DNA fragment, recombinant vector, transformant, and nitrogen fixation enzyme
11566249 · 2023-01-31
Assignee
Inventors
Cpc classification
C12N15/74
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
C12N5/10
CHEMISTRY; METALLURGY
International classification
Abstract
A DNA fragment to encode a nitrogen fixation enzyme includes a base sequence of SEQ ID NO:1 or a base sequence having not less than 50% identity with the SEQ ID NO:1.
Claims
1. A recombinant fosmid vector, comprising: the base sequence of SEQ ID NO:1, or a base sequence having not less than 95% identity with the base sequence of SEQ ID NO:1.
2. A recombinant fosmid vector, comprising any one of SEQ ID NOs: 2-10, 14, 17, 18, 25, or 26, and encoding a nitrogen fixation enzyme.
3. The recombinant fosmid vector of claim 1, which comprises a base sequence having not less than 95% identity with the base sequence of SEQ ID NO:1 and encoding a nitrogen fixation enzyme.
4. A transformant transformed by the recombinant fosmid vector of claim 1.
5. The recombinant fosmid vector of claim 1, which comprises the base sequence of SEQ ID NO:1.
6. A transformant transformed by the recombinant fosmid vector of claim 5.
7. The recombinant fosmid vector of claim 1, which comprises a base sequence having not less than 98% identity with the base sequence of SEQ ID NO:1 and encoding a nitrogen fixation enzyme.
8. A transformant transformed by the recombinant fosmid vector of claim 2.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
DESCRIPTION OF EMBODIMENTS
(4) (DNA fragment)
(5)
(6) A DNA fragment 2 in the embodiment of the invention has a base sequence of SEQ ID NO:1, or a base sequence having not less than 50% identity with the SEQ ID NO:1, which encodes a nitrogen fixation enzyme. In the embodiment of the invention, the nitrogen fixation enzyme means a nitrogen fixation enzyme allowing for elimination of the need for a nitrogen source required to be added to a medium for multiplication of Escherichia coli, or a nitrogen fixation enzyme allowing for multiplication of Escherichia coli without adding a metallic element required for nitrogenase, such as V or Mo, to a medium. In a more desirable embodiment of the invention, it means a nitrogen fixation enzyme which is active in photosynthetic organisms producing oxygen, such as algae or plants.
(7) The DNA fragment having a base sequence of SEQ ID NO:1 (indicated by the number 2 in
(8) The base sequence encoding the nitrogen fixation enzyme may be a base sequence having not less than 500% identity with the SEQ ID NO:1, and is preferably a base sequence having not less than 60% identity with the SEQ ID NO:1, more preferably a base sequence having not less than 70% identity with the SEQ ID NO:1, further preferably a base sequence having not less than 80% identity with the SEQ ID NO:1, further preferably a base sequence having not less than 90% identity with the SEQ ID NO:1, further preferably a base sequence having not less than 95% identity with the SEQ ID NO:1, and further preferably a base sequence having not less than 98% identity with the SEQ ID NO:1.
(9) The DNA fragment having a base sequence of SEQ ID NO:1 or a base sequence having not less than 50% identity with the SEQ ID NO:1 may be artificially synthesized by a genetic engineering procedure.
(10) The DNA fragment in the embodiment of the invention has any one or more of base sequences of SEQ ID NOs:2 to 33 which encode the nitrogen fixation enzyme. The base sequences of SEQ ID NOs:2 to 33 respectively correspond to open reading frames (Gene ID: from cce_2943 to cce_2974) shown in
(11) The DNA fragment in the embodiment of the invention has preferably not less than 5, more preferably not less than 10, further preferably not less than 15, further preferably not less than 20, further preferably not less than 25, further preferably not less than 28, and further preferably not less than 30 of the base sequences of SEQ ID NOs:2 to 33. The order of the base sequences of SEQ ID NOs:2 to 33 may be changed but is preferably not changed.
(12) The DNA fragment 2 in the embodiment of the invention shown in
(13) The DNA fragment having any one or more of the base sequences of SEQ ID NOs:2 to 33 is derived from, e.g., a genomic DNA of cyanobacteria. The cyanobacteria is, e.g., Cyanothece sp. ATCC 51142.
(14) The DNA fragment 2 can be isolated from a cyanobacterial genomic DNA by following the commonly performed operating procedure as described in 1 to 5 below. In more detail, it is possible to isolate according to, e.g., Example which is described later. The procedure of each operation is not specifically limited and various known methods can be employed.
