Dehydrogenase mutant L283V/L286V, and preparation method and use thereof
11873515 ยท 2024-01-16
Assignee
- GOLDEN HEALTH (GUANGDONG) BIOTECHNOLOGY CO., LTD. (Foshan, CN)
- TF BIOSYN BIOTECHNOLOGY CO., LTD. (Foshan, CN)
Inventors
- JIAJUN HUANG (FOSHAN, CN)
- RONGXU LI (FOSHAN, CN)
- ZIYING WU (FOSHAN, CN)
- HAOXUAN HU (FOSHAN, CN)
- SHAOYU BAI (FOSHAN, CN)
- DAVID ZHOU (FOSHAN, CN)
- TONY LU (FOSHAN, CN)
Cpc classification
C12N15/70
CHEMISTRY; METALLURGY
C12Y102/04001
CHEMISTRY; METALLURGY
C12N9/0008
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention provides a dehydrogenase mutant L283V/L286V, and a preparation method and use thereof, and relates to the field of biomedicine technologies. An amino acid sequence of the mutant L283V/L286V is as shown in SEQ ID NO: 1; and the mutant is prepared by simultaneously mutating 283.sup.rd and 286.sup.th leucine of a dehydrogenase with an amino acid sequence as shown in SEQ ID NO: 3 into valine. The dehydrogenase mutant L283V/L286V shows high selectivity in catalyzing myosmine reduction reaction in a whole cell system to produce S-nornicotine, and has relatively high dehydrogenase and imine reductase activities, a short enzyme reduction time, and a high transformation rate. The product S-nornicotine obtained through the reaction has extremely high optical purity, which reduces the operation difficulty of subsequent purification.
Claims
1. A dehydrogenase mutant comprising the amino acid sequence as shown in SEQ ID NO: 1.
2. A nucleic acid encoding the dehydrogenase mutant according to claim 1, wherein the nucleic acid comprises a nucleotide sequence comprising SEQ ID NO: 2.
3. A method for preparing the dehydrogenase mutant according to claim 1, comprising the following steps: S1: ligating a starting gene encoding a Mesorhizobium 6-phosphoglycerate dehydrogenase (MesPDH) enzyme into a plasmid to obtain a recombinant plasmid, wherein the MesPDH enzyme comprises the amino acid sequence as shown in SEQ ID NO: 3; S2: performing PCR amplification to produce a mutant gene as a product by contacting two mutation primers with the recombinant plasmid as a template, wherein PCR amplification results in the mutant gene encoding SEQ ID NO: 1 so that 283.sup.rd and 286.sup.th amino acids of SEQ ID NO: 3 encoded by the starting gene are both simultaneously mutated to encode valine, and recovering the mutant gene; and S3: transforming the mutant gene into a host cell, culturing the host cell, and inducing expression of the mutant gene in the host cell to obtain the dehydrogenase mutant.
4. The preparation method according to claim 3, wherein a nucleotide sequence of the starting gene encoding the MesPDH enzyme comprises the nucleotide sequence as shown in SEQ ID NO: 4.
5. The preparation method according to claim 3, wherein the two mutation primers comprise a primer 283/286-F and a primer 283/286-R; wherein the primer 283/286-F comprises the nucleotide sequence as shown in SEQ ID NO: 5, and the primer 283/286-R comprises the nucleotide sequence as shown in SEQ ID NO: 6.
6. The preparation method according to claim 3, wherein the host cell is Escherichia coli.
7. The preparation method according to claim 3, wherein in step S2 PCR amplification comprises performing pre-denaturation at 98 C. for 3 min; and then performing 30 cycles of denaturing at 98 C. for 10 s, annealing at 62 C. for 15 s, and extending at 72 C. for 2 min; and after the 30 cycles, performing extension at 72 C. for 10 min.
8. A method for preparing (S)-nornicotine, comprising: contacting an Escherichia coli whole cell containing a dehydrogenase mutant according to claim 1 with myosmine and glucose to produce (S)-nornicotine.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
DESCRIPTION OF EMBODIMENTS
(10) The present invention is further described below with reference to the accompanying drawings and specific implementations. It should be noted that the embodiments or technical features described below can be arbitrarily combined to form new embodiments provided that no conflict occurs. The following provides specific embodiments of the present invention, and the raw materials, equipment and the like used in the following embodiments can be obtained by purchasing, unless otherwise specified.
(11) In the following embodiments, experimental methods with indicated specific conditions are provided, usually based on conventional experimental conditions or experimental conditions suggested by manufacturers. Unless otherwise specified, various reaction reagents involved in the embodiments can be purchased through commercial channels. For the experimental methods of molecular biology not specifically described in this embodiment, references may be made to the Molecular Cloning: A Laboratory Manual.
