENSG00000011405 PIK3C2A NR_126366 ENSG00000231789 PIK3CD-AS2 NM_005027 ENSG00000105647 PIK3R2 NM_014602 ENSG00000196455 PIK3R4 NR_003571 PIN4P1 NM_003559 ENSG00000276293 PIP4K2B NM_012417 ENSG00000154217 PITPNC1 NM_001199924 ENSG00000260804 PKI55 NM_003706 ENSG00000105499 PLA2G4C NM_021796 ENSG00000170965 PLAC1 NM_001029869 ENSG00000173261 PLAC8L1 NM_178836 ENSG00000179598 PLD6 NM_000445 ENSG00000178209 PLEC NM_019012 ENSG00000052126 PLEKHA5 NM_015993 ENSG00000102934 PLLP NM_022737 ENSG00000105520 PLPPR2 NM_005032 ENSG00000102024 PLS3 NM_032242 ENSG00000114554 PLXNA1 NM_002673 ENSG00000164050 PLXNB1 NM_002676 ENSG00000100417 PMM1 NM_015160 ENSG00000165688 PMPCA NM_002687 ENSG00000100941 PNN NM_015720 ENSG00000114631 PODXL2 NM_015227 ENSG00000186866 POFUT2 NM_017542 POGK NM_015100 ENSG00000143442 POGZ NM_021173 ENSG00000175482 POLD4 NM_002693 ENSG00000140521 POLG NM_019014 ENSG00000125630 POLR1B NM_006232 ENSG00000163882 POLR2H NM_138338 ENSG00000100413 POLR3H NM_017739 ENSG00000085998 POMGNT1 NM_006237 ENSG00000152192 POU4F1 NM_153216 ENSG00000248483 POU5F2 NM_006903 ENSG00000138777 PPA2 NM_133263 ENSG00000155846 PPARGC1B NM_002706 ENSG00000138032 PPM1B NM_020700 ENSG00000111110 PPM1H NM_144641 ENSG00000164088 PPM1M NM_002710 ENSG00000186298 PPP1CC NM_002481 ENSG00000077157 PPP1R12B NM_001007533 ENSG00000182676 PPP1R27 NM_002716 ENSG00000137713 PPP2R1B NM_021132 ENSG00000107758 PPP3CB NM_005605 ENSG00000120910 PPP3CC NM_005134 ENSG00000154845 PPP4R1 NM_014678 ENSG00000100239 PPP6R2 NM_018312 ENSG00000110075 PPP6R3 NM_017765 ENSG00000040487 PQLC2 NM_032152 ENSG00000133246 PRAM1 NR_051984 ENSG00000258725 PRC1-AS1 NM_013388 ENSG00000138073 PREB NM_006553 ENSG00000141391 PRELID3A NM_153026 ENSG00000139174 PRICKLE1 NM_002733 ENSG00000181929 PRKAG1 NM_002734 ENSG00000108946 PRKAR1A NM_002735 ENSG00000188191 PRKAR1B NR_110822 PRKCA-AS1 NM_005400 ENSG00000171132 PRKCE NM_003891 ENSG00000126231 PROZ NM_018061 ENSG00000134186 PRPF38B NM_017892 ENSG00000196504 PRPF40A NM_012469 ENSG00000101161 PRPF6 NM_020719 ENSG00000126464 PRR12 NM_013318 ENSG00000130723 PRRC2B NM_015172 ENSG00000117523 PRRC2C NM_145239 ENSG00000167371 PRRT2 NM_000021 ENSG00000080815 PSEN1 NM_021144 ENSG00000164985 PSIP1 NM_002788 ENSG00000100567 PSMA3 NM_002789 ENSG00000041357 PSMA4 NM_002795 ENSG00000277791 PSMB3 NM_002796 ENSG00000159377 PSMB4 NM_002799 ENSG00000136930 PSMB7 NM_002805 ENSG00000087191 PSMC5 NM_002815 ENSG00000108671 PSMD11 NM_002816 PSMD12 NM_002808 ENSG00000175166 PSMD2 NM_003720 ENSG00000183527 PSMG1 NM_001128591 ENSG00000180822 PSMG4 NM_030664 ENSG00000165983 PTER NM_020440 ENSG00000134247 PTGFRN NM_005607 ENSG00000169398 PTK2 NM_003463 ENSG00000112245 PTP4A1 NM_003479 ENSG00000184007 PTP4A2 NM_002834 ENSG00000179295 PTPN11 NM_014369 ENSG00000072135 PTPN18 NM_015466 ENSG00000076201 PTPN23 NM_002850 ENSG00000105426 PTPRS NM_004339 ENSG00000183255 PTTG1IP NM_015317 ENSG00000055917 PUM2 NM_013357 ENSG00000172733 PURG NM_031292 ENSG00000129317 PUS7L NM_012293 ENSG00000130508 PXDN NM_002859 ENSG00000089159 PXN NR_038924 ENSG00000255857 PXN-AS1 NM_002863 ENSG00000100504 PYGL NM_005609 ENSG00000068976 PYGM NM_015617 ENSG00000171016 PYGO1 NM_198180 ENSG00000188710 QRFP NM_002826 ENSG00000116260 QSOX1 NM_014925 ENSG00000179912 R3HDM2 NM_025151 ENSG00000156675 RAB11FIP1 NM_016322 ENSG00000119396 RAB14 NM_014999 RAB21 NM_004249 ENSG00000157869 RAB28 NM_001031834 RAB40AL NM_004637 ENSG00000075785 RAB7A NM_005370 RAB8A NM_006908 ENSG00000136238 RAC1 NM_005053 ENSG00000179262 RAD23A NM_002874 ENSG00000119318 RAD23B NM_134422 ENSG00000002016 RAD52 NM_006550 ENSG00000197275 RAD54B NM_015106 ENSG00000164080 RAD54L2 NR_130894 ENSG00000237328 RAI1-AS1 NM_006266 ENSG00000160271 RALGDS NM_002884 ENSG00000116473 RAP1A NM_015646 ENSG00000127314 RAP1B NM_016340 ENSG00000158987 RAPGEF6 NM_016339 ENSG00000108352 RAPGEFL1 NM_005055 ENSG00000165917 RAPSN NM_020320 ENSG00000146282 RARS2 NM_006506 ENSG00000155903 RASA2 NM_018211 ENSG00000162437 RAVER2 NM_006910 ENSG00000122257 RBBP6 NM_014309 ENSG00000100320 RBFOX2 NM_022768 ENSG00000162775 RBM15 NM_018605 ENSG00000139746 RBM26 NM_004902 ENSG00000131051 RBM39 NM_002896 ENSG00000173933 RBM4 NM_031492 ENSG00000173914 