Method for preparing DNA unit composition, and method for creating concatenated DNA
10655133 ยท 2020-05-19
Assignee
Inventors
Cpc classification
C12N15/64
CHEMISTRY; METALLURGY
C12N15/66
CHEMISTRY; METALLURGY
International classification
C12N15/10
CHEMISTRY; METALLURGY
C12N15/66
CHEMISTRY; METALLURGY
C12N15/64
CHEMISTRY; METALLURGY
Abstract
Provided are: a method for preparing a DNA unit composition in which the mol number of a plurality of DNA units is more uniform, and a method for creating concatenated DNA. The method for preparing a DNA unit composition has: a step for preparing solutions which contain a plurality of DNA units to which an added sequence is linked, and preparing a solution for each type of DNA unit; and a step for, after preparing each of the solutions, measuring the concentration of the DNA unit in each of the solutions in a state where the added sequence is linked to the DNA unit, and on the basis of the results thereof, fractionating each of the solutions and making the mol number of the DNA unit in each of the solutions closer to being identical to one another.
Claims
1. A method of preparing a DNA unit fragment composition, comprising: a step of preparing solutions containing multiple kinds of DNA unit fragments, each solution containing one of the multiple kinds of DNA unit fragments, each DNA unit fragment being attached to a corresponding auxiliary sequence; and a step of, after preparing each solution, measuring the concentration of each kind of DNA unit fragment with the corresponding auxiliary sequence attached thereto in each of the solutions, and then based on the measurement result, taking a portion from each of the solutions so that the number of moles of DNA unit fragment in one portion is the same as the number of moles of DNA unit fragment in another portion, and combining each of the portions to prepare the DNA unit fragment composition.
2. The method of preparing a DNA unit fragment composition according to claim 1, wherein each DNA unit fragment with the corresponding auxiliary sequence attached thereto has a circular structure, and each corresponding auxiliary sequence is a plasmid DNA sequence harboring an origin of replication.
3. The method of preparing a DNA unit fragment composition according to claim 1, wherein a standard deviation of the sum of the length of the base sequence of each DNA unit fragment and the length of the base sequence of the corresponding auxiliary sequence attached to the DNA unit fragment is 20% to within 20% plus or minus the average value of the sum of the lengths.
4. The method of preparing a DNA unit fragment composition according to claim 1, wherein the average length of the base sequence of the corresponding auxiliary sequence attached to each DNA unit fragment is twice or greater than the average length of the base sequence of the DNA unit fragment.
5. The method of preparing a DNA unit fragment composition according to claim 1, wherein each DNA unit fragment is not longer than 1600 bp.
6. The method of preparing a DNA unit fragment composition according to claim 1, wherein the DNA unit fragments are used to construct a DNA concatemer, the DNA concatemer comprising DNA assemblies each comprising the DNA unit fragments, and the step of preparing solutions containing multiple kinds of DNA unit fragments comprises a step of designing each DNA unit fragment, the designing being conducted in a way that in the base sequence of each DNA assembly a non-palindromic sequence is present near each boundary between two adjacent DNA unit fragments, and each DNA unit fragment has the non-palindromic sequence at an end and is separated by the non-palindromic sequence from an adjacent DNA unit fragment.
7. A method of constructing a DNA concatemer to be used for microbial cell transformation, the DNA concatemer comprising more than one DNA assembly unit, each of the more than one DNA assembly unit comprising a DNA vector harboring an origin of replication effective in a host microorganism and a DNA assembly, the method comprising: a step of preparing a DNA unit fragment composition in a solution by the method as claimed in claim 1; a step of preparing the DNA vector; a step of removing with a restriction enzyme a corresponding auxiliary sequence from each DNA unit fragment with the corresponding auxiliary sequence attached thereto contained in the solution after preparation; and a step of, after the removal step, joining the DNA vector and each of the DNA unit fragment together, wherein each of the DNA vector and the DNA unit fragment is structurally capable of being joined repeatedly while maintaining a certain order, and each DNA assembly comprises of a DNA molecule in which the DNA unit fragment is joined to one another.
8. The method of constructing a DNA concatemer according to claim 7, further comprising: a step of, adjusting a coefficient of variation for the concentrations of the DNA vector and each DNA unit fragment in the combining step based on a relation between a yield of a DNA fragment comprising a target number of DNA unit fragments joined together and a coefficient of variation for the concentration of this DNA fragment, the yield being equal to the product of the number of DNA unit fragments per assembly unit and the number of the assembly unit.
9. The method of constructing a DNA concatemer according to claim 7, wherein the restriction enzyme is a Type II restriction enzyme.
10. The method of constructing a DNA concatemer according to claim 7, further comprising: a step of, before the removal step, mixing two or more solutions containing DNA unit fragments selected from the solutions containing DNA unit fragments.
11. The method of constructing a DNA concatemer according to claim 7, further comprising: a step of, after the removal step and before the joining step, inactivating the restriction enzyme.
12. The method of constructing a DNA concatemer according to claim 7, wherein the microorganism is Bacillus subtilis.
13. The method of claim 1, wherein a molar ratio among each of the different portions is 1.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
PREFERRED MODE FOR CARRYING OUT THE INVENTION
(27) Embodiments of the present invention are described below. The scope of the present invention, however, is not limited to these embodiments.
(28) <Method of Preparing DNA Unit Fragment Composition>
(29) A method of preparing a DNA unit fragment composition of the present invention comprises: a step of preparing solutions containing multiple kinds of DNA unit fragments, each solution containing one of the multiple kinds of DNA unit fragments, each DNA unit fragment being attached to a corresponding auxiliary sequence; and a step of, after the preparation step, measuring the concentration of each kind of DNA unit fragment with the corresponding auxiliary sequence attached thereto in each of the solutions, and then based on the measurement result, taking a portion from each of the solutions so that the number of moles of DNA unit fragment in one portion is close to the number of moles of DNA unit fragment in another portion. In the present specification, different kinds of DNA unit fragments are distinguished from each other by the difference in the base sequences. The DNA unit fragment refers to one with or without a restriction enzyme recognition site introduced thereinto.
(30) In the present invention, when the concentration of each kind of DNA unit fragment in the solution containing the DNA unit fragment is measured, the DNA unit fragment being measured has the corresponding auxiliary sequence attached thereto. The corresponding auxiliary sequences thus attached contribute to reduction in distribution of the lengths of different base sequences when the concentration of the solution is measured. As a result, when the measurement result is used to calculate the number of moles of each kind of DNA unit fragment, errors in the calculation are reduced. Then, when the resulting measurement result is used for taking a portion from each of the solutions so that the number of moles of DNA unit fragment in each portion is substantially the same, the molar ratio among different portions tends to be close to 1. The concentration of the DNA unit fragment in the solution thus measured refers to the molarity of the DNA unit fragment. The method of measuring the molarity of the DNA unit fragment in the solution is not particularly limited, but examples of the method include measuring the mass ratio (% by mass) of the DNA unit fragment in the solution and then using the measurement (% by mass) to calculate the molarity of the DNA unit fragment in the solution. In the method of measuring the molarity of the DNA unit fragment in the solution, a means capable of measuring the DNA concentration by weight with 20% precision is preferably used, and, more specifically, a microspectrophotometer for measuring ultraviolet absorption spectra is preferably used.
(31) The step of preparing solutions containing DNA unit fragments each with the corresponding auxiliary sequence attached thereto is not particularly limited and may be conducted, for example, by preparing each DNA unit fragment and then attaching the corresponding auxiliary sequence to the DNA unit fragment.
(32) Preparation of the DNA unit fragment may be conducted by using the DNA unit fragment synthesized in advance or newly constructed. Construction of each DNA unit fragment can be achieved by a well-known conventional method including polymerase chain reaction (PCR) and chemical synthesis. Addition of a restriction enzyme recognition sequence to each DNA unit fragment can be achieved by constructing the DNA unit fragment by PCR in which, for example, a primer having a restriction enzyme recognition sequence for forming a protruding end in the base sequence of the template DNA is used, or by constructing the DNA unit fragment by chemical synthesis in which a restriction enzyme recognition sequence is incorporated in advance for forming a certain protruding sequence at an end of the DNA unit fragment. The base sequence of the DNA unit fragment thus constructed can be confirmed by a well-known conventional method, for example, by incorporating the DNA unit fragment into a plasmid and then conducting Sanger base sequencing on an automated fluorescence sequencer.
(33) The corresponding auxiliary sequence is not particularly limited and may be a linear DNA molecule or a circular plasmid. When a circular plasmid DNA sequence is used, the DNA unit fragment with the corresponding auxiliary sequence attached thereto has a circular structure and therefore can be used, for example, to transform a host such as Escherichia coli.
(34) The DNA plasmid is not particularly limited in its kind, but for replication of the DNA plasmid in the transformed host, the plasmid DNA sequence preferably has an origin of replication. Specifically, a high-copy Escherichia coli plasmid vector, pUC19, or a derivative plasmid thereof is preferable. In order to reduce the distribution of the lengths between DNA unit fragments each attached to the corresponding auxiliary sequence so that the numbers of moles of the DNA unit fragments can be made close to one another, all the DNA unit fragments are preferably cloned into the same kind of plasmid vector.
(35) Attaching the corresponding auxiliary sequence to each DNA unit fragment may be conducted, for example, by ligation with DNA ligase, or by TA cloning in the case of attaching the DNA unit fragment to the DNA plasmid.
(36) The standard deviation of the distribution of the sum of the lengths of the base sequence of each DNA unit fragment and the base sequence of the corresponding auxiliary sequence attached to the DNA unit fragment is not particularly limited. When the standard deviation is small, calculation errors are reduced in the calculation of the number of moles of each DNA unit fragment conducted based on the measurement result of the DNA concentration in the solution, and, as a result, the number of moles of the DNA unit fragment contained in one solution can be close to the number of moles of DNA unit fragment in another solution. Specifically, the standard deviation of the distribution of the sum of the lengths of the base sequence of each DNA unit fragment and the base sequence of the corresponding auxiliary sequence attached to the DNA unit fragment preferably ranges from 20% to 20%, more preferably ranges from 15% to 15%, further more preferably ranges from 10% to 10%, further preferably ranges from 5% to 5%, even further preferably ranges from 1% to 1%, and most preferably ranges from 0.5% to 0.5% with relative to the average value of the sum of the lengths.
(37) The average length of the base sequence of the corresponding auxiliary sequence attached to each DNA unit fragment is not particularly limited. When the average length of the base sequence of the corresponding auxiliary sequence attached to each DNA unit fragment is greater than the average length of the base sequence of the DNA unit fragment, calculation errors are reduced in the calculation of the number of moles of the DNA unit fragment conducted based on the measurement result of the DNA concentration in the solution, and, as a result, the number of moles of the DNA unit fragment contained in one solution can be close to the number of moles of DNA unit fragment in another solution. Specifically, the average length of the base sequence of the corresponding auxiliary sequence attached to the DNA unit fragment is preferably not smaller than twice, further preferably not smaller than 5 times, further preferably not smaller than 10 times, and most preferably not smaller than 20 times the average length of the base sequence of the DNA unit fragment. When the average length of the base sequence of the corresponding auxiliary sequence attached to each DNA unit fragment is too great, handling of the DNA unit fragment with the corresponding auxiliary sequence attached thereto is difficult. Therefore, the average length of the base sequence of the corresponding auxiliary sequence attached to each DNA unit fragment is preferably not greater than 10000 times (specifically, for example, not greater than 5000 times, not greater than 3000 times, not greater than 1000 times, not greater than 500 times, not greater than 250 times, and not greater than 100 times) the average length of the base sequence of the DNA unit fragment, for example.
(38) The length of each DNA unit fragment is not particularly limited. However, the number of sessions of base sequencing required for determining the base sequence of each DNA unit fragment is preferably small in order to save time and cost. Therefore, each DNA unit fragment is preferably short, and specifically, it is preferably not longer than 1600 by and further preferably not longer than 1200 bp. Particularly when base sequencing is conducted by Sanger base sequencing on an automated fluorescence sequencer, which can determine about 800 consecutive bases in a single session of base sequencing, each DNA unit fragment is most preferably not longer than 800 by (specifically, not longer than 600 bp, not longer than 500 bp, not longer than 400 bp, not longer than 200 bp, and not longer than 100 bp, for example). As the DNA unit fragments thus become shorter, however, the number of them needed for constructing a DNA concatemer described below increases. Here, many DNA unit fragments can be joined together when they are prepared by the method of the present invention as described below. But, again, when each DNA unit fragment is too short, the number of the DNA unit fragments to be joined increases and, as a result, operation efficiency decreases. For this reason, each DNA unit fragment is preferably not shorter than 20 bp, more preferably not shorter than 30 bp, and further preferably not shorter than 50 bp.
(39) Applications of the DNA unit fragment composition prepared by the method of the present invention are not particularly limited. The DNA unit fragment composition prepared by the method of the present invention can be used to construct a DNA concatemer comprising DNA assemblies each comprising the DNA unit fragments. When the DNA unit fragment composition prepared by the method of the present invention is used to construct a DNA concatemer by a method described below, many kinds of DNA unit fragments (50 kinds or more, for example) can be joined together. This is achieved probably for a reason that the numbers of moles of DNA unit fragments contained in the DNA unit fragment composition prepared by the method of the present invention are close to one another with high precision.
(40) In the present invention, the step of preparing solutions containing DNA unit fragments may comprise a step of designing each DNA unit fragment. Designing each DNA unit fragment is not particularly limited. In the case, for example, where the DNA unit fragment composition is used to construct a DNA concatemer comprising DNA assemblies, the designing may be conducted in a way that the base sequence of each DNA assembly when divided by the number of kinds of its constituent DNA unit fragments into equal parts has a non-palindromic sequence near each boundary between two adjacent equal parts, and that each DNA unit fragment is separated by the non-palindromic sequence from an adjacent DNA unit fragment. The DNA unit fragments thus designed have substantially the same length. This characteristic is preferable in terms of operation efficiency because when the DNA unit fragments are to be used for DNA concatemer construction as described below and are therefore subjected to removal of corresponding auxiliary sequences with restriction enzymes and to subsequent electrophoresis for size-based selection, the DNA unit fragments are observed substantially as a single band, allowing recovery of all the DNA unit fragments to be completed in a single session of size-based selection. The area referred to by the expression near each boundary between two adjacent equal parts is not particularly limited, and may be determined, as needed, based on the length of the base sequence. When the base sequence of each DNA unit fragment is 1000-bp long, for example, the area near each boundary between two adjacent equal parts may be determined, for example, as an area within 100 by (specifically, within 90 bp, within 80 bp, within 70 bp, within 60 bp, within 50 bp, within 30 bp, within 20 bp, within 10 bp, within 5 bp) of each boundary between two adjacent equal parts.
(41) When the DNA unit fragment is thus designed for constructing a DNA concatemer comprising target DNA assemblies, the DNA unit fragment is preferably designed to have a non-palindromic sequence (a sequence that is not a palindromic sequence) at an end of the DNA unit fragment. The non-palindromic sequence of the DNA unit fragment thus designed is converted into a protruding sequence that is structurally capable of being joined repeatedly while maintaining a certain order as described below.
