RECOMBINANT NUCLEIC ACID OF ESCHERICHIA COLI, RECOMBINANT ESCHERICHIA COLI AND CULTURING METHOD THEREOF, AND METHOD FOR BIOSYNTHESIZING L-THREONINE THEREBY
20240018557 ยท 2024-01-18
Assignee
Inventors
- Zhiming RAO (Wuxi City, CN)
- Zhenqiang ZHAO (Wuxi City, CN)
- Meijuan XU (Wuxi City, CN)
- Xian ZHANG (Wuxi City, CN)
- Taowei YANG (Wuxi City, CN)
Cpc classification
C12N2800/22
CHEMISTRY; METALLURGY
C12Y401/01032
CHEMISTRY; METALLURGY
C12P13/08
CHEMISTRY; METALLURGY
International classification
Abstract
The present disclosure provides a recombinant nucleic acid of Escherichia coli, a recombinant E. coli, a culturing method thereof, and a method for biosynthesizing L-threonine thereby, and relates to the technical field of bioengineering. The recombinant nucleic acid of E. coli of the present disclosure, including the gene encoding phosphoenolpyruvate carboxykinase (pck), the gene encoding pyruvate carboxylase (pyc) and the gene encoding threonine operon, is transformed into E. coli to obtain a recombinant E. coli LMT4 strain that takes glucose as a substrate. Using the LMT4 for fermentative production may significantly improve the L-threonine yield and glucose conversion rate, laying a foundation for the industrial production of L-threonine.
Claims
1. A recombinant nucleic acid of Escherichia coli, comprising a gene encoding phosphoenolpyruvate carboxykinase (pck), a gene encoding pyruvate carboxylase (pyc) and a gene encoding threonine operon.
2. The recombinant nucleic acid according to claim 1, wherein expressions of the gene encoding pck, the gene encoding pyc and the gene encoding threonine operon are all initiated by a Trc promoter.
3. The recombinant nucleic acid according to claim 1, wherein the gene encoding pck is derived from Bacillus subtilis; the gene encoding pyc is derived from Bacillus licheniformis.
4. The recombinant nucleic acid according to claim 1, wherein the phosphoenolpyruvate carboxykinase pck is RBS optimized and glycine is mutated to arginine at position 143 in the pck; the pyc is RBS optimized and alanine is mutated to lysine at position 247 in the pyc.
5. The recombinant nucleic acid according to claim 1, wherein the threonine operon is RBS optimized and alanine is mutated to aspartic acid at position 144 in the threonine operon.
6. A recombinant E. coli comprising the recombinant nucleic acid according to any one of claim 1, wherein the recombinant E. coli overexpresses the pck, the pyc and the threonine manipulator.
7. The recombinant E. coli according to claim 6, wherein a basic strain of the recombinant E. coli comprises E. coli K-12 W3110.
8. A culturing method of the recombinant E. coli according to claim 6, comprising the following steps: inoculating the recombinant E. coli on a seed medium for cultivation to obtain a seed liquid; the seed medium comprises components of the following concentrations: dried corn steep liquor 5 g/L, glucose 20 g/L, yeast powder 5 g/L, KH.sub.2PO.sub.4 2 g/L, magnesium sulfate 1 g/L, FeSO.sub.4.Math.7H.sub.2O 20 mg/L and MnSO.sub.4.Math.H.sub.2O 20 mg/L.
9. A method for biosynthesizing L-threonine, comprising using the recombinant E. coli of claim 6, wherein the recombinant E. coli takes glucose as a fermentation substrate.
10. The method for biosynthesizing L-threonine according to claim 9, comprising the following steps: inoculating the seed liquid obtained by the culturing method according to claim 8 in a fermentation medium, performing an aerobic fermentation to obtain L-threonine, and the L-threonine is in a fermentation liquid; the fermentation medium comprises components of the following concentrations: glucose 20 g/L, potassium dihydrogen phosphate 2 g/L, yeast powder 3 g/L, betaine 1 g/L, magnesium sulfate 1 g/L, FeSO.sub.4.Math.7H.sub.2O 10 mg/L, MnSO.sub.4.Math.H.sub.2O 10 mg/L, dried corn steep liquor powder 8 g/L and vitamin B1 10 mg/L.
11. The recombinant nucleic acid according to claim 4, wherein the gene encoding pck is derived from B. subtilis.
12. The recombinant E. coli according to claim 6, wherein expressions of the gene encoding pck, the gene encoding pyc and the gene encoding threonine operon are all initiated by a Trc promoter.
13. The recombinant E. coli according to claim 6, wherein the gene encoding pck is derived from B. subtilis.
14. The recombinant E. coli according to claim 6, wherein the pck is RBS optimized and glycine is mutated to arginine at position 143 in the pck; the pyc is RBS optimized and alanine is mutated to lysine at position 247 in the pyc.
