METHOD FOR ANALYZING HIGHER-ORDER STRUCTURE OF RNA
20240018583 ยท 2024-01-18
Inventors
- Kaoru Richard Komatsu (Kyoto, JP)
- Emi MIYASHITA (Kyoto, JP)
- Kazumitsu ONIZUKA (Miyagi, JP)
- Fumi NAGATSUGI (Miyagi, JP)
Cpc classification
C12Q1/6806
CHEMISTRY; METALLURGY
C12N9/1276
CHEMISTRY; METALLURGY
C07D455/03
CHEMISTRY; METALLURGY
International classification
C12Q1/6806
CHEMISTRY; METALLURGY
C07D455/03
CHEMISTRY; METALLURGY
C07D401/12
CHEMISTRY; METALLURGY
Abstract
The present disclosure provides a technique for efficiently detecting a wider variety of RNA higher-order structures including non-Watson-Crick base pair-type higher order structures. The method for analyzing the RNA higher-order structure according to the present disclosure comprises the steps of providing a compound in which a target-binding moiety Sm and an RNA-modifying moiety Y are linked by a linker L; contacting the compound and one or a plurality of RNAs; determining a nucleotide sequence of the RNA after contacting with the compound; and determining a position and/or a region on the RNA that interacts with the target binding moiety of the compound, based on the nucleotide sequence.
Claims
1. A method for analyzing a higher-ordered structure of RNA comprising the steps of: providing a compound represented by the following formula (I), (II), (III) or (IV): ##STR00016## wherein, Sm denotes a target binding moiety, L denotes a linker, X denotes SR.sup.4, S(O)R.sup.4, OR.sup.5, or N(R.sup.6)R.sup.7, R.sup.1, R.sup.2 and R.sup.3 each independently denotes a hydrogen atom, halogen, alkyl optionally having a substituent, alkenyl optionally having a substituent, alkynyl optionally having a substituent, alkoxy optionally having a substituent, aryl optionally having a substituent, aralkyl optionally having a substituent, cycloalkyl optionally having a substituent, or heteroaryl optionally having a substituent, or R.sup.1 and R.sup.2, or R.sup.2 and R.sup.3 together with each other form a ring optionally having a substituent, R.sup.4 denotes alkyl optionally having a substituent, aryl optionally having a substituent or heteroaryl alkyl optionally having a substituent, R.sup.5 denotes a hydrogen atom, or alkyl optionally having a substituent, R.sup.6, and R.sup.7, each independently denotes a hydrogen atom, alkyl optionally having a substituent or aryl optionally having a substituent, or R.sup.6 and R.sup.7, together with each other form a ring optionally having a substituent, contacting the compound and one or a plurality of RNAs; determining a nucleotide sequence of the RNA after contacting with the compound; and determining a position and/or a region on the RNA that interacts with the target binding moiety of the compound, based on the nucleotide sequence.
2. The method of claim 1, wherein the compound of formula (I) is represented by the following formula (V): ##STR00017## wherein, Sm, L and X, each denotes the same meaning of claim 1, R.sup.8, R.sup.9, R.sup.10 and R.sup.11 each independently denotes a hydrogen atom, halogen, alkyl optionally having a substituent, alkenyl optionally having a substituent, alkynyl optionally having a substituent, alkoxy optionally having a substituent, aryl optionally having a substituent, aralkyl optionally having a substituent, cycloalkyl optionally having a substituent, or heteroaryl optionally having a substituent.
3. The method of claim 2, wherein, in the compound of formula (V), R.sup.8, R.sup.10 and R.sup.11 are hydrogen atoms, and R.sup.9 denotes a substituent represented by the following formula (VI) or (VII). ##STR00018##
4. The method of claim 1, wherein X denotes SR.sup.4 or S(O)R.sup.4, and R.sup.4 denotes methyl, hydroxyethyl, 2-pyridylmethyl or phenyl optionally having a substituent.
5. The method of claim 1, wherein X denotes N(R.sup.6)R.sup.7, and R.sup.6 and R.sup.7, each independently denotes a hydrogen atom, methyl or phenyl optionally having a substituent, or R.sup.6 and R.sup.7, together with each other form a cycloalkyl ring optionally having a substituent, a morpholine ring optionally having a substituent, or a piperazine ring optionally having a substituent.
6. The method of claim 1, wherein the RNA comprises a structural motif that forms a higher-ordered structure.
7. The method of claim 6, wherein the structural motif is a stem-loop, multi-branched loop, junction, bulge, kink-turn, pseudoknot, triplex or quadruplex structure, or a combination thereof.
8. The method of claim 1, wherein the linker is a divalent group selected from the group consisting of a polyethylene glycol (PEG) group having 1 to 20 ethylene glycol subunits, alkyl with 1-12 carbons optionally having a substituent, alkenyl optionally having a substituent, alkynyl optionally having a substituent, alkynyl optionally having a substituent, and cycloalkyl optionally having a substituent, and peptides containing 1 to 8 amino acids.
9. The method of claim 1, wherein the target binding moiety is any compound or a portion thereof, thereby identifying an RNA that interacts with the compound from the one or a plurality of RNAs.
10. The method of claim 1, further comprising a step of estimating a higher-ordered structure of the RNA region that interacts with the target binding moiety.
11. The method of claim 1, wherein the nucleotide sequence is determined using a complementary DNA synthesized by a reverse transcriptase with the RNA as a template and the complementary DNA comprises a sequence in which the reverse transcription reaction terminates at or near the position of binding of the compound on the RNA, or one or several bases are deleted or replaced by skipping the bases modified by the compound.
12. The method of claim 1 wherein the target binding moiety is a compound that binds to guanine quadruplex or a portion thereof.
13. A method for identifying a structure of target binding moiety that modulate the function of a target RNA comprising the steps of: providing a plurality of compounds represented by the following formula (I), (II), (III) or (IV): ##STR00019## wherein, Sm denotes a target binding moiety, L denotes a linker, X denotes SR.sup.4, S(O)R.sup.4, OR.sup.5, or N(R.sup.6)R.sup.7, and R.sup.1, R.sup.2 and R.sup.3 each independently denotes a hydrogen atom, halogen, alkyl optionally having a substituent, alkenyl optionally having a substituent, alkynyl optionally having a substituent, alkoxy optionally having a substituent, aryl optionally having a substituent, aralkyl optionally having a substituent, cycloalkyl optionally having a substituent, or heteroaryl optionally having a substituent, or R.sup.1 and R.sup.2, or R.sup.2 and R.sup.3 together with each other form a ring optionally having a substituent, R.sup.4 denotes alkyl optionally having a substituent, aryl optionally having a substituent or heteroaryl alkyl optionally having a substituent, R.sup.5 denotes a hydrogen atom, or alkyl optionally having a substituent, R.sup.6, and R.sup.7, each independently denotes a hydrogen atom, alkyl optionally having a substituent or aryl optionally having a substituent, or R.sup.6 and R.sup.7, together with each other form a ring optionally having a substituent, contacting the compounds and one or a plurality of RNAs; determining nucleotide sequences of the RNAs after contacting with the compounds; selecting a compound that interacts with the respective target RNA, based on the nucleotide sequence.
14. The method of claim 13, wherein the target binding moiety is a compound that binds to a guanine quadruplex or a portion thereof.
15. The method of claim 1, further comprising a step of concentrating the modified RNA by contacting the compound.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
DESCRIPTION OF EMBODIMENTS
[0042] Next, embodiments of the present invention will be described with reference to the drawings. Note that each embodiment described below does not limit the invention according to the claims, and all the elements described in each embodiment and combinations thereof are not necessarily essential to the solution of the present invention.
Definition
[0043] As used herein, the higher-order structure of RNA includes, in solution, secondary structures such as stem-loop, which mainly include partial double-strand formation based on intramolecular base pairing, single-strand structure of the portion without such base pairing, or cyclic single-strand structure; tertiary structures such as junction and pseudoknots; as well as quaternary structures consisting of complexes of the above structures. Triple chains, which are formed when nucleosides not involved in double-strand formation are inserted into the sub-groove of the RNA double helix, and guanine quadruplexes, in which four guanine bases form a planar structure by Hoogsteen-type hydrogen bonds and the planar structure is stacked, are also included among the higher-order structures of RNA. Further motifs called coaxial stacking include kissing-loop and pseudoknot. In the kissing-loop, the single-stranded loop regions of two hairpins interact by base pairing, and a helix is formed by coaxial stacking. The pseudoknot motif results when the single-stranded regions of the hairpin loops form base pairs with sequences upstream or downstream of the same RNA strand. Such structures are in a specific equilibrium state depending on the solution conditions (temperature, salt concentration, and the like) and fluctuate with the movement of the RNA molecule.