(42) <Method of Constructing DNA Concatemer>
(43) The present invention also subsumes a method of constructing a DNA concatemer. The method of constructing a DNA concatemer of the present invention comprises: a step of preparing the DNA unit fragment composition in the solution by the method described above; a step of preparing a DNA vector; a step of removing with a restriction enzyme the corresponding auxiliary sequence from each DNA unit fragment with the corresponding auxiliary sequence attached thereto contained in the solution; and a step of, after the removal step, joining the DNA vector and the DNA unit fragment together.
(44) The DNA concatemer comprises more than one DNA assembly unit and is to be used for microbial cell transformation. Each DNA assembly unit comprises the DNA vector and the DNA assembly. The number of DNA assembly units in one DNA concatemer is not particularly limited provided that it is greater than 1. However, for enhanced efficiency in transformation, the number is preferably not smaller than 1.5, more preferably not smaller than 2, further preferably not smaller than 3, and most preferably not smaller than 4.
(45) Each DNA vector harbors an origin of replication effective in a host microorganism that is to be transformed. The DNA vector is not particularly limited provided that it harbors a sequence that allows DNA replication to occur in a microorganism to be transformed with the DNA concatemer. For example, the DNA vector harbors a sequence coding for an origin of replication effective in a bacterium of the genus Bacillus (Bacillus subtilis). The sequence coding for an origin of replication effective in Bacillus subtilis is not particularly limited. Examples of sequences coding for the origin of replication include sequences coding for, for example, an origin of replication harbored by plasmids such as pTB19 (Imanaka, T., et al. J. Gen. Microbioi. 130, 1399-1408. (1984)), pLS32 (Tanaka, T and Ogra, M. FEBS Lett. 422, 243-246. (1998)), and pAM1 (Swinfield, T. J., et al. Gene 87, 79-90. (1990)).
(46) Each DNA assembly is a DNA molecule in which the DNA unit fragment described above is joined to one another. The DNA referred to in the present invention is a DNA molecule to be cloned, and is not particularly limited in its kind or size. Specifically, the DNA referred to in the present invention may have a sequence naturally occurring in a prokaryote, a eukaryote, a virus, or the like or an artificial sequence, for example. In the method of the present invention capable of joining many DNA unit fragments to a plasmid as described above, a DNA molecule having a long base sequence is preferably used. The DNA molecule having a long base sequence is, for example, a group of genes coding for an entire metabolic pathway or a complete or partial genomic DNA of a phage or the like.
(47) Each DNA assembly unit may or may not comprise an additional proper base sequence, where appropriate, besides the DNA vector and the DNA assembly. In the case of constructing a plasmid for use in expression of a constituent gene of the DNA assembly, the DNA assembly unit may comprise a base sequence capable of controlling transcription and translation, such as a promoter, an operator, an activator, and a terminator. Specific examples of a promoter for Bacillus subtilis as a host include Pspac promoter (Yansura, D. and Henner, D. J. Pro. Natl. Acad. Sci, USA 81, 439-443. (1984.)), the expression of which can be controlled by IPTG (isopropyl s-D-thiogalactopyranoside), and Pr promoter (Itaya, M. Biosci. Biotechnol. Biochem. 63, 602-604. (1999)).
(48) Each of the DNA vector and the DNA unit fragment is structurally capable of being joined repeatedly while maintaining a certain order. In the present specification, the expression joined while maintaining a certain order refers to that a DNA unit fragment is joined in a certain order and orientation to another DNA unit fragment or to a DNA vector adjacent within a DNA assembly unit. The expression joined repeatedly refers to that the 5 end of a DNA unit fragment or a DNA vector harboring its 5 base sequence is joined to the 3 end of a DNA unit fragment or a DNA vector harboring its 3 base sequence. Specific examples of such a DNA unit fragment include a DNA unit fragment having an end capable of being joined repeatedly to a partner while maintaining a certain order due to complementation between the base sequences of their protruding ends. Such protrusion is not particularly limited in its structure, or in the difference in shape between one on the 5 protruding end and one on the 3 protruding end, provided that it has a non-palindromic sequence.
(49) Each protruding end is preferably formed by the step of removing the corresponding auxiliary sequence from the DNA unit fragment with a restriction enzyme. Therefore, in construction of a DNA concatemer by the method of the present invention, the DNA unit fragment preferably comprises a restriction enzyme recognition sequence that allows removal of the corresponding auxiliary sequence with a restriction enzyme. The preparation of the DNA vector can also be conducted, for example, by restriction enzyme treatment that forms a protruding end and allows the DNA vector and the DNA unit fragment to join repeatedly while maintaining a certain order.
(50) The restriction enzyme used above for removal of the corresponding auxiliary sequence is not particularly limited, but is preferably a Type II restriction enzyme, and is more preferably a Type IIS restriction enzyme that can form a protruding end having a certain sequence at a locus at a certain distance outside its recognition sequence, such as AarI, BbsI, BbvI, BcoDI, BfuAI, BsaI, BsaXI, BsmAI, BsmBI, BsmFI, BspMI, BspQI, BtgZI, FokI, and SfaNI. A Type IIS restriction enzyme can form different protruding ends for a single DNA unit fragment, and consequently can maintain the order in which DNA unit fragments are joined. Not only in the preparation of the DNA unit fragment but also in the preparation of the DNA vector, a Type IIS restriction enzyme is preferably used for forming a protruding end that allows the DNA vector and the DNA unit fragment to join repeatedly while maintaining a certain order.
(51) The DNA unit fragments can be divided into groups, each group for a single restriction enzyme to be used for removal of the corresponding auxiliary sequence. In this case, each group can consist of two or more solutions each containing a different DNA unit fragment. The two or more solutions can be mixed together before the removal step. As a result, a separate session of restriction enzyme treatment is not required for respective DNA unit fragment, but, instead, a single session of restriction enzyme treatment is enough to treat an entire restriction-enzyme group. Especially when the DNA unit fragments are fractionated by electrophoresis, the DNA unit fragments can be recovered in a single session of fractionation and, as a result, operation efficiency is further enhanced. However, when there are multiple groups of the DNA unit fragments, fractionation is conducted for each group. When the DNA unit fragments are recovered, the recovered amounts can vary between different groups. Accordingly, the numbers of moles of DNA unit fragments that have been made substantially the same can also vary. For this reason, the number of groups each for a single restriction enzyme to be used for removal of the corresponding auxiliary sequence is preferably small, in other words, the number of kinds of restriction enzymes to be used for removal of the corresponding auxiliary sequence is preferably small. The number of kinds of restriction enzymes to be used is preferably not greater than 5, more preferably not greater than 3, and most preferably 1. Specifically, when only a single kind of restriction enzyme is used, all the solutions containing DNA unit fragments can be mixed together, leading to significant enhancement in operation efficiency and then to decreased probability of variation occurring in the number of moles of DNA unit fragments that have been made substantially the same. The number of moles of many DNA unit fragments are made substantially the same when mixed together, and therefore these many DNA unit fragments can be joined together as described above with a restriction enzyme.
(52) When a Type IIS restriction enzyme recognition sequence is added to the sequence of the DNA unit fragment, the Type IIS restriction enzyme to be used is selected so that it recognizes none of the sequences of the DNA unit fragments in the same group. In other words, when a certain Type IIS restriction enzyme is used, each restriction enzyme recognition is designed such that the Type IIS restriction enzyme does not recognizes the sequence of one DNA unit fragment but recognizes the sequence of another DNA unit fragment, a different Type IIS restriction enzyme is selected for the another DNA unit fragment. In case of such design, different Type IIS restriction enzymes are used for different DNA unit fragments, and that the DNA unit fragments can then be divided into groups each for a different Type IIS restriction enzyme. If a Type IIS restriction enzyme is available that recognizes none of the sequences of the DNA unit fragments used, the recognition sequence of the Type IIS restriction enzyme can be added to the DNA unit fragments so that the corresponding auxiliary sequences can be removed from the DNA unit fragments all at once with the single Type IIS restriction enzyme.
(53) The step of joining the DNA vector and the DNA unit fragment is not particularly limited, but can be conducted by, after restriction enzyme treatment, fractionating the DNA unit fragment from its corresponding auxiliary sequence treated with the restriction enzyme and then joining the DNA unit fragment thus fractionated and the DNA vector with DNA ligase or the like (ligation). In this way, a DNA concatemer to be used for microbial transformation can be constructed. It is noted that the DNA unit fragment used in the joining step has no restriction enzyme recognition sequence added thereinto.
(54) The method of fractionation between the DNA unit fragment and its corresponding auxiliary sequence is not particularly limited. It is preferable that the molar ratio between the DNA unit fragments is maintained after restriction enzyme treatment, and agarose gel electrophoresis is specifically preferable.
(55) The method of joining the DNA unit fragment and the DNA vector is not particularly limited, but the joining is preferably conducted in the presence of polyethylene glycol and a salt. The salt is more preferably a monovalent alkali metal salt. More specifically, the joining is further preferably conducted in a ligation reaction solution containing 10% polyethylene glycol 6000 and 250-mM sodium chloride. The concentration of each DNA unit fragment in the ligation reaction solution is not particularly limited, but is preferably not lower than 1 fmol/l. The reaction temperature and the reaction time for ligation are not particularly limited, but are preferably 37 C. and for 30 minutes or longer. Preferably, the concentration of the DNA vector in the ligation reaction solution is measured before reaction and then the number of moles of the DNA vector and the number of moles of the DNA unit fragment are adjusted to be the same.
(56) The method of preparing a DNA concatemer according to the present invention may or may not comprise, and preferably comprise a step of, based on a relation between the yield of a DNA fragment comprising a target number of DNA unit fragments joined together and a coefficient of variation for the concentration of this DNA fragment (hereinafter in the present specification, the coefficient is called coefficient of variation 1) (hereinafter in the present specification, the relation is called relation), the yield being equal to the product of the number of DNA unit fragments per assembly unit and the number of the more than one assembly unit, adjusting a coefficient of variation for the concentrations of the DNA vector and each DNA unit fragment (hereinafter in the present specification, the coefficient is called coefficient of variation 2) in the joining step. It is noted that the coefficient of variation 1 is a coefficient of variation used in the relation for convenience, and the coefficient of variation 2 is the coefficient of variation for the concentrations of each DNA unit fragment and the DNA vector in the actual joining step. By including this adjustment step, the coefficient of variation 2 is adjusted to fall within the range shown by the relation, a desired number of DNA unit fragments (for example, 50 DNA unit fragments) can be joined in the joining step.
(57) The target number of DNA unit fragments joined together refers to the number of DNA fragments intended to be joined in the joining step, and more specifically refers to the product of the number of DNA unit fragments per assembly unit to be joined and the number of the more than one assembly unit. The yield of a DNA fragment comprising a target number of DNA unit fragments joined together refers to the proportion of the number of DNA fragments per DNA assembly unit joined together to the total number of DNA fragments used for joining.
(58) The relation according to the present invention is a formula showing the relationship between the yield of a DNA fragment comprising a target number of DNA unit fragments joined together and the coefficient of variation 1. A formula determined by computer simulation of ligation, for example, can be used. More specifically, the relation can be obtained by conducting simulation of ligation, for example, for each of DNA unit fragment groups having a coefficient of variation 1 varying by 1% starting from 0% to 20% (10 to 30 groups, for example), determining the distribution of the number of DNA unit fragments per each resulting DNA concatemer (exponential distribution, for example), plotting a fitting curve of the resulting distributions, and using the fitting curve. A specific tool for use in ligation simulation is not particularly limited and a conventional known means can be used. For example, VBA (Visual Basic for Applications) of spreadsheet software Excel (registered trademark) 2007 can be used for programming as well as constructing algorithms to conduct simulation. The fitting curve can be plotted, for example, with a function of spreadsheet software Excel (registered trademark) 2007 that helps plotting exponential approximation curves. Adjustment of the coefficient of variation 2 based on the relation can be conducted, for example, after designing the relation, by substituting the yield of a target DNA fragment into the relation thus obtained, and adjusting the process in each pre-joining step so that the DNA fragment being joined has a coefficient of variation 1 equal to the thus-calculated coefficient of variation 1. The method of adjustment is not particularly limited. For example, the adjustment may be conducted by selecting, in a step such as the step of preparing the DNA vector, the step of preparing the DNA unit fragment, and/or the step of joining the DNA vector and the DNA unit fragment together, a measuring instrument (a spectrophotometer, a spectrofluorophotometer, or a real-time PCR apparatus, for example), that has its measurement errors known in advance for use in determining the concentration of the DNA vector or the DNA unit fragment in order to obtain the desired coefficient of variation 2.
(59) The coefficient of variation 2 is not particularly limited. As the variation in the concentrations of the DNA unit fragments being joined is reduced, the number of DNA unit fragments that can be joined increases. Therefore, the coefficient of variation 2 is preferably not greater than 20%, more preferably not greater than 15%, further preferably not greater than 10%, further more preferably not greater than 8%, and most preferably not greater than 5%.
(60) The method of preparing a DNA concatemer of the present invention may further comprise a step of inactivating the restriction enzyme after the removal step and before the joining step. A certain DNA unit fragment can have a restriction enzyme cleavage site that is the same as a restriction enzyme cleavage site for separating another DNA unit fragment from its corresponding auxiliary sequence. In this case, it is difficult to mix together different DNA unit fragment groups with their corresponding auxiliary sequences attached thereto while the restriction enzyme or enzymes are still active. Accordingly, the DNA unit fragments cannot be fractionated in a single session by combining these DNA unit fragment groups together. In contrast, when the restriction enzyme or enzymes have been inactivated, different DNA unit fragment groups with their corresponding auxiliary sequences attached thereto can be combined together after the inactivation, and, as a result, the DNA unit fragments can be fractionated in a single session. This advantage makes it easier to construct a DNA concatemer comprising even a greater number of DNA assemblies in the joining step, and, as a result, makes it easier to transform Bacillus subtilis. Inactivation of the restriction enzymes can be conducted by a well-known conventional method, for example, phenol-chloroform treatment.
(61) The host microorganism to be transformed is not particularly limited provided that it has ability to undergo spontaneous transformation. Examples of the ability to undergo spontaneous transformation include ability to process DNA into a single strand prior to taking it up. Specific examples of the host microorganism include bacteria of the genus Bacillus, bacteria of the genus Streptococcus, bacteria of the genus Haemophilus, abacteria of the genus Neisseria, and the like. Examples of the bacteria of the genus Bacillus include B. subtilis (Bacillus subtilis), B. megaterium (Bacillus megaterium), B. stearothermophilus (Bacillus stearothermophilus), and the like. Examples of the most preferable microorganisms, among these, include Bacillus subtilis that has excellent ability to undergo spontaneous transformation and recombination.
