ANIMAL MODEL OF BRAIN TUMOR AND MANUFACTURING METHOD OF ANIMAL MODEL
20230232794 · 2023-07-27
Inventors
- Seok Gu Kang (Suwon-si, KR)
- Jeong Ho Lee (Daejeon, KR)
- Joo Ho LEE (Daejeon, KR)
- Jeong Eun LEE (Daejeon, KR)
Cpc classification
A01K2217/15
HUMAN NECESSITIES
International classification
Abstract
The present invention relates to a brain tumor animal model that directly reflects the phenomenon in a human patient and a method of preparing the same, and more specifically, a brain tumor animal model that mutations are introduced into p53, Pten, and EGFR genes, a screening method of a therapeutic agent for a brain tumor using the animal model, and a preparing method thereof.
Claims
1. A non-human transgenic animal comprising, knock-out mutations of p53 and Pten genes in neural stem cells of subventricular zone (SVZ), and an activating mutation of epidermal growth factor receptor (EGFR) gene in neural stem cells of SVZ, wherein the animal has glioblastoma in the dorsolateral-caudal cortex region.
2. The non-human animal of claim 1, wherein the neural stem cells of SVZ are positive for Glial fibrillary acidic protein (GFAP).
3. The non-human animal of claim 2, wherein the GFAP-positive neural stem cells of SVZ have normal cytoarchitecture.
4. The non-human animal of claim 1, wherein the glioblastoma develops from neural stem cells that are positive for Glial fibrillary acidic protein (GFAP),
5. The non-human animal of claim 1, wherein the animal is rodent.
6. The non-human transgenic animal of claim 1, wherein the glioblastoma is a high-grade glioblastoma having characteristics of necrosis, microvascular proliferation and mitosis, and has an immune response to GFAP, Nestin, Olig2, and PDGFRα.
7. The non-human transgenic animal of claim 1, wherein the glioblastoma is IDH-wild type.
8. The non-human transgenic animal of claim 1, wherein the animal maintains the knockout mutations of p53 and Pten genes specific to neural stem cells in SVZ even after glioblastoma occurrence.
9. The non-human transgenic mouse of claim 1, wherein the p53 gene comprises at least a nucleotide sequence of SEQ. ID NOs. 38 to 40, and the Pten gene comprises at least a nucleotide sequence of SEQ. ID NOs. 41 to 43.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0116] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Patent and Trademark Office upon request and payment of the necessary fee.
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126]
[0127]
[0128]
[0129]
[0130]
[0131]
[0132]
[0133]
[0134]
[0135]
[0136]
[0137]
[0138]
[0139]
[0140]
[0141]
MODES FOR INVENTION
[0142] Hereinafter, the present invention will be described in more detail through the Examples. The Examples are only for describing the present invention in more specifically. Based on the gist of the present invention, it will be obvious to those skilled in the art that the scope of the present invention is not limited by these Examples.
[Preparation Examples 1] Sample Preparation
[0143] To examine the somatic mutations in normal SVZ tissue away from the tumor mass, 55 specimens including i) pathologically and radiographically normal SVZ tissue with a safe distance from the tumor, ii) tumor tissue, and iii) unaffected normal cortical tissue or blood were obtained from 17 patients having isocitrate dehydrogenase (IDH)-wildtype GBM (primary GBM), IDH-mutant GBM (secondary GBM), or meningioma, oligodendroglioma, and mestatic cancer (
[0144] The patients enrolled in our study underwent supra-total resection or other surgical resection of tumors located primarily in the temporal lobe, providing access to normal SVZ tissue away from the tumor mass, under the assistance of a magnetic resonance imaging (MRI)-based navigation system (
[Preparation Examples 2] Gene Expression Microarray Datasets and Subtype Classification
[0145] Total RNA was extracted from GBM tumour samples using a Qiagen RNeasy kit (Qiagen) according to the manufacturer's protocol. Expression profiles were obtained using an Illumina HumanHT-12 v4 Expression BeadChip. Raw data were variance stabilizing transformed normalized with the quantile normalization method using R/Bioconductor lumi package, and then standardized into [0, 1] by (values−MIN)/(MAX−MIN). The four gene signatures of GBM (Verhaak, R. G. W. et al. An integrated genomic analysis identifies clinically relevant subtypes of glioblastoma characterized by abnormalities in PDGFRA, IDH1, EGFR and NFL Cancer cell 17, 98, (2010)) were projected onto the gene expression data. To determine the subtypes of samples, enrichment scores for each subtype were generated using single sample gene set enrichment analysis (ssGSEA).
