ENZYMATIC MONOCYCLIZATION OF ACYCLIC MONOTERPENOIDS

Abstract

Enzyme mutant with squalene-hopene-cyclase activity, selected from mutants of a wild-type enzyme comprising an amino acid sequence selected from SEQ-ID No: 1 to 3 or an amino acid sequence derived therefrom with a degree of sequence identity in the range of from 60 to 99.9% of SEQ-ID No. 1 to 3, wherein the mutant catalyzes a one-step monocyclization reaction to produce products such as gamma-dihydroionone and/or alpha-dihydroionone.

Claims

1. A mutant enzyme with Squalene-hopene cyclase activity, selected from mutants of a wild-type enzyme comprising an amino acid sequence selected from SEQ-ID Nos. 1 to 3 or an amino acid sequence derived therefrom with a degree of sequence identity in the range of from 60 to 99.9% of SEQ-ID No. 1 to 3, wherein the mutant catalyzes at least the one-step monocyclization of a substrate of general formula (I) ##STR00016## to a monocyclic compound of formula (II) ##STR00017## wherein at least one of substituents R.sup.1 und R.sup.2 is selected from the group consisting of O, OH, thiol, amino, ester, halogen, nitro or nitrile groups and wherein at least one of substituents R.sup.1 und R.sup.2 is selected from hydrogen, alkyl or alkylene groups.

2. The mutant enzyme in accordance with claim 1, comprising a) a mutation in position G600 of SEQ-ID No. 1 or b) a mutation in an amino acid sequence selected from amino acid sequences SEQ-ID Nos. 2 to 3 wherein the position of the mutation corresponds to position G600 of SEQ-ID No. 1.

3. The mutant enzyme in accordance with claim 1 in which up to 10% of the amino acid groups are modified compared to SEQ-ID No. 1 or SEQ-ID No. 2 to 3 by deletion, insertion, substitution, addition or a combination thereof.

4. The mutant enzyme in accordance with claim 1 in which the mutation in position G600 of SEQ-ID No. 1 or in a position corresponding to position G600 in SEQ-ID No. 1 in one of the amino acid sequences SEQ-ID No. 2 to SEQ-ID No. 3 is a substitution selected from the group consisting of G600A, G600S, G600C, G600T, G600N, G600D, G600Q and G600E.

5. The mutant enzyme in accordance with claim 1 comprising in addition at least one mutation in one of positions Y420 or L607 of SEQ-ID No. 1 or at least one mutation in an amino acid sequence selected from amino acid sequences SEQ-ID No 2 to SEQ-ID No. 3 wherein the position of the mutation corresponds to position Y420 respectively L607 of SEQ-ID No. 1.

6. The mutant enzyme in accordance with claim 1 comprising three mutations in positions Y420, G600 und L 607 of Sequence-ID No. 1 or three mutations in an amino acid sequence selected from amino acid sequences SEQ-ID Nos 2 to 3 wherein the position of the mutation corresponds to position Y420, G600 and L607 of SEQ-ID No. 1.

7. The mutant enzyme in accordance with claim 1 comprising four mutations in positions A306, Y420, G600 und L 607 of Sequence-ID. No. 1 or four mutations in an amino acid sequence selected from amino acid sequences SEQ-ID Nos 2 to 3 wherein the position of the mutations correspond to positions A306, Y420, G600 and L607 of SEQ-ID No. 1.

8. The mutant enzyme corresponding to claim 1 comprising an amino acid sequence selected from SEQ-ID No. 4 to 8 and 34.

9. A nucleic acid sequence, encoding for an enzyme mutant in accordance with claim 1.

10. An expression cassette, comprising a nucleic acid sequence in accordance with claim 9.

11. A recombinant vector, comprising under the control of at least one regulative element, at least one nucleic acid sequence in accordance with claim 9.

12. A recombinant microorganism comprising at least one nucleic acid sequence in accordance with claim 9.

13. A process for the manufacture of compounds of formula (II) ##STR00018## wherein at least one of substituents R.sup.1 and R.sup.2 is selected from the group consisting of O, OH, thiol, amino, ester, halogen, nitro or nitrile groups and wherein at least one of substituents R.sup.1 und R.sup.2 is selected from hydrogen, alkyl or alkylene groups wherein compounds of formula (I) ##STR00019## wherein R.sup.1 and R.sup.2 are as defined above, are cyclized with an enzyme mutant in accordance with claim 1.

14. Use of an enzyme mutant in accordance with claim 1 for the cyclization of compounds.

15. The use in accordance with claim 14 for the manufacture of dihydroionone derivatives, in particular (+)--dihydroionone, starting from geranylacetone, nerylacetone, calmusal, calmusol or mixtures thereof.

Description

[0082] The FIGURE shows the conversion of substrate 16 with squalene-hopene cyclase from Thermesynechococcus elongatus (TeSHC).

WORKING EXAMPLES

[0083] Material

[0084] Chemicals:

[0085] The chemicals used for syntheses, molecular biology and biochemical work have been purchased from Carl-Roth (Karlsruhe, DE), VWR (Pennsylvania, US), Sigma-Aldrich (St. Louis, US) and Alfa-Aesar (Ward Hill, US). The substrates (E/Z)-geranyl acetone from VWR (A19184.14), Calmusal from ambinter (18445-88-0) and ambrinol from Amyris. All the other subtrates for biocatalytic purposes were chemically synthesized and analyzed by .sup.1H-NMR, .sup.13C-NMR and GC/MS.

[0086] Molecular Biological Kits.

[0087] The molecular biological kits for DNA-purification (Zymoclean DNA Clean & Concentrator Kit), Agarose gel-extraction (Zymoclean Ge/DNA Recovery Kit) and plasmid isolation (Zyppy Pilasmid Miniprep Ki6) were purchased from ZymoResearch (Irvine, US).