(62) The DNA concatemer constructed by the method of the present invention can be used for microbial cell transformation. The method of giving competency to a microorganism that is to be transformed can be a known method that is suitable for the selected microorganism. Specifically, for Bacillus subtilis, a method described in Anagnostopoulou, C. and Spizizen, J. J. Bacteriol., 81, 741-746(1961) is preferably used. Similarly, as the method of transformation, a known method that is suitable for the selected microorganism can be used. The amount of ligation product solution to give to the competent cell is not particularly limited, but is preferably from 1/20 to 20/20 and more preferably half the amount of the competent cell culture. The method of purifying the resulting plasmid from the transformant can also be a known method.
(63) The presence of DNA assemblies in the plasmid purified from the transformant can be confirmed by checking the size-based patterns of fragments cleaved by a restriction enzyme or enzymes, PCR, or base sequencing. When the DNA insert for a substance-producing function, it can be confirmed by detecting the function.
EXAMPLES
(64) The present invention will be described below more specifically by examples. The examples merely illustrate embodiments of the present invention, and therefore do not limit the scope of the present invention.
(65) (Materials)
(66) The microbial cells used for transformation were Bacillus subtilis cells. The strains of Bacillus subtilis used were strain RM125 (Uozumi, T., et al. Moi. Gen. Genet., 152, 65-69(1977)) and its derivative strain BUSY9797. As a DNA vector capable of replication in Bacillus subtilis, pGETS118-AarI-pBR (see SEQ ID NO:1) constructed as described below by using pGET118 (Kaneko, S., et al. Nucleic Acids Res. 31, e112 (2003)) as well as pGETS151-pBR (see SEQ ID NO:2) were used. As a DNA assembly, lambda phage DNA (manufactured by Toyobo Co., Ltd.) (see SEQ ID NO:3) and an artificial operon of the mevalonate pathway described below (see SEQ ID NO:4) were used. For selecting an Escherichia coli having a DNA plasmid into which a DNA unit fragment is incorporated, the antibiotic carbenicillin (Wako Pure Chemical Industries, Ltd.) was used. For selecting Bacillus subtilis, the antibiotic tetracycline (Sigma) was used. As a Type IIS restriction enzyme, AarI (Thermo), BbsI (NEB), BsmBI (NEB), and SfiI (NEB) were used. The restriction enzymes HindIII, PvuII, and T4 DNA Ligase used were manufactured by Takara Bio Inc. For ligation that was normally conducted for constructing an Escherichia coli plasmid, Takara Ligation Kit (Mighty) (Takara Bio Inc.) was used. For PCR reaction for preparing a DNA unit fragment, KOD plus polymerase manufactured by Toyobo Co., Ltd. was used. For colony PCR for base sequencing DNA cloned in a plasmid, Ex-Taq HS manufactured by Takara Bio Inc. was used. As a DNA plasmid that was a corresponding auxiliary sequence to be attached to a DNA unit fragment, pMD-19 (simple) (Takara Bio Inc.) was used. The enzyme used for purifying a circular plasmid was Plasmid Safe manufactured by EPICENTRE. As the agarose gel for electrophoresis, 2-Hydroxyethyl agarose (Sigma), which was agarose gel for DNA electrophoresis having low melting temperature, or UltraPure Agarose (Invitrogen Limited) was used. For inactivation of a restriction enzyme, phenol:chloroform:isoamyl alcohol 25:24:1 and TE saturated phenol (containing 8-quinolinol) manufactured by Nacalai Tesque, Inc. were used. The lambda terminase used was manufactured by EPICENTRE. For lambda phage packaging, Gigapack III Plus Packaging Extract from Agilent Technologies was used. The lysozyme used was manufactured by Wako Pure Chemical Industries, Ltd. The medium component of the LB medium and the agar-agar manufactured by Becton, Dickinson and Company were used. The IPTG (isopropyl s-D-thiogalactopyranoside) used was manufactured by Wako Pure Chemical Industries, Ltd. All the medium components and biochemical reagents other than those described above manufactured by Wako Pure Chemical Industries, Ltd were used. For construction of a plasmid other than those particularly mentioned, one of Escherichia coli strains DHSa, JM109, and TOP10 was used. For purification of a small amount of constructed plasmid from Escherichia coli, QIAprep Spin Miniprep Kit from QIAGEN was used, while for purification of a large amount, QIAfilter Midi Kit from QIAGEN was used. For DNA cleanup from an enzymatic reaction solution, MinElute Reaction Cleanup Kit from QIAGEN or QIAquick PCR purification Kit from QIAGEN was used. For purification of a gel block resulting from ordinary agarose gel electrophoresis separation, MinElute Gel Extraction Kit from QIAGEN was used. As a spectrophotometer for trace amount detection, nano-drop 2000 from Thermo was used. For base sequencing, the automated fluorescence sequencer 31301 Genetic Analyzer manufactured by Applied Biosystems Inc. was used. Other common DNA handling was conducted according to a standard protocol (Sambrook, J., et al., Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989)). Bacillus subtilis transformation and plasmid extraction were conducted according to a known method (Tsuge, K., et al., Nucleic Acids Res. 31, e133. (2003)).
(67) (Construction of DNA Vector used in Assembly)
(68) The DNA vector used in lambda phage DNA assembly, pGETS118-AarI-pBR (SEQ ID NO:1), was a plasmid constructed through multiple steps starting from the Escherichia coli-Bacillus subtilis shuttle plasmid vector pGETS118 harboring an origin of replication in Escherichia coli F factor, oriS, and an origin of replication in Bacillus subtilis, repA (Kaneko, et. al., Nucleic Acids Res., 31,e112. (2003)). The structure thereof is shown in
(69) (Designing DNA Unit Fragment's Border Regions)
(70) The number of different combinations of 4-base protruding was 4 raised to the 4th power, which was equal to 256. From these, protruding sequences used in the present invention were selected according to the following criterion. First, all the 16 palindromic sequences (Group 0) (AATT, ATAT, TATA, TTAA, CCGG, CGCG, GCGC, GGCC, ACGT, AGCT, TCGA, TGCA, CATG, CTAG, GATC, GTAC) were excluded because their complementary sequences had the same sequences as their own and therefore there was a possibility that identical fragments would join together, which was not appropriate in the present invention. The remaining 240 sequences included both a certain sequence (CCTA, for example) and its complementary sequence (TAGG), and therefore the theoretical number of combinations of protruding sequences applicable to DNA concatenation was 240/2=120 combinations. Then, based on the GC content and the appearance order in which the constituent G and C bases were aligned, these combinations were divided into groups of combinations of protruding ends as follows. (Group I) 6 combinations of protruding ends consisting of A and T alone (AAAA/TTTT, TAAA/TTTA, ATAA/TTAT, AATA/TATT, AAAT/ATTT, ATTA/TAAT). (Group II) All 32 combinations consisting of 3 bases selected from A and T and 1 base selected from C and G (CAAA/TTTG, ACAA/TTGT, AACA/TGTT, AAAC/GTTT, GAAA/TTTC, AGAA/TTCT, AAGA/TCTT, AAAG/CTTT, CAAT/ATTG, ACAT/ATGT, AACT/AGTT, AATC/GATT, GAAT/ATTC, AGAT/ATCT, AAGT/ACTT, AATG/CATT, CATA/TATG, ACTA/TAGT, ATCA/TGAT, ATAC/GTAT, GATA/TATC, AGTA/TACT, ATGA/TCAT, ATAG/CTAT, CTTA/TAAG, TCTA/TAGA, TTCA/TGAA, TTAC/GTAA, GTTA/TAAC, TGTA/TACA, TTGA/TCAA, TTAG/CTAA). (Group III) 44 combinations, left by subtracting 8 palindromic combinations from all 52 combinations consisting of 2 bases selected from A and T and 2 bases selected from C and G (AACC/GGTT, AACG/CGTT, AAGC/GCTT, AAGG/CCTT, ACAC/GTGT, ACAG/CTGT, ACCA/TGGT, ACCT/AGGT, ACGA/TCGT, ACTC/GAGT, ACTG/CAGT, AGAC/GTCT, AGAG/CTCT, AGCA/TGCT, AGGA/TCCT, AGTC/GACT, AGTG/CACT, ATCC/GGAT, ATCG/CGAT, ATGC/GCAT, ATGG/CCAT, CAAC/GTTG, CAAG/CTTG, CACA/TGTG, CAGA/TCTG, CATC/GATG, CCAA/TTGG, CCTA/TAGG, CGAA/TTCG, CGTA/TACG, CTAC/GTAG, CTCA/TGAG, CTGA/TCAG, CTTC/GAAG, GAAC/GTTC, GACA/TGTC, GAGA/TCTC, GCAA/TTGC, GCTA/TAGC, GGAA/TTCC, GGTA/TACC, GTCA/TGAC, GTGA/TCAC, TCCA/TGGA). (Group IV) 16 combinations with no 3 consecutive bases selected from C and G, out of all 32 combinations consisting of 1 base selected from A and T and 3 bases selected from C and G (CACC/GGTG, CCAC/GTGG, CTCC/GGAG, CCTC/GAGG, CACG/CGTG, CCAG/CTGG, CTCG/CGAG, CCTG/CAGG, CAGC/GCTG, CGAC/GTCG, CTGC/GCAG, CGTC/GACG, GAGC/GCTC, GGAC/GTCC, GTGC/GCAC, GGTC/GACC). (Group V) All 16 combinations with 3 consecutive bases selected from C and G, out of all 32 combinations consisting of 1 base selected from A and T and 3 bases selected from C and G (ACCC/GGGT, CCCA/TGGG, TCCC/GGGA, CCCT/AGGG, ACCG/CGGT, CCGA/TCGG, TCCG/CGGA, CCGT/ACGG, ACGC/GCGT, CGCA/TGCG, TCGC/GCGA, CGCT/AGCG, AGGC/GCCT, GGCA/TGCC, TGGC/GCCA, GGCT/AGCC). (Group VI) All 6 combinations consisting of bases selected from C and G alone (CCCC/GGGG, GCCC/GGGC, CGCC/GGCG, CCGC/GCGG, CCCG/CGGG, CGGC/GCCG).
(71) Boundaries between a DNA vector and a DNA unit fragment in Examples 1 and 2 were selected from Group 1 among the groups divided as above. Boundaries between two DNA unit fragments as candidates were selected from 60 combinations in total of protruding ends included in Group III (44 combinations) and Group IV (16 combinations). Selection of a combination of protruding ends was conducted by determining the full-length final base sequence made up by the sequences to be assembled and then determining ideal dividing boundaries that divided the full-length base sequence into equal parts. The base sequence used in Example 1 is described below referring to specific examples.
(72) Example 1 is an experiment of reconstruction of a 48522-bp molecule consisting of the 48502-bp full-length lambda phage genome, to which a 16-bp cos site and a 4-bp protruding sequence required for assembly are added. Table 1 below shows ideal dividing boundaries and actual dividing boundaries within DNA assemblies and protruding base sequences of the DNA assemblies in Example 1. Reconstruction was attempted by first dividing the molecule devoid of a plasmid vector for assembly into 50 DNA unit fragments having substantially the same size, and then joining these 50 DNA unit fragments together. Ideally, all of the 50 fragments are divided to have the same length. In order to avoid changing any base in the sequences to be assembled, it was necessary to construct 5 end protruding of 4 bases to be used for assembly, depending on the originally existing sequence. In reality, there was almost no chance that each single one of the ideal dividing boundaries had one of the protruding sequences described above, which means that it was impossible to divide the original sequence into equal DNA unit fragments at the ideal dividing boundaries. Therefore, in this example, in order to make the size of the unit as close to the size of the ideal dividing unit as possible, simulation was conducted to assign a protruding-end combination to each boundary. The simulation was conducted as follows: first, the full-length original molecule (48522 bp) was divided into 50 equal-sized ideal DNA unit fragments of 970 bp, which were then named as Fragment No. 01, Fragment No. 02, Fragment No. 03, . . . , and Fragment No. 50 in order of increasing absolute base number; and, then, the presence of any 4-base protruding end candidate was searched for within a 4-base sequence that extended the same distance from an absolute position of each ideal boundary (the ideal dividing boundaries lay between the 970th base and the 971th base, between the 1940th base and the 1941th base, between the 2910th base and the 2911th base, . . . , and between the 47530th base and the 47531th base), with the 4-base sequence being sequentially enlarged by 1 base at a time to each side of the ideal dividing boundary, namely, the 4-base sequence becoming sequentially enlarged to a 6-base sequence, an 8-base sequence, a 10-base sequence, a 12-base sequence, a 14-base sequence, a 16-base sequence, an 18-base sequence, a 20-base sequence, a 22-base sequence, and a 24-base sequence. This procedure is explained in the following specific example (Table 1). The ideal dividing boundary between Fragment No. 01 and Fragment No. 02 lay between the 970th base and the 971th base. Within the 16-base sequence extending the same distance from the ideal dividing boundary (the base sequence from the 963th base to the 988th base, namely, 5-ATGCTGCTGGGTGTTT-3), 7 protruding-end combination candidates were found (ACAC/GTGT, AGCA/TGCT, ATGC/GCAT, CACC/GGTG, CAGC/GCTG, CCAG/CTGG, CTGC/GCAG). This procedure was conducted for all the 49 ideal dividing boundaries, in an attempt to find at least one protruding sequence candidate within each base sequence of a certain length lying near each of the ideal dividing boundaries. When the length was extended to 24 bp, each base sequence had at least one 4-base protruding sequence candidate. Then, for each base sequence, a specific protruding sequence was selected from the protruding candidates, as follows: the least common protruding-end combination found (or not taken yet) in all of the (remaining) base sequences was assigned, preferentially, to the base sequence with the least number of protruding-end combination candidates; and this procedure was repeated so that a unique protruding-end combination was assigned to all the boundaries.