[Preparation Examples 3] Deep Whole-Exome Sequencing (WES) in Patient's Tissues
[0146] Genomic DNA was extracted with either the Qiamp mini DNA kit (Qiagen) for freshly frozen brain tissues or the Wizard Genomic DNA Purification Kit (Promega) for blood following the manufacturers' instructions. Each sequenced sample was prepared according to Agilent library preparation protocols (Agilent Human All Exon 50 Mb kit). Libraries underwent paired-end sequencing on an Illumina HiSeq 2000 and 2500 instrument (average read depth of 392×) according to the manufacturer's protocol. The analysis-ready bam files from Fastq files were generated according to the ‘best practices’ workflow designed by the Broad Institute. In brief, raw sequences were aligned from the fastq file to reference genome using BWA (http://bio-bwa.sourceforge.net) to generate sam files. The sam files were converted to bam files and conducted the marked duplicate using Picard (http://broadinstitute.github.io/picard). Then, indel artefacts in these bam files were cleaned up using RealignerTargetCreator and IndelRealigner in GATK analysis tools (http://www.broadinstitute.org/gatk/download). Next, the present inventors performed base quality score recalibration using BaseRecalibrator in GATK analysis tools for the accurate variant calling.
[Preparation Examples 4] Deep Sequencing of Glioma-Related Genes
[0147] Hybrid capture probes for 79 glioma-related genes were designed using SureDesign online tools (Agilent Technologies). Glioma-related genes included TCGA GBM exome sequencing results of significantly mutated genes (allele frequency (AF)>2%) and meaningful genomic data (driver genes and functional pathways involved in grade II or III glioma) from large cohorts of grade II and III gliomas from Japan (JPN) and The Cancer Genome Atlas Research Network (TCGA) Consortium (Brennan, C. W. et al. The somatic genomic landscape of glioblastoma. Cell 155, 462-477, (2013); Suzuki, H. et al. Mutational landscape and clonal architecture in grade II and III gliomas. Nat Genet 47, 458-468, (2015)). Genomic DNA (>200 ng) was sheared, and the DNA fragments were end-repaired, extended with an ‘A’ on the 3′ end, ligated with paired-end adaptors, and amplified (6 cycles). Adaptor-ligated libraries were hybridized for 24 h with biotinylated oligonucleotide RNA baits and enriched with streptavidin-conjugated magnetic beads. The final libraries were further amplified for 16 cycles with PCR and sequenced on an Illumina HiSeq 2500 sequencer (median read depth of 655×). Then, the present inventors generated an analysis-ready bam file using GATK best practice data cleanup pipeline. These bam files were converted to pileup files using Samtools (http://samtools.sourceforge.net).
[Preparation Examples 5] Site-Specific Amplicon Sequencing of Mutations in TERT Promoter
[0148] A target region is designed to flank C228T and C250T mutations in TERT promoter, corresponding to c.-124C>T and c.-146C>T of TERT. This region was amplified by PCR using the primers (a forward primer: AGCACCTCGCGGTAGTGG; and a reverse primer: GTCCTGCCCCTTCACCTT (SEQ ID NO: 2)). This region was amplified by PCR using targeted primers, including six base-pair index sequences. PCR was performed using PrimeSTAR GXL (Takara, Japan) high-fidelity DNA polymerase under optimized thermal conditions. Then, DNA library was prepared according to the TruSeq DNA sample preparation guide. In brief, end repair and addition of 3′A overhangs were performed using the TruSeq DNA kit (Illumina, USA). Indexed TruSeq adaptors were ligated according to the manufacturer's protocol and purified with AMPure beads (Agencourt Bioscience, USA). DNA fragments of 386 bp (274 bp of DNA plus 55 bp of adaptors with 57 bp of index) were excised from agarose gel and purified using the Mini elute gel extraction kit (Qiagen, USA). Then, the present inventors performed enrichment of DNA fragments that had adaptor molecules on both ends to amplify the amount of DNA in the library using PCR primer cocktail and master mix (Illumina, USA). Libraries were pooled and sequenced on a Hiseq sequencer (IlluminaSA) (median read depth of 917,384×). Then, the present inventors sorted raw sequences from the Hiseq sequencer by index to generate patient-specific fastq files using in-house transcripts. The sorted sequences were aligned by Bowtie2 (http://bowtie-bio.sourceforge.net/bowtie2/index.shtml) and a bam file was generated. The bam file was converted to pileup files using Samtools (http://samtools.sourceforge.net).
