SEEDLESS FRUIT PRODUCING PLANTS

20240018539 ยท 2024-01-18

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention is directed to seedless fruit producing plants. The present invention also comprises methods for production of said plants and the use of nucleic acids encoding cyclin SDS like proteins for the production of seedless fruits.

    Claims

    1-15. (canceled)

    16. A method for production of a seedless watermelon fruit comprising growing a watermelon plant and allowing pollination of said plant and harvesting the seedless fruit, wherein the watermelon plant comprises a mutant allele of a gene encoding a cyclin SDS like protein in homozygous form, wherein the mutant allele comprises a mutation in the promoter sequence resulting in no gene expression or reduced gene expression compared to a corresponding wild type allele or wherein the mutant allele encodes a non-functional protein or a reduced-function protein comprising a deletion, truncation, insertion or replacement of one or more amino acids, compared to the protein encoded by the wild type allele, wherein the cyclin SDS like protein of the wild type allele is encoded by one of the following nucleic acid molecules: a) a nucleic acid molecule, which encodes a protein with the amino acid sequence given under SEQ ID NO: 2; b) a nucleic acid molecule, which encodes a protein, the sequence of which has an identity of at least 80% with the amino acid sequence given under SEQ ID NO: 2; c) a nucleic acid molecule, which comprises the nucleotide sequence shown under SEQ ID NO: 1 or the complimentary sequence thereof; or d) a nucleic acid molecule, which has an identity of at least 90% with one of the nucleic acid sequences described under c).

    17. The method according to claim 16, wherein the mutant allele of a gene encoding a cyclin SDS like protein encodes a non-functional protein in which one or more amino acids are inserted, replaced or deleted.

    18. The method according to claim 16, wherein the mutant allele of a gene encoding a cyclin SDS like protein encodes a non-functional protein in which one or more amino acids are inserted, replaced or deleted in the conserved Cyclin N domain and/or Cyclin C domain of the protein.

    19. The method according to claim 16, wherein the watermelon plant is a vegetatively propagated plant.

    20. The method according to claim 16, wherein the mutant allele encodes a non-functional protein which is truncated and lacks the Cyclin_N and Cyclin_C domains.

    21. The method according to claim 16, wherein the mutant allele encodes a non-functional protein which lacks amino acids encoded by exons 2, 3 and/or 4 of the wild type cyclin SDS like protein.

    22. The method according to claim 16, wherein the mutant allele comprises a mutation which results in a premature stop codon.

    23. A method for production of a watermelon plant comprising the steps of: a) identifying a watermelon plant which has a mutation in an allele encoding a cyclin SDS like protein, wherein the cyclin SDS like protein of the wild type allele is encoded by one of the following nucleic acid molecules: i) a nucleic acid molecule, which encodes a protein with the amino acid sequence given under SEQ ID NO: 2; ii) a nucleic acid molecule, which encodes a protein, the sequence of which has an identity of at least 80% with the amino acid sequence given under SEQ ID NO: 2; iii) a nucleic acid molecule, which comprises the nucleotide sequence shown under SEQ ID NO: 1 or the complimentary sequence thereof; or iv) a nucleic acid molecule, which has an identity of at least 90% with one of the nucleic acid sequences described under c), and optionally b) determining whether the plant is male fertile and whether the plant, or a progeny plant produced by self-fertilization, produces seedless fruits, and optionally c) selecting a plant comprising at least on copy of the mutant allele of step a).

    24. The method according to claim 23, wherein the mutant allele in step a) is present in homozygous form.

    25. A method for production of a watermelon plant comprising the steps of: a) introducing mutations in a population of watermelon plants or providing a population of mutated watermelon plants, b) selecting a male fertile watermelon plant producing seedless fruit, c) verifying if the plant selected under b) has a mutation in an allele encoding a cyclin SDS like protein and selecting a watermelon plant comprising such a mutation, and optionally d) growing/cultivating the plants obtained under c), wherein the cyclin SDS like protein of the wild type allele is encoded by one of the following nucleic acid molecules: i) a nucleic acid molecule, which encodes a protein with the amino acid sequence given under SEQ ID NO: 2; ii) a nucleic acid molecule, which encodes a protein, the sequence of which has an identity of at least 80% with the amino acid sequence given under SEQ ID NO: 2; iii) a nucleic acid molecule, which comprises the nucleotide sequence shown under SEQ ID NO: 1 or the complimentary sequence thereof; or iv) a nucleic acid molecule, which has an identity of at least 90% with one of the nucleic acid sequences described under c).

    26. The method according to claim 25, wherein the population of plants of step a) is selfed prior to step b).

    27. The method according to claim 16, wherein the cyclin SDS like protein of the wild type allele is encoded by a nucleic acid molecule, which encodes a protein with the amino acid sequence given under SEQ ID NO: 2.

    28. The method according to claim 16, wherein the cyclin SDS like protein of the wild type allele is encoded by a nucleic acid molecule, which encodes a protein, the sequence of which has an identity of at least 80% with the amino acid sequence given under SEQ ID NO: 2.