(73) TABLE-US-00001 TABLE1 Ideal Pro- Comple- dividing 60Basesnearidealdividingboundary(| indicateseach Actual truding mentary boundary idealdividingboundary dividing sequence sequence 1|1 tgagacgtctcggcctgtttggccattaCG|GGGCGGCGACCTCGCGGGTTTTCGCTATTT 7/6 ATTA TAAT 970|971 TGCCCGTGTCGGTTATTCCAAAATGCTGCT|GGGTGTTTATGCCTACTTTATAGACCATAA 962/963 ATGC GCAT 1940|1941 GACTCCCAGCTGGACCGCTACGAAATGCGC|GTATGGGGATGGGGGCCGGGTGAGGAAAGC 1942/1943 ATGG CCAT 2910|2911 ACATCGCTGCGCGAATATGCCGGTTATCAC|GGCGGTGGCAGCGGATTTGGAGGGCAGTTG 2907/2908 CACG CGTG 3880|3881 TGAACCTGCAGACGGCTCAGGATACGGATA|ACGGCTACTCCGTGTTTGAGCAGTCACTGC 3879/3880 AACG CGTT 4850|4851 GGATGGTGGCGGGGGCATTTGACTGCGCTG|ACATCATCGCCCGTGTGCGTGACATAAAAC 4847/4848 CTGA TCAG 5820|5821 CAGTGACCCGGCTCATACCGCAACCGCGCC|CGGCGGATTGAGTGCGAAAGCGCCTGCAAT 5824/5825 GGAT ATCC 6790|6791 TTCCTTCAAAGCCGTCAAGGAGAAGCTGGA|TACCCGTCGTGGCTCTAATTCCGAGCTGGA 6790/6791 TACC GGTA 7760|7761 TGGTGTTTTTGATGACCCTGAAAATATCAG|CTATGCCGGACAGGGCGTGCGCGTTGAAGG 7759/7760 GCTA TAGC 8730|8731 CGAAGAGCTGGACAGCGATACCTGGCAGGC|GGAGCTGCATATCGAAGTTTTCCTGCCTGC 8731/8732 GAGC GCTC 9700|9701 AGAAATTACCGTCACCGCCAGTTAATCCGG|AGAGTCAGCGATGTTCCTGAAAACCGAATC 9700/9701 AGAG CTCT 10670|10671 GAAAGTGATGCGAAAAAAACAGCGGCAGTC|GTTGAACAGTCGCTGAGCCGACAGGCGCTG 10666/10667 AGTC GACT 11640|11641 GGGATGATCGTGAAAAGGCCCGTCTTGCGC|TTGAAGCCGCCCGAAAGAAGGCTGAGCAGC 11642/11643 GAAG CTTC 12610|12611 CACCCGTTCCGTGCTGTCCATGATGACAGA|AATTCTGCTTAAGCAGGCAATGGTGGGGAT 12606/12607 CAGA TCTG 13580|13581 GCAGAACGAAAAAGGTGAGCCGGTCACCTG|GCAGGGGCGACAGTATCAGCCGTATCCCAT 13577/13578 CTGG CCAG 14550|14551 TCTGGCGGGGATTGAGATGCCGGACTTTGA|TCGTGAGGATGACTGGTGGCGTAACGGCCA 14550/14551 TCGT ACGA 15520|15521 ATGGAGCGTGAGGAATGGGTAAAGGAAGCA|GTAAGGGGCATACCCCGCGCGAAGCGAAGG 15516/15517 AGCA TGCT 16490|16491 GGAGCCGCGCATCACCTGTAATGCGTACCT|GACCACACAGCGTAAGGCGTGGGATGTGCT 16487/16488 CCTG CAGG 17460|17461 ACACCGAAGGTGGTGAAGGGCGTGAGTTTC|CTGCTGCGTCTGACCGTAACAGCGGACGAC 17452/17453 TGAG CTCA 18430|18431 TGAATGCGAACTCCGGGACGCTCAGTAATG|TGACGATAGCTGAAAACTGTACGATAAACG 18428/18429 TGTG CACA 19400|19401 TGGATTACCGTAAGACGGAAATCACTCCCG|GGTATATGAAAGAGACGACCACTGCCAGGG 19394/19395 CTCC GGAG 20370|20371 AGGCCGCCACTTCAGCACGAGATGCGGTGG|CCTCAAAAGAGGCAGCAAAATCATCAGAAA 20366/20367 GTGG CCAC 21340|21341 TTTGACAAATCAGCCTACCCAAAACTTGCT|GTCGCGTATCCATCGGGTGTGCTTCCTGAT 21340/21341 GTCG CGAC 22310|22311 AGGGGAATATCAGAAGTGGAACGGCACAGC|CTGGGTGAAGGATACGGAAGCAGAAAAACT 22303/22304 GCAC GTGC 23280|23281 AATGACAATTTGCTTATGGAGTAATCTTTT|AATTTTAAATAAGTTATTCTCCTGGCTTCA 23268/23269 GAGT ACTC 24250|24251 GGGTGTTGAATGATTTCCAGTTGCTACCGA|TTTTACATATTTTTTGCATGAGAGAATTTG 24243/24244 CTAC GTAG 25220|25221 ACTACTAAGGTTGTAGGCTCAAGAGGGTGT|GTCCTGTCGTAGGTAAATAACTGACCTGTC 25220/25221 GTCC GGAC 26190|26191 TCCAATATAAAAGTATTGTGTACCTTTTGC|TGGGTCAGGTTGTTCTTTAGGAGGAGTAAA 26192/26193 GGTC GACC 27160|27161 TCTGCTTCCTTTTGGATAACCCACTGTTAT|TCATGTTGCATGGTGCACTGTTTATACCAA 27152/27153 ACTG CAGT 28130|28131 TTATCAAGTGTTTCCTTCATTGATATTCCG|AGAGCATCAATATGCAATGCTGTTGGGATG 28128/28129 CGAG CTCG 29100|29101 AAGTACATCGCAAAGTCTCCGCAATTACAC|GCAAGAAAAAACCGCCATCAGGCGGCTTGG 29096/29097 ACAC GTGT 30070|30071 CAGGATGGCGAACAACAAGAAACTGGTTTC|CGTCTTCACGGACTTCGTTGCTTTCCAGTT 30071/30072 GTCT AGAC 31040|31041 CTGGTTTCTCTCATCTGCTTCTGCTTTCGC|CACCATCATTTCCAGCTTTTGTGAAAGGGA 31041/31042 ACCA TGGT 32010|32011 AGCTCTCACATCGATCCCGGTACGCTGCAG|GATAATGTCCGGTGTCATGCTGCCACCTTC 32008/32009 AGGA TCCT 32980|32981 GCGTTGCAAATGATCGATGCATAGCGATTC|AAACAGGTGCTGGGGCAGGCCTTTTTCCAT 32984/32985 AGGT ACCT 33950|33951 AGATAAAAAATCGCCCTCACACTGGAGGGC|AAAGAAGATTTCCAATAATCAGAACAAGTC 33942/33943 TGGA TCCA 34920|34921 TTGAGCTTGGTGTGTTGAACAAAACTTTTT|CCCGATGGAATGGAAAGCATATATTATTCC 34918/34919 TTCC GGAA 35890|35891 AACAAGGATGCATATATGAATGAACGATGC|AGAGGCAATGCCGATGGCGATAGTGGGTAT 35894/35895 GCAA TTGC 36860|36861 AACAAAAAAGATGGGAATCCCAATGATTCG|TCATCTGCGAGGCTGTTCTTAATATCTTCA 36858/36859 CGTC GACG 37830|37831 CCTGACTGCCCCATCCCCATCTTGTCTGCG|ACAGATTCCTGGGATAAGCCAAGTTCATTT 37822/37823 TGTC GACA 38800|38801 ACGCCAGACTATCAAATATGCTGCTTGAGG|CTTATTCGGGCGCAGATCTGACCAAGCGAC 38804/38805 TTCG CGAA 39770|39771 AGCCTGGCTAACCGTGACCAGAACGAAGTG|AACGAAATCCGTCGCCAGTGGGTTCTGGCT 39760/39761 GAAC GTTC 40740|40741 AAATCCTTCCAGACCCAACCAAACCAATCG|TAGTAACCATTCAGGAACGCAACCGCAGCT 40738/40739 CGTA TACG 41710|41711 GCCTGCAAAGATGAGGAGGGATTGCAGCGT|GTTTTTAATGAGGTCATCACGGGATCCCAT 41704/41705 CAGC GCTG 42680|42681 TTAAAGCCCCGCAGTTACTGGATTAAACAA|GCCCAACAAGCCGTAAACGCCTTCATCAGA 42682/42683 CCAA TTGG 43650|43651 AAAAATATGTTATCTGCCACGCCGATTATC|CCTTTGACGAATACGAGTTTGGAAAGCCAG 43650/43651 CCTT AAGG 44620|44621 ATGGGTTAATTCGCTCGTTGTGGTAGTGAG|ATGAAAAGAGGCGGCGCTTACTACCGATTC 44614/44615 AGTG CACT 45590|45591 CGGACGTCAGAAAACGAGAAATCATGGTTA|TGACGTCATTGTAGGCGGAGAGCTATTTAC 45590/45591 TGAC GTCA 46560|46561 TACGAATGTTTGCTGGGTTTCTGTTTTAAC|AACATTTTCTGCGCCGCCACAAATTTTGGC 46559/46560 CAAC GTTG 47530|47531 TTTTATCGTTTCAATCTGGTCTGACCTCCT|TGTGTTTTGTTGATGATTTATGTCAAATAT 47528/47529 CTTG CAAG 48500|48501 ACGGGTCCTTTCGGGTGATCCGACAGGTTA|CGGGGCGGCGACCTCGaaaaggccttcttg 48516/48517 AAAA TTTT
Example 1, Construction of Lambda Phage Point Mutant with Assembly Comprising 50 DNA Unit Fragments and DNA Vector
(74) <Lambda Phage>
(75) A lambda phage is a bacteriophage that infects Escherichia coli, and is studied in the molecular biology field the most widely among other phages. Its genome is 48502-bp double-stranded DNA at its full-length, and the entire base sequence has been identified. It has various variants, many of which have been identified. In this example, construction of a lambda phage point mutant from a short DNA unit fragment of about 1 kb was attempted.
(76) <Division Design of Lambda Phage Genome>
(77) As a lambda phage, phage DNA manufactured by Toyobo Co., Ltd. was used. This product had a linear cos site. The full-length genome sequence of the phage was sequenced (SEQ ID NO:3), revealing 6 differences (g.138delG, g.14266_14267insG, g.37589C>T, g.37743C>T, g.43082G>A, g.45352 G>A) from a base sequence registered in the database (Accession No. J02459.1) (the full-length sequence shown under SEQ ID NO:3 had a size of 48526 bp, consisting of 48522 by as described above and 4 bases of the other protruding end). In order to divide this 48522-bp full-length base sequence (including duplicated cos sites) into parts having substantially the same length, ideal dividing boundaries were designated every 970 bp, followed by the procedure described above in (Designing DNA unit fragment's dividing regions). As a result, a unique 5 protruding end that was a 4-base sequence to the right of a corresponding cleavage site was successfully assigned to each DNA unit fragment group, as shown in Table 1.
(78) <Selection of Kind of Restriction Enzyme for Forming Protruding End>
(79) Examples of a Type IIS restriction enzyme for forming an arbitrary 4-base protruding sequence include AarI (5-CACCTGC(N)4/-3,5-/(N)8 GCAGGTG-3), BbsI (5-GAAGAC(N)2/-3,5-/(N)6 GTCTTC-3), BbvI (5-GCAGC(N)8/-3,5-/(N)12 GCTGC-3), BcoDI (5-GTCTCN/-3,5-/(N)5 GAGAC-3), BfuAI (5-ACCTGC(N)4/-3,5-/(N)8 GCAGGT-3), BsaI (5-GGTCTCN/-3,5-/(N)5 GAGACC-3), BsmAI (a BcoDI isoschizomer), BsmBI (5-CGTCTCN/-3,5-/(N)5 GAGACG-3), BsmFI (5-GGGAC(N)10/-3,5-/(N)14 GTCCC-3), BspMI (a BfuAI isoschizomer), BtgZI (5-GCGATG(N)10/-3,5-/(N)14CATCGC-3), FokI (5-GGATG(N)9/-35-/(N)13CATCC-5), and SfaNI (5-GCATC(N)9/-3,5-/(N)13 GATGC-5). These restriction enzymes were screened for any restriction enzyme that did not have its recognition site in an Escherichia coli plasmid vector used for gene fragment subcloning (pMD19, Simple, TAKARA), or any restriction enzyme that had its recognition site in there but was capable of forming a fragment longer enough or shorter enough than the ideal dividing unit. As a result, a total of 6 kinds of restriction enzyme candidates were found, including 5 restriction enzymes (AarI, BbsI, BfuAI, BsmFI, and BtgZI) that did not had no cleavage and 1 restriction enzyme (BsmBI) that had its recognition sequence in the vector but was capable of forming a fragment longer enough or shorter enough than the ideal dividing unit. As for these restriction enzyme site candidates, the distribution of the restriction enzyme site within the entire lambda phage, namely, across Fragment No. 01 to Fragment No. 50 was searched. As a result, each of these restriction enzymes had its restriction enzyme recognition sites within the lambda phage genome, namely, 12 sites for AarI, 24 sites for BbsI, 41 sites for BfuAI, 38 sites for BsmFI, 45 sites for BtgZI, and 14 sites for BsmBI. Then, for each DNA unit fragment, a restriction enzyme that did not cleave inside the DNA unit fragment itself was used. It was confirmed that it is sufficient that the fewest number of the kinds of restriction enzymes to be used was only 3, namely, BbsI, AarI, and BsmBI. Each of these Type IIS restriction enzymes was assigned for cleaving a certain group of DNA unit fragments, as follows.
(80) The group of fragments to be cleaved with BbsI consisted of Fragments Nos. 01 to 08, 12, 16 to 22, 24, 27, 28, 33 to 39, 43, and 45 to 50, a total of 33 fragments; the group to be cleaved with AarI consisted of Fragments Nos. 09 to 11, 13, 23, 25.30, 32, and 44, a total of 9 fragments; and the group to be cleaved with BsmBI consisted of Fragments Nos. 14, 15, 26, 29, 31, and 40 to 42, a total of 8 fragments.
(81) <Cloning of Gene Fragment>
(82) All of the 50 fragments, from Fragment No. 01 to Fragment No. 50, were amplified from the full-length lambda phage genome by PCR. First, to the 5 end of a primer for amplifying a DNA sequence between combinations of protruding-end sequences determined above, a corresponding restriction enzyme recognition site among those determined above was attached so that a protruding end was to be formed at the intended position. Then, to the resulting 5 end, a primer to which a TAG sequence was further attached was used. A pair of these primers made in this way was used to amplify a certain DNA fragment in the specified region from the full-length lambda phage genome. PCR reaction was allowed to proceed under the conditions where 50 l for one cycle consisted of 5 l of KOD Plus 10 buffer Ver.2, 3 l of 25-mM MgSO4, 5 l of dNTP (2 mM each), 1 l of KOD Plus (1 unit/l), 48 g of lambda phage DNA (Toyobo Co., Ltd.), 15 pmol of primers (an F primer and an R primer respectively), and sterilized water, and on a GeneAmp PCR System 9700 (Applied Biosystems Inc.) programmed as follows.