[Preparation Examples 6] Validation Sequencing of Candidate Variants
[0149] To validate the candidate variants, the present inventors used Sanger sequencing of PCR-amplified DNA for variants. Primers for PCR amplification were designed with Primer3 (http://bioinfo.ut.ee/primer3-0.4.0/) (Untergasser, A. et al. Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Res 35, W71-74, (2007)). PCR was performed using PrimeSTAR GXL (Takara, Japan) high-fidelity DNA polymerase under optimized thermal conditions. PCR products were evaluated on agarose gels. Sanger sequencing was performed using Big Dye
[0150] Terminator reactions and subsequent loading on an Applied Biosystems 3730E1 DNA analyser (Applied Biosystems, USA). For the candidate variants with low variant frequency <10% or undetermined in Sanger sequencing, site-specific amplicon sequencing described above was used. The present inventors validated 104 (11.0%) out of 946 GBM-related mutations and randomly selected mutations, of which mutational burdens ranged from 1.9% to 99.1%. Of validated targets, the present inventors confirmed 96 out of 104 mutations. VAF calculated by site-specific amplicon sequencing replaced VAF of WES to analyse the clonal relationship between SVZs and tumors.
[Preparation Examples 7] Real-Time Quantitative PCR
[0151] Real-time qPCR was performed using iQ™ SYBR® Green Supermix (Biorad, USA) in the thermal cycler system (CFX-96, Biorad, USA) following the manufacturer's protocol. The presence of CNVs was confirmed using specific primers for the EGFR sequence, RNase P, and LDHA (Table 2) designed using Primer3 (http://frodo.wi.mit.edu). Thermal cycling consisted of one cycle with initial denaturation and enzyme activation at 95° C. for 3 min, followed by 40 cycles at 95° C. for 10 s and annealing and extension at 55-60° C. for 30 s. The relative fold changes, compared to blood or normal brain tissue, were determined using the relative normalized expression method calculated by CFX Manager™ Software.
TABLE-US-00002 TABLE 2 Product Gene Locus Forward Reverse size EGFR Ch7:55229262- CGTCTCTTGCCGGA GGATTAAAGAAATAAC 86 55229347 ATGT CTCCTACCC (SEQ ID NO: 23) (SEQ ID NO: 24) RNaseP Chr15:75246734- GGGAGATGCGGAA CCTCCAGTCAGCCACAG 99 75246832 GAATGT AA (SEQ ID NO: 25) (SEQ ID NO: 26) LDHA Chr11:18408413- ACTGTGACCCTTAT CTTCCCTTAACTAGCTC 122 18408534 CCAGGC TCAGGA (SEQ ID NO: 27) (SEQ ID NO: 28)
[Preparation Examples 8] Single-Cell Cloning Preparation with Subsequent Sanger Sequencing
[0152] Single nuclei were isolated from fresh frozen tumor samples. More specifically, tissue samples were placed in NST-DAPI buffer and teased apart and homogenized with scalpels. After free nuclei were confirmed visually using fluorescence microscopy, nuclei stained with DAPI were analysed by FACS. Single nuclei were sorted from the DAPI-positive population. For subsequent Sanger sequencing, the present inventors selected representative shared driver and tumor-private mutations with a high variant allele frequency in tumor samples. Two primer sets to flank the sites of tumor-private and shared mutations were designed using MPprimer (http://biocompute.bmi.ac.cn/MPprimer/). These mutation regions were amplified by multiplex PCR using the two primer sets. The single nuclei PCR was performed using HotStarTaq DNA polymerase (Qiagen, USA) under optimized thermal conditions.
[Preparation Examples 9] Laser Capture Microdissection (LCM)
[0153] Formalin-fixed, paraffin-embedded tissue sections from tumor-free SVZ were collected and placed on glass slides. The slides were deparaffinized with xylene and rehydrated. Heat-induced antigen retrieval was performed with 90° C. for 20 min in Tris-EDTA buffer. The slides were blocked in PBS-GT for 1 h at room temperature and stained with mouse antibody to GFAP (1:500; G3893, Sigma) and rabbit antibody to 5100 (3 (1:500; ab52642, abcam). Samples were then washed in PBS and stained with the secondary antibodies Alexa Fluor 488-conjugated to rabbit (1:500 dilution; Invitrogen) and Alexa Fluor 555-conjugated to mouse (1:500 dilution; Invitrogen). Samples were washed in PBSagain and incubated in PBS with 300 nM DAPI. After performing immunofluorescence staining with GFAP, S1000 antibodies, and DAPI, the ependymal layer, hypocellular gap, and dense ribbon of cell bodies inSVZs were identified microdissected with the PALM laser capture system (Carl Zeiss, Germany). Genomic DNA was extracted from collected cells using a QiAamp micro kit (Qiagen, USA). The target region flanking C228T mutation of TERT promoter was amplified by PCR using targeted primers and high-fidelity PrimeSTAR GXL DNA polymerase (Takara, Japan). Amplified PCR product was purified and then site-specific amplicon sequencing described in Preparation Examples 5 was performed.