15. The recombinant E. coli according to claim 6, wherein the threonine operon is RBS optimized and alanine is mutated to aspartic acid at position 144 in the threonine operon.
16. The method of claim 8, wherein a basic strain of the recombinant E. coli comprises Escherichia coli K-12 W3110.
17. The method for biosynthesizing L-threonine according to claim 9, wherein a basic strain of the recombinant E. coli comprises E. coli K-12 W3110.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0023]
[0024]
DETAILED DESCRIPTION OF THE EMBODIMENTS
[0025] The present disclosure provides a recombinant nucleic acid of E. coli, including a gene encoding pck, a gene encoding pyc and a gene encoding threonine operon.
[0026] In some embodiments of the present disclosure, E. coli is used as the starting strain, and by means of gene editing, the pseudogene yeeL of the starting strain is knocked out and the gene encoding pck is integrated into the yeeL locus; the pseudogene yjhE of the starting strain is knocked out and the gene encoding pyc is integrated into the yjhE locus; and the pseudogene ydeu of the starting strain is knocked out and the gene encoding threonine operon is integrated into the ydeu locus. In some embodiments of the present disclosure, expressions of the gene encoding pck, the gene encoding pyc and the gene encoding threonine operon is initiated by Trc promoter. The method of gene editing is not particularly limited in the present disclosure, and in some embodiments it includes CRISPR Cas9.
[0027] In some embodiments of the present disclosure, the gene encoding pck is derived from B. subtilis. In some embodiments, before being integrated into the yeeL locus, the gene encoding pck is subjected to RBS optimization and mutation from glycine to arginine at position 143. In some embodiments, the RBS optimization of the present disclosure is to replace the RBS sequence located in the upstream of the gene encoding pck for regulating pck, with SEQ ID NO: 2: CATCAGATAGGTGTAAGGAGGTTTAGAT. In some embodiments, after the RBS optimization and the mutation of the present disclosure, the complete sequence of the gene encoding pck integrated into the yeeL locus is set forth in SEQ ID NO:1.
[0028] In some embodiments, the gene encoding pyc of the present disclosure is derived from B. licheniformis. In some embodiments, before being integrated into the yjhE locus, the gene encoding pyc is also subjected to RBS optimization and mutation from alanine to lysine at position 247. In some embodiments, the RBS optimization is to replace the RBS sequence located in the upstream of the gene encoding pyc for regulating pyc, and in some other embodiments, the nucleotide sequence of the replaced RBS sequence is set forth in SEQ ID NO: 4: CAACAGATAGGTGTAAGGAGGTTGAGAT. After the RBS optimization and mutation of the present disclosure, in some embodiments, the complete sequence of the gene encoding pyc integrated into the yjhE locus is set forth in SEQ ID NO:3.
[0029] The alanine is mutated to aspartic acid at the position 144 of the threonine operon of the present disclosure (thrABA144DC). In some embodiments, after the mutation, the nucleotide sequence of the gene encoding thrABA144DC is set forth in SEQ ID NO:5: TTTCACACAGGAAACAGA; meanwhile, RBS optimization is performed on the sequence set forth in SEQ ID NO:5, and in some embodiments, the RBS optimization is performed by replacing the RBS sequence set forth in SEQ ID NO:5 with the sequence set forth in SEQ ID NO:6: CGGTAAAGATATCGATAAGGAGGTTTTTT, and then the mutated and RBS-optimized thrABA144DC is integrated into the ydeu locus.
[0030] The present disclosure further provides a recombinant E. coli including the above recombinant nucleic acid, and the recombinant E. coli overexpresses pck, pyc and threonine operon.
[0031] In some embodiments, the basic strain of the recombinant E. coli of the present disclosure includes E. coli K-12 W3110, and the basic strain lacks the DNA-binding transcription inhibitor LacI, the threonine leader peptide encoding gene thrL, and the Na(+)/serine-threonine symporter gene sstT, threonine dehydrogenase tdh, threonine transporter tdcC. In some embodiments, the E. coli W3110 of the present disclosure is purchased from Beina Bio.