RBM4B NM_014248 RBX1 NM_018715 ENSG00000179051 RCC2 NM_002902 RCN2 NM_016606 ENSG00000132563 REEP2 NM_001001330 ENSG00000165476 REEP3 NM_032871 ENSG00000054967 RELT NM_013400 ENSG00000214022 REPIN1 NM_004726 ENSG00000169891 REPS2 NM_020695 ENSG00000079313 REXO1 NM_015523 ENSG00000076043 REXO2 NM_002913 ENSG00000035928 RFC1 NM_002915 ENSG00000133119 RFC3 NM_002919 ENSG00000080298 RFX3 NM_020211 ENSG00000182175 RGNM_ NM_005614 ENSG00000106615 RHEB NM_001252499 ENSG00000171792 RHNO1 NM_004040 ENSG00000143878 RHOB NM_152756 ENSG00000164327 RICTOR NM_018151 ENSG00000080345 RIF1 NM_012421 ENSG00000117000 RLF NM_001013838 ENSG00000159753 RLTPR NM_018145 ENSG00000137824 RMDN3 NR_003051 ENSG00000269900 RMRP NM_152470 ENSG00000141622 RNF165 NM_001098638 ENSG00000166439 RNF169 NR_046834 ENSG00000237738 RNF216-IT1 NM_003958 ENSG00000112130 RNF8 NR_023343 ENSG00000264229 RNU4ATAC NR_125730 ENSG00000207357 RNU6-2 NR_023344 ENSG00000221676 RNU6ATAC NM_002941 ENSG00000169855 ROBO1 NR_102746 ROPN1L-AS1 NM_000975 ENSG00000142676 RPL11 NM_002948 ENSG00000174748 RPL15 NM_000983 ENSG00000116251 RPL22 NM_000991 ENSG00000108107 RPL28 NM_000992 ENSG00000162244 RPL29 NM_000993 ENSG00000071082 RPL31 NM_007209 ENSG00000136942 RPL35 NM_015414 ENSG00000130255 RPL36 NM_000998 RPL37A NM_000999 ENSG00000172809 RPL38 NM_021104 ENSG00000229117 RPL41 NM_001003 ENSG00000137818 RPLP1 NM_002950 ENSG00000163902 RPN1 NR_002312 ENSG00000277209 RPPH1 NM_015203 ENSG00000163125 RPRD2 NM_005617 ENSG00000164587 RPS14 NR_077246 RPS14P3 NM_001019 ENSG00000134419 RPS15A NM_001020 ENSG00000105193 RPS16 NM_001022 RPS19 NM_001023 RPS20 NM_001025 ENSG00000186468 RPS23 NM_001026 ENSG00000138326 RPS24 NM_001032 ENSG00000213741 RPS29 NM_001010 ENSG00000137154 RPS6 NM_021135 ENSG00000071242 RPS6KA2 NM_020761 ENSG00000141564 RPTOR NM_015056 ENSG00000160208 RRP1B NM_033112 ENSG00000124541 RRP36 NM_007008 ENSG00000115310 RTN4 NM_012234 RYBP NM_002958 ENSG00000163785 RYK NM_005979 ENSG00000189171 S100A13 NM_014363 ENSG00000151835 SACS NM_005500 ENSG00000142230 SAE1 NM_174920 ENSG00000167100 SAMD14 NM_015265 ENSG00000119042 SATB2 NM_030962 ENSG00000133812 SBF2 NM_014963 ENSG00000064932 SBNO2 NM_004719 ENSG00000139218 SCAF11 NM_020706 ENSG00000156304 SCAF4 NM_173690 ENSG00000173611 SCAT NM_005505 ENSG00000073060 SCARB1 NR_004387 ENSG00000239002 SCARNA10 NR_003012 ENSG00000251898 SCARNA11 NR_003010 ENSG00000238795 SCARNA12 NR_003002 ENSG00000252481 SCARNA13 NR_004388 ENSG00000252712 SCARNA14 NR_003023 ENSG00000270066 SCARNA2 NR_003004 ENSG00000249784 SCARNA22 NR_003007 ENSG00000251869 SCARNA23 NR_132762 SCARNA26A NR_132767 SCARNA26B NR_003005 ENSG00000280466 SCARNA4 NR_003008 ENSG00000252010 SCARNA5 NR_003001 ENSG00000238741 SCARNA7 NR_002569 ENSG00000254911 SCARNA9 NM_016510 ENSG00000132330 SCLY NM_014654 SDC3 NM_033280 ENSG00000166562 SEC11C NM_004892 SEC22B NM_004206 ENSG00000093183 SEC22C NM_003262 ENSG00000008952 SEC62 NM_007214 ENSG00000025796 SEC63 NM_031216 ENSG00000085415 SEH1L NM_020858 ENSG00000137872 SEMA6D NM_021627 SENP2 NM_015640 ENSG00000142864 SERBP1 NM_014509 ENSG00000183569 SERHL2 NM_014445 ENSG00000120742 SERPI NM_004568 ENSG00000124570 SERPINB6 NM_003011 ENSG00000119335 SET NM_012271 ENSG00000181555 SETD2 NM_032233 ENSG00000183576 SETD3 NM_018187 ENSG00000168137 SETD5 NM_030648 ENSG00000145391 SETD7 NM_015046 ENSG00000107290 SETX NM_178860 ENSG00000063015 SEZ6 NM_031287 ENSG00000169976 SF3B5 NM_001018039 ENSG00000198879 SFMBT2 NM_005066 ENSG00000116560 SFPQ NM_144579 ENSG00000144040 SFXN5 NM_015503 ENSG00000178188 SH2B1 NM_020979 ENSG00000160999 SH2B2 NM_001103160 ENSG00000189410 SH2D5 NM_020145 ENSG00000148341 SH3GLB2 NR_038940 ENSG00000280693 SH3PXD2A-AS1 NM_020870 ENSG00000154447 SH3RF1 NM_000193 SHH NM_175908 ENSG00000187902 SHISA7 NM_005866 ENSG00000147955 SIGMAR1 NM_015073 ENSG00000105738 SIPA1L3 NM_006427 ENSG00000184990 SIVA1 NM_006930 SKP1 NM_006527 ENSG00000163950 SLBP NM_024628 ENSG00000221955 SLC12A8 NR_103743 ENSG00000226419 SLC16A1-AS1 NM_003054 ENSG00000165646 SLC18A2 NM_005628 ENSG00000105281 SLC1A5 NM_178526 ENSG00000181035 SLC25A42 NM_030674 ENSG00000111371 SLC38A1 NM_173514 ENSG00000177058 SLC38A9 NM_173596 ENSG00000139540 SLC39A5 NM_017836 