[0044] The motif or motif region means a functional structural unit of RNA that contains the higher-order structure of the RNA described above and allows the RNA to interact with the target substance. The motif region in the RNA subject to the higher-order structure analysis may consist of a single stem-loop structure (hairpin loop structure), multiple stem-loop structures (multi-branched loop structure), or other higher-order structures.
[0045] The term target or target RNA includes such RNA motifs and refers to RNAs that may be targets for the regulation of gene expression in cells or for therapeutic intervention with small molecule compounds. A variety of RNA molecules are understood to play important regulatory roles in both normal and diseased cells. Non-coding transcripts (non-coding transcriptome) represent a large group of emerging therapeutic targets. Non-coding RNAs, such as microRNAs (miRNAs) and long non-coding RNAs (lncRNAs), regulate transcription, splicing, mRNA stability/degradation, and translation. In addition, noncoding regions of mRNAs, such as the 5-untranslated region (5-UTR), 3-UTR, and introns, play regulatory roles in mRNA expression levels, selective splicing, translation efficiency, and effects on subcellular localization of mRNAs and proteins. The higher-order structure of RNA is critical to these regulatory activities.
(Compound Design and its Embodiments)
[0046] The compounds used in the present invention have the following structure in which a target binding moiety Sm and an RNA modifying moiety Y are bonded via a linker L.
##STR00002##
<Target Binding Moiety>
[0047] The target binding moiety is a moiety that interacts with a conformation formed by RNA, preferably a specific RNA structural motif. The novel compounds that interact with RNA forming higher order structures in vivo have great therapeutic potential. For example, Branaplam is known to recognize the bulge structures at the stem of SMN2, exon 7 (Campagne, S., Boigner, S., Rudisser, S. et al. Structural basis of a small molecule targeting RNA for a specific splicing correction. Nat Chem Biol 15, 1191-1198 (2019). https://doi.org/10.1038/s41589-019-0384-5), and Ribocil recognizes the multi-branched loop structure of FMN riboswitch (Howe, J., Wang, H., Fischmann, T. et al. Selective small-molecule inhibition of an RNA structural element Nature 526, 672-677 (2015). https://doi.org/10.1038/nature15542).
[0048] The chemical structures of several small molecule compounds during clinical or preclinical studies that act on various types of RNA for the treatment of various diseases are shown in
[0049] To date, approximately 1000 small molecules targeting the G4 structure have been reported in the G-Quadruplex Ligands Database (http://www.g4ldb.org/), and small G4 binders generally have aromatic surfaces for n-n stacking with the G tetrad, positively charged or basic groups that bind to loops or grooves of G4, and steric bulk that prevents intercalation with double-stranded DNA.
[0050] Thus, in one embodiment, the target binding moiety is selected to be a structure that binds to RNA from any compound or part thereof. One embodiment is the G4 binder described above. Specific G4 binders include, but are not limited to, acridine, berberine, pyridostatin, porphyrin derivatives such as TMPyP4, and macrocyclic compounds such as telomestatin. Other embodiments of triptycene scaffold structures that stabilize 3-way junctions of RNA have been reported (S. A. Barros and D. M. Chenoweth, Recognition of Nucleic Acid Junctions Using Triptycene Based Molecules, Angew Chem Int Ed Engl. 2014, 53 (50), pp. 13746-50). Still other embodiments include several small molecule compounds in clinical or preclinical trials that act on various RNAs, as shown in
<RNA Modifying Moiety>
[0051] The RNA modifying moiety in the present embodiment has a structure activated by contact with RNA from an inactive precursor, and consists of a part of a compound represented by the following formula (I), (II), (III), or (IV):
##STR00003##
[0052] In the formula, Sm denotes the target binding moiety as described above. L represents a linker that connects a target binding moiety and an RNA-modifying moiety, X represents SR.sup.4, S(O)R.sup.4, OR.sup.5 or N(R.sup.6)R.sup.7, R.sup.1, R.sup.2 and R.sup.3 each independently represents a hydrogen atom, a halogen, an optionally substituted alkyl, an optionally substituted alkenyl, an optionally substituted alkynyl, an optionally substituted alkoxy, an optionally substituted aryl, an optionally substituted aralkyl, an optionally substituted cycloalkyl, or an optionally substituted heteroaryl, or R.sup.1 and R.sup.2 or R.sup.2 and R.sup.3 together form an optionally substituted ring, R.sup.4 denotes an optionally substituted alkyl, an optionally substituted aryl, or an optionally substituted heteroarylalkyl, R.sup.5 denotes a hydrogen atom or an optionally substituted alkyl, R.sup.6 and R.sup.7 each independently denote a hydrogen atom, an optionally substituted alkyl, or an optionally substituted aryl, or R.sup.6 and R.sup.7 together form an optionally substituted ring.
[0053] Here, the alkyl of the optionally substituted alkyl represented by R.sup.1 to R.sup.7 usually means a linear or branched alkyl (C.sub.1-15 alkyl) having 1 to 15 carbon atoms, and examples thereof include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, neopentyl, hexyl, heptyl, octyl, nonyl, decyl, and the like. Preferably, C.sub.1-6 alkyl such as methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl or pentyl, more preferably methyl or ethyl, and most preferably methyl.
[0054] Examples of the alkenyl of the alkenyl optionally having a substituent represented by R.sup.1 to R.sup.3 include linear or branched alkenyl having 2 to 10 carbon atoms (C.sub.2-10 alkenyl). Specific examples thereof include vinyl, allyl, 1-propenyl, isopropenyl, methacryl, butenyl, crotyl, pentenyl, hexenyl, heptenyl, octenyl, nonenyl, and decenyl and the like.
[0055] Similarly, examples of the alkynyl of the optionally substituted alkynyl represented by R.sup.1 to R.sup.3 include linear or branched alkynyl having 2 to 10 carbon atoms (C.sub.2-10 alkynyl). Specific examples thereof include ethynyl, propargyl, butynyl, pentynyl, hexynyl, heptynyl, octynyl, noninyl, decynyl, and the like.
[0056] Examples of the alkoxy of the optionally substituted alkoxy represented by R.sup.1 to R.sup.3 include linear or branched alkoxy having 1 to 15 carbon atoms (C.sub.1-15 alkoxy). Specifically, methoxy and ethoxy are used. In the present specification, examples of the halo-C.sub.1-15 alkoxy include the above-mentioned C.sub.1-15 alkoxy substituted with one or more halogen atoms.
[0057] The aryl of the aryl optionally having a substituent represented by R.sup.1 to R.sup.7 means aryl (C.sub.6-14 aryl) having 6 to 14 carbon atoms, and examples thereof include phenyl, naphthyl, and those having 8 to 10 ring atoms in an ortho-fused bicyclic group and at least one ring being an aromatic ring (for example, indenyl).
[0058] The aralkyl of the optionally substituted aralkyl represented by R.sup.1 to R.sup.3 is an arylalkyl having an alkyl having 1 to 8 carbon atoms and which may be linear or branched, and examples thereof include C.sub.6-14 aryl-C.sub.1-8 alkyl such as benzyl, benzhydryl, 1-phenylethyl, 2-phenylethyl, phenylpropyl, phenylbutyl, phenylpentyl, phenylhexyl, naphthylmethyl, and naphthylethyl, with benzyl or naphthylmethyl being preferable.
[0059] The cycloalkyl of the optionally substituted cycloalkyl represented by R.sup.1 to R.sup.3 includes cycloalkyl (C.sub.3-7 cycloalkyl) having 3 to 7 carbon atoms, and specific examples thereof include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and cycloheptyl. Preferably, cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl, more preferably cyclopropyl or cyclobutyl.
[0060] The heteroaryl of the optionally substituted heteroaryl represented by R.sup.1 to R.sup.4 means a 5- to 7-membered aromatic heterocyclic (monocyclic) ring group containing 1 to 4 heteroatoms selected from 1 to 3 species of nitrogen, sulfur, and oxygen atoms in addition to a carbon atom as a ring atom, and examples thereof include furyl, thienyl, pyrrolyl, thiazolyl, pyrazolyl, oxazolyl, isoxazolyl, isothiazolyl, imidazolyl, 1,2,4-oxadiazolyl, 1,3,4-oxadiazolyl, 1,2,3-triazolyl, 1,2,4-triazolyl, 1,2,4-thiadiazolyl, 1,3,4-thiadiazolyl, tetrazolyl, pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, 1,3,5-triazinyl, azepinyl, and diazepinyl. The heteroaryl also includes a group derived from an aromatic heterocyclic ring (2 or more rings) obtained by condensing a 5- to 7-membered aromatic heterocyclic ring containing 1 to 4 heteroatoms selected from 1 to 3 species of nitrogen, sulfur, and oxygen atoms as a ring atom in addition to a carbon atom to a benzene ring or the above-mentioned aromatic heterocyclic (monocyclic) group, and examples thereof include indolyl, isoindolyl, benzo[b]furyl, benzo[b]thienyl, benzimidazolyl, benzoxazolyl, benzisoxazolyl, benzothiazolyl, benzoisothiazolyl, quinolyl, isoquinolyl, and the like.