[0032] The present disclosure also provides a method for constructing the recombinant E. coli. In some embodiments, the method of CRISPR Cas9 is used for construction (
[0033] (5) upstream and downstream homology arms of the pseudogene yjhE from the genome of E. coli K-12 W3110 are amplified by PCR; (6) primers pyc-1, pyc-2, pyc-3 and pyc-4 in Table 1 are used to amplify the pyc.sup.A247K gene from the B. licheniformis genome to obtain the fragments 1-pyc.sup.A247K and 2-pyc.sup.A247K, and then with the pyc-1 and the pyc-4 as primers, and the fragments 1-pyc.sup.A247K and 2-pyc.sup.A247K as templates, the 1-pyc.sup.A247K and 2-pyc.sup.A247K are fused into pyc.sup.A247K, where the pyc-1 primer contains the optimized RBS sequence, the pyc-2 and the pyc-3 are gene point mutation primers of pyc.sup.A247K, and the RBS optimization and point mutation of pyc.sup.A247K gene RBS are completed by PCR; (7) the upstream and the downstream homology arms of yjhE, and the pyc.sup.A247K fragment of initiated by the Trc promoter are fused to obtain an U-pyc.sup.A247K-D fragment; (8) the obtained fusion fragment U-pyc.sup.A247K-D and the vector containing yjhE-sgRNA are transformed into the recombinant strain LMT2 to obtain a recombinant strain, in which the pseudogene yjhE is knocked out and the pycA247K initiated by the Trc promoter is integrated into the yjhE locus, and the yjhE-sgRNA vector is removed to obtain a recombinant strain LMT3;
[0034] (9) upstream and downstream homology arms of the pseudogene ydeu from the genome of E. coli K-12 W3110 are amplified by PCR; (10) primers thrA-F, thrB-R and thrB-F, thrC-R in Table 1 are used to amplify the thrAB.sup.A144DC gene cluster of the threonine operon initiated by the Trc promoter by PCR from the genome of E. coli K-12 W3110 to obtain the fragments 1-thrAB.sup.A144DC and 2-thrAB.sup.A144DC, and then with thrA-F and the thrC-R as primers, and the fragments 1-thrAB.sup.A144DC and 2-thrAB.sup.A144DC as templates, the fragments 1-thrAB.sup.A144DC and 2_thrAB.sup.A144DC are fused into thrAB.sup.A144DC, where the thrA-F primer contains the optimized RBS sequence, the thrB-R and the thrB-F are gene point mutation primers of the thrAB.sup.A144DC, and the RBS optimization and point mutation of the threonine operon thrAB.sup.A144DC gene are conducted by PCR; (11) the upstream and downstream homology arms of ydeu and the thrAB.sup.A144DC gene cluster fragment of the threonine operon initiated by the Trc promoter are fused to obtain an U-thrAB.sup.A144DC-D fragment; (12) the obtained fusion fragment U-thrAB.sup.A144DC-D and the vector containing ydeu-sgRNA are transformed into the recombinant strain LMT3 to obtain a recombinant strain, in which the pseudogene ydeu is knocked out and the threonine operon thrAB.sup.A144DC gene cluster initiated by the Trc promoter is integrated into the ydeu locus, and the ydeu-sgRNA vector is removed to obtain a recombinant E. coli strain LMT4.
[0035] In the present disclosure, in order to complete the construction of the recombinant E. coli, the primers shown in Table 1 are used.
TABLE-US-00001 TABLE1 Primersused SEQID Primer Sequencefrom5to3 NO yeeL-U-F AAGAAATCCGACGCCAAAGG 7 yeeL-U-R ATCCGCTCACAATTCCACACATTATACGAGCCGGATGAT 8 TAATTGTCAACCTAACCTCGCCTCCCTACTG yeeL-D-F caggcggccctctcgtataaTGGCAAGTGCCTATAATACCCC 9 yeeL-D-R TCATCTAGTCCCGCAAACTCAA 10 pck-1 CTCGTATAATGTGTGGAATTGTGAGCGGATAACAACAT 11 CAGATAGGTGTAAGGAGGTTTAGATatgaactcagttgatttgac pck-2 cttatcatttcTttccggacgg 12 pck-3 ccgtccggaaAgaaatgataag 13 pck-4 ttatacgagagggccgcctg 14 yjhE-U-F CCAGTTTAATAAGAAAGGAGACG 15 yjhE-U-R TTGTTATCCGCTCACAATTCCACACATTATACGAGCCGG 16 ATGATTAATTGTCAATGTCGTGAACTGTGAGACGA yjhE-D-F ttgaactgaaaaaataaAAGTCGAATCAGGGCTGAAGTGGCACA 17 CTGAATTTG yjhE-D-R ACAACAGACCGAGAAAGACACT 18 pyc-1 AATTGTGAGCGGATAACAACAACAGATAGGTGTAAGG 19 AGGTTGAGATatgtcacaacagtctattca pyc-2 aacgctcggCTTcacttcgat 20 pyc-3 atcgaagtgAAGccgagcgtt 21 pyc-4 ttattttttcagttcaa 22 ydeu-U-F CATAAGCGGGAAGGGTATCGTG 23 ydeu-U-R TTGTTATCCGCTCACAATTCCACACATTATACGAGCCGG 24 ATGATTAATTGTCAATTGAACCGTGCCGCCATTCTC ydeu-D-F TGATGATGAATCATCAGTAAACCGTATAAGCCGCATGTC 25 GAGATGGCATGC ydeu-D-R ATGTCGTGAGCGTGGTATTGTC 26 thrA-F GAATTGTGAGCGGATAACAACGGTAAAGATATCGATAA 27 GGAGGTTTTTTatgcgagtgttgaagttcgg thrB-R aaacacggGTccacgttgtc 28 thrB-F gacaacgtggACccgtgttt 29 thrC-R TTACTGATGATTCATCATCA 30 PGRB-F Gttttagagctagaaatagcaagttaa 31 PGRB-R Attatacctaggactgagc 32 sgRNA-yeel-1 AGTCCTAGGTATAATACTAGTAACACAGCAATACGGTACGCGT 33 TTTAGAGCTAGAA sgRNA-yeel-2 TTCTAGCTCTAAAACGCGTACCGTATTGCTGTGTTACTAGTATTATACC 34 TAGGACT sgRNA-ydeu-1 AGTCCTAGGTATAATACTAGTTATCTGACCAGTAAATGGGAGTTTTAG 35 AGCTAGAA sgRNA-ydeu-2 TTCTAGCTCTAAAACTCCCATTTACTGGTCAGATAACTAGTATTATACC 36 TAGGACT sgRNA-yjhE-1 AGTCCTAGGTATAATACTAGTGCCTATCCGGGCTGTCCCGAGTTTTAG 37 AGCTAGAA sgRNA-yjhE-2 TTCTAGCTCTAAAACTCGGGACAGCCCGGATAGGCACTAGTATTATA 38 CCTAGGACT