ENSG00000114544 SLC41A3 NM_033102 ENSG00000158715 SLC45A3 NM_152672 ENSG00000163959 SLC51A NM_016615 ENSG00000010379 SLC6A13 NM_032290 ENSG00000133302 SLF1 NM_014720 ENSG00000065613 SLK NM_003070 ENSG00000080503 SMARCA2 NM_003072 ENSG00000127616 SMARCA4 NM_003075 ENSG00000139613 SMARCC2 NM_014837 ENSG00000116698 SMG7 NM_001136503 SMIM24 NM_001124767 SMIM4 NM_005871 SMNDC1 NM_020197 ENSG00000143499 SMYD2 NM_022743 ENSG00000185420 SMYD3 NM_014390 ENSG00000197157 SND1 NM_007241 SNF8 NR_117096 ENSG00000267322 SNHG22 NR_132782 SNORA100 NR_002954 ENSG00000212464 SNORA12 NR_002922 ENSG00000238363 SNORA13 NR_002956 ENSG00000207181 SNORA14B NR_002975 ENSG00000276161 SNORA17B NR_002576 ENSG00000199293 SNORA21 NR_002962 ENSG00000201998 SNORA23 NR_002964 ENSG00000272533 SNORA28 NR_002966 ENSG00000206755 SNORA30 NR_002967 ENSG00000199477 SNORA31 NR_002969 ENSG00000206948 SNORA36A NR_002970 ENSG00000207233 SNORA37 NR_002977 ENSG00000212607 SNORA3B NR_002978 ENSG00000207493 SNORA46 NR_003014 ENSG00000238961 SNORA47 NR_002980 ENSG00000206952 SNORA50A NR_003015 ENSG00000212443 SNORA53 NR_002982 ENSG00000207008 SNORA54 NR_002983 ENSG00000201457 SNORA55 NR_002984 ENSG00000206693 SNORA56 NR_004390 ENSG00000206597 SNORA57 NR_002985 SNORA58 NR_003025 ENSG00000239149 SNORA59A NR_002919 ENSG00000206838 SNORA5A NR_002325 ENSG00000206760 SNORA6 NR_002326 ENSG00000207405 SNORA64 NR_000012 ENSG00000207166 SNORA68 NR_002910 ENSG00000235408 SNORA71B NR_004404 SNORA73B NR_002915 ENSG00000200959 SNORA74A NR_002921 ENSG00000206885 SNORA75 NR_002996 ENSG00000200792 SNORA80A NR_028374 ENSG00000206633 SNORA80B NR_132769 SNORA87 NR_002952 ENSG00000277184 SNORA9 NR_132772 SNORA90 NR_132774 SNORA92 NR_132778 SNORA98 NR_003066 SNORD103C NR_003079 ENSG00000221066 SNORD111 NR_003030 ENSG00000212304 SNORD12 NR_003685 ENSG00000238886 SNORD121A NR_102369 ENSG00000238793 SNORD124 NR_003693 SNORD126 NR_132752 SNORD128 NR_132972 SNORD129 NR_132756 SNORD135 NR_003045 ENSG00000212232 SNORD17 NR_002441 ENSG00000200623 SNORD18A NR_000008 ENSG00000277194 SNORD22 NR_002602 ENSG00000206775 SNORD37 NR_002751 ENSG00000209702 SNORD41 NR_000013 ENSG00000238423 SNORD42B NR_002439 ENSG00000263764 SNORD43 NR_002741 ENSG00000265145 SNORD53 NR_002738 ENSG00000226572 SNORD57 NR_002736 ENSG00000206630 SNORD60 NR_002913 ENSG00000206989 SNORD63 NR_003054 ENSG00000277512 SNORD65 NR_003055 ENSG00000212158 SNORD66 NR_002450 SNORD68 NR_003057 ENSG00000212452 SNORD69 NR_000007 ENSG00000208797 SNORD73A NR_002579 SNORD74 NR_004398 ENSG00000202400 SNORD82 NR_002598 ENSG00000254341 SNORD87 NR_003073 ENSG00000275084 SNORD91B NR_003074 ENSG00000264994 SNORD92 NR_004378 ENSG00000208772 SNORD94 NR_002592 ENSG00000272296 SNORD96A NR_004379 ENSG00000208883 SNORD96B NR_004403 ENSG00000238622 SNORD97 NR_003076 SNORD98 NR_003077 ENSG00000221539 SNORD99 NM_014014 ENSG00000144028 SNRNP200 NM_007020 SNRNP35 NM_152551 ENSG00000168566 SNRNP48 NM_003089 ENSG00000104852 SNRNP70 NM_013322 ENSG00000086300 SNX10 NM_020468 ENSG00000135317 SNX14 NM_000454 ENSG00000142168 SOD1 NM_080627 ENSG00000149639 SOGA1 NM_006943 ENSG00000177732 SOX12 NM_003111 ENSG00000172845 SP3 NM_003116 ENSG00000061656 SPAG4 NM_006461 ENSG00000076382 SPAG5 NM_182513 SPC24 NM_020675 ENSG00000152253 SPC25 NM_012391 ENSG00000124664 SPDEF NM_015001 ENSG00000065526 SPEN NM_006542 SPHAR NM_020126 ENSG00000063176 SPHK2 NM_032566 ENSG00000145879 SPINK7 NM_020148 ENSG00000134278 SPIRE1 NM_139015 ENSG00000157837 SPPL3 NM_181784 ENSG00000198369 SPRED2 NM_025106 ENSG00000171621 SPSB1 NM_003900 ENSG00000161011 SQSTM1 NM_018079 ENSG00000068784 SRBD1 NM_004599 ENSG00000198911 SREBF2 NM_003131 ENSG00000112658 SRF NM_003132 ENSG00000116649 SRM NM_182691 ENSG00000135250 SRPK2 NM_006924 SRSF1 NM_003017 SRSF3 NM_005626 ENSG00000116350 SRSF4 NM_006275 ENSG00000124193 SRSF6 NM_003144 ENSG00000124783 SSR1 NM_003145 ENSG00000163479 SSR2 NM_007107 ENSG00000114850 SSR3 NM_014188 ENSG00000160075 SSU72 NM_021978 ENSG00000149418 ST14 NM_006100 ENSG00000064225 ST3GAL6 NM_001037228 STARD7-AS1 NM_007315 ENSG00000115415 STAT1 NM_014393 ENSG00000040341 STAU2 NM_004760 ENSG00000164543 STK17A NM_003576 ENSG00000102572 STK24 NM_030906 ENSG00000130413 STK33 NM_005563 