(15) 1. Mass culture of Cyanobacteria
(16) 2. Extraction and Fragmentation of Genomic DNA of cyanobacteria: As a step of increasing purity of DNA, polysaccharides may be removed after the fragmentation.
(17) 3. Cloning
(18) (1) Modify the ends of DNA fragments (2) Sort according to size by electrophoresis (e.g., using a low-melting-point agarose for polymer separation, at 18V for 24 hours) (3) Collect DNA fragments of about 25 to 40 kb (4) Insert each of the collected DNA fragments into a vector (e.g., a fosmid vector), thereby forming vectors with various DNA fragments (recombinant vectors)
4. Produce Transformant (1) The vectors with various DNA fragments are introduced (packaging) into bacteriophages (2) Infect Host such as Escherichia coli with the bacteriophages in the above (1), thereby obtaining Escherichia coli having vectors with various DNA fragments (transformants) (3) The transformants are grown in agar media and then obtained as colonies
5. Screening (1) Select Escherichia coli which can be grown in media not containing any nitrogen source (a nitrogen compound such as ammonium chloride, sodium nitrate) (2) Extract the vectors from the Escherichia coli (3) Decode genetic information of the DNA fragments inserted into the vectors
(19) The DNA fragment having any one or more of the base sequences of SEQ ID NOs:2 to 33 may be artificially synthesized by a genetic engineering procedure.
(20) (Recombinant Vector)
(21)
(22) A recombinant vector 3 in the embodiment of the invention contains the above-described DNA fragment in the embodiment of the invention. The recombinant vector 3 is preferably obtained by incorporating (inserting) the DNA fragment into a fosmid vector, but it is not limited thereto. It may be obtained by incorporation into, e.g., a plasmid vector, a cosmid vector or a virus vector, etc.
(23) The recombinant vector 3 in the embodiment of the invention can be obtained by following, e.g., the above-mentioned operating procedure for isolating the DNA fragment 2 from the cyanobacterial genomic DNA.
(24) (Transformant)
(25) The transformant in the embodiment of the invention is obtained by transforming a host such as Escherichia coli using the above-described recombinant vector in the embodiment of the invention.
(26) The transformant in the embodiment of the invention can be obtained by following, e.g., the above-mentioned operating procedure for isolating the DNA fragment 2 from the cyanobacterial genomic DNA.
(27) (Nitrogen Fixation Enzyme)
(28) The nitrogen fixation enzyme in the embodiment of the invention is expressed by the above-described transformant in the embodiment of the invention. The nitrogen fixation enzyme in the embodiment of the invention preferably has amino sequences of SEQ ID NOs: 34 to 65 which are arranged in this order (with SEQ ID NO: 34 on the left end side and SEQ ID NO: 65 on the right end side) and respectively correspond to the base sequences of SEQ ID NOs:2 to 33 (see Table 1 below; SEQ ID NO:2 corresponds to SEQ ID NO: 34, . . . and SEQ ID NO:33 corresponds to SEQ ID NO: 65). Any one or more of the amino acid sequences of SEQ ID NOs: 34 to 65 may be amino acid sequences in which one or more amino acids are inserted, replaced, deleted and/or added and which encode a nitrogen fixation enzyme functionally equivalent to the above-described nitrogen fixation enzyme (the same applied to the nitrogen fixation enzyme in an another embodiment of the invention described later). In such a nitrogen fixation enzyme, e.g., 1 to 30, preferably 1 to 20, more preferably 1 to 10, further preferably 1 to 5, most preferably 1 to 2 amino acids can be inserted, replaced, deleted and/or added (the same applied to the nitrogen fixation enzyme in an another embodiment of the invention described later).