[0036] The present disclosure also provides a culturing method for the above recombinant E. coli, including the following steps: the recombinant E. coli is inoculated on a seed medium and is cultured to obtain a seed liquid; the seed medium includes components with the following concentrations: dried corn steep liquor powder 5 g/L, glucose 20 g/L, yeast powder 5 g/L, KH.sub.2PO.sub.4 2 g/L, magnesium sulfate 1 g/L, FeSO.sub.4.Math.7H.sub.2O 20 mg/L and MnSO.sub.4.Math.H.sub.2O 20 mg/L.
[0037] In some embodiments, an amount of the inoculation in the present disclosure is 20%. In some embodiments, the culturing of the present disclosure is performed at 37 C., and accompanied by shaking. In some embodiments, the shaking is conducted at 500 rpm, and in some embodiments, the culturing is performed for 10 h. After the culturing according to the present disclosure, OD600 is 12-15.
[0038] The recombinant E. coli of the present disclosure can use glucose as a substrate to biosynthesize L-threonine, and the production of L-threonine and the glucose conversion rate are significantly improved, laying a foundation for the industrial production of L-threonine.
[0039] The present disclosure further provides use of the above recombinant E. coli in the biosynthesis of L-threonine.
[0040] E. coli W3110 modified by the present disclosure has high-yielding performance: 1. Overexpression of B. subtilis-derived phosphoenolpck can catalyze phosphoenolpyruvate to generate ketosuccinic acid, and the ketosuccinic acid is threonine acid precursors. Meanwhile, ATP, which is energy, is also generated in the catalytic process of phosphoenolpck, and the ATP is consumed in the process of threonine synthesis, so this technology can not only improve the supply of threonine synthesis precursors, but also provide the ATP energy required in the synthesis process. RBS optimization strategy improves the expression of phosphoenolin E. coli, and point mutation improves thermal stability and catalytic efficiency of the phosphoenol from B. subtilis, such that the conversion of phosphoenolpyruvate to ketosuccinic acid is faster. 2. Overexpression of pyc derived from B. licheniformis can catalyze the synthesis of ketosuccinic acid from pyruvic acid, while there is no pyc in E. coli, so by heterologous expression of pyc, the metabolic pathway for ketosuccinic acid synthesis from pyruvic acid in E. coli is expanded and the accumulation of threonine precursors is increased. The expression of pyc in E. coli is improved by the RBS optimization strategy, and the thermostability and catalytic efficiency of from B. licheniformis are improved by the point mutation, resulting in a faster conversion rate of pyruvic acid to ketosuccinic acid. 3. Overexpression of E. coli endogenous threonine operon thrABA144DC increases the metabolic flux in the direction of threonine synthesis, the expression level of the enzyme is further improved through RBS optimization, and the catalytic efficiency of thrB is improved by point mutation. The above disclosure can improve the ability of the strain to synthesize L-threonine. Meanwhile, these overexpressed genes are integrated into the E. coli genome instead of being overexpressed by plasmids, so there is no need to add antibiotics during the fermentation process to maintain the existence of the plasmids.
[0041] The present disclosure further provides a method for biosynthesizing L-threonine, including the following steps: the seed liquid obtained by the above culturing method is inoculated into a fermentation medium, and aerobic fermentation is performed. L-threonine acid is contained in the fermentation liquid.
[0042] The fermentation medium includes the components of the following concentrations: glucose 20 g/L, potassium dihydrogen phosphate 2 g/L, yeast powder 3 g/L, betaine 1 g/L, magnesium sulfate 1 g/L, FeSO.sub.4.Math.7H.sub.2O 10 mg/L, MnSO.sub.4.Math.H.sub.2O 10 mg/L, dried corn steep liquor powder 8 g/L and vitamin B1 10 mg/L.