[Preparation Examples 10] Analysis of Mutation Signature
[0154] To determine the contributions of mutational process, a multiple regression approach, deconstructSigs (Rosenthal, R., McGranahan, N., Herrero, J., Taylor, B. S. & Swanton, C. DeconstructSigs: delineating mutational processes in single tumors distinguishes DNA repair deficiencies and patterns of carcinoma evolution. Genome Biol 17, 31, (2016)) was performed to extract signatures based on the COSMIC signature framework (http://cancer.sanger.ac.uk/cosmic/signatures). Final inputs of mutations were 261 from 11 tumor-free SVZs, 812 from 9 GBMs, 60 from 1 GBM-invaded SVZ.
[Examples 1] Identification of Mutations in Tumor-Free SVZ and Tumor
[0155] The following experiments were performed based on a hypothesis that if the normal SVZ samples away from tumor obtained by the method of the Preparation Example 1, mutation burden or variant allele frequency (VAF) would be lower than tumor. Specifically, deep sequencing analysis were performed for the specimens of i) and iii) to identify low-level somatic mutations in the tumor-free SVZ. In briefly, deep whole exome sequencing (average read depth of 392×) in 34 samples, 2 telomerase reverse transcripase (TERT) promoter site in 61 samples (average read depth or 948,608×), deep targeted sequencing in 79 glioma-related genes known by Cancer Genome Atlas Brennan, C. W. et al. The somatic genomic landscape of glioblastoma. Cell 155, 462-477, (2013); Suzuki, H. et al. Mutational landscape and clonal architecture in grade II and III gliomas. Nat Genet 47, 458-468, (2015))(Table 3) of 18 samples (average read depth of 601×) were performed. Recently, the mutations on upstream of 124 bp (C228T) and 146 bp (C250T) from TERT ATG start site are reported as oncogenes in 83% of GBM patients. And somatic mutations of all exons and TERT promoter sites were investigated using Strelka algorithm (https://sites.google.com/site/strelkasomaticvariantcaller/) and Integrative Genomic Viewer of aligned bam files, and VAFs were measured in SVZ and tumor tissue. Somatic mutations were not identified only in the samples from unaffected brain or blood tissue among specimens obtained from patients. Among tissues analyzed with deep WES, the present inventors identified an average of 25.2 somatic mutations in each tumor-free SVZ specimen and 86.3 in each tumor specimen. To validate somatic mutations, the present inventors performed Sanger sequencing or site-specific amplicon sequencing using primers described in Table 3 above, and 92.3% of selected somatic mutations (96 of 104) were identified as authentic somatic mutations. It is discovered that 47% of the patients (8 of 17) had at least one somatic mutation in the coding or TERT promoter region of tumor-free SVZs that was shared with the matched tumor by deep sequencing analysis (
[0156] Together, the results indicates that patients with IDH-wildtype GBM share somatic mutations in SVZ and tumor tissue, but the expression level in SVZ is significantly low than tumor tissue.
