Pullulanase and use thereof

Abstract

The present application relates to the field of enzyme engineering, especially relates to a pullulanase as well as preparation and use thereof. The pullulanase and coding gene thereof were obtained by random mutation by using the Error-prone PCR technique on the gene of wild-type pullulanase to obtain a mutant PLUM. The enzyme activity of the mutant PLUM was improved by 57.03% compared with the wild-type pullulanase PLUM.

Claims

1. A pullulanase mutant having pullulanase activity, wherein, the said pullulanase mutant comprises the amino acid sequence of SEQ ID NO.4.

Description

BRIEF DESCRIPTION OF FIGURES

(1) FIG. 1 is a Error-prone PCR product electrophoresis image;

(2) wherein, M is marker; plum is the product of Error-prone PCR;

(3) FIG. 2 is a double-enzyme digestion verification graph of pGAPZC-pulm;

(4) wherein, M is marker; Vector is the product of double-enzyme digestion.

EXAMPLES

(5) In order to enable the purpose, the technical scheme and the advantages of the invention to be clearer, the present invention is further described in detail with reference to specific examples. It should be understood that the specific examples described herein are only used to explain the present invention and are not intended to limit the present invention.

Example 1 Obtaining of the Genome DNA of Bacillus Acidopullulyticus

(6) The wild type pullulanase mature peptide gene pul was from Bacillus Acidopullulyticus stored in the applicant's laboratory. The genome DNA was extracted by the method comprising the following steps:

(7) (1) an inoculating loop of Bacillus Acidopullulyticus was picked from a flat plate and inoculated into a medium, then cultured at 30 C., 200 rpm for one night;

(8) (2) the culture solution was centrifuged at 12000 r/min for 10 minutes, and then the thallus was harvested in the centrifuge tube;

(9) (3) 1 mL solution I (50 mmol/L Glucose; 25 mmol/L Tris-HCl, pH8.0; 10 mmol/L EDTA, pH8.0), 150 L lysozyme solution were added to the thallus, and digested at 37 C. for 30 minutes;

(10) (4) 300 L solution II (0.2 mol/L NaOH; 1% SDS) was added thereto, then the centrifuge tube was inverted for 5 minutes;

(11) (5) equal volume of solution III (saturated phenol:chloroform=1:1) was added, mixed uniformly, and then the mixed solution was centrifuged at the room temperature, 12000 r/min for 10 minutes, then the supernatant was transferred to another clean EP tube, and the organic phase and protein precipitate in lower layer were abandoned.

(12) (6) the above supernatant was repeatedly extracted twice, and extracted with equal volume of chloroform for one time, so as to remove the trace amounts of phenol;

(13) (7) a DNA was precipitated by adding 2-fold volume of absolute ethyl alcohol, then centrifuging at 12000 r/min for 10 minutes, removing the resulting supernatant, and washing the resulting precipitate with 70% ethanol (500 L) for two times;

(14) (8) the EP tube was inverted and aired on a filter paper, then the DNA was dissolved by TE buffer solution, and preserved at 20 C. for later use.

Example 2 Obtaining of the Mutator Gene of Pullulanase

(15) 1. Random Mutation

(16) Random mutation was carried out on the basis of the error-prone PCR (polymerase chain reaction) technology, and a high-activity pullulanase gene was obtained (TaKaRa Taq DNA polymerase was used).

(17) Primers were designed as follows:

(18) TABLE-US-00002 ForwardprimerP1(SEQIDNo.5): 5-TAAGAAGGAGATATACCATGGACAGCACCAGTACCAAGGTCAT C-3 ReverseprimerP2(SEQIDNo.6): 5-GTGGTGGTGGTGGTGCTCGAGTTACTGCTTAAGGATCAAAGTG GAGA-3

(19) The amplification template was the genome DNA obtained in example 1, the reaction system of the amplification was as follows:

(20) TABLE-US-00003 10 Tag PCR buffer 5 L dNTPs (2 mmol/L each) 5 L Forward primer P1 1.5 L (10 mol/L) Reverse primer P2 1.5 L (10 mol/L) 25 mmol/L MgCl.sub.2 11 L 5 mmol/L MnCl.sub.2 5 L Amplification template 20 pmol (genome DNA) TagDNA polymerase 1 L ddH.sub.2O complement to 50 L

(21) The amplification conditions were as follows: the reaction system was pre-denatured at 95 C. for 3 minutes; denatured at 95 C. for 60 seconds; and annealed at 61 C. for 60 seconds, extended at 72 C. for 180 seconds; after 30 cycles, the reaction system was incubated at 72 C. for 10 minutes, and then stored at 4 C.