[0043] In some embodiments, a volume of the seed liquid of the present disclosure is 20% of that of the fermentation medium, and the aerobic fermentation is performed after the inoculation. The aerobic fermentation is conducted at 37 C. with a dissolved oxygen concentration of 30%. In the process of aerobic fermentation, after substrate sugar is exhausted, residual sugar is controlled at 01 g/L by feeding glucose.
[0044] The recombinant nucleic acid of E. coli, the recombinant E. coli and the culturing method thereof, and the method for biosynthesizing L-threonine thereby provided by the present disclosure will be described in detail below in conjunction with examples, but they should not be construed as limiting the claimed scope of the present disclosure.
Example 1
[0045] 1. Construction of the Fusion Fragment U-Pck-D
[0046] The primers yeeL-U-F, yeeL-U-R, yeeL-D-F and yeeL-D-R in Table 1 were used to amplify the upstream and downstream homology arm fragments on each side of the yeeL gene from the genome of E. coli K-12 W3110 to obtain the fragments yeel1 (SEQ ID NO. 8) and yeel2 (SEQ ID NO. 9), and using the total DNA of E. coli W3110 were used as a template, PCR amplification was conducted with the above primers. The amplification conditions were: pre-denaturation at 95 C. for 5 min; 30 cycles of denaturation at 98 C. for 10 s, annealing at 55 C. for 15 s, extension at 72 C. for 60 s; final extension at 72 C. for 5 min. PCR amplification system: 1 L of template, 2 L of upstream and downstream primers, 20 L of sterilized double distilled water, 25 L of 2Phanta Max Master Mix. The PCR product was purified and recovered by gel recovery kit, and the concentration of the recovered product was checked by electrophoresis. The recovered product was stored in a 1.5 mL centrifuge tube and stored in a 20 C. refrigerator for later use.
[0047] Primers pck-1, pck-2, pck-3 and pck-4 in Table 1 were used to amplify the pck.sup.G143R gene from the B. subtilis genome to obtain the fragments 1-pck.sup.G143R2-pck.sup.G143R, and then with the pck-1 and the pck-4 as primers, and the fragments 1-pck.sup.G143R and 2-pck.sup.G143R as templates, the fragments 1-pck.sup.G143R and 2-pck.sup.G143R were fused into pck.sup.G143R, where the pck-1 primer contains the optimized RBS sequence, pck-2 and pck-3 were gene point mutation primers of pck, and the RBS optimization and point mutation of the pck.sup.G143R gene were conducted by PCR. With the total DNA of B. subtilis as a template, and the above primers were used for PCR amplification, and the amplification conditions were: pre-denaturation at 95 C. for 5 min; 30 cycles of denaturation at 98 C. for 10 s, annealing at 55 C. for 15 s, extension at 72 C. for 90 s; final extension at 72 C. for 5 min. PCR amplification system: 1 L of template, 2 L of upstream and downstream primers, 20 L of sterilized double distilled water, 25 L of 2Phanta Max Master Mix. The PCR product was purified and recovered by gel recovery kit, and the concentration of the recovered product was checked by electrophoresis. The recovered product was stored in a 1.5 mL centrifuge tube and stored in a 20 C. refrigerator for later use;
[0048] Fragments yeel1, pck.sup.G143R, yeel2 were subjected to fusion PCR to obtain a fusion fragment U-pck.sup.G143R_D (SEQ ID NO: 10), and with yeel1, yeel2, pck.sup.G143R as templates, the above primers yeeL-U-F, yeeL-D-R were used for PCR amplification.
[0049] The amplification conditions were: pre-denaturation at 95 C. for 5 min; 30 cycles of denaturation at 98 C. for 10 s, annealing at 55 C. for 15 s, extension at 72 C. for 90 s; final extension at 72 C. for 5 min. PCR amplification system: 1 L of template, 2 L of upstream and downstream primers, 20 L of sterilized double distilled water, 25 L of 2Phanta Max Master Mix. The PCR product was purified and recovered by gel recovery kit, and the concentration of the recovered product was checked by electrophoresis. The recovered product was stored in a 1.5 mL centrifuge tube and stored in a 20 C. refrigerator for later use.
[0050] 2. Construction of Yeel-sgRNA Recombinant Plasmid
[0051] Primers pGRB-F and pGRB-R were used to obtain the linearized vector L-pGRB by PCR from the vector pGRB (
[0052] 3. Construction of Recombinant E. coli LMT2
[0053] The recombinant plasmid yeel-sgRNA and fusion fragment U-pck.sup.G143R_D were transformed into E. coli K-12 W3110 (LMT1), and primers yeeL-U-F and yeeL-D-R were used to screen the transformants by colony PCR to confirm that the fusion fragment U-pck.sup.G143R-D was integrated into the yeel locus successfully. 2 mM arabinose was added for culturing at 30 C. for 12 h, the recombinant plasmid yeel-sgRNA was removed, and the recombinant strain LMT2 was obtained.