Embodiment 1
(12) Establishment of a Tertiary Structure Model of an MesPDH Enzyme:
(13) 1. 6-phosphogluconate dehydrogenase MesPDH from Mesorhizobium sp. L48C026A00 was analyzed, a homologous modeling tool MODELLER was used to perform homologous modeling on MesPDH to obtain a monomer MesPDH enzyme model Ma, the model was evaluated, a Ramachandran diagram showed that all amino acids were in a reasonable region, and the proportion of amino acids in the best region was as high as 97.3%. The model is reasonable, and the model Ma is shown in
(14) 2. Swiss-model, an online homologous modeling tool, was used to perform homologous modeling on MesPDH to obtain a dimer MesPDH enzyme model Mb, the model was evaluated, a Ramachandran diagram showed that all amino acids were in a reasonable region, and the proportion of amino acids in the best region was as high as 94.6%. The model is reasonable, and the model Mb is shown in
(15) 3. RoseTTAFold, an online modeling tool, was used to perform model prediction on MesPDH to obtain a monomer MesPDH enzyme model Mc, the model was evaluated, a Ramachandran diagram showed that all amino acids were in a reasonable region, and the proportion of amino acids in the best region was as high as 96.2%. The model is reasonable, and the model Mc is shown in
Embodiment 2
(16) Molecular docking simulation was used to predict a binding conformation of each substrate and an enzyme and sites were selected.
(17) 1. Molecular Docking Simulation
(18) Molecular simulation software Discovery Studio was used to locate active pocket centers of three modeling models, and molecular docking software AutodockVina was used to dock the MesPDH enzyme with myosmine, glucose, gluconic acid, NAD+, and NADH. A protein conformation analysis tool PyMOL was used to analyze each docking complex.
(19) 2. Docking Result Analysis
(20) As shown in
(21) 3. Selection of Amino Acid Sites
(22) Based on the foregoing three different models and the results of molecular docking, to enhance the dehydrogenase activity without affecting the imine reduction activity of the enzyme, the mutation sites were selected as amino acids L283 and L286, which were close to glucose and the surface of the enzyme molecule. By mutating leucine into valine, side chain groups of these two amino acids were shortened, the size of substrate active pocket was increased, and the composition of hydrophobic amino acids in the active pocket was not changed.
Embodiment 3
(23) Acquisition of Recombinant Wild Enzyme Strain BL21(DE3)/pET-32a-MesPDH:
(24) The whole gene was synthesized and optimized by using codon preference of Escherichia coli to obtain the MesPDH enzyme gene, with a nucleotide sequence as shown in SEQ ID NO: 4. The gene was ligated to a pET-32a plasmid, and the obtained recombinant plasmid was named pET-32a-MesPDH. The plasmid was transformed into Escherichia coli BL21(DE3) and the recombinant strain was named BL21(DE3)/pET-32a-MesPDH. The amino acid sequence of the wild-type MesPDH enzyme expressed by the recombinant wild-type enzyme strain is as shown in SEQ ID NO: 3.
Embodiment 4
(25) Acquisition of MesPDH Mutant Strains:
(26) 1. Construction of a Mutant Vector by Full Plasmid PCR
(27) (1) Small amount of plasmid extraction of recombinant plasmid pET-32a-MesPDH
(28) (2) A mutation primer was designed and had a 15 bp overlap region and 15 bp extension region, and the mutation site was designed in the overlap region. Plasmid pET-32a-MesPDH was used as a template for PCR full plasmid amplification, and a PCR system is shown in Table 1:
(29) TABLE-US-00001 TABLE 1 PCR System 2 PrimeSTAR Max DNA Polymerase 25 L pET-3 2a-MesPDH 1 L 283/286-F 1 L 283/286-R 1 L ddH.sub.2O Add to 50 L
(30) The mutation primers include a primer 283/286-F (as shown in SEQ ID NO. 5) and a primer 283/286-R (as shown in SEQ ID NO. 6), and the primer 283/286-F and the primer 283/286-R are a PCR upstream primer and downstream primer designed to simultaneously mutate the 283.sup.rd and 286.sup.th amino acids into valine. Specific primer information is shown in Table 2.
(31) TABLE-US-00002 TABLE2 MutationPrimers Sequence(5-3) SEQID Primers (mutategeneunderlined) NO. 283/286-F gatgttgcaagcgttgcattactgtttcgtaat 5 283/286-R tgcaacgcttgcaacatcgtcttccatgcttcc 6
(32) A mutant L283V/L286V was prepared by using the primer 283/286-F and the primer 283/286-R and PCR amplification. An amino acid sequence of the mutant L283V/L286V is as shown in SEQ ID NO: 1; and a nucleotide sequence of the gene encoding the mutant L283V/L286V is as shown in SEQ ID NO: 2.
(33) PCR amplification procedure: pre-denaturation was performed at 98 C. for 3 min; and a cycle was set to: denaturing at 98 C. for 10 s, annealing at 62 C. for 15 s, and extending at 72 C. for 2 min; 30 cycles were performed; finally extension was performed at 72 C. for 10 min; and after the reaction, a PCR product was recovered by using a kit.
(34) (3) The template DNA was removed through enzyme digestion, and the PCR product underwent enzyme digestion. An enzyme digestion system is shown in Table 3:
(35) TABLE-US-00003 TABLE 3 QuickCut Dpn I 1 L PCR Product 1 L 10 QuickCut Buffer 3 L ddH.sub.2O Add to 30 L
(36) The enzyme digestion system was digested in a metal bath at 37 C. for 1 h, and after the reaction, an enzyme digestion product was recovered by using a kit to obtain a mutant product.