(22) The PCR amplification product was detected by 1.0% agarose gel electrophoresis, a band of about 2800 bp was observed (FIG. 1). The PCR amplification product does not need to be treated, which can be instantly used for the construction of recombinant vector, and also can be stored for a long time at 20 C.

(23) 2. Linearization of the Expression Vector

(24) A conventional restriction enzyme of Takara was used to linearize the PET-28 plasmid, the reaction system was as follows:

(25) TABLE-US-00004 Nco I 5 L Xho I 5 L 10*K buffer 10 L 0.1% BSA 10 L pET-28a 5 g ddH.sub.2O complement to 100 L

(26) The linearization conditions are as follows: the reaction system was incubated at 37 C. for 3 hours; at 65 C. for 20 minutes, and then stored at 4 C. The linearized product can be immediately used for the construction of expression vector and can also be stored for a long time at 20 C.

(27) 3. Construction of Expression Vector Library

(28) The pul mutant expression vector library was constructed by using the one-step ligase of ClonExpress II of Vazyme to connect the error-prone PCR product with the linearized PET-28a. In order to ensure sufficient storage capacity, five connecting reactions were carried out at the same time, the connecting system was 100 L in total.

(29) The connecting system comprised the following components:

(30) TABLE-US-00005 5*CE II buffer 4 L Error-prone PCR product 112 ng Linearized PET-28a 110 ng Exnase II 2 L ddH.sub.2O complement to 20 L Note: the connecting system was prepared in an ice bath.

(31) The reaction conditions were as follows: the connecting system was incubated at 37 C. for 30 minutes; and at 4 C. for 5 minutes.

(32) After the reaction was finished, the product can be stored at 4 C. in a short term or stored at 20 C. in a long term.

(33) 4. Construction of Pul Mutant Expression Strain Library

(34) 20 L of the pul mutant expression vector obtained in step 3 was transformed into the expression strain Escherichia coli BL21 in the following manner:

(35) The competent cells of E. coli BL21 (100 L for each) were taken out from 80 C., and placed on ice to be dissolved, then immediately 20 L of the pul mutant expression vector was added thereto in an aseptic environment after dissolving. Then, the system was placed on ice for 30 minutes, and heat shocked by a water bath for 90 s at 42 C., cooled on ice for 1.5 min. Afterwards, 900 L of LB medium was added thereto, and a pre-cultivation was performed at 37 C., 200 r/min for 30 min, then a centrifugation was carried out for 2 min at the speed of 3000 rpm. The supernate of 600 L was skimmed, and the residual supernate were uniformly mixed with the resulting thallus sediment through blowing-suction by a pipettor to obtain a concentrated bacterial solution. Further, each 100 L of the concentrated bacterial solution was spreaded on an LB flat plate with kanamycin resistance, each group was provided with four parallel, and all inverted on the constant-temperature incubator to subject to a cultivation at 37 C. for one night.

(36) Finally, 20 flat plates with recombinant strain were obtained, sealed with sealing film and placed at 4 C. for short-term storing.

(37) 5. Screening of the High-activity Pullulanase Gene

(38) At least 2000 positive transformants were selected from the 20 flat plates with recombinant strain of step 4, and each of the positive transformants was divided to two parts, one was inoculated into a new flat plate with kanamycin resistance which used for strain preservation; meanwhile, the other was inoculated in a 96-well plate with 200 L LB liquid medium for each well (which contains 30 g/mL of kanamycin).

(39) The flat plate used for strain preservation was cultured overnight at 37 C., and then sealed with a sealing film, stored at 4 C.

(40) The 96-well plates were cultured at 37 C., 200 r/min. When OD.sub.600 reached 0.6, each of the wells was added with IPTG (final concentration of 1 mmol/L), and then an induction was performed at 16 C. for 16 h followed by a centrifugation at 4 C. 4000 r/min for 15 minutes to obtain the thallus. The obtained thallus was resuspended in 15 mL of pre-cooled PBS buffer solution with pH 7.4, and a cell disruption treatment was performed to crush cells by using a low-temperature ultrahigh-pressure continuous flow cell disruption instrument. After the disruption treatment was completed, a centrifugation was carried out at 4 C., 12000 r/min for 45 minutes to collect the supernate to obtain a crude enzyme solution. Then, an enzyme activity measurement was carried out on the crude enzyme solution. The measurement result showed that the enzyme activity of the mutant pulm is the highest, it was improved by 57.03% compared with that of the wild type pul. The mutant pulm was sent to Beijing Huada Gene Science and Technology Co., Ltd. to finish the gene sequencing by using a universal primer T7/T7 ter, the sequencing result showed that the mutator gene-pulm has a nucleotide sequence as shown in SEQ ID NO. 3 which encoded an amino acid with Gly547Cys, Asn549Thr and Leu623Phe compared with the PUL.