[0054] Method of plasmid removal: pREDCas9 plasmid was spectinomycin resistant, and pGRB plasmid was ampicillin resistant. 1. The modified strains with both spectinomycin and ampicillin resistances were inoculated in 10 mL of LB medium supplemented with 2 mM arabinose and 1 mM spectinomycin for culturing at 30 C. for 12 h. 2 l of bacterial liquid was taken to streak on spectinomycin-resistant LB plates for incubation at 30 C. for 12 h, and a single colony was picked to spot-plate on spectinomycin-resistant and ampicillin-resistant LB plates for incubation at 30 C. for 12 h. The colonies that grew normally on the spectinomycin-resistant plate but not on the ampicillin-resistant plate were strains with removed recombinant plasmid pGRB. 2. The strains with removed recombinant plasmid pGRB were inoculated in 10 ml LB medium, and cultured at 42 C. for 12 h. 2 l of the strain was streaked on an antibiotic-free plate and cultured at 37 C. for 12 h. A single colony was picked to spot-plate on a spectinomycin-resistant plate and the non-antibiotic-resistant plate, for culturing at 37 C. for 12 h, and strains that grew on the antibiotic-free plate but not grew on the spectinomycin-resistant plate were the strains with removed plasmid pREDCas9.
[0055] 4. Construction of Fusion Fragment U-Pyc-D
[0056] Primers yjhE-U-F, yjhE-U-R, yjhE-D-F and yjhE-D-R in Table 1 were used to amplify the upstream and downstream homology arm fragments on each side of the yjhE gene from the genome of E. coli K-12 W3110 to obtain the fragment yjhE 1 (SEQ ID NO: 11) and yjhE 2 (SEQ ID NO: 12). The above primers were used for PCR amplification, and the amplification conditions were: pre-denaturation at 95 C. for 5 min; 30 cycles of denaturation at 98 C. for 10 s, annealing at 55 C. for 15 s, extension at 72 C. for 60 s; final extension at 72 C. for 5 min. PCR amplification system: 1 L of template, 2 L of upstream and downstream primers, 20 L of sterilized double distilled water, 25 L of 2Phanta Max Master Mix. The PCR product was purified and recovered by gel recovery kit, and the concentration of the recovered product was checked by electrophoresis. The recovered product was stored in a 1.5 mL centrifuge tube and stored in a 20 C. refrigerator for later use;
[0057] Primers pyc-1, pyc-2 and pyc-3, pyc-4 in Table 1 were used to amplify pyc.sup.A247K gene from B. licheniformis genome to obtain a fragment pycA247K, the above primers were used for PCR amplification, and the amplification conditions were: pre-denaturation at 95 C. for 5 min; 30 cycles of denaturation at 98 C. for 10 s, annealing at 55 C. for 15 s, extension at 72 C. for 90 s; final extension at 72 C. for 5 min. PCR amplification system: 1 L of template, 2 L of upstream and downstream primers, 20 L of sterilized double distilled water, 25 L of 2Phanta Max Master Mix. The PCR product was purified and recovered by gel recovery kit, and the concentration of the recovered product was checked by electrophoresis. The recovered product was stored in a 1.5 mL centrifuge tube and stored in a 20 C. refrigerator for later use;
[0058] The fragments yjhE 1, pyc.sup.A247K, and yjhE 2 were subjected to a fusion PCR to obtain the fusion fragment U-pyc.sup.A247K-D (SEQ ID NO: 13). The above primers were used for PCR amplification, and the amplification conditions were: pre-denaturation at 95 C. for 5 min; 30 cycles of denaturation at 98 C. for 10 s, annealing at 55 C. for 15 s, extension at 72 C. for 90 s; final extension at 72 C. for 5 min. PCR amplification system: 1 L of template, 2 L of upstream and downstream primers, 20 L of sterilized double distilled water, 25 L of 2Phanta Max Master Mix. The PCR product was purified and recovered by gel recovery kit, and the concentration of the recovered product was checked by electrophoresis. The recovered product was stored in a 1.5 mL centrifuge tube and stored in a 20 C. refrigerator for later use.