TABLE-US-00001 TABLE 1 List of Buffers & Media Buffer Ingredients 10x phosphate buffer 0.17M KH.sub.2PO.sub.4, 0.72M K.sub.2HPO.sub.4, pH = 7.4 (KP.sub.i-buffer) Whole cell buffer 100 mM Citric acid, 0.1% SDS, pH = 6.0 Cyclodextrin (CD) buffer 0.2% SDS, 10 mM (2-Hydroxypropyl)- -cyclodextrin, pH = 6.0 Lysis buffer 200 mM Citric acid, 0.1% EDTA, pH = 6.0 Extraction buffer 100 mM Citric acid, 1% CHAPS, pH = 6.0

TABLE-US-00002 TABLE 2 List of media used Medium Ingredients Lysogeny broth 10 g/L tryptone, 10 g/L NaCl, 5 g/L yeast extract Auto-induction medium*(T-DAB) 12 g/L tryptone, 24 g/L yeast extract, 2.9 g/L glucose, 11.1 g/L Glycerol, 7.6 g/L Lactose

[0088] based on: https://www.tci.uni-hannover.de/uploads/tx_tkpublikationen/Poster_for_Wien_autoinduction_Z haopeng_Li.pdf

TABLE-US-00003 TABLE3 Listofprimersusedinthiswork Name No (SEQ-IDNo.) Sequence(5.fwdarw.3)Forward/Reverse 1 AacSHC_G600C CCGTATTATACCGGCACCTGCTTCCCGGGCG/ (ID36,ID37) CGCCCGGGAAGCAGGTGCCGGTATAATACGG 2 AacSHC_G600D CCGTATTATACCGGCACCGATTTCCCGGGCG/ (ID38,ID39) CGCCCGGGAAATCGGTGCCGGTATAATACGG 3 AacSHC_G600E CCGTATTATACCGGCACCGAATTCCCGGGCG/ (ID40,ID41) CGCCCGGGAATTCGGTGCCGGTATAATACGG 4 AacSHC_G600H CCGTATTATACCGGCACCCATTTCCCGGGCG/ (ID42,ID43) CGCCCGGGAAATGGGTGCCGGTATAATACGG 5 AacSHC_G600I CCGTATTATACCGGCACCATTTTCCCGGGCG/ (ID44,ID45) CGCCCGGGAAAATGGTGCCGGTATAATACGG 6 AacSHC_G600K CCGTATTATACCGGCACCAAATTCCCGGGCG/ (ID46,ID47) CGCCCGGGAATTTGGTGCCGGTATAATACGG 7 AacSHC_G600M CCGTATTATACCGGCACCATGTTCCCGGGCG/ (ID48,ID49) CGCCCGGGAACATGGTGCCGGTATAATACGG 8 AacSHC_G600N CCGTATTATACCGGCACCAACTTCCCGGGCG/ (ID50,ID51) CGCCCGGGAAGTTGGTGCCGGTATAATACGG 9 AacSHC_G600P CCGTATTATACCGGCACCCCGTTCCCGGGCG/ (ID52,ID53) CGCCCGGGAACGGGGTGCCGGTATAATACGG 10 AacSHC_G600Q CCGTATTATACCGGCACCCAGTTCCCGGGCG/ (ID54,ID55) CGCCCGGGAACTGGGTGCCGGTATAATACGG 11 AacSHC_G600L CCGTATTATACCGGCACCCTATTCCCGGGCG/ (ID56,ID57) CGCCCGGGAATAGGGTGCCGGTATAATACGG 12 AacSHC_G600S CCGTATTATACCGGCACCTCGTTCCCGGGCG/ (ID58,ID59) CGCCCGGGAACGAGGTGCCGGTATAATACGG 13 AacSHC_G600T CCGTATTATACCGGCACCACCTTCCCGGGCG/ (ID60,ID61) CGCCCGGGAAGGTGGTGCCGGTATAATACGG 14 AacSHC_G600V CCGTATTATACCGGCACCGTGTTCCCGGGCG/ (ID62,ID63) CGCCCGGGAACACGGTGCCGGTATAATACGG 15 AacSHC_G600Y CCGTATTATACCGGCACCTATTTCCCGGGCG/ (ID64,ID65) CGCCCGGGAAATAGGTGCCGGTATAATACGG 16 AacNMC_Y609F GGCGATTTTTATGCGGGCTTTACCATGTATC (ID66,ID67) GCCATGTG/ CACATGGCGATACATGGTAAAGCCCGCATAAAA ATCGC 17 AacSHC_Y420F CAACGGCGGCTGGGGCGCGTTTGATGTGGATA (ID68,ID69) ACACCAGC/ GCTGGTGTTATCCACATCAAACGCGCCCCAGC CGCCGTTG AacSHC_L607M GGTTCCCGGGCGATTTTTATGCCATGTATACCA (ID70,ID71) TGTATCGCC/ GGCGATACATGGTATAGCCGGCATAAAAATCGC CCGGGAACC AacSHC_L607S GGTTCCCGGGCGATTTTTATAGCCATTATACCAT (ID72,ID73) GTATCGCC/ GGCGATACATGGTATAGCCGCTATAAAAATCGCC CGGGAACC AacSHC_L607Y GGTTCCCGGGCGATTTTTATTATGGCTATACCATG (ID74,ID75) TATCGCC/ GGCGATACATGGTATAGCCATAATAAAAATCGCCC GGGAACC AacSHC_L607V GGTTCCCGGGCGATTTTTGTCCCATGTATACCATG (ID76,ID77) TATCGCC/ GGCGATACATGGTATAGCCGGGACAAAAATCGCC CGGGAACC 18 AacSHC_L607RVT GGTTCCCGGGCGATTTTTATRNTGGCTATACCATG (ID78,ID79) TATCGC/ ATAAAAATCGCCCGGGAACCCGGTGCCGGTATAA TACGG 19 AacSHC_1261X GCGATGGCAGCTGGGGCGGCNDTCAGCCGCCGTG (ID80,ID81, GTTTTATGC/ ID82,ID83) GCGATGGCAGCTGGGGCGGCVHGCAGCCGCCGTG GTTTTATGC/ GCGATGGCAGCTGGGGCGGCTGGCAGCCGCCGTG GTTTTATGC/ TGCCGCCCCAGCTGCCATCGCCCGCCTGGCGTTCCAG 20 AacSHC_F365X GAAACCGGGCGGCTTTGCGNDTCAGTTTGATAACGTG (ID84,ID85, TATTATCCGG/ ID86,ID87) GAAACCGGGCGGCTTTGCGVHGCAGTTTGATAACGTG TATTATCCGG/ GAAACCGGGCGGCTTTGCGTGGCAGTTTGATAACGTG TATTATCCGG/ CGCAAAGCCGCCCGGTTTCAGGTTCGGGCGTTTCAC 21 AacSHC_L36X GGCTATTGGTGGGGCCCGNDTCTGAGCAACGTGAC (ID88,ID89, CATG/ ID90,ID91) GGCTATTGGTGGGGCCCGVHGCTGAGCAACGTGACC ATG/ GGCTATTGGTGGGGCCCGTGGCTGAGCAACGTGAC CATG/ CGGGCCCCACCAATAGCCTTCATCTTTCTGGCAGC TCAG 22 AacSHC_S307X GGCTGGATGTTTCAGGCGNDTATTAGCCCGGTGT (ID92,ID93, GGG/ ID94,ID95) GGCTGGATGTTTCAGGCGVHGATTAGCCCGGTGT GGG/ GGCTGGATGTTTCAGGCGTGGATTAGCCCGGTGT GGG/ CGCCTGAAACATCCAGCCGCCATAATCCAGTTCCACG 23 AacSHC_A306X GGCGGCTGGATGTTTCAGNDTAGCATTAGCCCGGTG/ (ID96,ID97, GGCGGCTGGATGTTTCAGVHGAGCATTAGCCCGGTG/ ID98,ID99) GGCGGCTGGATGTTTCAGTGGAGCATTAGCCCGGTG/ CTGAAACATCCAGCCGCCATAATCCAGTTCCACGCCA TACAG ID represents the SEQ-ID No. in the sequence listing.