TABLE-US-00003 TABLE 3 Glioma-related genes NOTCH1, NOTCH2, PDGFRA, EGFR, PIK3CA, PIK3R1, PTEN, NF1, CIC, ATRX, IDH1, FUBP1, ARID1A, ARID1B, SMARCA4, CDKN2A, TP53, SETD2, MLL2, IDH2, ABCB1, ABCC9, ADAM29, AFM, ANKRD36, BRAF, C1orf150, CALCR, CARD6, CD3EAP, CDH18, CDH9, CDHR3, CDX4, COL1A2, CXorf22, DCAF12L2, DRD5, DYNC1I1, FGA, FOXR2, FRMD7, GABRA1, GABRA6, GABRB2, GPX5, HEATR7B2, IL18RAP, KEL, KRTAP20-2, LCE4A, LRRC55, LUM, LZTR1, MMP13, NLRP5, ODF4, PARD6B, PLCH2, PODNL1, QKI, RB1, RFX6, RPL5, SCN9A, SEMA3C, SEMA3E, SEMG1, SIGLEC8, NRAS, KRAS, CDK4, CDKN2B, FGFR, MDM2, MDM4, MET, CDKN2C, CDK6
TABLE-US-00004 TABLE 4 Distance Shared mutations between SVZ SNV, indel (YAF, TERT promoter (VAF, CNV (fold change, Patient no. and tumor (mm) SVZ.fwdarw.tumor) SVZ.fwdarw.tumor) SVZ.fwdarw.tumor) GBM 26 13.4 EGFR:p.Ala289Val(3%.fwdarw.48%) c228t( 1%.fwdarw.37%) EGFR (5.fwdarw.137) PTEN:p.Val317ts (2%.fwdarw.35%) GBM 187 18.8 TP53:p.Cys175Tyr (7%.fwdarw.92%) c228t( 2%.fwdarw.42%) — GBM 245 7.2 TP53:p.Glu285Lys (13%.fwdarw.62%) c228t( 6%.fwdarw.52%) — GBM 276 5.3 — c228t( 2%.fwdarw.33%) EGFR (3.fwdarw.18) GBM 499 26.6 EGFR:p.Ala269Val (4%.fwdarw.29%) c228t( 1%.fwdarw.36%) EGFR (7.fwdarw.83) GBM 520 RB1:p.Lys202ts (19%.fwdarw.39%) c228t(22%.fwdarw.36%) EGFR (10.fwdarw.21)
[Examples 2] Identification of Origin Region of GBM Tumor
[0157] About the result of Examples 1 that somatic mutations are shared in SVZ and tumor tissue of IDH-wild-type GBM patients, but the expression level in SVZ is much lower than in tumor tissue, it can be assumed that clones found in the SVZ gained tumor-private passenger mutations in a tumor development process after driver mutations had gained. The single cell sequencing of tumor sharing driver mutations with SVZ of IDH-wild-type GBM patients were performed, because tumors have to include not only mutations sharing with SVZ private passenger mutations in a single cell level, according to the assumption. More specifically, single nuclei were separated from a patient having a TP53, c.527G>A driver mutation in both of GBM tumor and SVZ and a TCERG1L, c.1127G>A passenger mutation only in GBM (GBM187) using fluorescence-activated cell sorting (FACS).
[0158] The VAFs of TP53, c.527G>A and TCERG1L, c.1127G>A were calculated in 91.8% and 87.2% which are similar to mutation level in tumor. And single cell sequencing was carried out for TP53, c.527G>A and TCERG1L, c.1127G>A regions. The result showed 42 of 47 sequenced clones had had both TP53, c.527G>A and TCERG1L, c.1127G>A mutations, 2 other clones had shown normal alleles in both regions (
[0159] Accordingly, it is found that cells having driver mutations in tumor-free SVZ away from tumor were transformed and developed GBM.
[Examples 3] Determining Tumor-Driving Region and Cells in Tumor-Free SVZ
[0160] Next, the present inventors sought to determine which cell types in tumor-free SVZs harbor the mutations driving GBM. The human SVZ is known to comprise three anatomically distinct layers: the ependymal layer, hypocellular gap, and astrocytic ribbon. Of these three layers, the glial fibrillary acidic protein GFAP-positive, astrocytic ribbon in the SVZ contains astrocyte-like stem cells and the following experiments were carried out to determine whether astrocyte-like stem cells develop driver mutations in SVZ. First, 510013, GFAP, and DAPI immunostaining were performed in order to isolate separately the three layers of SVZ (
[0161] Together, these results suggested that astrocyte-like stem cells from the astrocytic ribbon of the SVZ harbor driver mutations and clonally evolve to tumors away from the SVZ.
[Examples 4] Determining the Aetiology of Somatic Mutations in Tumor-Free SVZs
[0162] To examine the aetiology of somatic mutations in tumor-free SVZs, the present inventors attempted to analyse genetic signatures of the somatic mutations such as intrinsic DNA replication errors, exogenous or endogenous mutagen exposure and defective DNA repair. Mutational characteristics of somatic mutations were analyzed in coding regions of 11 tumor-free SVZs (271 somatic mutations), 9 tumors (845 somatic mutations), and 1 GBM-invaded SVZ (64 somatic mutations) discovered by each deep WES sequencing using DeconstructSigs (
[0163] Together, it was found that somatic mutations in SVZ causing GBM affects natural aging of NSCs having limited self-renewal capacities rather than rapid proliferation of abnormal cells, by the result of high Signature 5 mutation level in tumor-free SVZ
[Examples 5] Preparing Mouse Model of GBM Tumor
[0164] To test whether low-level somatic mutations in the NSCs of the SVZ could indeed lead to the formation of GBM away from the SVZ in vivo, a mouse model of Trp53 (also known as p53 or TP53), Pten and EGFR mutations in NSCs from the SVZ through genome editing was prepared: these mutations were recurrent driver mutations found in the tumor-free SVZ tissues from the GBM patients.