[0059] 5. Construction of yjhE-sgRNA Recombinant Plasmid
[0060] According to the sequence information of the vector PGRB, primers PGRB-F and PGRB-R were designed, and the linearized vector L-PGRB was obtained by PCR from the vector PGRB using the above primers. The designed sgRNA was ligated with the linearized vector L-PGRB to construct a recombinant plasmid yjhE-sgRNA. The above primers were used to PCR amplification, and the amplification conditions were: pre-denaturation at 95 C. for 5 min; 30 cycles of denaturation at 98 C. for 10 s, annealing at 55 C. for 15 s, extension at 72 C. for 90 s; final extension at 72 C. for 5 min. PCR amplification system: 1 L of template, 2 L of upstream and downstream primers, 20 L of sterilized double distilled water, 25 L of 2Phanta Max Master Mix. The PCR product was purified and recovered by gel recovery kit, and the concentration of the recovered product was checked by electrophoresis. The recovered product was stored in a 1.5 mL centrifuge tube and stored in a 20 C. refrigerator for later use;
[0061] 6. Construction of Recombinant E. coli LMT3
[0062] The recombinant plasmid yjhE-sgRNA and fusion fragment U-pyc.sup.A247K-D were transformed into recombinant strain LMT2, and primers yjhE-U-F and yjhE-D-R were used to screen transformants by colony PCR to confirm that the fusion fragment U-pyc-D was integrated into the yjhE locus successfully. 2 mM arabinose was added for culturing at 30 C. for 12 h, then the recombinant plasmid yjhE-sgRNA was removed, and the recombinant strain LMT3 was obtained.
[0063] 7. Construction of Fusion Fragment U-thrAB.sup.A144DC-D
[0064] Primers ydeu-U-F, ydeu-U-R, ydeu-D-F and ydeu-D-R in Table 1 were used to amplify the upstream and downstream homology arm fragments on each side of the ydeu gene from the genome of E. coli K-12 W3110 to obtain the fragments ydeu 1 (SEQ ID NO:14) and ydeu 2 (SEQ ID NO. 15). The above primers were used for PCR amplification and the amplification conditions were: pre-denaturation at 95 C. for 5 min; 30 cycles of denaturation at 98 C. for 10 s, annealing at 55 C. for 15 min, extension at 72 C. for 90 s; final extension at 72 C. for 5 min. PCR amplification system: 1 L of template, 2 L of upstream and downstream primers, 20 L of sterilized double distilled water, 25 L of 2Phanta Max Master Mix. The PCR product was purified and recovered by gel recovery kit, and the concentration of the recovered product was checked by electrophoresis. The recovered product was stored in a 1.5 mL centrifuge tube and stored in a 20 C. refrigerator for later use;
[0065] Primers thrA-F, thrB-R, thrB-F and thrC-R in Table 1 were used to amplify the thrAB.sup.A144DC gene from the E. coli genome to obtain the fragment thrAB.sup.A144DC. The above primers were used for PCR amplification, and the amplification conditions were: pre-denaturation at 95 C. for 5 min; 30 cycles of denaturation at 98 C. for 10 s, annealing at 55 C. for 15 s, extension at 72 C. for 90 s; final extension at 72 C. for 5 min. PCR amplification system: 1 L of template, 2 L of upstream and downstream primers, 20 L of sterilized double distilled water, 25 L of 2Phanta Max Master Mix. The PCR product was purified and recovered by gel recovery kit, and the concentration of the recovered product was checked by electrophoresis. The recovered product was stored in a 1.5 mL centrifuge tube and stored in a 20 C. refrigerator for later use;
[0066] The fragments ydeu 1, thrAB.sup.A144DC and ydeu 2 were subjected to a fusion PCR to obtain the fusion fragment U-thrAB.sup.A144DC-D (SEQ ID NO: 16). The above primers were used for PCR amplification, and the amplification conditions were: pre-denaturation at 95 C. for 5 min; 30 cycles of denaturation at 98 C. for 10 s, annealing at 55 C. for 15 s, extension at 72 C. for 90 s; final extension at 72 C. for 5 min. PCR amplification system: 1 L of template, 2 L of upstream and downstream primers, 20 L of sterilized double distilled water, 25 L of 2Phanta Max Master Mix. The PCR product was purified and recovered by gel recovery kit, and the concentration of the recovered product was checked by electrophoresis. The recovered product was stored in a 1.5 mL centrifuge tube and stored in a 20 C. refrigerator for later use.
[0067] 8. Construction of Ydeu-sgRNA Recombinant Plasmid
[0068] According to the sequence information of the vector PGRB, primers PGRB-F and PGRB-R were designed. The linearized vector L-PGRB was obtained by PCR from the vector PGRB using the above primers, and the designed sgRNA was ligated with the linearized vector L-PGRB to construct a recombinant plasmid ydeu-sgRNA. The above primers were used for PCR amplification, and the amplification conditions were: pre-denaturation at 95 C. for 5 min; 30 cycles of denaturation at 98 C. for 10 s, annealing at 55 C. for 15 s, extension at 72 C. for 90 s; final extension at 72 C. for 5 min. PCR amplification system: 1 L of template, 2 L of upstream and downstream primers, 20 L of sterilized double distilled water, 25 L of 2Phanta Max Master Mix. The PCR product was purified and recovered by gel recovery kit, and the concentration of the recovered product was checked by electrophoresis. The recovered product was stored in a 1.5 mL centrifuge tube and stored in a 20 C. refrigerator for later use.