[0089] General Analytics

[0090] Nuclear Magnetic Resonance

[0091] .sup.1H- und .sup.13C-NMR spectra were recorded on a BrukerAvance 500 Spectrometer at 500.15 MHz for .sup.1H- and 125 MHz for .sup.13C. The chemical shifts are referred to tetramethylsilane (=TMS) in ppm set to 0. All substances were dissolved in CDCl.sub.3 and recorded at room temperature.

[0092] Circular Dichroism

[0093] The specific optical rotation of the compounds was measured on a Perkin Elmer Polarimeter 241. Therefore the substance was dissolved in CHCl.sub.3 (c=0.5 mg/ml) and the specific rotation was measured with a sodium and a mercury spectral lamp.

[0094] Gas Chromatography

[0095] GC analyses were performed using an Agilent GC 7820A equipped with a mass spectrometer MSD 5977B and a HP-5MS capillary column (Agilent, 30 m250 m0.25 m) and helium as carrier gas with a constant pressure of 14.168 . Injections (1 L) were performed in split mode (10:1). Relative conversion rates were calculated directly from GC-MS spectra by integration-quotient of substrates and products. Chiral GO analysis was performed on a Shimadzu GC-2010 equipped with a OP ChiraSil-Dex GB capillary column (Agilent, 25 m250 m0.25 m) and hydrogen as carrier gas with constant velocity (linear velocity: 33.1 cm/s). Injections (1 L) were performed in split mode (5:1). Temperature programs are listed in table 4.

TABLE-US-00004 TABLE 4 Temperature programs used in this work Name Rate ( C./min) Temp. ( C.) Hold (min) Dihydroion long 120 0.1 2 145 0.6 Dihydrion short 120 0.1 2 137 0.6 Calmusal 110 0.1 2 135 0.6 General 50 3 6 120 0 10 150 0 15 170 0 20 200 0 25 250 0 30 310 Chiral 70 3 140 0 8 180 2

[0096] Chemical Synthesis

[0097] Synthesis of Geranyl Isopropanol

##STR00008##

[0098] For the reduction reaction geranyl acetone (0.50 ml, 2.34 mmol 1.00 eq.) was dissolved in ethanol (10 ml). Sodium borohydride (0.088 g, 2.34 mmol, 1.00 eq.) was then added carefully and the reaction mixture was stirred at room temperature for 1 h. After the reaction was complete, the mixture was quenched with 0.5 N HCl (2 ml) and stirred again for 30 min. Then distilled water (50 ml) was added and the aqueous phase was extracted three times with DCM. The combined organic phases were dried over CaCl.sub.2 and the geranyl isopropanol was obtained as a clear oil (0.49 ml, 2.04 mmol, 87%).