[0061] Examples of the substituent in the optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, and optionally substituted alkoxy are the same or different, and examples thereof include a halogen atom, C.sub.1-15 alkyl (preferably C.sub.1-6 alkyl), halo-C.sub.1-15 alkyl, C.sub.1-15 alkoxy, halo-C.sub.1-15 alkoxy, hydroxy, nitro, cyano, and amino. In the present specification, examples of the halogen atom include a fluorine atom, a bromine atom, a chlorine atom, and an iodine atom. Preferably, bromine and chlorine are used.
[0062] Examples of the substituent in the aryl optionally having a substituent, the aralkyl optionally having a substituent, and the ring optionally having a substituent are the same or different, and examples thereof include a substituent selected from the group consisting of halogen with 1 to 3 substitutions, hydroxy, sulfanyl, nitro, cyano, carboxy, carbamoyl, C.sub.1-10 alkyl, trifluoromethyl, C.sub.3-8 cycloalkyl, C.sub.6-14 aryl, aliphatic heterocyclic group, aromatic heterocyclic group, C.sub.1-10 alkoxy, C.sub.3-8 cycloalkoxy, C.sub.6-14 aryloxy, C.sub.7-16 aralkyloxy, C.sub.1-8 alkanoyloxy, C.sub.7-15 aroyloxy, C.sub.1-10 alkylsulfanyl, C.sub.1-8 alkanoyl, C.sub.7-15 aroyl, C.sub.1-10 alkoxycarbonyl, C.sub.6-14 aryloxycarbonyl, C.sub.1-10 alkylcarbamoyl, and diC.sub.1-10 alkylcarbamoyl, and preferred examples thereof include halogen with one substitution, hydroxy, sulfanyl, nitro, cyano, carboxy, C.sub.1-3 alkyl, trifluoromethyl, and C.sub.1-3 alkoxy.
[0063] The RNA modifying moiety of the present embodiment interacts with the target RNA to facilitate activation from an inactive precursor. For example, it is believed that the RNA modifying moiety included in the compound of formula (I) is activated only in the presence of the target RNA by an Elimination, Unimolecular, Conjugate Base reaction (E1cB reaction) as shown in the following scheme.
##STR00004##
[0064] The vinyl group in the active-type compound is expected to be highly reactive because of the electron-withdrawing carbonyl group attached to it. Therefore, the compound of formula (I) in the inactive form is a precursor compound by protecting this highly reactive vinyl group with several functional groups (X) as shown below. Scheme 1 shows the reaction mechanism whereby the leaving group X is removed when the target binding moiety Sm reaches and interacts with the target RNA. Acceleration of activation is thought to occur by the withdrawal of hydrogen atoms by the proximate available nucleobase and phosphate backbone to which the target binding moiety Sm is bound (labeled: B in Scheme 1). The reactive RNA modification moiety (vinyl group) generated is then efficiently alkylates the target base.
[0065] Various thiol or sulfoxide groups can be used as the leaving group X for this purpose. For example, X can be SR.sup.4, S(O)R.sup.4, OR.sup.5 or N(R.sup.6)R.sup.7, wherein R.sup.4 indicates alkyl which may have substituents, aryl which may have substituents, or heteroarylalkyl which may have substituents, R.sup.5 indicates hydrogen atom or alkyl which may have substituents, and R.sup.6 and R.sup.7 independently of each other indicate hydrogen atom, alkyl which may have substituents or aryl which may have substituents, or R.sup.6 and R.sup.7 together form a ring which may have substituents.
[0066] Preferable examples of X include SC.sub.1-6 alkyl, S-aryl, S(O)C.sub.1-6 alkyl, S(O)-aryl, OH, or N(C.sub.1-6 alkyl).sub.2, and more preferably SCH.sub.3, S-phenyl, S(O)CH.sub.3, S(O)-phenyl, OH, or N(CH.sub.3).sub.2. The phenyl may be substituted at the para-, meta- or para-position with methoxy, methyl, fluorine, chlorine or bromine.
[0067] In the compound represented by formula (II), (III), or (IV) described above, similarly to the compound of formula (I), an ethylene group having a leaving group X capable of easily performing an Elimination, Unimolecular conjugate Base reaction (E1cB reaction) is attached to the six-membered ring containing a nitrogen atom. Therefore, active vinyl entities can be generated by the same mechanism as the compound of formula (I), and can be considered to be OFF-ON type RNA modifiers.
[0068] In a preferred embodiment of the invention, the RNA-modifying moiety (Y) is a vinylquinazolinone precursor (VQ) represented by the following formula (V):
##STR00005##
[0069] In the formula, Sm, L, and X have the same meanings as described above, and R.sup.8, R.sup.9, R.sup.10, and R.sup.11 each independently denotes a hydrogen atom, a halogen, an optionally substituted alkyl, an optionally substituted alkenyl, an optionally substituted alkynyl, an optionally substituted alkoxy, an optionally substituted aryl, an optionally substituted aralkyl, an optionally substituted cycloalkyl, or an optionally substituted heteroaryl.
[0070] Preferable examples of R.sup.8 include a hydrogen atom, a halogen, or C.sub.1-15 alkyl, more preferably a hydrogen atom or C.sub.1-6 alkyl, and most preferably a hydrogen atom. Preferable examples of R.sup.9 include a hydrogen atom, optionally substituted C.sub.1-15 alkyl, optionally substituted C.sub.1-15 alkynyl, or optionally substituted heteroaryl, and more preferably a hydrogen atom or a compound represented by the following formula (VI) or (VII):
##STR00006##
[0071] Suitable examples of R.sup.10 are hydrogen atom, halogen or C.sub.1-15 alkyl, more preferably hydrogen atom or C.sub.1-6 alkyl, most preferably hydrogen atom.
[0072] Preferable examples of R.sup.11 include a hydrogen atom, a halogen, or C.sub.1-15 alkyl, more preferably a hydrogen atom or C.sub.1-6 alkyl, and most preferably a hydrogen atom.
[0073] Preferred examples of X are SR.sup.4 or S(O)R.sup.4, and R.sup.4 is methyl, hydroxyethyl, 2-pyridylmethyl or phenyl optionally having a substituent. In another embodiment, X is N(R.sup.6)R.sup.7, and R.sup.6 and R.sup.7 are each independently a hydrogen atom, methyl, or phenyl optionally having a substituent, or R.sup.6 and R.sup.7 may be taken together to form a cycloalkyl ring optionally having a substituent, a morpholine ring optionally having a substituent, or a piperazine ring optionally having a substituent.
<Linker>
[0074] The present invention can link the target binding moiety Sm and the RNA modifying moiety Y using a variety of bivalent or trivalent linkers to provide optimal binding and reactivity to bases proximal to the binding site of the target RNA. For example, in one embodiment, the linker is a polyethylene glycol (PEG) group of, for example, 1 to 20 ethylene glycol subunits. In other embodiments, the linker is an optionally substituted C.sub.1-12 aliphatic group or a peptide comprising 1-8 amino acids.
[0075] Suitable examples of linker L are (C.sub.2H.sub.4O).sub.nC.sub.2H.sub.4 (n is an integer from 1 to 5, preferably 2 or 3) and CONH(C.sub.2H.sub.4OC.sub.2H.sub.4).sub.mNHCO (m is an integer from 1 to 5, preferably 1 or 2) and the like.
<Synthesis Methods of Compounds of the Present Embodiments>
[0076] The compounds of the present invention may generally be prepared or isolated by synthetic and/or semisynthetic methods known to those of skill in the art for analogous compounds, and by methods detailed in the Examples and Figures herein. For example, various compounds of the present invention can be synthesized with reference to Schemes 2 to 9 described below.
[0077] Other protecting groups, leaving groups, and conversion conditions may readily be used, according to the technical knowledge of those skilled in the art, in the detailed descriptions and schemes and chemical reactions showing specific protecting groups (PG), leaving groups (LG), or conversion conditions in the examples. As used herein, the expression leaving group (LG) encompasses, but is not limited to, halogen (e.g., fluoride, chloride, bromide, iodide), sulfonate (e.g., mesylate, tosylate, benzenesulfonate, brosylate, nosylate, triflate), diazonium and the like.