Example 3 Construction of a Recombinant Pichia Pastoris Freely Expressing the Pullulanase Mutant

(41) The high-activity pullulanase gene (pulm) was linked with a Pichia Pastoris secretory expression vector-pGAPZC to construct the recombinant expression vector pGAPZC-pulm, and tansformed into the Pichia Pastoris.

(42) 1. Construction of the Recombinant Expression Vector pGAPZC-Pulm

(43) The pGAPZC was a fusion expression vector and provided with an alpha factor secreting signal peptide which can secrete protein out of Pichia pastoris cells made the protein convenient to be purified; meanwhile, the Zeocin resistant gene on pGAPZC was used for preserving and screening of recombinant strains;

(44) The MCS (multiple cloning site) of pGAPZC include EcoRI, PmlI, XhoI, NotI and XbaI. EcoRI/XbaI were chosen to construct the recombinant expression vector pGAPZC-pulm. Primers used to amplify pulm and add restriction enzyme cutting site were as follows:

(45) TABLE-US-00006 ForwardprimerP5(SEQIDNo.7): GGAATTCGACAGCACCAGTACCAAGGTCATC (ContainstheEcoRIsite) ReverseprimerP6(SEQIDNo.8): GCTCTAGATTACTGCTTAAGGATCAAAGTGGAGA (ContainstheXbaIsite)

(46) The amplification template was pET28a-pulm, the amplification system was as follows (The Pyrobest DNA Polymerase of Takara was used in this system):

(47) TABLE-US-00007 Amplification template DNA 500 ng Pyrobest DNA Polymerase (5 U/L) 0.25 L 10 Pyrobest buffer II 5 L dNTPs (2.5 mmol/L each) 4 L Forward primer P5 (10 mol/L) 1.5 L Reverse primer P6 (10 mol/L) 1.5 L ddH.sub.2O complement to 50 L

(48) The amplification conditions were as follows: pre-denaturation at 98 C. for 3 minutes; denaturation at 98 C. for 10 seconds; annealing at 61 C. for 60 seconds, and extension at 7210 for 180 seconds. This process repeats for 30 cycles. Then, incubation was performed at 72 C. for 10 minutes. And the product was stored at 4 C. The PCR amplification product (pulm) was detected by 1.0% agarose gel electrophoresis, a band of about 2800 bp was observed. After being purified by the DNA Purification Kit the PCR amplification product can be immediately used for the construction of the recombinant expression vector, and also can be stored for a long time at 20 C.

(49) The purified pulm and the pGAPZC were respectively subjected to enzyme digestion by using the EcoRI/XbaI, the enzyme digestion system was as follows:

(50) TABLE-US-00008 EcoR I 5 L Xba I 5 L 10*M buffer 10 L (from TaKaRa) DNA 5 g ddH.sub.2O complement to 100 L

(51) 1.0% agarose gel electrophoresis was used to separate the enzyme digestion product, the pGAPZC and pulm fragments were recycled by gel extraction and linked by T4 ligase overnight. The connecting system was as follows:

(52) TABLE-US-00009 T4 ligase 1 L 10* T4 Buffer 2.5 L pGAPZaC 0.03 pmol pulm 0.3 pmol ddH2O complement to 25 L

(53) After the preparation of the connecting system was completed, the system was kept at 16 C. for 16 hours for connecting, and then stored at 4 C. Thus, the recombinant expression vector pGAPZC-pulm was completed.

(54) The heat shock method was used to transform the pGAPZC-pulm into E. coli DH5 competent cells. And the competent cells were spreaded onto the LB flat plate with Zeocin resistance and then cultured overnight. Then, the positive transformants were selected for plasmids extraction, then the plasmids were verified by enzyme digestion (FIG. 2) and sequencing was done to confirm the right recombinant expression vector pGAPZC-pulm was obtained.

(55) 2. Construction and Screening of Recombinant Strain Expressing High Activity Pullulanase Mutant

(56) (1) Preparation of the Linearized Plasmid DNA

(57) Before transformed into the Pichia Pastoris, the recombinant expression vector pGAPZC-pulm needed to be linearized, so that the integration efficiency of the plasmid on the Pichia Pastoris chromosome will be improved. And the linearization was completed by restriction endonuclease BspHI.