[0099] .sup.1H-NMR (CDCl.sub.3, 500 MHz): (ppm) 1.19 (d, J=2.9 Hz, 3H), 1.50 (quart, J=7.7 Hz, 2H) 1.6 (s, 3H), 1.62 (s, 3H), 1.68 (s, 3H), 1.88-1.92 (t, J=7.3 Hz, 2H), 2.04-2.12 (m, 4H), 3.77-3.84 (sept, J=17.43 Hz, 1H), 5.05-5.10 (t, J=6.7 Hz, 1H), 5.12-5.17 (t, J=6.8 Hz, 1H). .sup.13C-NMR (CDCl.sub.3, 125 MHz): (ppm) 16.50 (1C), 16.66 (1C), 22.44-25.63 (4C), 38.15-38.70 (2C), 66.97 (1C), 75.67 (1C), 122.22-123.24 (2C), 134.9 (1C). MS (EI): m/z (%)=196 (0.3), 153 (32), 135 (21), 109 (58), 95 (21), 82 (19), 81 (21), 69 (100), 68 (13), 67 (44). The data are consistent with the literature.sup.1.

Synthesis of 6,10-dimethylundeca-5,9-dien-2-ol (23)

[0100] ##STR00009##

[0101] The reaction was carried out analog to synthesis (1). The product was obtained as a clear oil (0.21 ml, 1.04 mmol, 43%).

[0102] .sup.1H-NMR (CDCl.sub.3, 500 MHz): (ppm) 1.19-1.34 (m, 2H), 1.55-1.59 (m, 2H) 1.61 (s, 3H), 1.62-1.65 (m, 1H), 1.68 (s, 3H), 1.69-1.71 (m, 2H), 2.04-2.12 (m, 4H), 3.62-3.67 (t, J=6.6 Hz, 2H), 5.03-5.19 (m, 2H). The data is consistent with the literature.sup.2.

[0103] Sulfuric Acid Catalyzed Cyclization of ()--Dihydroionone

##STR00010##

[0104] For the cyclization reaction ()--dihydroionone (400 L, 1.8 mmol) was dissolved in THE (15 mL) in a 50 mL Schott-bottle. 2N sulfuric acid (5 mL) was then added and the reaction mixture was shaken at 37 C. for 24 h. The reaction was quenched by addition of water (20 mL) and extracted with Diethylether (330 mL). The combined organic phases were dried over MgSO.sub.4 and purified via silica chromatography (10:1, hexane: ethyl acetate) to yield the slightly yellowish liquid (+)--ambrinol (350 L, 1.5 mmol, 88% yield); ([].sub.D.sup.20=+84.6; Lit.=81.8.sup.3).

[0105] .sup.1H-NMR (CDCl.sub.3, 500 MHz): (ppm) 0.87 (s, 3H), 0.91 (s, 3H) 1.14 (m, 1H), 1.22 (s, 3H), 1.24-1.40 (m, 3H), 1.45-1.51 (m, 2H), 1.67-1.74 (m, 2H), 1.98-2.02 (m, 2H), 2.06-2.17 (m, 2H), 5.45 (t, J=3.84 Hz, 1H). .sup.13C-NMR (CDCl.sub.3, 125 MHz): (ppm) 22.6 (1C), 23.8 (1C), 25.05 (1C), 26.02 (1C), 28.07 (1C), 29.24 (1C), 31.11 (1C), 28.95 (1C), 47.25 (1C), 49.82 (1C), 70.28 (1C), 122.04 (1C), 137.39 (1C). The data is consistent with the literature.sup.4.

[0106] (+)--ambrinol MS (EI): m/z (%)=194 (5), 176 (40), 161 (30), 136 (100), 121 (66), 120 (40), 109 (28), 105 (31), 95 (49), 93 (28).

[0107] Side product: ()--ambrinol: MS (EI): m/z (%)=194 (6), 176 (55), 161 (100), 136 (40), 121 (84), 107 (43), 106 (46), 105 (60), 93 (52), 91 (42).

[0108] General Methods

[0109] Plasmid Isolation

[0110] Isolation of the plasmid proceeded following to the standard protocol of Zyppy Plasmid Miniprep Kit by ZymoResearch..sup.5 For the photometric determination of the plasmid DNA concentration, 1 L was measured on a Nanodrop 1000 (Agilent, Santa Clara, US) at a wavelength of 260 nm.

[0111] Site-Saturation/-Directed Mutagenesis

[0112] The gene encoding for AacSHC (UniProt: P33247) or a variant based on this gene was cloned into a pET-22b(+) vector system (Merck, Darmstadt, Germany). SacI and NdeI were used as restriction sites. Cloning followed the standard protocol of Novagene's KOD Hot Start DNA Polymerase..sup.6 The composition of the PCR mixture and the temperature profile are described in Table 5 and Table 6.

TABLE-US-00005 TABLE 5 Composition of the PCR mixture substance volume [l] final concentration daH.sub.20 29 DMSO 2.5 KOD Hot Start Buffer (10x) 5 1x dNTPs (2 mM each) 5 250 m (each) MgSO.sub.4 (25 mM) 4.5 2 mM Template DNA 1 0.5-5 ng/l Primer forward (10 M) 1 0.2 m Primer reverse (10 M) 1 0.2 m KOD Hot Start DNA Polymerase 1

TABLE-US-00006 TABLE 6 PCR temperature profile step Temperature [ C.] time [s] cycles Initial denaturation 95 120 1 Denature 95 30 Annealing 60 30 30 Extension 70 210 Final extension 72 420 1

[0113] Site-saturation libraries were generated employing the 22c-trick method..sup.7 PCR products were digested with 1 L DpnI for 2 h at 37 C., purified by agarose gel electrophoresis and ligated into the pET22b(+) vector by Gibson assembly.sup.8. After purification using the DNA Clean & Concentrator-5 kit.sup.9 the plasmids were transformed via heat-shock method. Site-directed clones were digested and directly transformed afterwards.