ENSG00000117632 STMN1 NM_004099 ENSG00000148175 STOM NM_153335 ENSG00000266173 STRADA NM_018387 ENSG00000165209 STRBP NM_003763 ENSG00000124222 STX16 NM_005819 ENSG00000135823 STX6 NM_022491 ENSG00000111707 SUDS3 NM_014884 ENSG00000064607 SUGP2 NM_015411 ENSG00000129103 SUMF2 NM_025154 ENSG00000164828 SUN1 NM_007192 ENSG00000092201 SUPT16H NM_017503 ENSG00000148291 SURF2 NM_006753 SURF6 NM_153694 ENSG00000139351 SYCP3 NM_004819 ENSG00000125755 SYMPK NM_006372 ENSG00000135316 SYNCRIP NM_015180 ENSG00000054654 SYNE2 NM_032431 ENSG00000162298 SYVN1 NM_004606 ENSG00000147133 TAF1 NM_006284 TAF10 NM_005643 ENSG00000064995 TAF11 NM_005679 ENSG00000103168 TAF1C NM_031923 ENSG00000165632 TAF3 NM_005642 ENSG00000178913 TAF7 NM_004783 ENSG00000149930 TAOK2 NM_007375 TARDBP NM_152295 ENSG00000113407 TARS NM_025150 ENSG00000143374 TARS2 NM_001097643 TAS2R30 NM_020773 ENSG00000132405 TBC1D14 NM_144628 ENSG00000125875 TBC1D20 NM_014832 ENSG00000136111 TBC1D4 NM_005993 ENSG00000141556 TBCD NM_014726 ENSG00000198933 TBKBP1 NM_005647 ENSG00000101849 TBL1X NM_024665 ENSG00000177565 TBL1XR1 NR_125749 ENSG00000267280 TBX2-AS1 NM_005996 ENSG00000135111 TBX3 NM_006706 ENSG00000113649 TCERG1 NM_014972 ENSG00000141002 TCF25 NM_003214 ENSG00000007866 TEAD3 NR_001566 ENSG00000270141 TERC NM_017746 ENSG00000136891 TEX10 NM_018469 ENSG00000136478 TEX2 NM_015926 ENSG00000164081 TEX264 NR_033910 TFAP2A-AS1 NM_178548 ENSG00000116819 TFAP2E NM_014553 ENSG00000115112 TFCP2L1 NM_003234 ENSG00000072274 TFRC NM_003243 ENSG00000069702 TGFBR3 NM_022065 ENSG00000115970 THADA NM_138350 ENSG00000041988 THAP3 NM_020449 ENSG00000125676 THOC2 NM_024817 ENSG00000187720 THSD4 NM_022037 ENSG00000116001 TIA1 NM_003252 TIAL1 NM_152259 ENSG00000140534 TICRR NM_020375 TIGAR NM_030953 ENSG00000164296 TIGD6 NM_012458 ENSG00000099800 TIMM13 NM_001001563 ENSG00000105197 TIMM50 NM_153375 ENSG00000223573 TINCR NM_004614 ENSG00000166548 TK2 NM_001064 ENSG00000163931 TKT NM_003260 ENSG00000065717 TLE2 NM_012465 ENSG00000095587 TLL2 NM_020123 ENSG00000077147 TM9SF3 NM_003217 ENSG00000139644 TMBIM6 NM_017905 ENSG00000150403 TMCO3 NM_015348 ENSG00000075568 TMEM131 NM_032928 ENSG00000244187 TMEM141 NM_017814 ENSG00000064545 TMEM161A NM_018475 ENSG00000134851 TMEM165 NM_012264 ENSG00000198792 TMEM184B NM_001003682 ENSG00000253304 TMEM200B NM_016499 ENSG00000187049 TMEM216 NM_001145529 ENSG00000204278 TMEM235 NM_001114748 TMEM240 NM_152261 ENSG00000151135 TMEM263 NM_001256829 ENSG00000080603 TMEM265 NM_018112 ENSG00000095209 TMEM38B NM_014698 ENSG00000196187 TMEM63A NM_016456 ENSG00000116857 TMEM9 NM_014738 ENSG00000177728 TMEM94 NM_020644 ENSG00000175348 TMEM9B NR_027157 ENSG00000257167 TMPO-AS1 NM_003840 ENSG00000173530 TNFRSF10D NM_014452 ENSG00000146072 TNFRSF21 NM_033396 ENSG00000149115 TNKS1BP1 NM_025235 ENSG00000107854 TNKS2 NM_001013722 ENSG00000182095 TNRC18 NM_015319 ENSG00000111077 TNS2 NM_016272 ENSG00000183864 TOB2 NM_020243 TOMM22 NM_001134493 TOMM6 NM_003286 ENSG00000198900 TOP1 NM_007027 ENSG00000163781 TOPBP1 NM_022347 ENSG00000169905 TOR1AIP2 NM_017723 ENSG00000198113 TOR4A NM_000546 ENSG00000141510 TP53 NM_017901 ENSG00000186815 TPCN1 NM_005079 ENSG00000076554 TPD52 NM_000365 ENSG00000111669 TPI1 NM_000547 ENSG00000115705 TPO NM_003292 ENSG00000047410 TPR NM_004593 TRA2B NM_003300 ENSG00000131323 TRAF3 NR_034108 ENSG00000231889 TRAF3IP2-AS1 NM_014965 ENSG00000182606 TRAK1 NM_016292 ENSG00000126602 TRAP1 NM_014408 ENSG00000054116 TRAPPC3 NM_018415 ENSG00000124496 TRERF1 NM_025195 ENSG00000173334 TRIB1 NM_014818 ENSG00000166436 TRIM66 NM_030912 ENSG00000171206 TRIM8 NM_021820 ENSG00000066651 TRMT11 NM_024950 ENSG00000155275 TRMT44 NM_018006 ENSG00000100416 TRMU NM_016000 ENSG00000072756 TRNT1 NM_017636 ENSG00000130529 TRPM4 NM_173485 ENSG00000182463 TSHZ2 NR_028393 ENSG00000270106 TSNAX-DISC1 NM_005724 TSPAN3 NM_006675 ENSG00000011105 TSPAN9 NR_002781 ENSG00000235217 TSPY26P NM_003309 TSPYL1 NM_022117 ENSG00000184205 TSPYL2 NM_003310 ENSG00000032389 TSSC1 NM_032037 ENSG00000178093 TSSK6 NM_173500 ENSG00000128881 TTBK2 NM_024525 ENSG00000143643 TTC13 NM_001080441 TTC36 NM_138376 TTC5 NM_144596 ENSG00000165533 TTC8 NM_015644 TTLL3 NM_006082 ENSG00000123416 TUBA1B NM_032704 