[0069] 9. Construction of Recombinant E. coli LMT4
[0070] The recombinant plasmid ydeu-sgRNA and the fusion fragment U-thrAB.sup.A144DC-D were transformed into E. coli LMT3, and primers ydeu-U-F and ydeu-D-R were used to screen transformants by colony PCR to confirm that the fusion fragment U-thrAB.sup.A144DC-D was integrated into the ydeu locus successfully. 2 mM arabinose was added for culturing at 30 C. for 12 h, the recombinant plasmid ydeu-sgRNA was removed, and the recombinant strain LMT4 was obtained.
Example 2
[0071] The recombinant strain LMT4 constructed in Example 1 was inoculated into a seed medium for seed culture, and then the seed culture was transferred to a fermentation medium for culture at an inoculation amount of 20%.
[0072] 1. Process control of 5 L seed tank [0073] a. A temperature of 37 C., a pH of 7.0, a rotation speed of 500 rpm, and an air volume of 0.3 m3/h were set, the whole process temperature was kept at 37 C., the tank pressure was 0.050.08 MPa, and the culture period was 10 h; [0074] b. Transplantation standard: until OD600 reached 12-15. [0075] c. The seed medium included dried corn steep liquor powder 5 g/L, glucose 20 g/L, yeast powder 5 g/L, KH.sub.2PO.sub.4 2 g/L, magnesium sulfate 1 g/L, FeSO.sub.4.Math.7H.sub.2O 20 mg/L, and MnSO.sub.4.Math.H.sub.2O 20 mg/L;
[0076] 2. Fermentation process control of 5 L fermentation tank [0077] a. A temperature of 37 C., a pH of 7.0, an initial speed of 300 rpm, and an air volume of 0.3 m.sup.3/h were set, the whole process temperature was kept at 37 C., and the tank pressure was 0.050.08 MPa; [0078] b. control of residual sugar: glucose was added to keep the residual sugar within 01 g/L; [0079] c. control of DO: at 0 h, the air volume was 0.3 m.sup.3/h, 300 rpm, and the tank pressure was 0.05 MPa; [0080] d. when the DO dropped below 30%, the dissolved oxygen level was controlled at 30% by adjusting the ventilation rate and stirring speed until the fermentation ended; [0081] e. the fermentation medium included glucose 20 g/L, potassium dihydrogen phosphate 2 g/L, yeast powder 3 g/L, betaine 1 g/L, magnesium sulfate 1 g/L, FeSO.sub.4.Math.7H.sub.2O 10 mg/L, and MnSO.sub.4.Math.H.sub.2O 10 mg/L, dried corn steep liquor powder 8 g/L, vitamin B1 10 mg/L.
[0082] 3. Determination method of L-threonine: [0083] 1) Sample treatment: 1 mL of the fermentation broth after 48 hours of fermentation was centrifuged at 12,000 rpm for 10 minutes to remove bacterial cells and a resulting supernatant was taken. The supernatant was diluted with deionized water and filtered through a filter membrane with a pore size of 0.22 m. [0084] 2) analysis method: pre-derivatization of OPA column [0085] 3) chromatographic conditions: [0086] (1) chromatographic column: chromatographic column C18 (2504.6) mm [0087] (2) column temperature: 40 C. [0088] (3) mobile phase A: 3.01 g of anhydrous sodium acetate was weighed in a beaker, dissolved with ultrapure water and diluted to 1 L, then 200 L of triethylamine was added, and the pH was adjusted to 7.200.05 with 5% acetic acid; after suction filtration, 5 mL of tetrahydrofuran was added, and after mixing, suction filtration was performed again with a 0.22 m inorganic filter membrane, and then a resulting filtrate was put into an ultrasonic cleaning pot to exhaust for 20 min for later use;
[0089] mobile phase B: 3.01 g of anhydrous sodium acetate was weighed in a beaker; dissolved with ultrapure water and diluted to 200 mL; the pH was adjusted to 7.200.05 with 5% acetic acid; 400 mL of acetonitrile and 400 mL of methanol was added to this solution for mixing and suction filtration, and a resulting filtrate was put into an ultrasonic cleaning pot to exhaust for 20 minutes for later use. [0090] (4) flow rate: 1.0 ml/min; [0091] (5) UV detector: 338 nm; [0092] (6) column temperature: 40 C.
[0093] According to statistics, 160 g/L threonine could be produced in a 5 L fermenter for 48 h, and the glucose conversion rate was 60%.
[0094] The above are only the preferred embodiments of the present disclosure. It should be pointed out that for those skilled in the art, several improvements and modifications can be made without departing from the principles of the present disclosure, which should be regarded as the claimed scope of the present disclosure.