(29) TABLE-US-00001 TABLE 1 Gene Gene product Gene ID SEQ Protein ID SEQ (CyanoBase- Type of Molecular Number of Length ID (NCBI-Protein Type of Molecular Length ID ID) Sequence type strands Topology (bp) NO ID) Sequence type Topology (aa) NO cce_2943 DNA cDNA Double- Linear 1665 2 ACB52291 Amino acid Protein Linear 554 34 stranded cce_2944 DNA cDNA Double- Linear 3198 3 ACB52292 Amino acid Protein Linear 1065 35 stranded cce_2945 DNA cDNA Double- Linear 1572 4 ACB52293 Amino acid Protein Linear 523 36 stranded cce_2946 DNA cDNA Double- Linear 885 5 ACB52294 Amino acid Protein Linear 294 37 stranded cce_2947 DNA cDNA Double- Linear 525 6 ACB52295 Amino acid Protein Linear 174 38 stranded cce_2948 DNA cDNA Double- Linear 465 7 ACB52296 Amino acid Protein Linear 154 39 stranded cce_2949 DNA cDNA Double- Linear 600 8 ACB52297 Amino acid Protein Linear 199 40 stranded cce_2950 DNA cDNA Double- Linear 321 9 ACB52298 Amino acid Protein Linear 106 41 stranded cce_2951 DNA cDNA Double- Linear 1566 10 ACB52299 Amino acid Protein Linear 521 42 stranded cce_2952 DNA cDNA Double- Linear 183 11 ACB52300 Amino acid Protein Linear 60 43 stranded cce_2953 DNA cDNA Double- Linear 345 12 ACB52301 Amino acid Protein Linear 114 44 stranded cce_2954 DNA cDNA Double- Linear 702 13 ACB52302 Amino acid Protein Linear 233 45 stranded cce_2955 DNA cDNA Double- Linear 486 14 ACB52303 Amino acid Protein Linear 161 46 stranded cce_2956 DNA cDNA Double- Linear 96 15 ACB52304 Amino acid Protein Linear 31 47 stranded cce_2957 DNA cDNA Double- Linear 714 16 ACB52305 Amino acid Protein Linear 237 48 stranded cce_2958 DNA cDNA Double- Linear 543 17 ACB52306 Amino acid Protein Linear 180 49 stranded cce_2959 DNA cDNA Double- Linear 912 18 ACB52307 Amino acid Protein Linear 303 50 stranded cce_2960 DNA cDNA Double- Linear 99 19 ACB52308 Amino acid Protein Linear 32 51 stranded cce_2961 DNA cDNA Double- Linear 933 20 ACB52309 Amino acid Protein Linear 310 52 stranded cce_2962 DNA cDNA Double- Linear 780 21 ACB52310 Amino acid Protein Linear 259 53 stranded cce_2963 DNA cDNA Double- Linear 816 22 ACB52311 Amino acid Protein Linear 271 54 stranded cce_2964 DNA cDNA Double- Linear 129 23 ACB52312 Amino acid Protein Linear 42 55 stranded cce_2965 DNA cDNA Double- Linear 267 24 ACB52313 Amino acid Protein Linear 88 56 stranded cce_2966 DNA cDNA Double- Linear 1065 25 ACB52314 Amino acid Protein Linear 354 57 stranded cce_2967 DNA cDNA Double- Linear 1107 26 ACB52315 Amino acid Protein Linear 368 58 stranded cce_2968 DNA cDNA Double- Linear 444 27 ACB52316 Amino acid Protein Linear 147 59 stranded cce_2969 DNA cDNA Double- Linear 285 28 ACB52317 Amino acid Protein Linear 94 60 stranded cce_2970 DNA cDNA Double- Linear 1011 29 ACB52318 Amino acid Protein Linear 336 61 stranded cce_2971 DNA cDNA Double- Linear 1560 30 ACB52319 Amino acid Protein Linear 519 62 stranded cce_2972 DNA cDNA Double- Linear 387 31 ACB52320 Amino acid Protein Linear 128 63 stranded cce_2973 DNA cDNA Double- Linear 1221 32 ACB52321 Amino acid Protein Linear 406 64 stranded cce_2974 DNA cDNA Double- Linear 204 33 ACB52322 Amino acid Protein Linear 67 65 stranded
(30) Alternatively, the nitrogen fixation enzyme in the embodiment of the invention may have any one or more of the amino sequences of SEQ ID NOs: 34 to 65.
(31) The nitrogen fixation enzyme in the embodiment of the invention has preferably not less than 5, more preferably not less than 10, further preferably not less than 15, further preferably not less than 20, further preferably not less than 25, further preferably not less than 28, and further preferably not less than 30 of the amino sequences of SEQ ID NOs: 34 to 65. The order of the amino sequences of SEQ ID NOs: 34 to 65 ma be changed but is preferably not changed.
(32) In addition, the nitrogen fixation enzyme in another embodiment of the invention is not limited to that expressed by the above-described transformant in the embodiment of the invention as long as it is a nitrogen fixation enzyme having the same amino acid sequence as that of the above-described nitrogen fixation enzyme in the embodiment of the invention. For example, it may be, e.g., that synthesized by a commercially available protein synthesizer.