ENSG00000167553 TUBA1C NM_006088 ENSG00000188229 TUBB4B NM_032525 ENSG00000176014 TUBB6 NR_002323 TUG1 NM_003322 ENSG00000112041 TULP1 NM_020245 ENSG00000130338 TULP4 NM_022830 ENSG00000149016 TUT1 NM_175852 ENSG00000084652 TXLNA NM_005499 ENSG00000126261 UBA2 NM_016172 ENSG00000130560 UBAC1 NM_177967 ENSG00000134882 UBAC2 NM_018449 ENSG00000137073 UBAP2 NM_021009 ENSG00000150991 UBC NM_003343 ENSG00000184787 UBE2G2 NM_005339 ENSG00000078140 UBE2K NM_003969 ENSG00000130725 UBE2M NM_021988 ENSG00000244687 UBE2V1 NM_000462 ENSG00000114062 UBE3A NM_198920 ENSG00000118420 UBE3D NM_016936 ENSG00000118900 UBN1 NM_172070 ENSG00000144357 UBR3 NM_020765 ENSG00000127481 UBR4 NM_015902 ENSG00000104517 UBR5 NM_014233 ENSG00000108312 UBTF NM_015562 UBXN7 NM_031432 ENSG00000130717 UCK1 NM_012474 UCK2 NM_003355 UCP2 NM_020120 ENSG00000136731 UGGT1 NM_013282 ENSG00000276043 UHRF1 NM_017979 ENSG00000140553 UNC45A NM_001080419 ENSG00000132478 UNK NM_006830 ENSG00000127540 UQCR11 NM_003715 ENSG00000138768 USO1 NM_005153 ENSG00000103194 USP10 NR_046547 USP12-AS1 NM_020718 ENSG00000103404 USP31 NM_032582 USP32 NM_014709 ENSG00000115464 USP34 NM_025090 ENSG00000055483 USP36 NR_038408 UST-AS1 NM_006649 ENSG00000156697 UTP14A NM_020368 ENSG00000132467 UTP3 NM_003373 ENSG00000035403 VCL NM_001001888 ENSG00000205642 VCX3B NM_014667 ENSG00000144560 VGLL4 NR_108060 ENSG00000229124 VIM-AS1 NM_018445 ENSG00000131871 VIMP NM_030938 ENSG00000062716 VMP1 NM_173858 VN1R5 NM_015378 ENSG00000048707 VPS13D NM_022916 VPS33A NM_015303 ENSG00000156931 VPS8 NM_003384 ENSG00000100749 VRK1 NR_026703 ENSG00000199990 VTRNA1-1 NM_152718 ENSG00000167992 VWCE NM_015045 ENSG00000062650 WAPL NM_017883 ENSG00000101940 WDR13 NM_144574 ENSG00000140153 WDR20 NM_025160 ENSG00000162923 WDR26 NM_182552 ENSG00000184465 WDR27 NM_006784 WDR3 NM_052844 ENSG00000119333 WDR34 NM_018669 ENSG00000160193 WDR4 NM_018268 ENSG00000164253 WDR41 NM_019613 ENSG00000141580 WDR45B NM_032118 ENSG00000005448 WDR54 NM_007331 ENSG00000109685 WHSC1 NM_017778 ENSG00000147548 WHSC1L1 NM_015610 ENSG00000157954 WIPI2 NM_004626 ENSG00000085741 WNT11 NM_030753 ENSG00000108379 WNT3 NR_126473 ENSG00000251128 WWC2-AS1 NR_001564 ENSG00000229807 XIST NM_003400 ENSG00000082898 XPO1 NM_015171 ENSG00000169180 XPO6 NM_001127438 XRCC6P5 NM_003651 ENSG00000060138 YBX3 NM_006555 ENSG00000106636 YKT6 NM_014263 ENSG00000136758 YME1L1 NM_006761 ENSG00000108953 YWHAE NM_003406 ENSG00000164924 YWHAZ NM_180990 ENSG00000186919 ZACN NM_175907 ZADH2 NM_001079 ENSG00000115085 ZAP70 NM_003443 ENSG00000116809 ZBTB17 NM_145166 ZBTB47 NM_015898 ENSG00000178951 ZBTB7A NM_024824 ENSG00000100722 ZC3H14 NM_018471 ENSG00000065548 ZC3H15 NM_021943 ENSG00000156639 ZFAND3 NR_002438 ENSG00000248492 ZFAT-AS1 NM_006885 ENSG00000140836 ZFHX3 NM_004926 ENSG00000185650 ZFP36L1 NM_133458 ENSG00000184939 ZFP90 NR_125796 ZFPM2-AS1 NM_003410 ENSG00000005889 ZFX NM_015346 ENSG00000072121 ZFYVE26 NM_144588 ENSG00000155256 ZFYVE27 NM_003439 ENSG00000106261 ZKSCAN1 NM_006956 ENSG00000164631 ZNF12 NM_003434 ENSG00000125846 ZNF133 NM_007152 ENSG00000005801 ZNF195 NM_003455 ENSG00000166261 ZNF202 NM_152287 ENSG00000158805 ZNF276 NM_003575 ENSG00000170265 ZNF282 NM_003421 ENSG00000075407 ZNF37A NM_017757 ENSG00000215421 ZNF407 NM_181489 ENSG00000185219 ZNF445 NM_133464 ENSG00000173258 ZNF483 NM_014930 ENSG00000081386 ZNF510 NM_145806 ZNF511 NM_152909 ENSG00000188785 ZNF548 NM_024341 ENSG00000130544 ZNF557 NM_152477 ENSG00000196357 ZNF565 NM_152600 ZNF579 NM_017652 ENSG00000083828 ZNF586 NM_032828 ENSG00000198466 ZNF587 NM_173539 ENSG00000172748 ZNF596 NM_015042 ENSG00000180357 ZNF609 NM_014497 ENSG00000075292 ZNF638 NM_016620 ENSG00000122482 ZNF644 NM_017865 ENSG00000171163 ZNF692 NM_025069 ENSG00000183779 ZNF703 NM_152557 ENSG00000181220 ZNF746 NM_024702 ENSG00000141579 ZNF750 NM_024910 ENSG00000133624 ZNF767P NM_001137674 ENSG00000197385 ZNF860 NM_080603 ENSG00000168612 ZSWIM1 NM_020928 ENSG00000130449 ZSWIM6 NM_001042697 ENSG00000214941 ZSWIM7 NM_025112 ENSG00000070476 ZXDC NM_015534 ENSG00000036549 ZZZ3
REFERENCES
[0425] Aranda, S., Mas, G., and Di Croce, L. (2015). Regulation of gene transcription by Polycomb proteins. Sci Adv 1, e1500737.