[0165] 5-1. Mouse Experiment Information and Preparation of LoxP-Stop-LoxP EGFRvii f/+; LoxP-Stop-LoxP tdTomato f/+ Mouse
[0166] All mouse experiments were approved by and performed according to the guidelines of the Institutional Animal Care and Use Committee (IACUC) of the KAIST.
[0167] The mice were housed in isolator cages with free access to food and water. The housing room was located in a specific-pathogen-free condition maintained at a constant temperature of 23° C. on a 12-h light-dark cycle with lights off at 19:00. The health status of mouse was examined regularly by the veterinarians and investigators.
[0168] Disease Specific Survival (DSS) endpoint was met when the mice died or met the criteria for euthanasia under the IACUC protocol. The criteria for euthanasia were: (i) severe weight loss of more than 20%, (ii) severe neurological impairment including paralysis, seizure and hunched posture with impaired motor power, or (iii) head bulging sign.
[0169] A LoxP-Stop-LoxP EGFRvii f/+; LoxP-Stop-LoxP tdTomato f/+ mouse was prepared by mating a LoxP-Stop-LoxP EGFRviii mouse (FVB strain) purchased from NCI mouse repository and a LoxP-Stop-LoxP-tdTomato mouse (C57BL/6) purchased from The Jackson Laboratory
[0170] 5-2. Construction of the Cre-Expressing CRISPR-Cas9 Vector
[0171] In order to insert Trp53, Pten, and EGFR mutations to NSCs of mouse SVZ, a single vector containing sgRNAs targeting p53/Pten, Cas9, and Cre recombinase was generated.
[0172] Specifically, the pU6-(BbsI)_CBh-Cas9-T2A-BFP plasmid was obtained as a gift from R. Kuehn (Addgene plasmid 64323). sgRNAs targeting p53 (sgP53) and Pten (sgPTEN) were designed using CRISPRtool (http://crispr.mit.edu) to minimize potential off-target effects. sgRNA candidates for p53 and Lacz were designed by a method known in the art (Cancer Cell 28, 429-440 (2015)). sgRNA sequences are shown in Table 5.
TABLE-US-00005 TABLE 5 SEQ ID Target NO: gene Sequence (5’.fwdarw.3’) 29 Trp53 GGTGTAATAGCTCCTGCATGG 30 PTEN GGTTGGTCAAGATCTTCACAGA 31 LacZ GGTGCGAATACGCCCACGCGAT
[0173] Oligonucleotides containing each sgRNA sequence were synthesized by Cosmogenetech and annealed in vitro with a thermocycler. pU6-(BbsI)_CBhCas9-T2A-BFP plasmid was digested with BbsI and ligated with the annealed oligonucleotides.
[0174] The genome-editing test with plasmids containing sgRNAs was performed by a method known in the art (Nat. Protocols 8, 2281-2308 (2013)). In brief, Neuro-2a cells were transfected with the plasmids carrying sgRNAs candidates using jetPRIME transfection reagent (Polyplus). After 2 days, genomic DNA was extracted from the treated cells using the Qiamp mini DNA kit (Qiagen) and used as a template for PCR amplification of target regions. T7 Endonuclease I assay (T7E1 assay; NEB) was performed to test the genome-editing efficiency of sgRNA candidates. The T7E1 results shown in
Mutation frequency (%)=100×(1−(1−fraction cleaved).sup.1/2) [Formula 1]
[0175] To generate a single vector containing sgRNAs targeting p53/Pten, Cas9, and Cre recombinase, the present inventors amplified P2A-Cre with AAV:ITR-U6-sgRNA (backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR (a gift from F. Zhang, Addgene plasmid 60226), and then switched T2A-BFP to P2A-Cre in the pU6-(BbsI)_CBh-Cas9-T2A-BFP plasmid. Next, the present inventors amplified pU6-sgP53, pU6-sgPTEN and switched pU6-(BbsI) to pU6-sgP53-pU6-sgPTEN in pU6-(BbsI)_CBh-Cas9-P2A-Cre plasmid to generate pU6-sgP53-pU6-sgPTEN_CBh-Cas9-P2A-Cre plasmid (sgTP-Cas9-Cre). In addition, the present inventors inserted sgLacz to pU6-(BbsI)_CBh-Cas9-P2A-Cre to generate sgLacz-Cas9-Cre. The final vector map was shown in
[0176] 5-3. Insertion of Vectors to Mouse SVZ by Electroporation
[0177] The Cre-containing CRISPR-Cas9 vector generated by a method of Examples 5-2 was injected to front SVZ of one side of LoxP-Stop-LoxP EGFRviii f/+; LoxP-Stop-LoxP tdTomato mouse cerebral hemisphere by in vivo electroporation to induce oncogenic mutations to NSCs in specific regions of mouse SVZ and determine mutant cell migration from SVZ.