[0114] Plasmid Transformation

[0115] Chemically competent cells based on rubidium chloride were produced for the transformation of the plasmid DNA..sup.10 The transformation was carried out under sterile conditions. For site saturation libraries 3 L of the purified PCR product was added to 25 L XL1-blue competent cells and incubated for 30 min on ice, followed by a heat shock at 42 C. for 105 s with subsequent ice cooling for 3 min. After adding 500 l of LB medium, the cells were incubated for 40 min at 37 C. and used for inoculation of a 5 mL LB medium (Ampicillin, c.sub.end=100 g/ml) pre-culture overnight. After isolation of the plasmid, transformation into 50 L BL21 (DE3) was performed using the heat shock method. After regeneration 150 L were streaked out on an agar plate (Ampicillin, c.sub.end=100 g/ml) and incubated at 37 C. overnight. For quality control the plasmid was isolated from another 150 L and sent for sequencing. For site-directed mutants the PCR product was directly transformed into XL1-blue competent cells after digest. After regeneration 300 L were streaked out on an agar plate for single clone picking.

[0116] Expression of AacSHC Libraries in 96-DW Plates

[0117] Individual colonies were picked from generated agar plates and cultivated in 500 L LB medium (Ampicillin, c.sub.end=100 g/ml) for 18-20 h at 37 C., 800 rpm. Expression cultures were inoculated with 10 L of the pre-culture into 1 mL of T-DAB autoinduction medium (Ampicillin, c.sub.end=100 g/ml) with lactose as the inductor. The cultures were incubated for 20 h at 37 C., 800 rpm and harvested afterwards (4000g, 20 min).

[0118] Expression in 24 DW-Plates

[0119] Individual colonies were picked from generated agar plates and cultivated in 2 mL LB medium (Ampicillin, c.sub.end=100 g/ml) for 18-20 h at 37 C., 180 rpm. Expression cultures were inoculated with 40 L of the pre-culture into 4 mL of T-DAB autoinduction medium (Ampicillin, c.sub.end=100 g/ml) with lactose as the inductor. The cultures were incubated for 20 h at 37 C., 600 rpm and harvested afterwards (4000g, 20 min).

[0120] Thermolysis Purification.sup.11,12

[0121] Harvested or lyophilized cells were resuspended in 1 mL Lysis buffer and incubated for 60 min at 70 C. The cell suspension was centrifuged (14000g, 1 min) and the supernatant was discarded. As the enzyme is membrane-bound 1 mL 1%-CHAPS buffer was added to extract it from the cell pellet by shaking at room temperature for 1d, 600 rpm. After subsequent centrifugation (14000g, 1 min) the supernatant containing the AacSHC was transferred to a new tube followed by SDS-PAGE analysis and determination of enzyme concentration by using the Nanodrop 1000 (Agilent, Santa Clara, US). Therefore the Protein A280 mode was chosen with MW=71439 Da and molar extinction coeffizient =185180 as protein specific data.

[0122] SDS-PAGE

[0123] After protein purification and extraction 20 l of the enzyme preparation was mixed with 10 l SDS loading buffer and heated to 95 for 10 min. Afterwards 10 l of the preparation were loaded on the pre-prepared SDS-PAGE.

[0124] Screening of AacSHC Libraries Via GC-MS

[0125] Harvested pellets were resuspended in 400 L whole cell buffer and transferred to another 96-DW plate equipped with 1.2 mL glass inlets. Afterwards 4 L substrate/DMSO stock solution (substrate c.sub.end=2 mM) was added directly into the cell suspension, the plates were sealed and shaken for 20 h at 30 C., 600 rpm. In order to stop the reaction 600 L cyclohexene/o-xylol (1:1) was added and the mixture was incubated for 10 min. The plates were centrifuged (4000g, 5 min), sealed using PP-sealings and a GC-MS equipped with a PAL-Sampler was used to inject directly from the organic phase. Quantification was made directly from the Total Ion Count chromatogram by quotient AREA.sub.product/(AREA.sub.substrate+AREA.sub.product)*100. In total 90 variants per plate were screened. Promising variants were rescreened by expression in 24 DW-plates.

[0126] Verification of Promising Hits

[0127] Promising candidates from the 96-DW screening were taken for inoculation of a 5 mL LB pre-culture. Afterwards the plasmids were isolated and transformed for single colony picking. The single colonies were expressed in 24 DW-plates and after harvesting the OD.sub.600 was set to 20 in whole cell buffer substrate was added (c.sub.end=4.4 mM) The reactions were carried out at least in technical duplicates. Reactions were stopped by adding Dichloromethane. After two extraction the resulting organic phase was measured directly over GC-MS. Quantification was made directly from the Total Ion Count chromatogram by quotient AREA.sub.product/(AREA.sub.substrate+AREA.sub.product)*100.

[0128] Determination of Total Turnover Number

[0129] After expression and harvesting in 24 DW-plates the cell pellets were frozen at 80 C. overnight. Afterwards the frozen pellets were lyophilized in a Christ alpha2-4LD plus overnight. For the reaction setup 10 mg of the E. coli whole cells were resuspended in 1 ml cyclodextrin buffer and 2 l (c.sub.end=8.8 mM) of substrate was added to the suspension and the reaction was stirred for 20 h at 30 C. The reaction was stopped by addition of DCM and 10 mM of 1-Undecanol was added. The reaction was extracted three times and the combined organic phases were measured over GC-MS. Quantification was made by 1-Undecanol as internal standard. The protein concentration was determined by extracting the enzyme from 10 mg for each batch in triplikates via thermolysis (see (6)). Verification and quality control was done by SDS-PAGE.