(58) (2) The Transformation of Linearized pGAPZC-Pulm into Pichia Pastoris, Identification of Positive Transformant, and Screening of Pullulanase Strain with High-Productivity

(59) {circle around (1)} 80 L of Pichia Pastoris SMD 1168 competent cells and 10 g of the linearized pGAPZC-pulm were added to a 1.5 ml pre-cooled centrifuge tube and mixed evenly, then transferred into a pre-cooled conversion cup;

(60) {circle around (2)} the conversion cup of step {circle around (1)} was placed in a ice bath for 5 min, and a electroporation was carried out on Pichia Pastoris SMD1168 according to the parameters recommended by the electroporation device;

(61) {circle around (3)} after the pulse, 1 ml of pre-cooled 1 mol/L sorbitol solution was added into the conversion cup immediately to obtain a transformation solution, then the transformation solution was transferred into a new 1.5 mL centrifuge tube;

(62) {circle around (4)} after a static culture at 30 C. for 1.5 h, 200 L of the transformation solution was sucked and spread onto the MD medium;

(63) {circle around (5)} a cultivation was carried out at 30 C. until the transformants appeared.

(64) {circle around (6)} a single colony of the transformants was selected and dissolved in 10 L of deionized water to get the bacterial suspension. 2 L of the bacterial suspension was taken and added with Lyticease to react for 10 min at 30 C. Then, the resulting reaction solution was placed into a refrigerator with the temperature of 80 C. to be frozen for 10 min, so that the cell wall of the yeast was cracked to release the genome. The released genome was used as a template for PCR. The positive transformant was identified by taking Pichia Pastoris SMD 1168 with empty pGAPZC as a control.

(65) {circle around (7)} on the basis that the positive transformant has been identified, screening of the high geneticin-resistant transformant was performed by using flat plate containing different concentrations of geneticin, and then the enzyme activity of the pullulanase of the high geneticin-resistant transformant was measured respectively to obtain the high-yield strain SMD 1168/pGAPZC-pulm of pullulanase.

Example 4 Expression and Preparation of Pullulanase Mutant by SMD 1168/pGAPZC-Pulm

(66) The recombinant bacterium SMD 1168/pGAPZC-pulm was inoculated to a YPD liquid medium and cultured at 30 C., 250 r/min for 24 h. Then the culture was transferred into a fresh BMGY medium at the inoculation amount of 1%, and cultured at 30 C., 250 r/min for 24 hours, and a centrifugation was carried out for 5 minutes at 6000 r/min to obtain the thallus. Then, the thallus was transferred into a BMMY medium, and cultured at 30 C., 250 r/min for 120 hours to obtain the crude enzyme liquid of the pullulanase. Then a high-activity pullulanase was precipitated by salt fractionation of the crude enzyme liquid, wherein the protein precipitate was collected, dissolved, desalted by dialysis, and treated by an ion exchange chromatography and a gel chromatography, and then the freeze drying, so as that the high-activity pullulanase pure enzyme powder was obtained.

(67) About 183 mg pure enzyme powder of pullulanase was obtained by every liter of culture medium. Example 5 Determination of the pullulanase activity

(68) 1. Assay Method

(69) DNS method: 50 L appropriately diluted pullulanase solution was added to 450 L buffer (the 5% pulullan solution and the buffer solution with pH5.0 were uniformly mixed in a ratio of 1:8), and then sufficient mixing was done to react 30 min at 50 C., and then 500 L DNS solution was added to terminate the reaction. A water bath was carried out for 10 minutes at 100 C., then OD.sub.540 values were measured.

(70) 2. Result

(71) The specific activity of PUL and PULM were assayed as 370 U/mg and 581 U/mg, it was shown that the specific activity has been improved by 57.03% after the mutation.

(72) Definition of specific enzyme activity: under determination conditions, the enzyme required by generating 1 mol of reducing sugar (Glucose) per minute from the hydrolyzation of pulullan is defined as an enzyme activity unit (U), the specific enzyme activity means the number of enzyme activity unit in per unit weight of protein, which was generally represented by U/mg protein.

(73) The SMD 1168/pGAPZC-pulm and Bacillus Acidopullulyticus were fermented as the method described in example 4, and then the pullulanase activity of the fermentation broth thereof was measured. It was shown that SMD 1168/pGAPZC-pulm was 106.4 U/ml and Bacillus Acidopullulyticus was 7.4 U/mL.

(74) The above embodiments only express several embodiments of the present invention, the description is specific and detailed, but is not to be construed as limiting the scope of the patent. It should be noted that for one of ordinary skill in the art, the above embodiments can also make a plurality of deformation, combinations and improvements without departing from the concept of the present invention, thereof, all of which belong to the scope of protection of this patent. Therefore, the protection scope of the invention should be determined by the appended claims.