[0078] As used herein, the expression oxygen protecting group encompasses, for example, carbonyl protecting groups and hydroxyl protecting groups. Hydroxyl protecting groups are well known in the art. Suitable hydroxyl protecting groups include, but are not limited to, esters, allyl ethers, ethers, silyl ethers, alkyl ethers, aryl alkyl ethers, and alkoxyalkyl ethers. Such esters include, for example, formates, acetates, carbonates, and sulfonates.
[0079] Amino protecting groups are also well known in the art. Suitable amino protecting groups include, but are not limited to, aralkylamines, carbamates, cyclic imides, allylamines, and amides. Such groups include, for example, t-butyloxycarbonyl (BOC), ethyloxycarbonyl, methyloxycarbonyl, trichloroethyloxycarbonyl, allyloxycarbonyl (Alloc), benzyloxycarbonyl (CBZ), allyl, phthalimide, benzyl (Bn), fluorenyl methylcarbonyl (Fmoc), formyl, acetyl, chloroacetyl, dichloroacetyl, trichloroacetyl, phenylacetyl, trifluoroacetyl, and benzoyl.
[0080] Those skilled in the art will appreciate that the various functional groups present in the compounds of the invention, for example, aliphatic groups, alcohols, carboxylic acids, esters, amides, aldehydes, halogens, and nitriles, can be interconverted by techniques known in the art (including, but not limited to, reduction, oxidation, esterification, hydrolysis, partial oxidation, partial reduction, halogenation, dehydration, partial hydration, and hydration).
(Method for Analyzing Higher-Ordered Structure of RNA)
[0081]
<Preparation Step of Target RNA (S20)>
[0082] The target RNA is an RNA to be analyzed; it can be one type or a mixture of plurality of RNAs and can be either extracted from living organisms or artificially synthesized. The target RNA preferably contains a motif region for exerting a function in vivo. The motif region may consist of a single stem-loop structure (hairpin loop structure) or may comprise multiple stem-loop structures (multi-branched loop structures). In the present embodiment, it is possible to include a motif region extracted with reference to a stem structure (see, for example, WO2018/003809). Thus, a target RNA reflecting a functional structural unit actually present in the RNA can be prepared without dividing the motif region. The motif region may have any sequence length as long as its function is maintained, and may be, for example, 1000 bases or less, 900 bases or less, 800 bases or less, 700 bases or less, 600 bases or less, 500 bases or less, 400 bases or less, 300 bases or less, 200 bases or less, 150 bases or less, 100 bases or less, or 50 bases or less.
[0083] The target RNA of the present embodiment can be synthesized by any known genetic engineering method. Preferably, the target RNA can be produced by transcribing template DNA that has been synthesized by an outsourced synthesis company. To perform transcription from DNA to RNA, DNA comprising the sequence of the target RNA may have a promoter sequence. Although not particularly limited, a T7 promoter sequence is exemplified as a preferred promoter sequence. When the T7 promoter sequence is used, for example, the RNA can be transcribed from DNA having a desired target RNA sequence using the MEGAshortscript T7 Transcription Kit provided by Life Technologies. In the present embodiment, RNA can be modified RNA as well as adenine, guanine, cytosine, and uracil. Examples of the modified RNA include pseudouridine, 5-methylcytosine, 5-methyluridine, 2-O-methyluridine, 2-thiouridine, and N6-methyladenosine.
[0084] In one embodiment, the target RNAs may be used as a target RNA library containing plurality of target RNAs, each with a different sequence. In this embodiment, multiple target RNAs are preferably synthesized simultaneously, which can be done using oligonucleotide library synthesis technology. This is done by synthesizing one base at a time using an ink-jet technique that prints individual bases at defined positions on a slide to elongate a template DNA of a specified length. The constructed oligos are then cut from the slides, pooled, dried, and stored in a single tube. Oligo libraries can then be re-dissolved and amplified, followed by in vitro transcription reactions to prepare targeted RNA libraries. Oligonucleotide Library Synthesis, which is not specifically limited in this invention, can be produced by outsourcing to Agilent Technologies or Twist Biosciences.
<Modification Step of Target RNA (S30)>
[0085] The compound synthesized in step S10 is added to the solution containing the target RNA prepared in step S20 to bring said compound into contact with the target RNA. This solution may be a solution containing different concentrations and amounts of the compound. It may also contain various surfactants, polymers, and osmolytes. It may also be a biological solution containing different concentrations and amounts of proteins, cells, viruses, lipids, mono- and polysaccharides, amino acids, nucleotides, DNA, and various salts and metabolites. The concentration of said compounds can be adjusted to specifically bind to specific motifs of the target RNA.
[0086] Furthermore, if the reactivity of the RNA-modifying moiety of a compound is dependent on pH, the pH may be maintained in the range of, for example, but not limited to, 6.5 to 8.0. The RNA can be replaced by any procedure that folds into the desired conformation at the desired pH (e.g., about pH 7). The RNA is first heated and then cooled in a steep, low ionic strength buffer to eliminate multimeric forms. Subsequently, a folding solution can be added to allow the RNA to achieve an accurate conformation and react with the compound of the present embodiment.
<Detection Step of Modified Base (S40)>
[0087] This step detects the modified bases by sequencing the RNA obtained in the above modification step (S30). The method is not limited to reading the modified bases in the RNA sequence. For example, a pull-down method using an antibody specific for the modified base or a nanopore sequencing method that directly reads the RNA potential may be used. This direct RNA nanopore sequencing method is a technique for detecting RNA modification sites at the single molecule level. In the direct RNA sequencing platform currently developed and commercially available by Oxford Nanopore Technologies, RNA bound to motor proteins moves through biological nanopores suspended in a membrane. As RNA passes through the pore under voltage bias, changes in picoampere ion current are observed depending on the chemical identity (i.e., sequence) of the short sequence (5 nucleotides) passing through the constriction (see Garalde, D. R., et al. (2018) Highly parallel direct RNA sequencing on an array of nanopores. Nat. Methods, and Workman, R. E., et al. (2019) Nanopore native RNA sequencing of a human poly(A) transcriptome. Nat. Methods, 16, 1297, 1305.)
[0088] In a preferred embodiment, the step of detecting modified bases (S30) is mutational profiling (MaP) comprising conversion of RNA to complementary DNA (cDNA). In this embodiment, first, cDNA is synthesized by reverse transcriptase or another polymerase using one or more target RNAs obtained in step S30 as a template. Reverse transcriptase is an enzyme that synthesizes cDNA from RNA, and includes, but is not limited to, a thermostable enzyme such as mouse or avian reverse transcriptase. Alternatively, the enzyme may be a reverse transcriptase TGIRT (Thermostable Group II intron reverse transcriptase) present in retrotransposons such as prokaryotes and fungi.
[0089] These enzymes terminate the reverse transcription reaction at or near the position alkylated by the RNA modifying moiety (Y) on the target RNA, as shown in
[0090] The cDNA is then sequenced, and the plurality of reads are aligned. cDNA libraries derived from a mixture of multiple target RNAs can be used to efficiently detect chemical modifications in nucleic acids such as RNA using massively parallel sequencing (MPS). As an example, in Illumina's next-generation sequencer, the 5-end side of tens to hundreds of millions of DNA fragments is fixed on a flow cell via adapters at both ends. Next, the adapter on the 5-end side pre-fixed on the flow cell is annealed to the adapter sequence on the 3-end side of the DNA fragment to form a bridge-like DNA fragment. By conducting a nucleic acid amplification reaction with DNA polymerase in this state, a large number of single-stranded DNA fragments can be locally amplified and fixed. The next-generation sequencer can then use the resulting single-stranded DNA as a template for sequencing, and as of 2020, a vast amount of sequence information, approximately 3 Tb, can be obtained in a single analysis.
[0091] In one embodiment, the sequence data (reads) obtained by the next-generation sequencer are aligned in a manner that includes barcode sequences. This is because by aligning sequence data for each individual barcode sequence, it is possible to sequence samples containing many types of target RNAs simultaneously. Even if the RNAs to be analyzed contain similar sequences, for example, gene families, single nucleotide polymorphisms, etc., it is possible to identify and analyze them. A barcode sequence is a tag with a unique sequence that is added to each type of nucleic acid molecule or to each molecule. If a barcode sequence having a unique sequence is added to plurality of RNAs to be analyzed, each RNA can be identified and analyzed based on the type of the added barcode after modification and amplification of plurality of RNAs simultaneously.