[0178] Specifically, neonate, 2-3-day-old pups (P2-P3) were anaesthetized by hypothermia (over 5 min) and fixed to a support using an adhesive plaster. As a general positional marker, a virtual line connecting the right eye with lambda was used and a capillary needle was inserted at about one-third the length of this line from the eye. The right lateral ventricle was injected at a depth of 2 mm from the skull with 1 μl of plasmid solution (2 ug/ul, containing 1% (v/v) FastGreen). Injection success was achieved with the Fast-Green staining visualizing the shape of the lateral ventricle. Only successfully injected animals were subjected to five electrical pulses (100 V, 50 ms, separated by 950 ms intervals) using the ECM830 electroportor (BTX-Harvard apparatus) and 1-mm tweezer electrodes (CUY650P1, Nepagene). The positive electrode was positioned ahead of the eye, and the negative was placed in the opposite position on the ventral side. After electroporation, mice were placed on a 37° C. heating plate until they fully recovered and were returned to their mother. The transfected cells expressing tdTomato were mainly located on the rostral-dorsolateral side in the anterior horn of the lateral ventricle at post-injection 2 days. However, the transfected cells decreased gradually to the caudal direction and disappeared at the coronal section of the rostral head of the hippocampus.
[0179] The immunostaining result of Trp53/Pten/EGFR mutant mice 3 days after electroporation is shown in
[0180] 5-4. Identifying Development of Brain Tumor in Mice Model
[0181] 90% of the electroporated mice (9 of 10) developed brain tumors with a median survival of 20 weeks, whereas no brain tumors were found in control mice simply sgLacz-targeting CRISPR-Cas9 vectors were electroporated (
[0182] Additionally, EGFRviii expression and Trp53 and Pten indels in brain tumor were examined Specifically, tumor mass separated with a scalpel and genomic DNA was extracted from tdTomato-positive cells in olfactory bulb which are microdissected using laser-microdissection. Trp53 and Pten region of mouse genome are amplified using primers listed in Table 6.
TABLE-US-00006 TABLE 6 SEQ ID NO: Primer name Sequence (5’.fwdarw.3’) 32 Mouse_Trp53_forward AGGTAGGGAGCGACTTCACC 33 Mouse_Trp53_reverse TAAGGATAGGTCGGCGGTTC 34 Mouse_Pten_forward AGACCATAACCCACCACAGC 35 Mouse_Pten_reverse TACACCAGTCCGTCCCTTTC
[0183] After amplification of target region, site-specific amplicon sequencing described in Preparation Examples 5 above was performed. To measure the frequencies of indels in the target regions, the Cas-Analyzer algorithm (http://www.rgenome.net/cas-analyzer/#!) was used. The indel frequency result is shown in
[0184] Specifically, indels were randomly generated near the sgRNAs targeting sites, and both Trp 53 and Pten showed high indel frequencies over 80%. More specifically, indels of Trp53 were randomly generated in range of 69/402,693 to 69/402,702 of chromosome 11, and indels of Pten were randomly generated in range of 32874403 to 32874412 of chromosome 19 (reference mouse genome: UCSC mouse standard genome).
[0185] The Table 7 below is showing the representative amplicon sequencing results of Trp53 and Pten which are sequences more than 1% of total reads. The read frequency of the Table 7 refers to the each read ratio having notated sequences to total reads.