(37) 2. Sequencing Verification and Successful Construction of Mutant Strains
(38) The mutant product was transformed into competent cells of Escherichia coli BL21(DE3), inverted at 37 C. for overnight culture, quasi-positive transformants were selected for sequencing verification, and mutant expression strains were successfully obtained.
Embodiment 5
(39) Whole Cell Catalytic Reaction of a Dehydrogenase Mutant L283V/L286V
(40) 1. Induction of Recombinant Strains of MesPDH and Recombinant Strains of a Mutant and Preparation of a Whole Cell Enzyme Solution
(41) (1) BL21(DE3)/pET-32a-MesPDH and BL21(DE3)/pET-32a-L283V/L286V strains were taken, and activated by streaking on an LB plate containing Amp (100 g/mL). After inverted culture at 37 C. overnight, a single colony was selected and inoculated into 5 mL of LB liquid medium containing Amp, and underwent shaking culture at 37 C. for 12-16 h at 200 r/min. The seed solution cultured overnight was inoculated into 20 mL of fresh LB liquid medium containing Amp based on an inoculation amount of 1%, and underwent shaking culture at 37 C. for 2-3 h at 200 r/min until OD 600 was 0.6-0.8. Then IPTG with a final concentration of 0.5 mM was added, and the culture solution was placed at 20 C. and underwent shaking culture at 200 r/min for 16 h to induce protein expression.
(42) (2) After induction, centrifugation was performed at 4 C. and 6000 rpm for 5 min to collect cells. After the cells were washed with a phosphate buffer (with pH of 7.0) once, an appropriate amount of phosphate buffer (pH 7.0) was added based on a wet weight of the cells to resuspend the cells to obtain a cell suspension with a whole cell concentration of 100 mg/mL. All operations were performed on ice or at 4 C.
(43) 2. Whole Cell Reaction
(44) (1) The whole cell suspensions of a wild-type MesPDH enzyme and a mutant L283V/L286V enzyme obtained in the foregoing experiments were used as an enzyme solution to test the catalytic reaction of myosmine in groups. Specific reaction systems are shown in Table 4 and Table 5.
(45) TABLE-US-00004 TABLE 4 Reaction System of MesPDH Enzyme or L283V/L286V Enzyme MesPDH enzyme/ L283 V/L286V 10 mg/mL enzyme whole cell enzyme solution Myosmine solution 10 mg/mL Glucose 18.5 mg/mL Phosphate buffer (pH 7.0) Add to 1 mL
(46) TABLE-US-00005 TABLE 5 Reaction System of MesPDH Enzyme or L283V/L286V Enzyme MesPDH enzyme/L283V/L286V 10 mg/mL enzyme whole cell enzyme solution Myosmine solution 10 mg/mL Glucose 0.5 mg/mL Phosphate buffer (pH 7.0) Add to 1 mL
(47) (2) The foregoing reaction system underwent oscillation reaction at 30 C. for 24 h at a rotation speed of 200 rpm. After the reaction was finished, absolute ethanol twice the volume of the reaction solution was added to the reaction solution to stop the reaction, and then the reaction mixture underwent rotary evaporation at 65 C. and 100 rpm to remove the solvent. Finally, 2 mL of absolute ethanol was added to redissolve a product after the rotary evaporation, the solution was filtered by a 0.45 m organic filter, and then detection by using an HPLC was performed.
(48) 3. S-Nornicotine Detection Method
(49) Qualitative and quantitative analysis of S-nornicotine was performed on reaction results of the reaction systems in Table 4 and Table 5 by using the HPLC, and chromatographic conditions were as follows: High performance liquid chromatograph: Agilent 1100 Series Chromatographic column: ChiralpakAD-Hcolumn (250 mm4.6 mm5 m) Detector: DAD detector, with a detection wavelength of 254 nm Mobile phase ratio and elution conditions: flow rate of 1 mL/min; column temperature of 30 C.; an injection volume of 10 L; and an isocratic elution mobile phase system being n-hexane:ethanol:ethylenediamine=74.9:25.0:0.1.
(50) 4. Result Analysis
(51) As shown in
(52) In addition, when the mutant L283V/L286V enzyme was used for the whole-cell catalysis of the system in Table 4, the content of components in the reaction system was detected after reaction for 24 h, less than 20% of myosmine remained, and most of the myosmine was transformed into S-nornicotine. When the whole-cell catalytic reaction of the system in Table 5 was performed, almost no myosmine remained, and the reaction could completely transform the myosmine into S-nornicotine, indicating that the mutant L283V/L286V enzyme improved its dehydrogenase activity, while not affecting the reductase activity, and could complete high transformation without additional glucose dehydrogenase.
(53) Liquid phase detection results are shown in
(54) The process of whole cell synthesis of S-nornicotine is shown in
(55) The foregoing descriptions are merely preferred implementations of the present invention. It should be noted that a person of ordinary skill in the art may further make several improvements and modifications without departing from the principle of the present invention, and such improvements and modifications should be deemed as falling within the protection scope of the present invention.