    29. The method according to claim 16, wherein the cyclin SDS like protein of the wild type allele is encoded by a nucleic acid molecule, which comprises the nucleotide sequence shown under SEQ ID NO: 1 or the complimentary sequence thereof.

    30. The method according to claim 16, wherein the cyclin SDS like protein of the wild type allele is encoded by a nucleic acid molecule, which has an identity of at least 90% with one of the nucleic acid sequences described under c).

    Description

    DESCRIPTION OF THE FIGURES

    [0374] FIG. 1 Watermelon fruits from wild type plants (1A), wild type plants compared to fruits from EMB1 mutant plants (1B), slice of seedless fruit from an EMB1 mutant plant (IC) and opened embryoless seed of an EMB1 mutant plant (1D).

    [0375] FIG. 2 Sequence alignment comparing the sequences obtained for Sample Numbers 114, 115, 116 and 117. The number in the top right side indicates the nucleotide position in the corresponding sequence shown under SEQ NO 1. Sample Numbers 116 and 117 are obtained from EMB1 mutant plants. Sample Numbers 114 and 115 are obtained from wild type plants.

    [0376] FIG. 3 Electrophoretic analysis of the PCR products obtained from cDNA of Sample Numbers 114, 115, 116 and 117 on a polyacrylamide gel. Sample Numbers 114 and 115 are obtained from wild type plants. Sample Numbers 116 and 117 are obtained from EMB1 mutant plants.

    GENERAL METHODS

    1. Isolation of RNA

    [0377] Young ovary tissue was cut into small pieces, frozen in liquid nitrogen and stored at 80 C. until further use. The frozen tissue pieces were ground into powder with piston and mortar in liquid nitrogen to keep the powder frozen. 100 mg of the powder was used to isolate total RNA using a plant RNA isolation kit according to the manufacturer's protocol (RNeasy Plant Mini Kit, Qiagen).

    2. Preparation of cDNA The RNA was treated with DNase (TURBODNA-free, Ambion) and 0.9 g RNA was used for reverse transcription according to the manufacturer's protocols (iScript cDNA Synthesiskit, BioRad).
    3. PCR on cDNA

    [0378] PCR took place in a total volume of 20 l of buffer (Phire reaction buffer, Thermo Fisher Scientific) containing 0.2 mM dNTP's, 0.4 l Phire Hot Start II DNA Polymerase (Thermo Fisher Scientific), 0.25 M of each primer and 0.4 l cDNA mix. After initial denaturation step of 30 minutes at 90 C., 40 cycles of 10 seconds at 98 C., 15 seconds at 60 C. and 30 seconds at 72 C. were performed and the reaction was finalized with 3 minutes at 72 C.

    4. Sequencing

    [0379] The PCR product size was analysed using QIAxcel Advanced System (Qiagen) and the PCR reaction mixture was sent to a service provider to be sequenced (BaseClear, NL).

    EXAMPLES

    1. Isolation of Seedless Fruit Mutant

    [0380] A mutant population was established by treating approximately 10.000 watermelon seeds from an inbred line (WMZD0048TYY, abbreviated TYY in the following) with EMS several hours and subsequently washing the seeds in streaming tap water for 30 minutes. After that the seeds were kept wet until sowing in soil. M1 Plants were grown from the mutagenized seeds, self-pollinated and the seeds (M2 generation) were harvested. Eight seeds from each of 3000 M2 families were sown grown and mutant plants producing seedless fruits were isolated. One of these mutant plants was designated EMB1. Propagation of the EMB1 mutant plant was performed by grafting cuttings of the EMB1 mutant plant to rootstock of a non-mutagenized watermelon plants.

    2. Confirmation of Seedless Fruit Phenotype

    [0381] The EMB1 mutant was back-crossed with the original non-mutagenized watermelon TYY inbred line, using pollen from the EMB1 mutant (BC1 generation). 25% of the plants grown from the self-pollinated BC1 generation did produce seedless fruits.

    [0382] Pollen from the EMB1 mutant was also used for crossing with different watermelon inbred lines for establishing a mapping population. 25% of self-pollinated plants of the mapping population produced seedless fruits.

    [0383] The results from the respective back-crosses and crosses wherein pollen from the EMB1 mutant was used to fertilise other inbred lines clearly demonstrate that pollen of the EMB1 mutant is fertile.

    [0384] In further crosses EMB1 mutant plants, homozygous for the emb1 mutant allele were used as female parent and pollinated with pollen from various different other lines. 100% of plants from each of these crosses produced seedless fruits.

    [0385] Results obtained from the different crossings show that the emb1 mutation is due to a single recessive allele. The results also demonstrate that the seedless fruit phenotype is maintained when pollen form seed producing plants is used to fertilise EMB1 mutant plants. The seedless fruit phenotype therefore is not due to aberrant pollen of the EMB1 mutant but can be assigned to defects in embryo development.