[0130] Up-Scaling Reactions

[0131] In order to isolate and determine the structure of the products upscalings of the biotransformations were performed. Therefore, the corresponding variant was expressed and the harvested cell pellets were lyophilized. Afterwards 3 g of lyophilized whole cells were resuspended in 200 mL buffer (0.1% SDS, 50 mM Citric acid, 5 mM (2-Hydroxypropyl)--cyclodextrin) and 200 l substrate was added. The reactions were carried out in closed 250 mL flasks at 30 C. and 250 rpm for seven days. The crude product was centrifuged to get rid of the cell debris. The aqueous phase containing the product encapsulated by cyclodextrin was extracted with diethyl ether three times, reduced under vacuum, purified over column chromatography (petroleum ether: ethyl acetate; 50:1->10:1) and evaluated via NMR and GC/MS.

[0132] For Z-geranyl acetone conversion 10 g of lyophilized whole cells were used in 500 mL cyclodextrin (CD) buffer and 2 g (2.24 ml) substrate was added.

[0133] E-geranyl acetone 16t with G600R (SEQ-ID No.16)

##STR00011##

[0134] Colorless oil, 0.167 ml, 0.77 mmol, 85% yield. (4S,8S)-2,5,5,8-tetramethyl-4,5,6,7,8,8-hexahydro-4H-chromene 11t: .sup.1H-NMR (CDCl.sub.3, 500 MHz): (ppm) 0.81 (s, 3H), 0.91 (s, 3H) 1.17 (s, 3H), 1.21-1.29 (m, 1H), 1.4-1.6 (m, 5H), 1.68 (s, 3H), 1.72-1.94 (m, 3H), 4.4-4.5 (m, 1H). .sup.13C-NMR (CDCl.sub.3, 125 MHz): (ppm) 19.07 (1C), 19.21 (1C), 19.82 (1C), 20.51 (1C), 20.77 (1C) 30.31 (1C), 32.25 (1C), 39.99 (1C), 41.65 (1C), 48.37 (1C), 76.48 (1C), 94.97 (1C), 147.97 (1C). The data is consistent with the literature..sup.13

[0135] Z-geranyl acetone 16c with G600R (SEQ-ID No.16)

##STR00012##

[0136] Colorless oil, 0.098 ml, 0.45 mmol, 49% yield. (4R,8S)-2,5,5,8-tetramethyl-4,5,6,7,8,8-hexahydro-4H-chromene 11t: .sup.1H-NMR (CDCl.sub.3, 500 MHz): (ppm) 0.85 (s, 3H), 0.87 (s, 3H) 1.16 (s, 3H), 1.32-1.39 (m, 1H), 1.54 (s, 3H), 1.6-1.66 (m, 3H), 1.68 (s, 3H), 1.72-1.97 (m, 3H), 2.14-2.27 (m, 1H), 4.4-4.5 (d, J=2.6 Hz, 1H). .sup.13C-NMR (CDCl.sub.3, 125 MHz): (ppm) 18.13 (1C), 19.79 (1C), 20.54 (1C), 21.19 (1C), 26.50 (1C) 32.46 (1C), 33.73 (1C), 39.66 (1C), 41.99 (1C), 44.00 (1C), 74.71 (1C), 94.56 (1C), 148.76 (1C).

[0137] Z-geranyl acetone 16c with NMC

##STR00013##

[0138] Colorless oil, 1.97 ml, 9.1 mmol, 89% yield. ()--dihydroionone 9: .sup.1H-NMR (CDCl.sub.3, 500 MHz): (ppm) 0.87 (s, 3H), 0.92 (s, 3H) 1.10-1.30 (m, 2H), 1.42-1.62 (m, 2H), 1.66-1.70 (m, 1H), 1.76-1.83 (m, 1H), 1.97-2.04 (m, 2H), 2.11 (s, 3H), 2.22-2.45 (m, 2H), 4.50-4.51 (d, J=1.03 Hz, 1H), 4.75-4.77 (m, 1H). .sup.13C-NMR (CDCl.sub.3, 125 MHz): (ppm) 20.31 (1C), 22.62 (1C), 23.52 (1C), 26.5 (1C), 28.3 (1C), 30.20 (1C), 32.00 (1C), 34.83 (1C), 42.38 (1C), 53.40 (1C), 109.5 (1C), 149.09 (1C), 209.52 (1C). The data is consistent with the literature..sup.14

[0139] E/Z-geranyl isopropanol 21 with G600N/L607S (SEQ-ID No.17)

##STR00014##

[0140] Yellowish oil, 0.020 ml, 0.9 mmol, 10% yield. .sup.1H-NMR (CDCl.sub.3, 500 MHz): (ppm) 2S,4S,8S-Tetrahydroedulane 24: 0.81 (s, 3H), 0.89 (s, 3H), 1.14-1.15 (d, J=3.1, 3H), 1.23 (s, 3H), 1.28 (s, 1H) 1.33 (s, 1H), 1.42-1.53 (m, 5H), 1.56 (s, 2H), 1.62-1.77 (m, 4H), 3.97-4.04 (m, 1H). 2R,4S,8S-Tetrahydroedulane 25: 0.74 (s, 3H), 0.87 (s, 3H), 1.09-1.10 (d, J=3.2, 3H), 1.23 (s, 3H), 1.28 (s, 1H) 1.33 (s, 1H), 1.42-1.53 (m, 5H), 1.56 (s, 2H), 1.62-1.77 (m, 4H), 3.72-3.79 (m, 1H). .sup.13C-NMR (CDCl.sub.3, 125 MHz): 2R,4S,8S-Tetrahydroedulane 25: (ppm) 19.54 (1C), 19.59 (1C), 20.19 (1C), 20.78 (1C), 22.72 (1C), 32.11 (1C), 33.37 (1C), 35.61 (1C), 40.75 (1C), 41.67 (1C), 53.30 (1C), 65.51 (1C), 74.83 (1C). The data is consistent with the literature..sup.15

[0141] 4-((R)-2,2-dimethyl-6-methylenecyclohexyl)butan-2-ol 18: Characteristic methylene signals at .sup.1H-NMR (CDCl.sub.3, 500 MHz): (ppm) 4.53 (d, J=1.25 Hz, 1H) and 4.75 (t, J=1.25 Hz, 1H). From the chiral GC data and the enantiopure monocyclization of 16c we assume the stereocenter here to be R.