(83) One cycle consisted of incubation at 94 C. for 2 mM, at 98 C. for 10 s, 55 C. for 30 s, and then at 68 C. for 1 min. The cycle was repeated 30 times, followed by incubation at 68 C. for 7 mM The amplified DNA unit fragments were separated in 1% agarose gel (UltraPure Agarose, Invitrogen Ltd.) made of 1TAE buffer (prepared by diluting Tris-acetate-EDTA stock buffer (50 concentrated) pH8.3 (at 25 C.) manufactured by Nacalai Tesque, Inc. 50 times with milliQ water) containing 2 mg/ml of Crystal Violet (Wako Pure Chemical Industries, Ltd.), on an electrophoresis system (i-MyRun. NC, Cosmo Bio Co., Ltd.) at a voltage of 100 V for 10 mM of electrophoresis. The DNA band in question was cut out from the electrophoresis gel with a razor to recover as the gel segment weighed about 200 mg. From this gel segment, a DNA unit fragment was purified with a Concert Rapid Gel Extraction System (Life Technologies). The specific procedure was as follows: L1 Buffer having a volume 3 times the weight of the gel segment was added to the gel segment; the gel segment was dissolved at 45 C. in a block incubator for about 10 min; the resulting solution was added into a spin column cartridge supplied (a 2-ml centrifuge tube into which a spin column was attached); centrifugation was conducted at 20,000g for 1 mM and the flow-through was discarded; 750 l of L2 Buffer was then added to the spin column; and centrifugation was conducted at 20,000g for 1 mM and the flow-through was discarded. In order to remove as much residue such as the L2 Buffer remaining in the spin column as possible, the following procedure was conducted: the spin column was centrifuged at 20,000g for 1 mM; the spin column was transferred from the 2-ml centrifuge tube which was discarded to a 1.5-ml centrifuge tube; into the spin column, 30 l of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH8.0) was added; and the spin column was left for 2 mM and was then centrifuged at 20,000g for 1 min to recover a DNA solution. The resulting DNA was preserved at 20 C. until it was used. The resulting DNA unit fragment was cloned into the Escherichia coli plasmid vector by the following TA cloning method.
(84) To 8 l of the DNA unit fragment solution, 1 l of 10 Ex-Taq Buffer that came with TAKARA PCR reaction enzyme Ex-Taq, 0.5 l of 100-mM dATP, and 0.5 l of Ex-Taq was added, followed by incubation at 65 C. at 10 min. As a result, a protrusion of A was added to the 3 end of the DNA unit fragment. To 1 l of the DNA unit fragment solution, 1 l of TAKARA pMD19-Simple and 3 l of sterilized water were added and mixed, and thereto, 5 l of TAKARA Ligation (Mighty) Mix was added, followed by incubation at 16 C. for 30 min A 5-l portion of the ligation solution was added to 50 l of Escherichia coli DHSa chemically competent cell, followed by incubation on ice for 15 min, heat shock at 42 C. for 30 sec, and then being left on ice for 2 min. Thereto, 200 l of an LB medium was added, followed by incubation at 37 C. for 1 h. The culture was streaked onto an LB plate supplemented with carbenicillin (100 g/ml) and containing 1.5% agar-agar, followed by overnight culture at 37 C. As a result, a transformant transformed with the plasmid was obtained. A resulting colony was treated with a PCR template DNA preparation reagent (Cica Geneus DNA preparation reagent, KANTO CHEMICAL CO., INC.), and a PCR template DNA molecule was prepared. Specifically, Reagent a and Reagent b in the reagent kit were mixed in a ratio of 1:10, and into 2.5 l of the resulting solution, a fraction of a colony taken from the plate with a toothpick was suspended, followed by treatment at 72 C. for 6 min and then at 94 C. for 3 min. To the resulting liquid, 2.5 l of TAKARA Ex-Taq 10 enzyme, 2 l of 2.5-mM dNTP solution, 0.25 l of 10-pmol/l M13F primer, 0.25 l of 10-pmol/l M13R primer, 17 l of sterilized water, and 0.5 l of Ex-TaqHS were added, followed by incubation at 94 C. for 5 min. A cycle of incubation at 98 C. for 20 sec, at 55 C. for 30 sec, and at 72 C. for 1 min was repeated 30 times for DNA amplification. The base sequence of the PCR product was analyzed to confirm complete agreement of it with the intended sequence. Consequently, all the clones gave the correct sequences. In this process, one of the variants obtained from Fragment No. 10 was found to have synonymous substitution within its gene-V-coding region (g.9515 G>C). Due to this mutation, in the phage genome, a restriction enzyme AvaI recognition site newly appears (
(85) <High-Purity Purification of Plasmid Harboring DNA Unit Fragment>
(86) Each of the all 50 kinds of Escherichia coli transformants each harboring a plasmid into which a corresponding one of Fragments Nos. 01 to 50 having the intended sequence had been cloned was cultured overnight at 37 C. for 120 spm in 50 ml of an LB medium supplemented with 100 g/ml of carbenicillin. The resulting bacterial cells were subjected to purification with QIAfilter Plasmid Midi Kit (QIAGEN). To 50 l of the resulting crude plasmid solution, 5 l of a 3-M potassium acetate-acetic acid buffer solution (pH5.2) and 125 l of ethanol were added, followed by centrifugation at 20,000g for 10 min for ethanol precipitation of the DNA. The resulting precipitate was rinsed with 70% ethanol, and the residue was removed, followed by re-dissolution in 50 l of TE (pH8.0). A 1-l sample was taken from the crude plasmid solution for measurement of the DNA concentration with a spectrophotometer for trace amount detection (ND-2000, Thermo). The amount of DNA in the crude plasmid solution at this time was about 0.5 g/l to 4 g/l. Referring to the measurement value, 5 g of DNA was taken from each crude plasmid solution and collected into a 1.5-ml tube, into which sterilized water was added so as to achieve a total volume of 50 l. Thereto, 6 l of Plasmid Safe (Epicentre) 10 reaction buffer, 2.4 l of 25-mM ATP solution, and 2 l of Plasmid Safe enzyme solution were added and mixed, followed by incubation at 37 C. for 1 h in the programmable block incubator BI-526T (ASTEC) and then incubation at 75 C. for 30 min for enzyme inactivation. The resulting solution was purified with PCR purification kit (QIAGEN). In the final step of purification with the kit, the DNA adsorbed on the column was eluted off not with the elution buffer that came with the kit but with 25 l of TE buffer (pH8.0) so as to give a highly-pure plasmid solution. The plasmid harboring Fragment No. 01 and the plasmid harboring Fragment No. 21 before and after purification were analyzed by DNA electrophoresis (UltraPure Agarose, Invitrogen Limited), confirming incorporation of the intended fragments (DNA unit fragments) (
(87) <Precisely Adjusting Concentrations of Plasmids each Harboring DNA Unit Fragment, and Combining Equal Moles of Plasmids>
(88) The resulting DNA solution was reanalyzed with a spectrophotometer for trace amount detection so as to determine the concentration of the highly-pure plasmid solution. The concentration of each sample was within the range from about 100 ng/l to 200 ng/l reflecting the degree of purification of the crude plasmid solution, where the theoretical maximum concentration was 200 ng/l. Based on the measurement result, 15 l of each plasmid solution was taken into a 1.5-ml tube, to which TE was added so as to achieve a concentration of each plasmid of 100 ng/l. Reanalysis of the concentration of the resulting highly-pure plasmid solution with a spectrophotometer for trace amount detection showed variation from the target value of 100 ng/l within the range of about several percent. As for each highly-pure plasmid solution, the volume (l) of the solution containing 500 ng of the DNA was accurately calculated to the second decimal place. A portion of the DNA solution in an amount of this volume (about 5 l) was combined with the other such portions that were to be cleaved later with the same kind of restriction enzyme (the BbsI group, the AarI group, and the BsmBI group). Between the portions combined together, the numbers of moles of the DNA unit fragments were adjusted to be substantially the same.
(89) <Cleavage of Same-mole-number Plasmids Combined Together, in One Session with Restriction Enzyme>
(90) The total volume of the combined same-mole-number plasmid solution was about 165 l for the BbsI group, about 45 l for the AarI group, and about 40 l for the BsmBI group. The combined solution of each group was tripled in volume with sterilized water, giving a highly-pure plasmid solution having a volume of 495 l, 135 l, or 120 l, which was cleaved with the corresponding kind of restriction enzyme as follows.
(91) To the highly-pure plasmid solution of the BbsI group, 55 l of 10NEB buffer #2 and 27.5 l of the restriction enzyme BbsI (NEB) were added to give about 577 l of the resulting plasmid solution, which was subjected to reaction at 37 C. for 2 h. To the highly-pure plasmid solution of the AarI group, 15 l of 10 Buffer_for_AarI that came with the restriction enzyme, 3 l of 50 Oligonucleotide for activation of cleavage that also came with the restriction enzyme, and 7.5 l of the restriction enzyme AarI (Thermo) were added to give about 160 l of the resulting plasmid solution, which was subjected to reaction at 37 C. for 2 h. To the highly-pure plasmid solution of the BsmBI group, 13.3 l of 10NEB Buffer #3 and 6.3 l of the restriction enzyme BsmBI (NEB) were added to give about 140 l of the resulting plasmid solution, which was subjected to reaction at 55 C. for 2 h. After 2 h, a portion was taken from each plasmid solution without the same-mole-number relationship being lost, in other words, 33 l from the BbsI group, 9 l from the AarI group, and 8 l from the BsmBI group were taken. A 5-l sample from each portion was analyzed by DNA electrophoresis, and cleavage of the plasmids with the corresponding restriction enzyme was confirmed (
(92) <Fractionation, in One Session, of 50 DNA Unit Fragments by Agarose Gel Electrophoresis, and Purification>
(93) After the confirmation above, an equal amount of phenol-chloroform-isoamyl alcohol (25:24:1) (Nacalai Tesque, Inc.) was added to and mixed well with each plasmid solution for restriction enzyme inactivation. The resulting mixture of the plasmid solution and phenol-chloroform-isoamyl alcohol (25:24:1) was combined with the other mixtures into a single tube, followed by centrifugation (20,000g, 10 min) for separation into a phenol phase and an aqueous phase. The aqueous phase (about 900 l) was transferred to another 1.5-ml tube, to which 500 l of 1-butanol (Wako Pure Chemical Industries, Ltd.) was added and mixed well, and the resultant was centrifuged (20,000g, 1 min) so as to remove water-saturated 1-butanol. This series of procedure was repeated until the aqueous phase was reduced to a volume of 450 l or lower. To the resultant, 50 l of a 3-M potassium acetate-acetic acid buffer (pH5.2) and 900 l of ethanol were added, followed by centrifugation (20,000g, 10 min) to precipitate the DNA, which was rinsed with 70% ethanol and dissolved in 20 l of TE. To the resultant, 2 l of 10 Dye for electrophoresis was added. The entire mixture was subjected to electrophoresis in 0.7% agarose gel with low melting temperature (2-Hydroxyethyl Agarose Type VII, Sigma) in the presence of 1TAE (Tris-Acetate-EDTA Buffer) buffer on a commercially available agarose gel electrophoresis system (i-MyRun. N, nucleic acid electrophoresis system, Cosmo Bio Co., Ltd.) at a voltage of 35 V (about 2 V/cm) for 4 h of electrophoresis. As a result, Fragments Nos. 01 to 50 were separated from the plasmid vectors (
(94) In order to confirm the number of moles contained in each group before and after size-based selection was determined by quantitative PCR.
(95) <Gene Assembly>
(96) The resulting same-mole-number mixture of Fragments Nos. 01 to 50 had a DNA concentration by weight of 98 ng/l and a sum of the lengths of the base sequences of 48,522 bp. On the other hand, the DNA vector (pGETS118-AarI/AarI) had a DNA concentration by weight of 190 ng/l, and its full length was 15,139 bp. This length-weight ratio was used for obtaining a same-mole-number mixture of the both DNA molecules, in other words, the same-mole-number mixture of Fragments Nos. 01 to 50 was mixed with the DNA vector at a ratio of 6.21 l:1.00 l. To 7.2 l of the resulting same-mole-number mixed solution, 8.2 l of 2 ligation buffer was added, and the entire mixture was incubated at 37 C. for 5 min. Thereto, 1 l of T4 DNA ligase (Takara) was added, followed by incubation at 37 C. for 4 h. A portion of the resulting mixture was analyzed by electrophoresis, and successful ligation was confirmed (
(97) <Checking Structures of Plasmid in Transformant>
(98) 12 strains of colonies were randomly selected, and each of them was cultured overnight in an LB medium supplemented with 2 ml of 10 g/ml tetracycline. For increasing the number of copies of the plasmid inside, IPTG was added to achieve a final concentration of 1 mM, followed by culturing at 37 C. for 3 h. The plasmid was extracted from the resulting bacterial cells, followed by double digestion with the restriction enzymes HindIII and SfiI. Electrophoresis analysis was conducted, and 4 out of the 12 strains gave the desired cleavage pattern (
(99) <Checking Functions of Gene Assemblies>
(100) Lambda phage functions of the plasmid derived from each of the 4 strains were checked in terms of plaque-forming ability, as follows. Each of the assembly-harboring plasmids called #3, #4, #6, and #12 was cleaved with lambda terminase (Lambda terminase, Epicentre) to give a vector part and a gene assembly part. The latter was added to a lambda packaging extract (Gigapack III Plus Packaging Extract, Agilent Technologies). Escherichia coli (strain VCS257) was infected with the resultant, and was spread on an LB plate, followed by overnight culture at 37 C. As a result, plaque formation was observed. It was confirmed that the shape of the plaques was similar to that of the plaques concurrently obtained by lambda phage DNA manufactured by Toyobo Co., Ltd. (
(101) These results showed that the 50 DNA unit fragments as constituents of lambda phage DNA and the DNA vector (pGETS118-AarI/AarI), a total of 51 DNA fragments, were successfully joined together.
Example 2, Construction of Artificial Operon of Mevalonate Pathway by Assembling 55 DNA Unit Fragments and DNA Vector
(102) The isoprenoids are known to be a large class of compounds having an isoprene unit as a skeleton and are synthesized from a common starting compound, which is isopentenyl diphosphate (IPP). There are two pathways known for IPP production starting from the glycolytic pathway, namely, the mevalonate pathway and the non-mevalonate pathway. Both of these pathways may be present in a single living organism, but Escherichia coli only has the non-mevalonate pathway. In order to enhance the ability of Escherichia coli to produce IPP, a part of the genes coding for the mevalonate pathway in yeast, a eukaryote, was artificially constructed by assembling synthetic DNA fragments according to the frequency in use of codons occurring in Escherichia coli, as follows.
(103) <Designing Sequence of Artificial Operon of Mevalonate>
(104) There are 3 genes (ERG10 (1.2 kb), ERG13 (1.5 kb), and HMG1 (3.2 kb)) necessary in the first half of the mevalonate pathway in yeast, namely, the metabolic pathway starting from acetyl CoA to mevalonic acid. The codons in these 3 genes were redesigned according to the frequency in use of codons occurring in Escherichia coli to give 3 artificial genes, which were then made into an artificial operon (5,951 bp) (SEQ ID NO:4) (the full-length sequence shown under SEQ ID NO:4 had a size of 5,955 by including 4 bases to serve as a protruding end), as described below. The redesigning of the gene codons in yeast to gene codons in Escherichia coli was conducted by ranking yeast synonymous codons based on the frequency in appearance of them occurring among all genes in yeast, also ranking Escherichia coli synonymous codons based on the frequency in appearance of them occurring among all genes in Escherichia coli, and exchanging between codons in the same rank.