[0092] Alternatively, all cDNAs can be aligned together and then the alignment can be evaluated by taking into account the barcode mutation information for alignments with low confidence. In either method, the accuracy of the sequence information can be improved by aligning the RNA sequence to be analyzed together with the barcode sequence.
[0093] Based on the aligned nucleotide sequence, the location and frequency of mutations that have occurred are detected. The mutation rate at a given nucleotide is simply the number of mutations (mismatches, deletions and insertions) divided by the number of reads at that location. The data from which the raw reactivity is calculated for each nucleotide can be normalized using various criteria. Data quality control can be performed by considering the sequence read depth and standard error.
<Analysis Step of RNA Higher-Order Structure (S50)>
[0094] Based on the position and frequency of mutations on the target RNA detected in the above step S40, the higher-order structure formed by the target RNA can be analyzed. For example, if the target binding moiety Sm in the compound is known to interact with a specific RNA structural motif, the higher-order structure formed by the target RNA can be estimated based on that information. For example, the G4 binder is used to estimate the G4 structure of the RNA. Alternatively, if a specific compound without such information is used as the target binding moiety Sm, the RNA region that interacts with it is estimated to be the binding site with the compound. Thus, in one embodiment, any compound or part thereof can be used as a target binding moiety to identify the RNA that interacts with said arbitrary compound among plurality of target RNAs.
[0095] Based on the three-dimensional structure of the RNA to which any compound binds, it is then possible to estimate the three-dimensional structure formed by the RNA region in question, for example, the structure of the binding pocket of the target binding moiety (this is also called the ligand binding pocket) and the pharmacophore that is complementary to it. The structure of such binding pockets or pharmacophores are also part of the higher-order structure of RNA. A binding pocket is an internal pore or cavity observed on the surface of an RNA molecule that forms a higher-order structure and is large enough for the ligand molecule to bind. A pharmacophore is also an assembly of steric and electronic features necessary to ensure optimal supramolecular interaction with a specific biological target and to induce (or block) a biological response. For example, the use of compounds that recognize complex RNA structural motifs that are considered to have high drug discovery potential, such as 3-way junction structures, can lead to the comprehensive discovery of RNA structures with high drug discovery potential.
(Method of Identifying the Structure of a Target Binding Moiety that Regulates the Function of a Target RNA)
[0096] In another embodiment of the invention, there is provided a method for identifying the structure of a target binding moiety that regulates the function of a target RNA, comprising the steps of: preparing a plurality of compounds represented by formula (I), (II), (III) or (IV) described above; contacting these plurality of compounds with one or more target RNAs; determining the nucleotide sequences of the target RNAs contacted with these compounds; and selecting a compound that interacts with the respective target RNAs based on the determined nucleotide sequences.
[0097] The structure of the target binding moiety is important for the development of small molecule compounds with beneficial pharmacological activity. Small molecule compounds can be optimized to exhibit excellent absorption from the gut, excellent distribution to target organs, and excellent cell permeation. Small molecule compounds can be used to modulate pre-mRNA splicing. One example is spinal muscular atrophy (SMA), which is also associated with several compounds shown in
[0098] An example of defective splicing causing disease is the dystrophin gene in Duchenne muscular dystrophy (DMD). Various different mutations leading to immature termination codons in DMD patients can be removed by exon skipping facilitated by oligonucleotides; small molecules that bind to RNA structures and affect splicing are predicted to have similar effects. Thus, in one aspect, the invention is a method for identifying a structure of a target binding moiety that modulates the splicing pattern of a target pre-mRNA to treat a disease or disorder, the method comprising the steps of contacting one or more compounds represented by formula (I), (II), (III) or (IV), and selecting a compound that interacts with the target RNA by analyzing the results of analysis of the higher-order structure of the RNA disclosed herein.
[0099] The following examples are provided to explain the invention in more detail, but the invention is not restricted in any way by these examples.
EXAMPLES
[0100] Acridine-VQ (SPh) and Berberine-VQ (SPh), which specifically bind and alkylate to G4, were used as modifying molecules (they are sometimes referred to collectively as Sm-VQ), to perform mutational profiling (MaP) on target RNA1. Acridine-VQ (SPh) and Berberine-VQ (SPh) are small molecular weight compounds prepared by covalently bonding acridine and berberine, which selectively bind to the G4 structure, respectively, with VQ precursors having thiophenyl (SPh) groups (
Synthesis Example 1
Synthesis of Acridine-VQ
[0101] ##STR00007##
[0102] To a solution of 2-aminobenzamide (301 mg, 2.21 mmol) in DMF (4.0 mL), were added K.sub.2CO.sub.3 (919 mg, 6.65 mmol) and tert-butyl bromoacetic acid (485 L, 3.31 mmol) and stirred at 90 C. After stirred for 40 hours, the mixture was cooled to room temperature and diluted with CH.sub.2Cl.sub.2 (30 mL) and water (10 mL). The organic layer was separated, dried over anhydrous Na.sub.2SO.sub.4, filtered, and evaporated under reduced pressure. The residue was purified by column chromatography (CHCl.sub.3/MeOH=99/1) to give the compound 5 (265.7 mg, 48%) as a pale yellow solid.
[0103] To a solution of compound 5 (100.3 mg, 0.40 mmol) in CH.sub.2Cl.sub.2 (3.5 mL) was added 3-(methylthio)propionyl chloride (140 L, 1.21 mmol) and stirred at room temperature. After stirred for 3 hours, the reaction mixture was diluted with CH.sub.2Cl.sub.2 (10 mL) and washed with saturated aqueous NaHCO.sub.3 (15 mL4), water (15 mL), and brine (15 mL). The organic layer was dried over anhydrous Na.sub.2SO.sub.4, filtered, and concentrated under reduced pressure. The crude product was suspended in Et.sub.2O/hexane= (10 mL). The solid was filtered off, followed by washing with Et.sub.2O/hexane= (20 mL) to afford the desired compound 6 (97.1 mg, 73%) as a pale yellow solid.
[0104] To a solution of compound 6 (41 mg, 0.13 mmol) in DCM (0.2 mL) were added triisopropyl silane (40 L, 0.19 mmol) and TFA (0.82 mL), then the reaction mixture was stirred at room temperature. After stirred for 4 hours, the reaction mixture was then concentrated under reduced pressure and co-evaporated with acetonitrile three times. The residue was purified by column chromatography (EtOAc only.fwdarw.EtOAc:MeOH=4:1) to afford compound 7 as a white solid (25 mg, 72%).
[0105] .sup.1H NMR (DMSO-d.sub.6, 400 MHz) (ppm) 8.14 (1H, d, J=7.6 Hz), 7.87 (1H, dd, J=7.2, 8.0 Hz), 7.64 (1H, d, J=8.4 Hz), 7.57 (1H, dd, J=7.2, 7.6 Hz), 5.24 (2H, s), 3.16 (2H, brs), 2.87 (2H, t, J=7.2 Hz), 2.49 (2H, br), 2.12 (3 Hs). .sup.13C NMR (DMSO-d6, 125 MHz) (ppm) 169.0, 164.4, 163.4, 140.7, 135.3, 127.7, 127.2, 119.6, 116.8, 49.0, 34.0, 30.2, 15.1; ESI-HRMS (m/z): [M+H].sup.+ calculated for C.sub.13H.sub.15N.sub.2O.sub.3S.sup.+, 279.0798, found 279.0795.
##STR00008##
[0106] 9-chloroacridine (compound 8) (230 mg, 1.08 mmol) and amine linker (compound 9) (321 mg, 1.29 mmol) were dissolved in phenol (1.1 g) then the reaction mixture was stirred at 100 C. for 3 hours. The reaction mixture was cooled to room temperature and poured 1 N aqueous NaOH (10 mL). The solution was extracted with CH.sub.2Cl.sub.2(30 mL2), washed with brine (20 mL), dried over anhydrous Na.sub.2SO.sub.4, filtered and evaporated. The residue was purified by column chromatography (CHCl.sub.3: MeOH=9:1.fwdarw.7:1.fwdarw.5:1.fwdarw.3:1) to afford compound 10 as a yellow oil (442 mg, 96%).