6,10-dimethylundeca-5,9-dien-2-ol 23 with G600N/L607S (SEQ-ID No.17)

[0142] ##STR00015##

[0143] Characteristic C7-methylene signals for 20 at .sup.1H-NMR (CDCl.sub.3, 500 MHz): 4.55 (d, J=1.00 Hz, 1H) and 4.75 (t, J=1.30 Hz, 1H). From the chiral GC data and the enantiopure monocyclization of 10c we assume the stereocenter here to be R.

[0144] Table 7 shows the relative conversion rates in % of substrate mixture 16 and isolated 16t and 16c with the wild-type enzyme and the variant G600R and the corresponding product selectivities.

TABLE-US-00007 (E/Z)-GER (E)-GER (Z)-GER 16 16t 16c WT 23.2 29.0 0.7 G600R 80.4 95.7 68 error WT 4.1 2.5 0.2 error G600R 5.1 0.8 4.3 selectivity WT bicyclic 100 100 60 selectivity bicyclic 95 100 85 G600R monocyclic 5 15

[0145] Reaction conditions: E. coli whole cells harboring AacSHC variant resuspended in whole-cell buffer (0.1 M citric acid, 0.1% SDS, pH=6.0) with an OD.sub.600=20, 20 h, 30 C., 4.4 mM substrate (=1 l in 1 ml cell suspension).

TABLE-US-00008 TABLE 8 Relative conversion rates in % of the substrate Z-geranyl acetone X with all variants at position 600 and the corresponding product selectivities Hexahydrochromene 9 14 overall conv. error G600R (ID 16) 26.2 1.7 0.7 28.5 0.6 G600M (ID 18) 25.5 0.7 0.6 26.7 1.1 G600T (ID8) 8.8 7.9 3.8 20.4 0.4 G600L (ID 19) 16.1 0.4 0.3 16.8 0.3 G600N (ID 11) 9.9 1.0 1.6 12.4 1.2 G600Q (ID13) 9.6 0.4 0.5 10.4 2.0 G600Y (ID20) 8.1 0.6 0.3 9.0 0.2 G600C (ID15) 6.8 1.5 0.7 9.0 0.4 G600S (ID10) 4.6 2.7 1.2 8.5 0.5 G600K (ID21) 6.6 0.7 0.3 7.5 1.2 G600D (ID12) 5.4 1.2 0.7 7.3 2.5 G600E (ID14) 5.8 1.1 0.3 7.2 1.8 G600V (ID22) 5.4 0.2 0.1 5.7 2.3 G600A (ID9) 2.9 0.9 0.3 4.2 1.0 G600F (ID23) 3.4 0.3 0.1 3.8 2.1 G600I (ID24) 3.4 0.1 0.0 3.6 0.5 G600W (ID25) 2.6 0.4 0.2 3.1 0.3 G600H (ID26) 1.1 0.1 0.1 1.3 0.8 WT (ID1) 0.5 0.1 0.1 0.7 0.4 G600P (ID 27) 0.1 0.0 0.0 0.1 0.0 ID represents the SEQ-ID No. in the sequence listing.

[0146] Reaction conditions: E. coli whole cells harboring AacSHC variant resuspended in whole-cell buffer (0.1 M citric acid, 0.1% SDS, pH=6.0) with an OD.sub.600=22, 20 h, 30 C., 8.48 mM substrate (=2 l in 1 ml cell suspension).

TABLE-US-00009 TABLE 9 Relative conversion rates in % of the substrate Z- geranyl acetone X with the variants at position 607 and the corresponding product selectivities. Hexahydrochromene 9 14 overall conv. error L607S (ID28) 8.8 6.3 1.8 16.9 1.2 L607M (ID29) 10.5 0.4 0.3 11.2 0.5 L607A (ID30) 5.5 3.3 0.8 9.5 0.6 L607V (ID31) 3.8 1.8 0.5 6.1 0.7 L607G (ID32) 1.2 0.4 0.2 1.7 0.2 ID represents the SEQ-ID No. in the sequence listing.

[0147] Reaction conditions: E. coli whole cells harboring AacSHC variant resuspended in whole-cell buffer (0.1 M citric acid, 0.1% SDS, pH=6.0) with an OD.sub.600=20, 20 h, 30 C., 8.8 mM substrate (=2 l in 1 ml cell suspension).

TABLE-US-00010 TABLE 10 Relative conversion rates in %, corresponding selectivities and total turnover numbers (TTN) of the wild-type enzyme and the engineered enzymes. Enzymeconc. 1.54 1.32 1.5 1.54 1.64 1.38 in g/l Enzymeconc. 2.15569E05 1.848E05 2.1E05 2.156E05 2.296E05 1.932E05 in mol/l MW = 71439 WT G600R G600T N1 N2 NMC g/mol (+L607A) (+Y420F) (+306V) chromene 0.5 21.9 6.4 4.4 1.8 1.0 9 0.1 1.5 7.4 22.2 63.8 95.2 14 0.1 0.7 1.1 1.4 2.2 2.1 overall conversion 0.7 24.1 14.9 28.0 67.8 98.3 error conversion 0.2 3.0 0.5 3.2 0.9 2.4 TTN 2.9 114.8 62.4 114.4 260.0 447.8 error TTN 0.8 14.3 2.1 13.1 3.4 10.9

[0148] 10 mg lyophilized E. coli whole cells harboring AacSHC variant (18-22 M) resuspended in 1 mL whole-cell buffer (0.1 M citric acid, 0.1% SDS, 10 mM 2-Hydroxypropyl)--cyclodextrin, pH=6.0), 24 h, 30 C., 8.8 mM substrate.