    3. Identification of the Gene Causing the Seedless Fruit Phenotype

    [0386] The mapping population established by pollinizing different watermelon inbred lines with pollen from the EMB1 mutant plant was analysed and a single nuclear polymorphism (SNP) was detected in the genomic sequence shown under SEQ ID NO 1. SEQ ID NO 1 shows the sequence of the wild type allele. In the respective allele of the EMB1 mutant plant the nucleotide guanine (G) at position number 2185 in SEQ ID NO 1 is replaced by adenine (A).

    4. Analysis of mRNA Transcribed from Emb1 Alleles

    [0387] Flower buds of different size were harvested from field grown plants. Sample Numbers 114 and 115 are flower buds from plants of the original inbred line, designated TYY, which was used for mutagenesis. TYY thus represent wild type plants comprising wild type emb1 alleles. Sample Numbers 115 and 116 are flower buds from seedless fruit producing EMB1 mutant plants comprising mutant emb1 alleles. An overview of phenotypes, material harvested and analysed for respective Sample Numbers is given in Table 1.

    TABLE-US-00002 TABLE 1 Sample Plant Sample Number Name Tissue collected Phenotype 114 TYY (101) Flower bud 1 mm Wild type seed bearing fruit 115 TYY (102) Flower bud 3-4 mm Wild type seed bearing fruit 116 EMB1 (103) Flower bud 1 mm Seedless fruit 117 EMB1 (104) Flower bud 3-4 mm Seedless fruit

    [0388] RNA was isolated from the flower buds of the different Sample numbers. 700 ng RNA for each of the Sample numbers was used for cDNA synthesis. A PCR reaction using primers A4532 (SEQ ID NO 7) and A4533 (SEQ ID NO 8) was performed on each of the cDNA samples obtained. The primers were designed to amplify a part of the emb1 allele of the coding sequence indicated in SEQ ID NO 1. The PCR products were analysed on a polyacrylamide gel which is shown in FIG. 3. From FIG. 3 it is clearly derivable, that Sample numbers 116 and 117 did result a shorter PCR fragment than all the other Sample numbers. This clearly indicated that the mRNA of the emb1 mutant allele comprises a deletion of nucleotides compared to the corresponding wild type allele in Sample numbers 114 and 115.

    5. cDNA Sequence Analysis of Emb1 Alleles

    [0389] cDNA of Sample Numbers 114, 115, 116 and 117 were sequenced using primer A4532 shown under SEQ ID NO 7, primer A4538 shown under SEQ ID NO 11, primer A4534 SEQ ID NO 9 and primer A4535 SEQ ID NO 10. The sequences obtained from each of Sample Numbers 116 and 117 is shown under SEQ ID NO 3 as mRNA molecule. The sequences obtained from each of Sample Numbers 114 and 115 is identical to the coding sequence indicated in SEQ ID NO 1. Comparison of the sequences obtained from Sample Numbers 114, 115, 116 and 117 showed that the sequences of each of Sample Number 116 and 117 has a deletion of 16 consecutive nucleotides compared to the sequences of each of Sample Number 114 and 115. In addition, sequences of each of Sample Number 116 and 117 have a frame shift which causes a pre-mature stop codon in the coding sequence, compared to the sequences of each of Sample Number 114 and 115. An alignment of the sequence parts concerned is shown in FIG. 2.

    [0390] It is concluded, that the emb1 mutant allele of Sample Numbers 116 and 117 is transcribed into an mRNA which has a deletion, a frame shift in the reading frame and a pre-mature stop codon compared to mRNA transcribed from the wild type allele of Sample Numbers 114 and 115. In addition, it can be seen from FIG. 2 that the mRNA transcribed from the emb1 mutant allele of Sample Numbers 116 and 117 encodes a protein wherein 8 amino acids are exchanged compared to protein encoded by the mRNA transcribed from the wild type allele of Sample Numbers 114 and 115.

    6. Generation of Another Watermelon Mutant Plant

    [0391] Knowing the cyclin SDS like gene sequence made it possible to generate other mutant alleles in the SDS like gene. The EMS mutagenized TILLING population was screened with primers designed on a domain in which EMS mutations could convert an amino acid encoding codon into a stop codon.

    TABLE-US-00003 Forwardprimer: (SEQIDNO:21) CGAAGAGAAAGGATTAGACGTTG Reverseprimer: (SEQIDNO:22) TCTGAGCAGTCAGTATCAGACG

    [0392] A plant was identified comprising a mutant cyclin SDS like allele. The identified allele comprises a single nucleotide replacement at nucleotide 1687 of SEQ ID NO: 1, leading to a stop codon. The mutant allele thus encodes a truncated cyclin SDS like protein comprising only amino acids 1 to 223 of the wild type protein of SEQ ID NO: 2. The cDNA of the mutant allele is provided in SEQ ID NO: 17 and the truncated protein encoded by the mutant allele is provided in SEQ ID NO: 18.