(33) The nitrogen fixation enzyme described above is not limited to that having the same amino acid sequence as that of the above-described nitrogen fixation enzyme in the embodiment of the invention and may be a nitrogen fixation enzyme with an amino acid sequence having not less than 40% identity with said amino acid sequence. It is preferably a nitrogen fixation enzyme with an amino acid sequence having not less than 50% identity with said amino acid sequence, more preferably a nitrogen fixation enzyme with an amino acid sequence having not less than 60% identity with said amino acid sequence, further preferably a nitrogen fixation enzyme with an amino acid sequence having not less than 70% identity with said amino acid sequence, further preferably a nitrogen fixation enzyme with an amino acid sequence having not less than 80% identity with said amino acid sequence, further preferably a nitrogen fixation enzyme with an amino acid sequence having not less than 90% identity with said amino acid sequence, further preferably a nitrogen fixation enzyme with an amino acid sequence having not less than 95% identity with said amino acid sequence, and further preferably a nitrogen fixation enzyme with an amino acid sequence having not less than 98% identity with said amino acid sequence.
(34) The nitrogen fixation enzyme with an amino acid sequence having not less than 40% identity with the above-described nitrogen fixation enzyme may be artificially synthesized by a commercially available protein synthesizer.
(35) “Identity” of the base sequence or the amino acid sequence as used herein means a level of homology of bases, or amino acid residues, constituting each sequence between sequences to be compared. Regarding the amino acid sequence, a presence of gaps and properties of amino acid are taken account of (Wilbur, Proc. Natl. Acad. Sci. U.S.A. 80:726-730 (1983)). To calculate the identity, it is possible to use BLAST (Altschul: J. Mol. Biol. 215: 403-410 (1990)) or FASTA (Peasron: Methods in Enzymology 183:63-69 (1990)), etc., which are commercially available software. Any numerical values for “identity” only need to be numerical values calculated by a homology search program known to those skilled in the art and can be calculated by using, e.g., default (initial setting) parameters on homology algorithm BLAST (Basic local alignment search tool) hypertext transfer protocol/www./ncbi.nlm.nih.gov/BLAST of National Center for Biotechnology Information (NCBI).
Effects of the Embodiments of the Invention
(36) The following effects are obtained in the embodiments of the invention.
(37) (1) It is possible to provide a DNA fragment which encodes a nitrogen fixation enzyme allowing for elimination of the need for a nitrogen source required to be added to a medium for multiplication of Escherichia coli, a recombinant vector containing the DNA fragment, a transformant transformed by the recombinant vector, and the nitrogen fixation enzyme.
(2) It is possible to provide a DNA fragment which encodes a nitrogen fixation enzyme allowing for multiplication of Escherichia coli without adding a rare metallic element such as V or Mo to a medium, a recombinant vector containing the DNA fragment, a transformant transformed by the recombinant vector, and the nitrogen fixation enzyme.
(3) The nitrogen fixation enzyme is expressed using a gene derived from cyanobacteria which is a photosynthetic organism producing oxygen (it is a nitrogen fixation enzyme different from nitrogenase). Therefore, it is possible to carry out nitrogen fixation in photosynthetic organisms producing oxygen, such as algae or plants.
(4) It is an energy-saving nitrogen fixation reaction which works under ordinary temperature and normal pressure and it is thus possible to significantly reduce the energy cost as compared to the Haber-Bosch process which requires a large amount of energy in a high-temperature and high-pressure environment.
(5) By introducing the DNA fragment in the embodiment of the invention into industrially useful bacteria, algae or plants, it is possible to obtain a species which can be grown without the need for nitrogen fertilizer (ammonia, ammonium chloride, sodium nitrate, etc.).
EXAMPLES
(38) The invention will be described in more detail below based on Examples below. However, the invention is not limited thereto.