(105) <Designing DNA Unit Fragment>
(106) A restriction enzyme that had no potential to cleave the 5,951-bp DNA sequence after the exchange between synonymous codons was looked for, in the same manner as in Example 1. The result showed that the DNA sequence contained no recognition sequence of the restriction enzyme AarI and therefore had no potential to be cleaved with AarI. Therefore, AarI was selected for cleaving in the process of all clone preparation. The full-length sequence (5,951 bp) was divided into 55 fragments, each of which was 108 by long on average. This size was designated as the size of each ideal dividing unit. Near boundaries between these dividing units, the presence of any one of particular sequences (60 combinations in total, consisting of 44 combinations left by subtracting 8 palindromic combinations from all 52 combinations consisting of 2 bases in total selected from A and T and 2 bases in total selected from C and G (Group III described above) and all 16 combinations with no 3 consecutive bases selected from C and G out of all 32 combinations consisting of 1 base in total selected from A and T and 3 bases in total selected from C and G (Group IV described above)) was searched for. As a result, one of these particular sequences were found to be occurred within 7 by to each side of the ideal dividing boundary. Based on these results, the full-length sequence was divided into 55 fragments, each having a size from 98 by to 115 bp. Table 2 shows the dividing units and the protruding base sequences within a DNA assembly in Example 2. To the boundary between a mevalonate-pathway gene group and a gene-assembling vector, the protruding sequences (ATTA and AAAA) consisting only of A and/or T were utilized.
(107) TABLE-US-00002 TABLE2 Full- SEQ Sequence(IncludingAarIsite.Fournucleotidesunderlined length ID Fragment indicatesprotrusionsequence.5.fwdarw.3) (bp) NO: MEV001 cacctgcacgtattaGGCCTgttTGGCCGTGACACCGGACAATGAGTAatgTCGCAAAATGTGTACA 127 11 TTGTCTCAACCGCACGCACTCCGATTGGCTCCTTCCAAGGCTCGTTGTCacgtgcaggtg MEV002 cacctgcacgtTGTCTTCTAAGACGGCCGTAGAACTGGGCGCGGTGGCGTTAAAAGGAGCAC 140 12 TGGCGAAGGTGCCGGAACTGGATGCCTCTAAGGATTTTGACGAAATTATTTTTGGCAAT GTGCTCTCacgtgcaggtg MEV003 cacctgcacgtTCTCGGCAAACCTGGGACAGGCGCCCGCACGCCAGGTGGCGCTGGCGGCAG 129 13 GCCTGAGCAACCATATAGTGGCCAGTACGGTGAATAAGGTTTGCGCCTCTGCGATGacgt gcaggtg MEV004 cacctgcacgtGATGAAGGCCATAATTCTGGGCGCGCAGTCTATAAAATGCGGCAACGCGGA 136 14 TGTGGTTGTCGCGGGCGGCTGCGAATCGATGACCAATGCCCCGTACTACATGCCGGCCG CACGacgtgcaggtg MEV005 cacctgcacgtCACGGGCTGGCGCAAAATTTGGACAGACCGTGCTCGTGGATGGCGTTGAAC 136 15 GCGATGGGCTGAATGATGCTTACGATGGCTTGGCAATGGGCGTCCACGCCGAAAAGTG CGCACacgtgcaggtg MEV006 cacctgcacgtGCACGGGATTGGGATATTACCCGCGAACAGCAGGACAACTTTGCAATAGAA 131 16 TCTTACCAGAAATCGCAGAAATCGCAGAAGGAAGGCAAATTCGACAACGAAATTGTCC acgtgcaggtg MEV007 cacctgcacgtGTCCCAGTGACTATTAAGGGTTTTCGCGGCAAGCCAGATACCCAGGTTACAA 135 17 AGGACGAGGAACCAGCGCGCTTACACGTGGAAAAACTGCGCTCGGCCCGTACCGTGTT CCAacgtgcaggtg MEV008 cacctgcacgtTCCAGAAAGAAAATGGCACCGTGACCGCAGCGAATGCGTCGCCGATAAATG 138 18 ATGGCGCGGCCGCAGTTATACTGGTGTCTGAAAAAGTGCTGAAGGAAAAGAACCTGAA GCCACTGacgtgcaggtg MEV009 cacctgcacgtACTGGCGATTATAAAAGGCTGGGGCGAGGCAGCGCATCAGCCGGCGGATTT 139 19 TACGTGGGCGCCGTCGCTCGCCGTGCCGAAGGCGCTGAAACATGCGGGAATAGAAGAC ATAAACTCacgtgcaggtg MEV010 cacctgcacgtACTCGGTGGATTACTTTGAATTCAACGAAGCATTTTCAGTGGTTGGCCTGGT 133 20 AAATACCAAGATTCTGAAGTTGGACCCGTCGAAGGTGAACGTCTATGGCGGCGCGGTG Gacgtgcaggtg MEV011 cacctgcacgtGTGGCGTTGGGCCACCCGCTGGGCTGCTCGGGCGCGCGCGTAGTGGTGACGC 130 21 TTTTGTCTATATTACAACAGGAAGGTGGCAAGATAGGCGTGGCAGCAATTTGCAACacgt gcaggtg MEV012 cacctgcacgtCAACGGCGGCGGCGGCGCGTCTTCGATTGTTATTGAAAAGATCtaaGGCCTtga 140 22 TGGCCAACGCGGGAGATTTTTCatgAAACTATCCACCAAACTCTGCTGGTGCGGCATTAA AGGTacgtgcaggtg MEV013 cacctgcacgtAGGTCGCCTCCGTCCCCAGAAGCAGCAGCAGTTACACAACACGAATCTGCA 129 23 GATGACCGAATTGAAAAAACAGAAGACTGCGGAACAGAAAACTCGCCCACAGAACGac gtgcaggtg MEV014 cacctgcacgtAACGTTGGCATTAAAGGCATACAGATTTACATACCGACCCAGTGCGTTAATC 136 24 AGTCGGAGTTGGAGAAATTTGATGGAGTGTCGCAGGGCAAATACACGATTGGCCTTGG ACAGacgtgcaggtg MEV015 cacctgcacgtACAGACTAATATGTCGTTTGTTAACGACCGCGAAGATATATACTCAATGTCT 130 25 TTGACCGTGCTGTCGAAGCTGATAAAGAGCTACAATATAGACACTAATAAAATTGGacgt gcaggtg MEV016 cacctgcacgtTTGGCCGCTTAGAAGTTGGCACCGAAACCCTTATTGACAAGTCTAAGTCGGT 136 26 TAAGTCGGTTCTGATGCAGCTGTTTGGCGAAAATACCGACGTTGAAGGCATTGACACAC TCAacgtgcaggtg MEV017 cacctgcacgtCTCAACGCATGCTACGGCGGCACTAATGCTCTGTTCAATTCGCTGAATTGGA 137 27 TTGAATCGAATGCCTGGGATGGCCGCGACGCAATTGTCGTGTGTGGCGATATTGCAATA TACGacgtgcaggtg MEV018 cacctgcacgtTACGATAAGGGCGCAGCCCGCCCGACTGGCGGCGCAGGCACCGTGGCGATG 131 28 TGGATAGGCCCAGATGCGCCGATTGTCTTTGACTCGGTCCGCGCGTCGTACATGGAACac gtgcaggtg MEV019 cacctgcacgtGAACACGCATACGATTTTTACAAGCCGGATTTCACTAGTGAATATCCATACG 135 29 TTGATGGCCATTTTTCCTTAACCTGCTACGTTAAGGCGCTCGATCAGGTGTACAAGAGC TAacgtgcaggtg MEV020 cacctgcacgtGCTATTCTAAGAAGGCGATTTCGAAAGGGCTGGTGAGTGATCCTGCGGGCTC 134 30 AGATGCGCTGAATGTGCTGAAATATTTCGACTACAATGTGTTCCATGTGCCGACTTGCA Aacgtgcaggtg MEV021 cacctgcacgtGCAAACTGGTTACGAAATCCTACGGCCGCTTATTGTATAATGATTTCCGCGC 135 31 AAACCCACAGCTGTTCCCGGAAGTGGACGCAGAATTAGCGACCAGAGATTATGACGAA TCGacgtgcaggtg MEV022 cacctgcacgtATCGTTAACTGATAAGAATATTGAAAAAACCTTTGTGAACGTGGCGAAGCCG 139 32 TTCCACAAAGAGCGCGTGGCACAGTCGCTGATTGTGCCGACGAATACGGGCAATATGT ACACTGCacgtgcaggtg MEV023 cacctgcacgtCTGCCTCGGTGTATGCAGCATTTGCCTCGTTGTTAAATTATGTGGGTTCGGAC 132 33 GACTTACAGGGAAAGCGGGTGGGCTTATTTTCGTACGGCTCTGGCTTAGCGGCCTCGacg tgcaggtg MEV024 cacctgcacgtCTCGTTGTATTCGTGTAAAATTGTGGGCGACGTTCAGCATATTATAAAGGAA 131 34 TTAGATATTACCAATAAATTAGCAAAGCGCATAACTGAAACCCCGAAGGATTACGAAac gtgcaggtg MEV025 cacctgcacgtCGAAGCGGCAATAGAACTGCGCGAAAACGCACATCTGAAGAAGAATTTCAA 134 35 ACCACAGGGCTCTATTGAGCATCTGCAGAGCGGCGTGTACTACCTGACTAATATAGATG ACacgtgcaggtg MEV026 cacctgcacgtTGACAAATTTCGCCGCTCGTACGATGTGAAAAAAtaaGGCCTcgaTGGCCGTGA 131 36 ACTGGATAGTGAAATAatgCCCCCCTTGTTCAAGGGTCTTAAACAAATGGCCAAGacgtgcag gtg MEV027 cacctgcacgtCAAGCCGATTGCATATGTGTCCCGCTTTTCAGCTAAACGACCGATTCATATC 143 37 ATCCTCTTTTCGTTGATAATCTCTGCCTTCGCGTATTTGTCTGTTATTCAATATTACTTCA ACGGCTGGacgtgcaggtg MEV028 cacctgcacgtCTGGCAGTTGGATTCCAACAGCGTGTTTGAAACCGCGCCGAACAAAGACTCT 135 38 AATACCTTGTTTCAGGAATGCTCTCATTACTACCGCGATTCTTCGTTGGATGGCTGGGTC Tacgtgcaggtg MEV029 cacctgcacgtGTCTCCATAACTGCTCATGAAGCGAGCGAGTTACCGGCACCGCACCATTACT 127 39 ATTTGTTAAATCTTAATTTCAACAGCCCAAACGAAACCGACTCTATTCCGGAAacgtgcaggt g MEV030 cacctgcacgtGGAATTGGCGAATACAGTGTTTGAGAAAGATAACACGAAATATATTCTTCAG 141 40 GAAGATCTAAGCGTGTCTAAAGAAATTTCGTCGACCGATGGTACAAAATGGCGTTTAC GCAGCGACCacgtgcaggtg MEV031 cacctgcacgtGACCGCAAAAGCCTCTTCGACGTCAAGACATTAGCCTATTCGCTATACGATG 126 41 TCTTTTCCGAAAACGTCACTCAGGCCGACCCCTTTGACGTTCTCATTATGGTacgtgcaggtg MEV032 cacctgcacgtTGGTGACCGCATACTTGATGATGTTCTACACTATCTTCGGACTATTCAACGAC 136 42 ATGCGTAAGACTGGGTCCAACTTTTGGCTGAGTGCATCGACGGTAGTTAACTCGGCCTC CTacgtgcaggtg MEV033 cacctgcacgtTCCTCCCTCTTCTTAGCCCTGTATGTTACTCAGTGCATTTTGGGAAAAGAAGT 135 43 GTCTGCCTTAACCCTCTTTGAAGGCCTGCCATTCATTGTCGTGGTGGTGGGCTTCAAGCA acgtgcaggtg MEV034 cacctgcacgtAGCACAAAATAAAGATTGCACAATATGCACTTGAGAAATTTGAACGCGTTG 141 44 GCTTATCGAAACGTATTACCACTGATGAAATAGTGTTTGAATCTGTAAGTGAAGAGGGC GGCCGGCTGacgtgcaggtg MEV035 cacctgcacgtGCTGATTCAGGACCATCTGCTCTGCATTTTTGCATTTATAGGTTGTTCGATGT 124 45 ATGCGCACCAGCTGAAGACCCTGACGAATTTCTGTATCTTATCCGCCTTacgtgcaggtg MEV036 cacctgcacgtCCTTTATATTGATTTTTGAACTGATTTTAACCCCAACGTTTTATTCGGCGATA 139 46 TTAGCTCTCCGCCTTGAAATGAACGTGATACACCGCTCGACCATTATAAAGCAGACGTT AGAAGacgtgcaggtg MEV037 cacctgcacgtGAAGAAGACGGCGTGGTGCCGTCGACGGCCCGCATAATTTCGAAAGCCGAA 136 47 AAGAAATCTGTCTCGTCGTTCTTAAACCTAAGCGTAGTGGTTATTATAATGAAACTATC GGTTacgtgcaggtg MEV038 cacctgcacgtGGTTATCCTTCTGTTTGTTTTCATAAATTTTTATAATTTTGGCGCCAACTGGGT 131 48 TAACGATGCATTCAACTCCCTGTACTTCGATAAGGAACGGGTGTCGTTGCCGGATacgtgc aggtg MEV039 cacctgcacgtGGATTTTATTACTTCAAACGCATCGGAAAATTTTAAAGAGCAGGCGATTGTG 140 49 AGCGTTACTCCGTTATTATATTACAAACCTATTAAGTCTTACCAGAGAATTGAGGATAT GGTGCTCacgtgcaggtg MEV040 cacctgcacgtGCTCTTGCTGCTCCGGAACGTTAGCGTGGCAATTCGGGATCGTTTCGTTAGC 129 50 AAATTAGTGCTCTCTGCATTAGTCTGTAGCGCGGTTATAAACGTATATTTACTGAacgtgca ggtg MEV041 cacctgcacgtCTGAACGCGGCGCGCATTCATACTAGCTATACCGCCGACCAGCTGGTAAAAA 131 51 CCGAAGTTACTAAGAAGTCGTTTACCGCGCCAGTCCAGAAGGCGTCGACGCCGGTGTac gtgcaggtg MEV042 cacctgcacgtGTGTTAACTAACAAAACGGTTATTTCGGGTTCAAAAGTTAAAAGCTTATCCT 143 52 CGGCTCAGTCAAGTTCCTCCGGTCCATCCTCCTCGAGCGAGGAAGATGATTCTAGAGAT ATTGAAAGTCacgtgcaggtg MEV043 cacctgcacgtAGTCTGGATAAGAAAATCCGGCCATTAGAAGAATTAGAAGCCTTATTAAGC 127 53 AGCGGTAACACGAAACAGCTGAAGAATAAAGAGGTTGCGGCACTGGTGATTCACacgtgc aggtg MEV044 cacctgcacgtTCACGGCAAGTTACCACTGTACGCGCTGGAGAAAAAATTAGGCGATACCAC 136 54 ACGCGCTGTGGCTGTCCGGCGTAAGGCGCTCTCCATTCTGGCCGAAGCGCCAGTCTTAG CCTCacgtgcaggtg MEV045 cacctgcacgtCCTCGGATCGGTTACCGTATAAAAACTATGACTACGACAGAGTCTTTGGAGC 132 55 GTGCTGCGAAAACGTGATCGGCTACATGCCACTGCCTGTGGGCGTGATCGGACCTCTGa cgtgcaggtg MEV046 cacctgcacgtTCTGGTGATAGATGGCACGTCGTATCATATCCCGATGGCCACCACGGAGGGC 135 56 TGCCTGGTCGCGTCGGCAATGCGGGGATGCAAGGCCATAAACGCGGGAGGCGGCGCCA CGAacgtgcaggtg MEV047 cacctgcacgtACGACCGTGTTAACCAAGGATGGCATGACGCGCGGACCGGTCGTTCGGTTCC 138 57 CGACCCTGAAACGCTCGGGCGCATGCAAGATCTGGTTAGACTCCGAAGAGGGTCAGAA TGCCATacgtgcaggtg MEV048 cacctgcacgtCCATTAAAAAAGCGTTTAATTCGACGTCCCGCTTTGCCCGGCTTCAGCATATT 132 58 CAGACCTGCTTGGCCGGTGATTTACTATTCATGCGCTTTCGCACGACCACCGGCGACacgt gcaggtg MEV049 cacctgcacgtCGACGCCATGGGCATGAACATGATTTCGAAAGGCGTTGAATACTCCTTAAAG 140 59 CAGATGGTCGAAGAGTATGGATGGGAAGATATGGAGGTGGTTTCTGTGTCGGGCAATT ACTGCACTacgtgcaggtg MEV050 cacctgcacgtCACTGACAAAAAACCGGCGGCAATAAATTGGATAGAAGGCCGGGGCAAGA 128 60 GCGTTGTTGCCGAAGCGACCATTCCAGGCGATGTGGTTCGCAAAGTATTAAAAAGCacgt gcaggtg MEV051 cacctgcacgtAAGCGATGTGTCTGCCCTGGTGGAGCTGAATATTGCGAAGAACCTGGTGGGT 137 61 TCGGCCATGGCGGGGTCGGTGGGCGGTTTTAATGCCCATGCCGCGAACTTAGTAACGGC GGTGacgtgcaggtg MEV052 cacctgcacgtGGTGTTCCTGGCCTTAGGTCAGGATCCAGCCCAGAACGTGGAAAGCTCTAAT 133 62 TGCATCACGCTGATGAAAGAAGTAGACGGCGATCTGCGCATTTCTGTCTCTATGCCGTC acgtgcaggtg MEV053 cacctgcacgtCGTCTATAGAAGTCGGCACTATAGGCGGCGGCACCGTGTTGGAACCGCAGG 134 63 GCGCAATGCTGGACTTATTAGGCGTCCGCGGACCCCATGCGACTGCGCCAGGCACTAAT GCacgtgcaggtg MEV054 cacctgcacgtATGCCCGGCAGTTAGCCCGCATCGTGGCATGCGCAGTTCTGGCCGGCGAATT 130 64 ATCTTTATGCGCGGCATTGGCCGCAGGACATCTGGTGCAGAGCCATATGACTCACAacgtg caggtg MEV055 cacctgcacgtCACAATCGTAAACCAGCGGAACCGACGAAACCAAATAACCTGGACGCAACC 138 65 GATATCAACCGGCTGAAAGATGGGTCTGTTACTTGTATTAAATCTtaaGGCCTTCTTGGCC aaaaacgtgcaggtg
<Construction of DNA Unit Fragment from Synthetic DNA>
(108) Each of the divided fragments obtained was prepared with 2 molecules of chemically synthesized 80-base DNA, according to a method by Rossi et al. (Rossi, J. J., and Itakura, K. 1982. J. Biol. Chem. 257, 9226-9229 (1982)). Specifically, each of the resulting divided fragments had these 2 chemically synthesized DNA molecules hybridizing to each other at the 3 end for a span of several tens bp, and also had an AarI recognition site introduced to the 5 end side so that the above-designed protruding sequence was to be formed between the AarI cleavage site and the 5 end by digestion. The hybridization between these 2 synthetic DNA molecules followed by template-dependent elongation reaction gave a double-stranded DNA unit fragment, which was then amplified by PCR in the way to be described below. The resultant double-stranded DNA unit fragment as well as a pair of PCR primers designed to hybridize with the AarI recognition site on each end, namely, a total of 3 kinds of DNA molecules, were used to be added in the PCR reaction, and consequently a DNA unit fragment flanked by AarI cleavage sites was obtained. The resultant DNA unit fragment was joined to Escherichia coli plasmid vector pMD19 by TA cloning method, followed by transformation of Escherichia coli for cloning method. Sequencing was then conducted to select a clone having a base sequence desirable for each fragment.
(109) <Mixing Same Mole Numbers of Plasmids each Harboring DNA Unit Fragment>