[0426] Badis, G., Berger, M. F., Philippakis, A. A., Talukder, S., Gehrke, A. R., Jaeger, S. A., Chan, E. T., Metzler, G., Vedenko, A., Chen, X., et al. (2009). Diversity and complexity in DNA recognition by transcription factors. Science 324, 1720-1723.
[0427] Bag, J., and Bhattacharjee, R. B. (2010). Multiple levels of post-transcriptional control of expression of the poly (A)-binding protein. RNA Biol 7, 5-12.
[0428] Bailey, T. L., Boden, M., Buske, F. A., Frith, M., Grant, C. E., Clementi, L., Ren, J., Li, W. W., and Noble, W. S. (2009). MEME SUITE: tools for motif discovery and searching. Nucleic acids research 37, W202-208.
[0429] Beltran, M., Yates, C. M., Skalska, L., Dawson, M., Reis, F. P., Viiri, K., Fisher, C. L., Sibley, C. R., Foster, B. M., Bartke, T., et al. (2016). The interaction of PRC2 with RNA or chromatin is mutually antagonistic. Genome Res 26, 896-907.
[0430] Bernstein, E., Duncan, E. M., Masui, O., Gil, J., Heard, E., and Allis, C. D. (2006). Mouse polycomb proteins bind differentially to methylated histone H3 and RNA and are enriched in facultative heterochromatin. Molecular and cellular biology 26, 2560-2569.
[0431] Blackledge, N. P., Rose, N. R., and Klose, R. J. (2015). Targeting Polycomb systems to regulate gene expression: modifications to a complex story. Nat Rev Mol Cell Biol 16, 643-649.
[0432] Cheng, B., Ren, X., and Kerppola, T. K. (2014). KAP1 represses differentiation-inducible genes in embryonic stem cells through cooperative binding with PRC1 and derepresses pluripotency-associated genes. Mol Cell Biol 34, 2075-2091.
[0433] Feng, X., Grossman, R., and Stein, L. (2011). PeakRanger: a cloud-enabled peak caller for ChIP-seq data. BMC bioinformatics 12, 139.
[0434] Frith, M. C., Fu, Y., Yu, L., Chen, J. F., Hansen, U., and Weng, Z. (2004). Detection of functional DNA motifs via statistical over-representation. Nucleic acids research 32, 1372-1381.
[0435] Giresi, P. G., Kim, J., McDaniell, R. M., Iyer, V. R., and Lieb, J. D. (2007). FAIRE (Formaldehyde-Assisted Isolation of Regulatory Elements) isolates active regulatory elements from human chromatin. Genome Res 17, 877-885.
[0436] Glisovic, T., Bachorik, J. L., Yong, J., and Dreyfuss, G. (2008). RNA-binding proteins and post-transcriptional gene regulation. FEBS Lett 582, 1977-1986.
[0437] Grau, D. J., Chapman, B. A., Garlick, J. D., Borowsky, M., Francis, N. J., and Kingston, R. E. (2011). Compaction of chromatin by diverse Polycomb group proteins requires localized regions of high charge. Genes & development 25, 2210-2221.
[0438] Hendrickson, D., Kelley, D. R., Tenen, D., Bernstein, B., and Rinn, J. L. (2016). Widespread RNA binding by chromatin-associated proteins. Genome Biol 17, 28.
[0439] Incarnato, D., Neri, F., Anselmi, F., and Oliviero, S. (2014). Genome-wide profiling of mouse RNA secondary structures reveals key features of the mammalian transcriptome. Genome Biol 15, 491.
[0440] Jeon, Y., and Lee, J. T. (2011). YY1 tethers Xist RNA to the inactive X nucleation center. Cell 146, 119-133.
[0441] Ji, X., Li, W., Song, J., Wei, L., and Liu, X. S. (2006). CEAS: cis-regulatory element annotation system. Nucleic acids research 34, W551-554.
[0442] Kaneko, S., Bonasio, R., Saldana-Meyer, R., Yoshida, T., Son, J., Nishino, K., Umezawa, A., and Reinberg, D. (2014a). Interactions between JARID2 and noncoding RNAs regulate PRC2 recruitment to chromatin. Molecular cell 53, 290-300.
[0443] Kaneko, S., Son, J., Bonasio, R., Shen, S. S., and Reinberg, D. (2014b). Nascent RNA interaction keeps PRC2 activity poised and in check. Genes & development 28, 1983-1988.
[0444] Kaneko, S., Son, J., Shen, S. S., Reinberg, D., and Bonasio, R. (2013). PRC2 binds active promoters and contacts nascent RNAs in embryonic stem cells. Nature structural & molecular biology.
[0445] Kent, W. J., Sugnet, C. W., Furey, T. S., Roskin, K. M., Pringle, T. H., Zahler, A. M., and Haussler, D. (2002). The human genome browser at UCSC. Genome Res 12, 996-1006.
[0446] Khalil, A. M., Guttman, M., Huarte, M., Garber, M., Raj, A., Rivea Morales, D., Thomas, K., Presser, A., Bernstein, B. E., van Oudenaarden, A., et al. (2009). Many human large intergenic noncoding RNAs associate with chromatin-modifying complexes and affect gene expression. Proceedings of the National Academy of Sciences of the United States of America 106, 11667-11672.