TABLE-US-00007 TABLE 71 Read SEQ ID frequency NO: Nucleotide sequence (%) Trp53 38 TGTGTCTTCCCCCAGGCCGGCTCTGAGTATACCACCATCCACTACAA 36.3 GTACATGTGTAATAGCTCCTGCACTTGGGGGGCATGAACCGCCGACC TATCCTTA 39 TGTGTCTTCCCCCAGGCCGGCTCTGAGTATACCACCATCCACTACAA 34.7 GTACATGTGTAATAGCTCCTGTGGGGGGCATGAACCGCCGACCTATC CTTA 40 TGTGTCTTCCCCCAGGCCGGCTCTGAGTATACCACCATCCACTACAA 8.0 GTACATGTGTAATAGCTCCTGCAATGGGGGGCATGAACCGCCGACCT ATCCTTA Pten 41 AGACCATAACCCACCACAGCTAGAACTTATCAAACCCTTCTTGAAGA 38.9 TCTTGACCAATGGCTAAGTGAAGATGACAATCATGTTGCAGCAATTC ACTGTAAAGCTGGAAA 42 AGACCATAACCCACCACAGCTAGAACTTATCAAACCCTCTGAAGATC 36.6 TTGACCAATGGCTAAGTGAAGATGACAATCATGTTGCAGCAATTCAC TGTAAAGCTGGAAA 43 AGACCATAACCCACCACAGCTAGAACTTATCAAACCCTTCGTGAAG 3.3 ATCTTGACCAATGGCTAAGTGAAGATGACAATCATGTTGCAGCAATT CACTGTAAAGCTGGAAA
[0186] For the identification of EGFRviii expression in tumors, RNA was extracted from tumor and untreated brain tissue using RNeasy Mini Kit (Qiagen). Then, cDNA was generated from the extracted RNA using SuperScript II (Invitrogen). To amplify EGFRviii from the cDNA, the present inventors designed primers annealing to human EGFR exons 1 and 8. The sequences of the primers are as follows: forward, 5′-CCCAGGCACTTGATGATACTC-3′ (SIQ. ID NO. 36) and reverse, 5′-CTTGCTTTGGGTGGAGAGTT-3′(SEQ ID NO: 37). The PCR conditions were as follows: 98° C. for 2 min; 35 times (98° C. for 10 s, 60° C. for 15 s, 68° C. for 30 s); hold at 4° C. Then, the amplicon was analysed by electrophoresis on 2% agarose gel. Actb was used as control. The electrophoresis result is shown in
[0187] A gross mass of tumor was identified 16 weeks after electroporation. The MRI image is represented in
[0188] Specifically, MRI conditions are as follows. The mice were initially anaesthetized by inhalation of 5% isoflurane in an air/O2 mixture, and then placed in a cradle for MRI scans, with a respiratory mask connected to 1.5% isoflurane in an air/O2 mixture. MRI experiments were performed on an a 3T MRS 3000 scanner (MR Solutions) with a birdcage mouse head coil.
[0189] T1-weighted and T2-weighted images were respectively acquired with spin echo (SE) and fast spin echo (FSE) sequences for investigation of anatomical and pathological conditions. Scan parameters were as follows: time to repeat/echo time=550/11 ms (SE) and 3,000/68 ms (FSE), field of view=22×22 mm2, matrix size=256×256 (SE) and 256×248 (FSE), slice thickness=1 mm, number of slices=19, and scan time=9 min 23 s (SE) and 9 min 18 s (FSE).
[0190] The tumor tissues were stained by H&E staining method, and the result is shown in
[0191] Through, as somatic cancer driving mutants, for example, Trp53, Pten, and EGFR mutations have abilities to develop malignant glioma from NSCs in SVZ.
[0192] 5-6. Similarities with Human Glioma
[0193] (1) Over Time Analysis of Glioma Development
[0194] To examine the time and spatial relationships between the occurrence of mutations in SVZs and the formation of glioma, the present inventors analysed the progress of glioma development over time.
[0195] Specifically, the present inventors obtained serial sections of mouse brain tissue from the olfactory bulb to caudal cortex, 2 days, 8 weeks and 13 to 15 weeks after electroporation. Then, tdTomato-positive cell migration was traced. It is discovered that tdTomato-positive cells migrated from the SVZ to the dorsolateral-caudal cortex and the olfactory bulb (
[0196] In genome-edited mice (n=18), cells harboring driver mutations that migrated to the olfactory bulb properly differentiated to mature neurons and did not lead to glioma development, whereas cells that migrated to the dorsolateral-caudal cortex did (
[0197] The tdTomato-positive cells proliferated throughout serial sections from p64, Pten and Egfr mutated mice. In particular, tdTomato-positive cells increased markedly in number over time in the distant cortical region away from the mutation arising SVZ (−2.5 and −3.5 mm from bregma) (
[0198] Furthermore, the present inventors also noted that 67% of the gliomas developed in a distant region away from the mutation arising SVZ (
[0199] (2) Identification of Cell Line Developing Glioma
[0200] To examine whether cells from NSCs develop glioma, abnormal proliferations were analyzed for neuron, astrocyte, oligodendrocyte, and oligodendrocyteprecursor cells.
[0201] Specifically, before the formation of a visible tumor, tdTomato-positive cells in cortex region were immunostained as follows: NeuN for neuron, GFPA for astrocyte, MBP for oligodendrocyte, and Olig2 and PDGFRα for oligodendrocyteprecursor cells.
[0202] Majority of tdTomato-positive cells were co-expressing Olig2 or PDGFRα (