(110) Each of the 55 strains of Escherichia coli each harboring the resulting desired clone was cultured and then subjected to treatment with Plasmid mini-prep (QIAGEN), whereby 50 l of a crude plasmid solution was obtained. A 1-l sample of the resultant was analyzed with a spectrophotometer for trace amount detection, and the DNA concentration of it was determined as 82 ng/l to 180 ng/l. Each plasmid weighing about 5 g was treated with Plasmid Safe, followed by enzyme inactivation by heating. Purification with Mini-elute PCR purification Kit (QIAGEN) gave 25 l of a highly-pure plasmid solution. A 1-l sample of the resultant was analyzed with a spectrophotometer for trace amount detection, and the concentration of it was determined as 108 ng/l to 213 ng/l. A 20-l portion of the highly-pure plasmid solution was transferred into a separate tube and diluted with TE so as to make the concentration of the plasmid be mathematically 100 ng/l. The resulting purified plasmid solution was reanalyzed with a microspectrophotometer to calculate the concentration, and, based on the concentration measurement, the volume (l) of the solution containing 500 ng of the highly pure plasmid was accurately calculated to the second decimal place. A portion of each plasmid solution in an amount of this volume (about 5 l) was separated into one tube, where this portion was combined with the other such portions. To the resulting same-mole-number plasmid mixture solution, which was about 275 l in total volume, sterilized water having a volume twice the volume of the same-mole-number plasmid mixture solution, 137.5 l of 10 Buffer_for_AarI, and 67.5 l of the restriction enzyme AarI were added, followed by reaction at 37 C. overnight.
(111) <Size-based Selection of 55 DNA Unit Fragments in One Session>
(112) To the resulting reaction solution, an equal amount of phenol-chloroform-isoamyl alcohol (25:24:1) was added for AarI inactivation, followed by centrifugation. The resulting supernatant was purified by ethanol precipitation, and the precipitate was dissolved in 20 l of TE. The resultant, combined with xylene cyanol as a coloring agent for electrophoresis, was subjected to electrophoresis in 2.5% agarose gel with TAE buffer for 30 minutes at 100 V so as to separate the DNA vector pMD19 and the insert DNA unit fragment (
(113) <Purification of Same-mole-number Mixture of DNA Unit Fragments>
(114) DNA purification from the obtained gel segment was conducted with MiniElute Gel Extraction Kit (QIAGEN) as follows.
(115) The volume of the gel was measured from the weight thereof, and CG Buffer having a volume 15 times the volume thus calculated was added, followed by incubation at 50 C. for 10 min for dissolving the gel. Thereto, isopropyl alcohol having a volume 5 times the volume of the gel segment was added, and the resulting liquid was placed in the column, followed by centrifugation to make the DNA adsorbed on the column. To the column, 500 l of CG Buffer was added, followed by centrifugation for washing, and then 750 l of PE Buffer was further added, followed by centrifugation for washing. In this way, the column was washed. The column was centrifuged one more time for complete removal of any residue. To the column, 10 l of TE buffer was added, followed by centrifugation. Thus, a mixed solution of substantially the same number of moles of the 55 DNA unit fragments was obtained.
(116) <Addition of DNA having Origin of Replication, to Same-mole-number Mixed Solution of DNA Unit Fragments>
(117) The mixed solution was analyzed with a spectrophotometer for trace amount detection to measure the concentration, and the DNA concentration thereof was determined as 20 ng/l. pGET151/AarI was also prepared at the same time in a concentration of 67 ng/l. In consideration of these results as well as the ratio between the lengths of these (5955 bp:4306 bp), the same-mole-number mixed solution of the 55 fragments and the pGETS151/AarI were mixed in a ratio of 4.63:1.
(118) <Gene Assembling>
(119) To 5.63 l of the resulting same-mole-number mixed solution, 6.63 l of 2 ligation buffer was added, followed by incubation at 37 C. for 5 mM. Thereto, 1 l of T4 DNA ligase (Takara) was added, followed by incubation at 37 C. for 4 h. A sample of the resultant was analyzed by electrophoresis for checking whether or not ligation between the DNA unit fragments and the DNA vector in a tandem-repeat structure was successful (
(120) <Transformation, and Checking Structures of Assembly>
(121) From the resulting 154 colonies, 24 clones were randomly selected and inoculated into an LB medium supplemented with 10 g/ml tetracycline. IPTG was added thereto so as to achieve a final concentration of 1 mM during the logarithmic phase, followed by culturing to reach the stationary phase. The DNA plasmid was extracted and was treated with the restriction enzyme PvuII, followed by electrophoresis for checking the cleavage pattern (
(122) These results showed that the 55 DNA unit fragments as constituents of the artificial operon of the mevalonate pathway and the DNA vector (pGETS151-pBR), a total of 56 DNA fragments, were successfully joined together.
(123) Thus, it was confirmed that the method of the present invention of constructing a DNA concatemer was capable of joining 50 or more DNA fragments together. The reason for this many DNA fragments being successfully joined together was probably that the numbers of moles of DNA unit fragments are close to one another more accurately.
(124) The reason that the numbers of moles of DNA unit fragments in the DNA unit fragment composition prepared by the method of the present invention were close to one another more accurately was probably the following.
(125) When the concentration of each DNA unit fragment in the solution containing the DNA unit fragment was measured in Examples 1 and 2, the DNA unit fragment being measured had the corresponding auxiliary sequence attached thereto (specifically, a circular DNA plasmid). Even if the base sequences of different kinds of DNA unit fragments varied greatly, the corresponding auxiliary sequences thus attached contributed to reduction in distribution of the lengths of different base sequences being measured. As a result, when the measurement result was used to calculate the number of moles of each kind of DNA unit fragment, errors in the calculation were reduced. Then, when the resulting measurement result was used for taking a portion from each of the solutions so that the number of moles of DNA unit fragment in each portion was adjusted to be substantially the same, the molar ratio between different portions tended to be close to 1. Probably for this reason, the numbers of moles of DNA unit fragments became more accurately substantially the same.
(126) In Example 1, the standard deviation of the distribution of the sum of the lengths of the base sequence of each DNA unit fragment and the base sequence of the corresponding auxiliary sequence attached to the DNA unit fragment was 3691.4 bp6.6 bp, and ranged from 0.18% to 0.18% of the average value of the sum of the lengths. In Example 2, the standard deviation of the distribution of the sum of the lengths of the base sequence of each DNA unit fragment and the base sequence of the corresponding auxiliary sequence attached to the DNA unit fragment was 2828.2 bp4.5 bp, and ranged from 0.16% to 0.16% of the average value of the sum of the lengths. In Examples 1 and 2, the standard deviation was smaller than the average value of the sum of the lengths, and probably for this reason, errors in the calculation of the number of moles of each DNA unit fragment conducted based on the measurement result of the DNA concentration in the solution were reduced.
(127) The ratio of the average length of the base sequence of the corresponding auxiliary sequence attached to each DNA unit fragment to the average length of the base sequence of the DNA unit fragment was about 2.7 in Example 1 and about 27 in Example 2. Because the average length of the base sequence of the corresponding auxiliary sequence attached to each DNA unit fragment was longer than the average length of the base sequence of the DNA unit fragment, errors in the calculation of the number of moles of each DNA unit fragment conducted based on the measurement of the DNA concentration in the solution were further reduced, and probably for this reason, errors in the calculation of the number of moles of each DNA unit fragment conducted based on the measurement of the DNA concentration in the solution were further reduced.
(128) In Example 1 and Example 2, designing each DNA unit fragment was conducted in a way that the base sequence of each DNA assembly when divided by the number of kinds of its constituent DNA unit fragments into equal parts had a non-palindromic sequence near each boundary between two adjacent equal parts, and that each DNA unit fragment was separated by the non-palindromic sequence from an adjacent DNA unit fragment. The DNA unit fragments thus designed had substantially the same length. When the DNA unit fragments were subjected to removal of corresponding auxiliary sequences with restriction enzymes and to subsequent electrophoresis for size-based selection, the DNA unit fragments were observed as a band at substantially the same position, allowing recovery of all the DNA unit fragments to be completed in a single session of size-based selection. Therefore, operation efficiency was enhanced.
(129) In Example 1, the DNA unit fragments were divided into groups, each group for a single restriction enzyme to be used for removal of the corresponding auxiliary sequence (3 kinds of restriction enzymes in Example 1, 1 kind of restriction enzyme in Example 2). In this case, each group consisted of two or more solutions each containing a different DNA unit fragment. The two kinds or more solutions could be mixed together before the removal step. As a result, a separate session of restriction enzyme treatment was not required for respective DNA unit fragment, but, instead, a single session of restriction enzyme treatment was enough to treat an entire restriction-enzyme group. Consequently, the operation efficiency of DNA concatemer construction was enhanced. It was confirmed that even such mixture is used, the number of moles of many DNA unit fragments were substantially the same when mixed together, and therefore the many DNA unit fragments were successfully joined together as described above.
Test Example 1, Checking Level of Repeating Unit of Redundancy (r) of DNA Assembly Unit Required for Transformation of Bacillus subtilis DNA Plasmid
(130) In order to check the level of the repeating number (redundancy) r of DNA assembly unit required for transformation of Bacillus subtilis DNA plasmid, the following test was conducted.
(131) The plasmid pGETS11840-Pr-SfiI-pBR (SEQ ID NO:1) harboring an origin of replication effective in Bacillus subtilis was used to prepare the following DNA molecules (A) to (H).
(132) <Preparation of DNA (A)>
(133) The DNA (A) was a circular monomeric DNA plasmid with redundancy of r=1. First, Escherichia coli was transformed with pGETS118-t0-Pr-SfiI-pBR. Most of the plasmids obtained from the resulting transformant were the DNA (A), but a small amount of multimers were also contained. In order to remove the multimers, all the plasmids obtained were subjected to electrophoresis in agarose gel with low melting temperature for DNA-size-based selection, and only the monomeric DNA plasmid region was cut out from the gel and purified. Thus, the DNA (A) was prepared.
(134) <Preparation of DNA (B)>
(135) The DNA (B) was a linear monomeric DNA plasmid with redundancy of r=1. The DNA (B) was prepared by treating the DNA (A) with the restriction enzyme BlpI (the recognition site thereof was (5-GC/TNAGC-3)).