[0447] Kim, J., Cantor, A. B., Orkin, S. H., and Wang, J. (2009). Use of in vivo biotinylation to study protein-protein and protein-DNA interactions in mouse embryonic stem cells. Nat Protoc 4, 506-517.
[0448] Kung, J. T., Kesner, B., An, J. Y., Ahn, J. Y., Cifuentes-Rojas, C., Colognori, D., Jeon, Y., Szanto, A., del Rosario, B. C., Pinter, S. F., et al. (2015). Locus-specific targeting to the X chromosome revealed by the RNA interactome of CTCF. Molecular cell 57, 361-375.
[0449] Lee, J. T., and Lu, N. (1999). Targeted mutagenesis of Tsix leads to nonrandom X inactivation. Cell 99, 47-57.
[0450] Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis, G., Durbin, R., and Genome Project Data Processing, S. (2009). The Sequence Alignment/Map format and SAMtools. Bioinformatics 25, 2078-2079.
[0451] Ma, W., Noble, W. S., and Bailey, T. L. (2014). Motif-based analysis of large nucleotide data sets using MEME-ChIP. Nat Protoc 9, 1428-1450.
[0452] Magistri, M., Faghihi, M. A., St Laurent, G., 3rd, and Wahlestedt, C. (2012). Regulation of chromatin structure by long noncoding RNAs: focus on natural antisense transcripts. Trends in genetics : TIG 28, 389-396.
[0453] Mahony, S., and Benos, P. V. (2007). STAMP: a web tool for exploring DNA-binding motif similarities. Nucleic acids research 35, W253-258.
[0454] Marchese, D., de Groot, N. S., Lorenzo Gotor, N., Livi, C. M., and Tartaglia, G. G. (2016). Advances in the characterization of RNA-binding proteins. Wiley interdisciplinary reviews. RNA 7, 793-810.
[0455] Morey, L., Pascual, G., Cozzuto, L., Roma, G., Wutz, A., Benitah, S. A., and Di Croce, L. (2012). Nonoverlapping functions of the Polycomb group Cbx family of proteins in embryonic stem cells. Cell stem cell 10, 47-62.
[0456] Nicol, J. W., Helt, G. A., Blanchard, S. G., Jr., Raja, A., and Loraine, A. E. (2009). The Integrated Genome Browser: free software for distribution and exploration of genome-scale datasets. Bioinformatics 25, 2730-2731.
[0457] O'Loghlen, A., Munoz-Cabello, A. M., Gaspar-Maia, A., Wu, H. A., Banito, A., Kunowska, N., Racek, T., Pemberton, H. N., Beolchi, P., Lavial, F., et al. (2012). MicroRNA regulation of Cbx7 mediates a switch of Polycomb orthologs during ESC differentiation. Cell stem cell 10, 33-46.
[0458] Pinter, S. F., Sadreyev, R. I., Yildirim, E., Jeon, Y., Ohsumi, T. K., Borowsky, M., and Lee, J. T. (2012). Spreading of X chromosome inactivation via a hierarchy of defined Polycomb stations. Genome Res 22, 1864-1876.
[0459] Quinlan, A. R., and Hall, I. M. (2010). BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841-842.
[0460] Ramirez, F., Dundar, F., Diehl, S., Gruning, B. A., and Manke, T. (2014). deepTools: a flexible platform for exploring deep-sequencing data. Nucleic acids research 42, W187-191.
[0461] Ray, D., Kazan, H., Cook, K. B., Weirauch, M. T., Najafabadi, H. S., Li, X., Gueroussov, S., Albu, M., Zheng, H., Yang, A., et al. (2013). A compendium of RNA-binding motifs for decoding gene regulation. Nature 499, 172-177.
[0462] Ray, M. K., Wiskow, O., King, M.J., Ismail, N., Ergun, A., Wang, Y., Plys, A. J., Davis, C. P., Kathrein, K., Sadreyev, R., et al. (2016). CAT7 and cat71 long non-coding RNAs Tune Polycomb Repressive Complex 1 Function During Human and Zebrafish Development. J Biol Chem.
[0463] Rouskin, S., Zubradt, M., Washietl, S., Kellis, M., and Weissman, J. S. (2014). Genome-wide probing of RNA structure reveals active unfolding of mRNA structures in vivo. Nature 505, 701-705.
[0464] Rozowsky, J., Euskirchen, G., Auerbach, R. K., Zhang, Z. D., Gibson, T., Bjornson, R., Carriero, N., Snyder, M., and Gerstein, M. B. (2009). PeakSeq enables systematic scoring of ChIP-seq experiments relative to controls. Nat Biotechnol 27, 66-75.
[0465] Sandelin, A., Alkema, W., Engstrom, P., Wasserman, W. W., and Lenhard, B. (2004). JASPAR: an open-access database for eukaryotic transcription factor binding profiles. Nucleic acids research 32, D91-94.
[0466] Sarma, K., Levasseur, P., Aristarkhov, A., and Lee, J. T. (2010). Locked nucleic acids (LNAs) reveal sequence requirements and kinetics of Xist RNA localization to the X chromosome. Proc Natl Acad Sci USA 107, 22196-22201.
[0467] Shin, H., Liu, T., Manrai, A. K., and Liu, X. S. (2009). CEAS: cis-regulatory element annotation system. Bioinformatics 25, 2605-2606.
[0468] Sigova, A. A., Abraham, B. J., Ji, X., Molinie, B., Hannett, N. M., Guo, Y. E., Jangi, M., Giallourakis, C. C., Sharp, P. A., and Young, R. A. (2015). Transcription factor trapping by RNA in gene regulatory elements. Science 350, 978-981.
[0469] Simon, J. A., and Kingston, R. E. (2013). Occupying chromatin: Polycomb mechanisms for getting to genomic targets, stopping transcriptional traffic, and staying put. Molecular cell 49, 808-824.
[0470] Simon, J. M., Giresi, P. G., Davis, I. J., and Lieb, J. D. (2012). Using formaldehyde-assisted isolation of regulatory elements (FAIRE) to isolate active regulatory DNA. Nat Protoc 7, 256-267.
[0471] Spassov, D. S., and Jurecic, R. (2003). The PUF family of RNA-binding proteins: does evolutionarily conserved structure equal conserved function? IUBMB Life 55, 359-366.
[0472] Spitale, R. C., Flynn, R. A., Zhang, Q. C., Crisalli, P., Lee, B., Jung, J. W., Kuchelmeister, H. Y., Batista, P. J., Torre, E. A., Kool, E. T., et al. (2015). Structural imprints in vivo decode RNA regulatory mechanisms. Nature 519, 486-490.