TABLE-US-00011 TABLE 11 Relative conversion rates in % of the substrate Z-geranyl acetone X with the variants N2, Y420F/L607A, Y420F/G600T/L607A/Y609F and Y609F and the corresponding product selectivities overall chromene 9 14 conv. error N2 (Y420F/G600T/L607A) 1.4 58 1.8 60.2 5.4 (ID5) Y420F/L607A (ID33) 2.6 8.2 0.5 12 1.1 Y420F/G600T/L607A/Y609F 1 1 0.2 2.2 0.1 (ID34) Y609F (ID35) 0 0 0 0 0 ID represents the SEQ-ID No. in the sequence listing.

[0149] Reaction conditions: E. coli whole cells harboring AacSHC variant resuspended in whole-cell buffer (0.1 M citric acid, 0.1% SDS, pH=6.0) with an OD.sub.600=22, 20 h, 30 C., 8.8 mM substrate (=2 l in 1 ml cell suspension).

[0150] Biotransformation of 16 Using Other Cyclases

[0151] In the following experiment the capability of other cyclases to perform the monocyclization reaction is shown. Therefore, the thermophilic squalene-hopene cyclase from Thermesynechococcus elongatus (TeSHC) which naturally harbors a phenylalanine at position 429 (corresponding position in AacSHC Y420) was chosen. The results show 2% conversion of the substrate 16 towards monocyclic product 9, therefore, confirm the findings of the present invention and show the general capability of squalene-hopene cyclases to perform this reaction (FIGURE).

LITERATURE

[0152] 1. Li, Y., Lu, B., Li, C. & Li, Y. First total synthesis of () Hedaol B. Synth. Commun. 33, 1417-1423 (2003). [0153] 2. Brooks, J. L., Xu, L., Wiest, O. & Tan, D. S. Diastereoselective Synthesis of Highly Substituted Tetrahydrofurans by Pd-Catalyzed Tandem Oxidative Cyclization-Redox Relay Reactions Controlled by Intramolecular Hydrogen Bonding. J. Org. Chem. 82, 57-75 (2017). [0154] 3. Justicia, J. et al Titanium-catalyzed enantioselective synthesis of -ambrinol. Adv. Synth. Catal 350, 571-576 (2008). [0155] 4. Serra, S. An expedient preparation of enantio-enriched ambergris odorants starting from commercial ionone alpha. Flavour Fragr. J. 28, 46-52 (2013). [0156] 5. Zymo Research. Zyppy Plasmid Miniprep Kit. Instr. Man. 4037, 1-9 (2014). [0157] 6. Biosystems, A., Drive, L. C., City, F. & Countries, A. O. <TB341.pdf>. 1-9 (1800). [0158] 7. Kille, S. et al. Reducing codon redundancy and screening effort of combinatorial protein libraries created by saturation mutagenesis. ACS Synth. Biol. 2, 83-92 (2013). [0159] 8. Gibson, D. G. et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods 6, 343-345 (2009). [0160] 9. America, S. Instruction Manual Instruction Manual. Int. Bus. 1-183 (2003). [0161] 10. Green, R. & Rogers, E. J. Chemical Transformation of E. coli Rachel. Methods 3-6 (2014) doi:10.1016/B978-0-12-418687-3.00028-8.Chemical. [0162] 11. Koschorreck, K., Wahrendorff, F., Biemann, S., Jesse, A. & Urlacher, V. B. Cell thermolysisA simple and fast approach for isolation of bacterial laccases with potential to decolorize industrial dyes. Process Biochem. 56, 171-176 (2017). [0163] 12. Ren, X., Yu, D., Han, S. & Feng, Y. Thermolysis of recombinant Escherichia coli for recovering a thermostable enzyme. Biochem. Eng. J. 33, 94-98 (2007). [0164] 13. Seitz, M., Syron, P., Steiner, L., Klebensberger, J. & Nestl, B. M. Synthesis of Heterocyclic Terpenoids by Promiscuous SqualeneHopene Cyclases. ChemBioChem 14, 436-439 (2013). [0165] 14. Fuganti, C., Serra, S. & Zenoni, A. Synthesis and olfactory evaluation of (+)- and ()--ionone. Helv. Chim. Acta 83, 2761-2768 (2000). [0166] 15. Linares-Palomino, P. J., Salido, S., Altarejos, J., Nogueras, M. & S??nchez, A. Synthesis and odour evaluation of stereoisomers of octahydrobenzopyran derivatives. Flavour Fragr. J. 21, 659-666 (2006). [0167] 16. Burghardt, T. E. Developments in the deprotection of thioacetals. J. Sulfur Chem. 26, 411-427 (2005). [0168] 17. Land, H. & Humble, M. S. YASARA: A tool to obtain structural guidance in biocatalytic investigations. in Methods in Molecular Biology vol. 1685 43-67 (Humana Press Inc., 2018). [0169] 18. Waterhouse, A. et al. SWISS-MODEL: Homology modelling of protein structures and complexes. Nucleic Acids Res. 46, W296-W303 (2018). [0170] 19. Chen, D. et al. Regulation of protein-ligand binding affinity by hydrogen bond pairing. Sci. Adv. 2, (2016). [0171] 20. Syrn, P. O., Hammer, S. C., Claasen, B. & Hauer, B. Entropy is key to the formation of pentacyclic terpenoids by enzyme-catalyzed polycyclization. Angew. ChemieInt. Ed. 53, 4845-4849 (2014).