[0107] To a solution of compound 10 (14 mg, 0.03 mmol) in DCM (0.2 mL) was added TFA (0.95 mL) and the reaction mixture was stirred at room temperature for 2 hours. The reaction mixture was concentrated and co-evaporated three times with acetonitrile. The residue was passed through amino silica, concentrated and then dissolved in DMF (0.5 mL). The reaction solution was added to a new flask having compound 7 (11 mg, 0.04 mmol) in DMF (0.1 mL). To the reaction mixture were added HBTU (15 mg, 0.04 mmol), HOBt (5.3 mg, 0.04 mmol), DIPEA (58 L, 0.33 mmol) and the reaction mixture was stirred at room temperature. After stirring for 2 h, the reaction mixture was diluted with DCM and washed with saturated aqueous NaHCO.sub.3 and brine. The organic layer was separated, dried over Na.sub.2SO.sub.4, filtered and evaporated. The residue was purified by column chromatography (EtOAc:MeOH=49:1-29:1-19:1-9:1) to afford compound 3SMe as a yellow solid (10 mg, 52%). A part of this solid was further purified by reversed-phase HPLC using a C-18 column (Nacalai tesque: COSMOSIL 5C.sub.18-AR-II, 10250 mm) by a linear gradient of 0-45%/30 min acetonitrile in 0.1% TFA buffer at a flow rate of 4 mL/min at 40 C., and monitored by UV detection at =254 nm and fluorescence detection (ex=266 nm, em=450 nm) to afford the desired product as a pale yellow solid. The concentration of compound 3-SMe was determined by quantitative .sup.1H NMR using maleic acid as an internal standard (.sub.260=48,750 M.sup.1 cm.sup.1).
[0108] .sup.1H NMR ((DMSO-d.sub.6, 600 MHz) (ppm) 13.48 (1H, s), 9.64 (1H, dd, J=5.4, 6.0 Hz), 8.59 (2H, d, J=9.0 Hz), 8.56 (1H, dd, J=5.4, 6.0 Hz), 8.04 (1H, dd, J=5.4, 6.0 Hz), 8.04 (1H, dd, J=1.2, 7.8 Hz), 7.98 (2H, dd, J=1.2, 8.4 Hz), 7.83 (2H, dd, J=1.2, 8.4 Hz), 7.72 (1H, dd, J=1.2, 8.4 Hz), 7.55 (2H, dd, J=7.2, 7.8 Hz), 7.41 (2H, dd, J=7.2, 8.4 Hz), 4.92 (2H, s), 4.27 (2H, q, J=5.4 Hz), 3.92 (2H, t, J=5.4 Hz), 3.57-3.58 (2H, m), 3.47-3.50 (2H, m), 3.36 (2H, t, J=5.4 Hz), 3.19 (2H, dd, J=5.4, 11.4 Hz), 3.04 (2H, br-s), 2.85 (2H, t, J=7.8 Hz), 2.09 (3H, s). .sup.13C NMR ((DMSO-d.sub.6, 150 MHz) (ppm) 167.2, 166.2, 163.1, 158.3, 158.1, 157.8, 141.2, 135.3, 133.9, 127.3, 125.6, 123.4, 119.3, 118.6, 115.5, 69.9, 69.4, 68.8, 68.2, 49.0, 48.7, 40.1, 38.8, 34.3, 29.9, 14.9. ESI-HRMS (m/z): [M+H].sup.+ calculated for C.sub.32H.sub.36N.sub.5O.sub.4S.sup.+, 586.2483; found 586.2484.
Synthesis of Aminoacridine-VQ-Conjugated thiophenol (3-SPh)
##STR00009##
[0109] To a solution of compound 3SMe (2 nmol) in DMSO (2 L) was added a solution of MMPP (1.2 nmol) in water (1.2 L), and the mixture was allowed to stand at room temperature for 1 minute to obtain compound 3S(O)Me. Thiophenol (100 nmol) and DMSO (1.2 L) in carbonate buffer (50 mM, 0.4 L), DMSO (0.2 L) at pH 10 were added and the mixture was incubated at 37 C. for 3 hours. The mixed solution was purified by HPLC to obtain compound 3-SPh.
[0110] Large scale synthesis: To a solution of compound 3-SMe (11.8 mol) in DMSO (250 L) and water (930 L) was added a solution of MMPP (10.8 mol) in water (708 L) and the mixture was allowed to rest at room temperature for 1 minute to give compound 3S(O)Me. Carboxylic acid buffer pH 10 (50 mM, 232 L), thiophenol (5.9 mmol) in DMSO (116 L), and DMSO (690 L) were added and incubated at 37 C. for 3 hours. To this solution was added 2 2-dipyridyl disulfide (2.9 mmol) in DMSO (58 L) and the solution was purified by HPLC to give compound 3SPh.
[0111] .sup.1H NMR (600 MHz, DMSO-d.sub.6) of 3SPh: (ppm)=13.42 (1H, s), 9.60 (1H, t, J=5.4 Hz), 8.59 (2H, d, J=8.4 Hz), 8.48 (1H, t, J=5.4 Hz), 8.05 (1H, dd, J=7.8, 1.8 Hz), 7.97 (2H, dd, J=8.4, 7.2 Hz), 7.82 (2H, d, J=8.4 Hz), 7.71 (1H, dd, J=7.8, 7.2, 1.8 Hz), 7.54 (2H, t, J=8.4 Hz), 7.43 to 7.39 (2H, m), 7.33 (2H, d, J=7.2 Hz), 7.29 (2H, t, J=7.2 Hz), 7.16 (1H, t, J=7.2 Hz) 4.9 (2H, s), 4.27 (2H, q, J=5.4 Hz), 3.91 (2H, t, J=5.4 Hz), 3.57 (2H, t, J=5.4 Hz), 3.47 to 3.45 (2H, m), 3.36 to 3.31 (4H, m), 3.15 (2H, t, J=5.4 Hz), 3.07 (2H, br).
[0112] .sup.13C NMR (150 MHz, DMSO-d.sub.6) of 3SPh: (ppm)=167.26, 166.07, 162.60, 158.23, 157.70, 141.18, 135.97, 135.21, 133.78, 129.09, 128.11, 127.26, 125.77, 125.50, 119.28, 118.52, 115.23, 69.84, 69.40, 68.73, 68.16, 48.91, 48.64, 38.71, 34.18, 28.97. ESI-HRMS (m/z): [M+H].sup.+ calculated for C.sub.37H.sub.38N.sub.5O.sub.4S.sup.+, 648.2639; found 648.2649.
(Synthesis Example 2) Synthesis of Berberine-VQ
[0113] ##STR00010##
[0114] To a solution of compound 1 (5 mg, 35.93 mol) in DMF (0.4 mL) was added DIPEA (9.5 L), HBTU (12.8 mg, 33.75 mol) and HOBt (3.4 mg, 25.16 mol). After stirring at room temperature for 30 minutes, N-(tert-butoxycarbonyl)-2-(2-aminoethoxy)ethylamine (4.5 L, 22.54 mol) was added and reacted for 24 hours. The reaction solution was evaporated using an oil pump to remove DMF, and then extracted with CHCl.sub.3(15 mL), and washed with saturated NaHCO.sub.3(10 mL2) and brine (10 mL). The organic solution was then dried over Na.sub.2SO.sub.4 and concentrated. The crude compound was purified by the following method. Silica gel column chromatography (Pasteour pipette, CHCl.sub.3:MeOH=50:1.fwdarw.30:1.fwdarw.20:1.fwdarw.10:1) was performed to afford white solid of Compound 2 (1.4 mg, 3.01 mol, 16.8%).
##STR00011##
[0115] To a solution of compound 4 (15 mg, 41.92 mol) in DMF (1.5 mL) was added K.sub.2CO.sub.3(11.3 mg, 81.75 mol) and t-butyl-2-bromoacetate (12.5 L, 85.21 mol) and the reaction mixture changed to brown from yellow. After stirring at room temperature for 21 hours, the reaction mixture was filtered and yellow solid precipitated on cotton. The precipitate was dissolved in MeOH and then evaporated to afford yellow solid (5.5 mg, 12.60 mol). The residue filtration liquor was recrystallized using EA:MeOH:hexane=1.7 mL: 1 mL: 6 mL to afford yellow fine powder. (7 mg, 16.04 mol, total yield is 68.3%)
##STR00012##
[0116] To a solution of 5 (7 mg, 16.04 mol) in DCM (105 L) was added triethyl silane (3.85 L, 24.06 mol) and TFA (420 L), Under room temperature the reaction mixture was stirred for 1 hour and then after evaporation and co-evaporation with MeCN three times the crude compound was purified by silica gel column chromatography (EA:MeOH=10:1-8:1-5:1-1:1-1:10) to afford yellow solid. (3.5 mg, 9.20 mol, 57.4%).