(39) (Isolation of DNA Fragment to Encode a Nitrogen Fixation Enzyme of the Invention)
(40) A genomic DNA extracted from cyanobacteria Cyanothece sp. ATCC 51142 (ATCC number (accession number): 51142) was physically sheared, in detail, an extracted genomic DNA solution was drawn up and dispensed five times by a fine-tipped pipette tip (from Quality Scientific Plastics, Inc.) and blunt ends were generated by End-Repair Enzyme Mix (from Epicentre). Alternatively, vortex or sonication, etc., may be used for the physical shearing. The blunt-ended DNA fragments were sorted by size using electrophoresis, and the DNA fragments having an average strand length of 25 to 40 kb were extracted. Next, the DNA fragments were respectively ligated to CopyControl™, pCC2FOS™ Fosmid Vectors (from Epicentre) having a chloramphenicol resistance gene (cut and linearized at Eco72 I site (between 382.sup.nd C and 383.sup.rd G) and dephosphorylated) (see
(41) A colony of the transformed Escherichia coli was taken and placed in 4 mL of LB medium (LB/Cm) containing 12.5 mg/mL of chloramphenicol, and cultured in the air at 37° C. and 180 rpm for 18 hours. Next, the cultured Escherichia coli was collected, was washed three times with a M9−N medium (0.6% Na.sub.2HPO.sub.4, 0.3% KH.sub.2PO.sub.4, 0.05% NaCl, 0.2% glucose, 0.00147% CaCl.sub.2×2H.sub.2O, 0.05% MgSO.sub.4×7H.sub.2O, 0.01% L-leucine) not containing any nitrogen source (a nitrogen compound such as ammonium chloride, sodium nitrate), and was then resuspended with a M9−N medium. The prepared Escherichia coli suspension was plated into a M9−N medium (M9−N/Cm) agar plate containing 12.5 mg/mL of chloramphenicol and was cultured at 37° C. for 72 hours. The obtained colony was subcultured in a M9−N medium (M9−N/Cm) agar plate again, and a strain showing growth was isolated as a clone with nitrogen fixation phenotype. The clone was named Transformant 1.
(42) Next, a base sequence inserted into the fosmid vector of the clone exhibiting nitrogen fixation phenotype was analyzed. As a result, it was found that the previously-described base sequence of SEQ ID NO:1 was inserted into the transformant 1. In this base sequence, it was found that the previously-mentioned thirty-two open reading frames having the base sequences of SEQ ID NOs:2 to 33 are contained and respectively encode the previously-described amino sequences of SEQ ID NOs: 34 to 65. These protein's amino acid sequences are not homologous with the known nitrogen-fixing protein (nitrogenase) and it was thus judged that the nitrogen fixation enzyme and the DNA fragment encoding it, which were obtained in this example, are novel. The base sequence inserted into the fosmid vector was analyzed using pCC2 forward-b and pCC2 reverse-b primers. The base sequences of the used primers are as followed;
(43) TABLE-US-00002 pCC2 forward-b; (SEQ ID NO: 67) CCAGTCACGACGTTGTAAAACG pCC2 reverse-b; (SEQ ID NO: 68) CGCCAAGCTATTTAGGTGAGAC
(Evaluation of Nitrogen Fixation Ability of the Transformant)
(44) Using a M9−N medium not containing a nitrogen source, a multiplication test was conducted to evaluate nitrogen fixation ability of the transformant 1. The transformant 1 (Example 1) and EPI300 with a pCC2FOS™ Fosmid Vector (from Epicentre) with no DNA fragment insertion described above (Comparative Example 1) were cultured for 24 hours in M9+N media (M9+N/Cm) each obtained by adding 0.1% ammonium chloride as a nitrogen source to a M9−N medium, and bacterial cells were collected, were washed three times with a M9−N medium and were then inoculated into 5 mL of a M9−N medium (M9−N/Cm) so that the optical density at a wavelength of 660 nm (hereinafter, described as OD660) was 0.02. Shaking culture was carried out at 37° C. and 45 rpm by using a small shaking culture apparatus [Bio Photo Recorder (trademark) TVS062CA, from Toyo Co., Ltd.] and OD660 of the broth was measured every hour. The multiplication test results are shown in
(45) In the M9−N medium (M9−N/Cm) not containing a nitrogen source, multiplication of Escherichia coli EPI-300 (Comparative Example 1) was significantly inhibited but the transformant 1 (Example 1) exhibited rapid multiplication. This result shows that nitrogen fixation ability can be provided by introducing the DNA fragment, obtained in this example and encoding the nitrogen fixation enzyme, into Escherichia coli.
(46) The invention is not limited to the embodiments and Example and can be changed in various ways.
REFERENCE SIGNS LIST
(47) 1 GENOMIC DNA 2 DNA FRAGMENT 3 FOSMID VECTOR (RECOMBINANT VECTOR)