(136) <Preparation of DNA (C)>
(137) The DNA (C) was a tandem-repeat linear multimeric DNA plasmid with redundancy of r>1. BlpI used for preparing the DNA (B) above formed a 3-base non-palindromic protruding sequence at the 5 end. Accordingly, by joining molecules of the DNA (B) to each other with DNA ligase, a continuous linear multimeric DNA plasmid having its plasmid units arranged in a certain orientation was prepared, which was the DNA (C).
(138) <Preparation of DNA (D)>
(139) The DNA (D) was a linear monomeric DNA plasmid with redundancy of r=1. The DNA (D) was prepared by treating the DNA (A) with the restriction enzyme EcoRI (the recognition site thereof was (5-G/AATTC-3)).
(140) <Preparation of DNA (E)>
(141) The DNA (E) was a linear multimeric DNA plasmid including a portion with partially redundancy of r>1 and composed of molecules of the DNA (D) joined together in a random orientation. EcoRI used for preparing the DNA (D) above formed a 3-base palindromic protruding sequence at the 5 end. Accordingly, by joining DNA plasmids that were cleaved with EcoRI, it was possible to construct a multimeric DNA plasmid having its plasmid units joined in a random orientation. The DNA (E) was prepared by joining molecules of the DNA (D) above to each other with DNA ligase.
(142) <Preparation of DNA (F)>
(143) The DNA (F) was a linear semi-monomeric mixture with r1. The DNA (F) was prepared as follows: the DNA (A) was cleaved only at a single site with the restriction enzyme KasI, dephosphorylated, and then cleaved with BlpI at a site near the above-cleaved site to give a DNA fragment; the DNA (A) was cleaved only at a single site with the restriction enzyme AfeI, dephosphorylated, and then cleaved with BlpI at a site near the above-cleaved site to give a DNA fragment; and mixing both of these resulting DNA fragments in equal amount. Each of the DNA fragments in the mixture (F) had redundancy r which is slightly lower than 1.
(144) <Preparation of DNA (G)>
(145) The DNA (G) was a linear semi-dimer DNA plasmid with redundancy of r=1.98. The DNA (G) was prepared by joining 2 DNA fragments (F) above with DNA ligase, and the orientation therein was regulated by its BlpI sites alone.
(146) <Preparation of DNA (H)>
(147) The cleavage site in the DNA (B) and the cleavage site in the DNA (D) were away from each other. The DNA (H) was a mixture prepared by not joining but mixing the DNA (B) and the DNA (D) in equal number of moles.
(148) <Transformation of Bacillus subtilis Competent Cell with DNA (A) to DNA (H)>
(149) A Bacillus subtilis competent cell was transformed with each of the DNA (A) to the DNA (H). Based on the appearance number of the tetracycline-resistant strains as index, the number of transformants per 1 g was determined Each of the DNA (A) to the DNA (H) for use in transformation was dissolved in ligation buffer regardless of whether the DNA was to be subjected to ligation reaction.
(150) It was confirmed that these results showed that transformants were obtained only with the ligation, namely, the DNA (C), the DNA (E), and the DNA (G), with the circular DNA (A) not counted. As indicated by these results, no transformant would be obtained with redundancy being r=1 or r<1 even when the DNA molecule was prepared by mixing 2 kinds of linear plasmid molecules having different cleavage sites that would be able to compensate for each other. As a result, it was indicated that redundancy of a linear DNA molecule needed to satisfy r>1 at lowest.
(151) (Simulation 1, Ligation Simulation)
(152) <Setting Algorithm for Ligation Simulation>
(153) Simulation was programmed on VBA of spreadsheet software Excel 2007. The DNA fragment F used in virtual ligation was expressed as 3 parameters, Fi(Ni, Li, Ri). i referred to the identification number of the fragment, more specifically the number on the cell in the row i on Excel. N referred to the number of DNA unit fragments in a single ligation DNA fragment molecule in virtual ligation. L referred to an arbitrary natural number that represented the sequence of the left protruding end of the ligation product. Similarly to L, R referred to an arbitrary natural number that represented the sequence of the right protruding end of the ligation product. When L=R, the 2 protruding sequences were complementary to each other. Therefore, the relationship L=R defines that ligation was eligible to occur. Ligation simulation was conducted as follows.
(154) The random number j that satisfied ij was obtained by generating a uniform random number between 0 and 1 by the RAND ( ) method, multiplying the resulting number by m (described below), and rounding off the resulting number to give an integer. This resulting integer was applied to the fragment Fi(Ni, Li, Ri) to give the fragment Fj(Nj, Lj, Rj). Whether these 2 fragments were to be successfully joined together was determined according to the following discrimination formulae, and when they were to be successfully joined together, the parameters of these fragments were converted as follows.
(155) When Li=Rj was satisfied, in other words, when the left end of Fi and the right end of Fj were to be successfully joined together, conversion was made to give the fragment Fi(new)(Ni(old)+Nj(old), Lj(old), Ri(old)) and the fragment Fj(new)(0, 0, 0). In contrast, when Ri=Lj was satisfied, in other words, when the right end of the fragment Fi and the left end of the fragment Fj were to be successfully joined together, conversion was made to give the fragment Fi(new)(Ni(old)+Nj(old), Li(old), Rj(old)) and the fragment Fj(new)(0, 0, 0). When LiRj and RiLj were satisfied, no conversion was made (giving (the fragment Fi(new)(Ni(old), Li(old), Ri(old)) and the fragment Fj(new)(Nj(old), Lj(old), Rj(old))), where no virtual ligation was to occur. The same calculation conducted sequentially with i=1.fwdarw.m was defined as 1 cycle of virtual ligation. Here, the variable m referred to the total number of DNA fragments in the virtual ligation cycles, and for the 1st simulation cycle, the variable m referred to the total number of DNA unit fragments to start with. After calculation for the 1st cycle of virtual ligation, calculation for the next cycle of virtual ligation was conducted by rearranging the fragments Fi by the sorting function (the Sort method) in the VBA command of Excel 2007 so that the values Li were arranged in descending order, counting the total number of the fragments Fi except for the fragment F(0, 0, 0), and using the resulting total number as a variable m for the new cycle. Virtual ligation was repeated until the number of fragments reached the minimum mmin where there were no more protruding fragments complementary to each other and therefore no more cycle of virtual ligation was possibly conducted. The value mmin was determined according to the following calculation based on data about the starting DNA unit fragments, namely, the pre-ligation DNA unit fragments.
(156) mmin=(total number of DNA unit fragments)(total number, across entire system, of 1 out of 2 kinds of DNA unit fragments both satisfying L=R, that was fewer than the other)
(157) <Ligation Simulation>
(158) Virtual DNA unit fragment groups each of which consisted of 6 fragments, 13 fragments, 26 fragments, or 51 fragments assembled together were formed as follows. The virtual DNA unit fragment groups contained a fixed number, 640, of DNA unit fragments on average, and had a coefficient of variation (CV) that was set to increase sequentially by 1% from 0% to 20%.
(159) The virtual DNA unit fragment groups were formed respectively by generating a group of random numbers from 0 to 1 corresponding to each assembly size by the uniform random number command RAND ( ) of Excel, standardizing the group of random numbers with average value of 0 and variance of 1, multiplying each standardized random number by (fragment average value*CV(%)/100), and adding the average value of fragments to the resulting number. For each assembly size, independent 20 groups of random numbers were constructed each for one of the CV (%) values. Each of these groups of random numbers underwent virtual ligation by the simulation, which was conducted until mmin was reached. The resulting 20 virtual ligation fragments were combined together, and the total number of ligation fragments for each N value was obtained. The ratio of (N valuenumber of ligation fragments) to the total number of DNA unit fragments used in ligation was determined. A 100-% stacked graph was created such that the value attributed to a molecule with a higher N value was plotted lower in the graph. Such graphs are shown in
(160) <Obtaining Theoretical Formula for Ligation from Ligation Simulation>
(161) The results of the ligation simulation were numerically analyzed in order to obtain a general formula for the ligation mechanism. First, whether it was possible to plot a fitting curve for the distribution of the sizes of ligation products for each CV value for each assembly size was evaluated.
(162) The number of molecules contained in a ligation product for each N value shown in the histogram had a general tendency to exponentially decrease as N value increased, and appeared to be close to geometric distribution, which was one type of discrete probability distribution. Microscopically, however, the histogram displayed a periodic model consisting of cycles each of the size of the gene assembly, namely, the size of one redundancy unit (6 in the case of the 6-fragment assembly). The histogram displayed a characteristic pattern where no fragment occurred for N value being equal to an integral multiple of the size of the gene assembly. This particular characteristic was not in complete agreement with geometric distribution or with exponential distribution regarded as continuous probability distribution. However, when converting the axis that showed the number of molecules in a ligation product into logarithmic expression, selecting and taking out, from each cycle, the components that constituted the same microscopic cycle, in other words, the components that gave the same remainder when N was divided by 6 or the size of the assembly, and plotting a linear approximation curve, the resulting linear approximation curve had the second power of a very high correlation coefficient (0.94 or greater). Therefore, it was considered that there was no problem when a linear approximation curve created for each component displayed exponential distribution. The same distribution as displayed by the case of the 6-fragment assembly where CV value as variation in the concentration was 20%, shown in
(163) Specific procedure was as follows: (1) in the results of simulation conducted for each assembly size described above, the number of molecules for about 3 cycles as for each of the components that gave the same remainder when N was divided by the size of the assembly was subjected to logarithmic transformation, and the resulting values were used to create a linear approximation curve, followed by determining the slope () of the straight line and calculating the value ;
(164) and (2) next, in consideration that the average value of f(N) in the exponential distribution function was the reciprocal of the parameter , namely, 1/, the average value of N of ligation products for the 20 groups of random numbers was determined, and the reciprocal of the resulting average value was used to determine for each CV (%) (CV (%)). The results of (1) and (2) were plotted, with setting the abscissa showing the CV (%) value of variation of concentrations of DNA unit fragments and the ordinate showing the value. As a result, it was shown that all the plottings for each size of the gene assembly were on a direct proportional straight line passing through a certain original point. A linear approximation curve was determined for each set of these plottings, as shown in
(165) <Qualitative Analysis of Reaction Rate of Ligation>
(166) The ligation simulation described above was intended to represent a state where ligation between all reasonable protruding-end combinations had been fully completed. Here, in order to examine how close the ligation reaction conditions in actual gene assembly were to reaction conditions in simulation, the kinetics of ligation reaction were analyzed.
(167) First, in ligation reaction conducted under the conditions in actual gene assembly, samples of the ligation products were taken at various reaction times. A 51-fragment concatemer for phage reconstruction was used, and all the 51 joints were qualitatively analyzed to evaluate the degree of actual joining. The average concentration of the DNA unit fragments used in ligation was about 0.2 fmol/l. To the DNA unit fragment solution, T4 DNA ligase was added. After 0 minute, 1.25 minutes, 2.5 minutes, 5 minutes, 10 minutes, 20 minutes, 40 minutes, 80 minutes, 160 minutes, and 320 minutes at 37 C., a sample of each reaction solution was taken. Then the progress of ligation of each fragment was evaluated using a primer set for quantitative PCR designed to amplify DNA stretching across the joint between 2 DNA unit fragments being reasonably joined, a primer set for quantitative PCR designed to amplify only inside each DNA unit fragment, and, as an indicator, the dilution series of DNA that was produced by cleaving with a restriction enzyme a commercially available phage genomic DNA (Toyobo Co., Ltd.) or an assembly-harboring plasmid constructed in advance and then rendering the resulting DNA fragment linear. The results showed that ligation had been completed in about 10 minutes at any joint under these reaction conditions, indicating that ligation would be substantially fully completed in the actual reaction time of 4 hours (240 minutes). The results also showed that the ratio of the number of joints after sufficient time (after 40 minutes) to the number of the kind of the DNA unit fragments that was fewer than the other was substantially 1, indicating that most of the ligated DNA fragments joined to their correct ligation partners.
(168) <Estimation of Misligation Rate>
(169) The state of ligation was studied in more detail. Among the assemblies obtained in the experiment above of reconstruction of phage genome, all the clones except for clones #3, #4, #6, and #12 with their entire base sequences completely determined (namely, clones #1, #2, #5, #7, #8, #9, #10, and #11) were subjected to base sequencing in order to identify ligation site between a wrong combination.
(170) <Distribution of Sizes of Actual Ligation Products, and Verification of Agreement with Simulation>
(171) From these two analyses described above, namely, estimation of the misligation rate and qualitative analysis of reaction rate of ligation, it was presumed that ligation would be substantially fully completed in actual ligation reaction after a sufficient amount of time of 4 hours and that the probability of misligation was low. Then, as for actual DNA unit fragment groups with variation occurring in the concentration of the starting DNA unit fragments, whether distribution of the sizes of actual ligation products was predictable by simulation was studied, as follows.
(172) Analysis was conducted on the groups used in the experiment of reconstruction of phage genome. The groups had variation in the concentrations of DNA unit fragments with 7.5% of CV as observed by quantitative PCR. An observed value resulting from quantitative PCR involved measurement errors of CV=3.6%. Therefore, the true CV value for DNA unit fragment variation was presumably and possibly lower than CV=7.5%. Simulation was conducted to determine a CV value that was potentially the true CV value. As a result, when the true CV value was 6.6%, the observed value was presumably and possibly CV=7.5% due to measurement errors of CV=3.6%. In consideration of the true DNA unit fragment variation being CV=6.6%, simulation was conducted so as to simulate ligation of 51 kinds of starting DNA unit fragments under conditions of average 640 fragments prepared for the RAND ( ) method and CV=6.6%. The simulation reaction was conducted until not only mmin indicating 100% reaction rate was reached but also a designated m value was reached. The designated m value was obtained by determining m values for ligation-eligible rates of 95%, 96%, 97%, 98%, and 99% ligation, preparing 100 independent groups of random numbers for each m value, and determining the designated m value. The distribution patterns of obtained ligation products displayed by these 100 groups were combined together, and the length (bp) of DNA of each virtual ligation product of DNA unit fragments was determined by using the parameters F(N, L, R). Then, the actual DNA unit fragment groups used in experiment of reconstruction of phage genome with variation in the number of fragments of CV=6.6% were, as described in the paragraph Qualitative analysis of reaction rate of ligation above, subjected to reaction at 37 C. for 4 hours, followed by electrophoresis on a CHEF-type pulsed-field gel electrophoresis system (manufactured by Bio Craft Co., Ltd.) for 16 hours under electrophoresis conditions of 0.5 TBE, 5 V/cm, and 30 sec per cycle, in order to see the actual distribution of the molecular weight of DNA.
(173) <Generalization of Ligation Simulation>
(174) DNA unit fragments used in actual assembly cannot be free from variation in the concentration. How well actual variation in the concentrations of DNA unit fragments needed to be regulated was summarized based on the general formula f(N)=0.0058*CV(%)*exp(0.0058*CV(%)*N) determined above, and was shown in
(175) [Sequence Listing]