##STR00013##
[0117] To a solution of 2 (2.8 mg, 6.03 mol) in DCM (40 L) was added triethyl silane (1.45 L) and TFA (150 L). After stirred at r.t for 30 min the reaction mixture was evaporated and co-evaporated using MeCN three times. The crude compound was quickly put through silica gel column (CHCl.sub.3: MeOH=10:1-1:1) to remove TFA, the obtained solution was concentrated and added (washed by DMF 100 L2) to the solution mixture of 6 (2.3 mg, 6.05 mol), DIPEA (3.15 L, 18.14 mol), HOBt (1.9 mg, 14.01 mol), HBTU (5.6 mg, 14.76 mol) in DMF (150 L). After being stirred at r.t for 1 hour HBTU (2.6 mg, 6.86 mol) was replenished. After 30 min the reaction mixture was evaporated and dissolved in DMSO then filtrated with membrane (Advantec 13 HPO45AN 0.45 m). The filtration liquor was purified by HPLC to afford yellow solution. (3.26 mol, 53.9%).
[0118] .sup.1H NMR (600 MHz, DMSO) (ppm)=9.96 (1H, s), 8.91 (1H, s), 8.59 (1H, d, J=5.4 Hz), 8.22 (1H, t, J=5.4 Hz), 8.18 (1H, d, J=9.6 Hz), 8.06 (1H, d, J=7.8 Hz), 7.99 (1H, d, J=9 Hz), 7.78 (1H, s), 7.76 (1H, t, J=7.2, 8.4 Hz), 7.44 (2H, m), 7.09 (1H, s), 6.18 (2H, s), 4.97 (2H, s), 4.90 (2H, d, J=6 Hz), 4.79 (2H, s), 4.04 (3H, s), 3.48 (4H, m), 3.35 (2H, t, J=6 Hz), 3.19 (2H, t, J=6 Hz), 3.06 (2H, s), 2.86 (2H, t, J=7.2 Hz), 2.10 (3H, s).
[0119] .sup.13C NMR (600 MHz, DMSO) (ppm) 167.90, 167.35, 166.32, 163.00, 149.89, 149.83, 147.72, 145.82, 141.92, 141.28, 137.53, 133.73, 132.89, 130.63, 127.26, 126.62, 125.44, 123.76, 121.27, 120.42, 120.14, 119.23, 115.32, 108.44, 105.45, 102.11, 71.62, 68.70, 57.12, 55.44, 48.64, 38.76, 38.28, 34.37, 29.81, 26.37, 14.84.
[0120] HRMS (ESI-TOF) calculated for C.sub.38H.sub.40N.sub.5O.sub.8S.sup.+[M].sup.+: 726.2592, found: 726.2567, for C.sub.38H.sub.41N.sub.5O.sub.8S.sup.+[M+H].sup.2+: 363.6333, found: 363.6345.
##STR00014##
[0121] To a solution of compound 7 (5 mol) in DMSO (269 L) was added a solution of MMPP (25 mol) in water (1.25 ml) and the mixture was stirred at room temperature for 1 minute to afford compound 8. Carbonate buffer (50 mM, pH=10, 1 mL), thiophenol (800 L, 400 mol, 500 mM in DMSO) and DMSO (2.7 mL) were then added and the mixture was incubated at 37 C. for 3 h. The solution was purified by HPLC to afford compound 9 (3 mol, 60%).
[0122] .sup.1H NMR (600 MHz, DMSO) of compound 9: (ppm) 9.96 (1H, s), 8.90 (1H, s), 8.55 (1H, s), 8.23 (1H, s), 8.17 (1H, d, J=9 Hz), 8.06 (1H, d, J=7.8 Hz), 7.98 (1H, d, J=9 Hz), 7.78 (1H, s), 7.74 (1H, t, J=8.4H, s), 3.48 (2H, t, J=6.0 Hz), 3.43 (2H, t, J=6.0 Hz), 3.36 (2H, m), 3.35 (2H, m), 3.27 (2H, t, J=5.4 Hz), 3.19 (2H, t, J=6.0 Hz), 3.08 (2H, s).
[0123] .sup.13C NMR (150 MHz, DMSO) of Compound 9: (ppm) 167.92, 167.33, 166.20, 162.61, 149.89, 149.83, 147.72, 145.78, 141.93, 141.23, 137.49, 136.00, 133.78, 132.90, 13 0.61, 129.11, 1218.14, 127.29, 126.60, 125.80, 125.51, 123.76, 121.26, 120.41, 120.12, 119.26, 118.41, 116.42, 115.31, 108.44, 105.45, 102.11, 71.63, 68.71, 68.57, 68.71, 68.57, 57.12, 55.45, 48.63, 38.74, 38.29, 34.20, 28.98, 26.38.
[0124] HRMS (ESI-TOF) calculated for C.sub.43H.sub.42N.sub.5O.sub.8S.sup.+[M].sup.+: 788.2749, found: 788.2708, for C.sub.43H.sub.43N.sub.5O.sub.8S.sup.+[M+H].sup.2+: 394.6411, found: 394.6415.
(Example 1) Mutational Profiling (MaP) Using Sm-VQ as a Modifying Molecule
<Sequence of Target RNA1>
[0125] To demonstrate the utilities of Acridine-VQ synthesized in Synthesis Example 1 and Berberine-VQ synthesized in Synthesis Example 2, the following sequence was used as an RNA to be analyzed: 5-[cassette sequence]-GUCUCGCGAGAGUGAGGCAAGCAUACCGGGGCGGGCCUUGGGCGGGGUGUAUGCAAUG GUGCUGAGAGGCACCACAAAU-[cassette sequence]-3 (SEQ ID No.1). This sequence is an artificial modification of a portion of the G4 sequence present in the promoter sequence of human vascular endothelial growth factor: 5-AGCAUACCGGGGCGGGCCUUGGGCGGGG-3 (SEQ ID No.2), forming a stable G4 structure. The 5-end of RNA1 contains any sequence required for DNA amplification reaction (5-cassette sequence) and the 3-end contains any sequence required for reverse transcription reaction and DNA amplification reaction (3-cassette sequence).
<Alkylation Reaction to Target RNA1>
[0126] First, the target RNA1 was incubated in 20 mM phosphate buffer (pH 7.0), 80 mM KCl, and 20 mM NaCl solution (PKN Buffer) at 95 C. for 5 min and then cooled to 4 C. for RNA folding. Next, each Sm-VQ was reacted with the target RNA1. The scale of the reaction solution was 20 L and the composition was 1 M target RNA1, 1PKN Buffer, and 20 M each Sm-VQ precursor. For the negative control sample, dimethyl sulfoxide (DMSO) and 20 mM EDTA (diluted with 1PKN Buffer) were added instead of 20 M Sm-VQ precursor. After the reaction, target RNA1 was purified. Zymo Research RNA Clean & Concentrator-5 or AMPure XP (Beckman Coulter) was used for purification.
<Reverse Transcription Reaction for Mutational Profiling>
[0127] The RNA sample after the alkylation reaction was subjected to a reverse transcription reaction using a reverse primer having a sequence complementary to the 3-cassette sequence. First, reverse transcription primer annealing was performed on RNA after the alkylation reaction. The scale of the reaction solution was 10 L, and the composition was 7 L of the RNA solution after the alkylation reaction, 1 L of 2 M reverse primer, and 2 L of 10 mM dNTP. Here, 2.22RT Buffer required for the reverse transcription reaction was prepared. The composition was 2.22MaP pre-buffer, 2.22M Betaine, 11.1 mM MgCl.sub.2. The 2.22MaP pre-buffer is prepared in advance. The composition of the 5MaP pre-buffer is 250 mM Tris (pH 8.0), 375 mM KCl, 50 mM DTT. Next, the reverse transcription reaction was performed using a protocol of holding at 25 C., 10 minutes.fwdarw.60 C., 90 minutes.fwdarw.90 C., 10 minutes.fwdarw.4 C. The scale of the reaction solution was 20 L, and the composition was 1 L of TGIRT-III, 9 L of 2.22RT Buffer, and 10 L of the reaction solution after annealing. Next, 1 L of RNase H was added to the solution after the reverse transcription reaction, and the mixture was reacted at 37 C. for 20 minutes to decompose the remaining RNA. Finally, cDNA was purified. For purification, RNA Clean & Concentrator-5 manufactured by Zymo Research Corporation or AMPure XP manufactured by Beckman Coulter, Inc. was used.