[0473] Taliaferro, J. M., Lambert, N. J., Sudmant, P. H., Dominguez, D., Merkin, J. J., Alexis, M. S., Bazile, C., and Burge, C. B. (2016). RNA Sequence Context Effects Measured In Vitro Predict In Vivo Protein Binding and Regulation. Molecular cell 64, 294-306.
[0474] Tamura, K., Stecher, G., Peterson, D., Filipski, A., and Kumar, S. (2013). MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol Biol Evol 30, 2725-2729.
[0475] Tavares, L., Dimitrova, E., Oxley, D., Webster, J., Poot, R., Demmers, J., Berstarosti, K., Taylor, S., Ura, H., Koide, H., et al. (2012). RYBP-PRC1 complexes mediate H2A ubiquitylation at polycomb target sites independently of PRC2 and H3K27 me3. Cell 148, 664-678.
[0476] Trapnell, C., Roberts, A., Goff, L., Pertea, G., Kim, D., Kelley, D. R., Pimentel, H., Salzberg, S. L., Rinn, J. L., and Pachter, L. (2012). Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat Protoc 7, 562-578.
[0477] Van Nostrand, E. L., Pratt, G. A., Shishkin, A. A., Gelboin-Burkhart, C., Fang, M. Y., Sundararaman, B., Blue, S. M., Nguyen, T. B., Surka, C., Elkins, K., et al. (2016). Robust transcriptome-wide discovery of RNA-binding protein binding sites with enhanced CLIP (eCLIP). Nat Methods 13, 508-514.
[0478] Vierstra, J., Rynes, E., Sandstrom, R., Zhang, M., Canfield, T., Hansen, R. S., Stehling-Sun, S., Sabo, P. J., Byron, R., Humbert, R., et al. (2014). Mouse regulatory DNA landscapes reveal global principles of cis-regulatory evolution. Science 346, 1007-1012.
[0479] Wang, J., and Bell, L. R. (1994). The Sex-lethal amino terminus mediates cooperative interactions in RNA binding and is essential for splicing regulation. Genes & development 8, 2072-2085.
[0480] Wang, X., Goodrich, K. J., Gooding, A. R., Naeem, H., Archer, S., Paucek, R. D., Youmans, D. T., Cech, T. R., and Davidovich, C. (2017). Targeting of Polycomb Repressive Complex 2 to RNA by Short Repeats of Consecutive Guanines. Molecular cell 65, 1056-1067 e1055.
[0481] Warzecha, C. C., Sato, T. K., Nabet, B., Hogenesch, J. B., and Carstens, R. P. (2009). ESRP1 and ESRP2 are epithelial cell-type-specific regulators of FGFR2 splicing. Molecular cell 33, 591-601.
[0482] Wei, G. H., Badis, G., Berger, M. F., Kivioja, T., Palin, K., Enge, M., Bonke, M., Jolma, A., Varjosalo, M., Gehrke, A. R., et al. (2010). Genome-wide analysis of ETS-family DNA-binding in vitro and in vivo. EMBO J 29, 2147-2160.
[0483] Woo, C. J., Maier, V. K., Davey, R., Brennan, J., Li, G., Brothers, J., 2nd, Schwartz, B., Gordo, S., Kasper, A., Okamoto, T. R., et al. (2017). Gene activation of SMN by selective disruption of lncRNA-mediated recruitment of PRC2 for the treatment of spinal muscular atrophy. Proc Natl Acad Sci USA 114, E1509-E1518.
[0484] Xie, Z., Hu, S., Blackshaw, S., Zhu, H., and Qian, J. (2010). hPDI: a database of experimental human protein-DNA interactions. Bioinformatics 26, 287-289.
[0485] Yap, K. L., Li, S., Munoz-Cabello, A. M., Raguz, S., Zeng, L., Mujtaba, S., Gil, J., Walsh, M. J., and Zhou, M. M. (2010). Molecular interplay of the noncoding RNA ANRIL and methylated histone H3 lysine 27 by polycomb CBX7 in transcriptional silencing of INK4a. Molecular cell 38, 662-674.
[0486] Zhang, Y., Liu, T., Meyer, C. A., Eeckhoute, J., Johnson, D. S., Bernstein, B. E., Nusbaum, C., Myers, R. M., Brown, M., Li, W., et al. (2008). Model-based analysis of ChIP-Seq (MACS). Genome Biol 9, R137.
[0487] Zhao, J., Ohsumi, T. K., Kung, J. T., Ogawa, Y., Grau, D. J., Sarma, K., Song, J. J., Kingston, R. E., Borowsky, M., and Lee, J. T. (2010). Genome-wide identification of polycomb-associated RNAs by RIP-seq. Molecular cell 40, 939-953.
[0488] Zhen, C. Y., Tatavosian, R., Huynh, T. N., Duc, H. N., Das, R., Kokotovic, M., Grimm, J. B., Lavis, L. D., Lee, J., Mejia, F. J., et al. (2016). Live-cell single-molecule tracking reveals co-recognition of H3K27 me3 and DNA targets polycomb Cbx7-PRC1 to chromatin. Elife 5.
[0489] Zovoilis, A., Cifuentes-Rojas, C., Chu, H. P., Hernandez, A. J., and Lee, J. T. (2016). Destabilization of B2 RNA by EZH2 Activates the Stress Response. Cell 167, 1788-1802 e1713. [0490] Chen, B., Yun, J., Kim, M. S., Mendell, J. T., and Xie, Y. (2014). PIPE-CLIP: a comprehensive online tool for CLIP-seq data analysis. Genome biology 15, R18. [0491] Ray, M. K., Wiskow, O., King, M. J., Ismail, N., Ergun, A., Wang, Y., Plys, A. J., Davis, C. P., Kathrein, K., Sadreyev, R., et al. (2016). CAT7 and cat71 long non-coding RNAs Tune Polycomb Repressive Complex 1 Function During Human and Zebrafish Development. The Journal of biological chemistry. [0492] Spitale, R. C., Flynn, R. A., Zhang, Q. C., Crisalli, P., Lee, B., Jung, J. W., Kuchelmeister, H. Y., Batista, P. J., Torre, E. A., Kool, E. T., et al. (2015). Structural imprints in vivo decode RNA regulatory mechanisms. Nature 519, 486-490.
Other Embodiments
[0493] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.