<Preparation of Illumina Sequence Libraries>
[0128] Amplicon PCR and index PCR were performed as DNA amplification reactions for preparation of the library. Amplicon PCR was performed at a reaction volume of 25 L using 0.5 ng of reverse transcription product, 1Platenum SuperFi PCR Master Mix and 1SuperFi GC Enhancer (both manufactured by Thermo Fisher Scientific Co., Ltd.), 500 nM forward primer and reverse primer. First, after heating to 98 C. for 30 seconds, 3-step PCR was performed at 98 C. for 10 seconds, 64 C. for 10 seconds, 72 C. for 20 seconds. After the last cycle, the temperature was held at 72 C. for 5 minutes and then cooled to 4 C. After PCR, 2.5 L Exonuclease I (manufactured by NEW ENGLAND Biolabs) was added to decompose the remaining primer, and the mixture was reacted at 37 C. for 15 minutes. For purification, the DNA clean-up and enrichment protocol of the Monarch PCR & DNA clean-up kit (5 g) (New England Biolabs) was used. For the final elution, 8 L of DNA elution buffer was used. This was ready to index for the Illumina sequence. Index PCR was then performed using 1 ng amplicon PCR product at 25 L reaction volume. Other reaction components are 1 M index primers of 1Platinum SuperFi PCR Master Mix and Nextera XT Index Kit v2 (Illumina). After heating to 98 C. for 30 seconds first, 3 cycles of PCR were performed at 98 C. for 10 seconds, 55 C. for 10 seconds, 72 C. for 20 seconds. After the last cycle, the temperature was held at 72 C. for 5 minutes and then cooled to 4 C. Purification was performed using AMPure XP (manufactured by Beckman Coulter, Inc.). For elution, 14 L of water was added to the dried beads, mixed thoroughly, incubated at room temperature for 10 minutes, and the supernatant was collected. Samples with different indices were then mixed into the same solution for the sequence.
<Illumina Sequence>
[0129] Sequencing was performed using NextSeq500/550 Mid Output Kit v2.5 (150 cycles) or Miseq Micro kit v2 and Miseq Nano kit v3 with paired-end reads and standard read primers.
<Alignment and Data Analysis>
[0130] The FASTQ file was aligned with the reference using BWA after removing the adapter region. The percent deletion (Deletion rate) was calculated by summing the number of deletions for each nucleotide and dividing by the total number of reads at a base position. In order to reduce noise due to sequence-specific mutation, the loss rate of the unmodified sample was subtracted from the loss rate of the Sm-VQ-modified sample to determine the delta loss rate (Deletion rate) of the following formula (1).
Delta loss rate (Deletion rate)=loss rate modified-loss rate unmodified.
Results and Discussion
<Detection of G4 Structure of Target RNA1>
[0131] The target RNA1 containing the G4 structure was subjected to the above-described experiments and analyses, and the G4 structure was detected through identification of the binding site of the low molecular compound that binds to G4. Acridine-VQ (SPh) and berberine-VQ (SPh) were used as the modification molecules. From the sequence data, we calculated the deletion rate at each nucleotide position for the sample containing Sm-VQ (Sm-VQ) and the control sample without Sm-VQ (DMSO) (
<Evaluation of Deletion Length in Target RNA1>
[0132] To evaluate how much sequence information is lost due to deletion in sequencing, the length of deletion in each nucleotide of target RNA1 was calculated using the same sequence data as Example 1. The length of respective nucleotide deletions was calculated from sequencing data of the sample containing Sm-VQ and the control sample without Sm-VQ, a difference was taken, the number of deletions occurring only in the sample containing Sm-VQ was calculated for each deletion length, and the ratio of any base to the total number of deletions was evaluated (
<Verification Time-Dependence of Alkylation Reaction in Deletion Probability>
[0133] To verify whether the deletion observed in MaP with target RNA1 is due to a chemical reaction by a modifying molecule, a time-dependent change in the deletion probability was confirmed. Specifically, the reaction time with 18 hours as a standard in
<Control Experiment and Analysis Using Control Modifying Molecule Sm-VQ-SMe>
[0134] To show that the deletions identified in mutational profiling using target RNA1 are due to the modification reaction of VQ and not caused by specific binding of small molecules (acridine and berberine) to G4, a control experiment was performed using a negative control molecule of Sm-VQ, i.e., Sm-VQ(SMe) as a modifying molecule. In Sm-VQ(SMe), the SPh group of the VQ precursor is replaced by a SMe group. The SMe group is less likely to undergo an elimination reaction than the SPh group, and the conversion efficiency of the VQ precursor to VQ is lower. In other words, Sm-VQ(SMe), like Sm-VQ(SPh), binds to the desired higher-order structure, but the modification efficiency is lower than that of Sm-VQ(SPh) (Non-Patent Literature 5). We compared the Deletion rate of Sm-VQ (SPh) and that of Sm-VQ (SMe) as modifying molecules in acridine and berberine, respectively (
(Example 2) Cluster Analysis of Target RNA Having Single Nucleotide Polymorphism
<Preparation of Target RNA Sequence>
[0135] Two sequences, wild type and SNP type, derived from microRNA precursors (pre-miRNA-1229) were used as the sequences to be analyzed. The wild-type pre-miRNA-1229 sequence comprises: 5-GGGUAGGUUUGGGGGAGCGUGGCUGGGGGUUCAGGGGACA-3 (SEQ ID No. 3). The SNP type pre-miRNA-1229 sequence comprises the sequence in which the 21st cytosine of pre-miRNA-1229 is replaced by uracil: 5-GGGGUAGGGUUGUGGGCUGGGGGUUCAGGGGACA-3 (SEQ ID No.4). This single nucleotide substitution is known as rs2291418. At the 5 end of each RNA sequence is added any sequence necessary for DNA amplification reaction and mapping (5-cassette sequence) and any sequence necessary for sequence differentiation (5-barcode sequence), and the 3-end was appended with an arbitrary sequence required for reverse transcription and DNA amplification reactions (3-cassette sequence) and an arbitrary sequence required for sequence differentiation (3-barcode sequence). The RNAs to be analyzed were constructed as follows, containing a different barcode sequence for each target RNA sequence.
5-[Cassette Sequence]-[Barcode Sequence]-[SEQ ID NO:3 or SEQ ID NO:4]-[Barcode Sequence]-[Cassette Sequence]-3
[0136] Hereafter, the RNA to be analyzed containing wild-type pre-miRNA-1229 is denoted as WT, and the RNA to be analyzed containing SNP-type pre-miRNA-1229 is denoted as SNP.
<Relationship Between Rs229418 and Alzheimer's Disease>
[0137] rs2291418 is a SNP within pre-miRNA-1229 that has been reported to be associated with Alzheimer's disease (AD). AD is a known protein misfolding disease, in which the accumulation of tau protein and beta-amyloid (A) protein triggers symptoms. Various proteins are involved in A processing and trafficking, including sortilin-associated receptor 1 (SORL1). miRNA-1229-3p is known to regulate SORL1 translation, and miRNA-1229-3p expression levels have been shown to be significantly higher in rs2291418 is known to be increased in pre-miRNA-1229 mutants.
[0138] Pre-miRNA-1229 has been reported to be in equilibrium between the G4 structure and the hairpin structure. In addition, rs2291418 has been reported to alter the equilibrium between this structure. (see Joshua A. Imperatore., et al. (2020) Characterization of a G-Quadruplex Structure in Pre-miRNA-1229 and in Its Alzheimer's Disease-Associated Variant rs229418: Implications for miRNA-1229 Maturation. Int. J. Mol. Sci.)
<Mutational Profiling by Berberine-VQ>
[0139] Alkylation reactions with Berberine-VQ were performed using the two types of RNAs to be analyzed, WT and SNP, prepared as described above. The conditions for the alkylation reaction are basically the same as in Example 1, but the concentration of the target RNA is different. In Example 1, 1 M of target RNA1 was used, whereas in this example, the alkylation reaction was performed on a library containing 22 RNA sequences, including two types of RNAs to be analyzed, WT and SNP, at 1 M. Reverse transcription reactions, preparation of cDNA libraries, and mutational profiling by sequencing were then performed under the same conditions as Example 1.
<Clustering Analysis of Deletion Pattern>
[0140] (1) First, the deletion information of the sequence to be analyzed was extracted from the SAM format file obtained by mapping the reads in the Berberine-VQ modification group sample to the reference sequence. Specifically, from the SAM format file of the Berberine-VQ modification group sample, 2000 reads were randomly selected from among the reads in which at least one deletion of length 1 occurred in the sequence to be analyzed, and for each read, an array was generated containing information on the length of the deletion for each base in the sequence to be analyzed. The length of each array was equal to the length of the sequence being analyzed, and as a component of the array, a number 0 or 1 was included, based on the presence or absence of a deletion. 1 corresponded to the base with the deletion, and 0 corresponded to the base without the deletion. [0141] (2) Next, using UMAP, the arrays extracted in (1) that contained the deletion information for each read were compressed into two dimensions. This compression was performed on the 4000 arrays extracted from the WT and SNP data. [0142] (3) Next, k-means was used to cluster the deletion information compressed into two dimensions in (2). First, the Elbow method was used to estimate the appropriate number of clusters. The Elbow method is a method to estimate the optimal number of clusters by calculating and illustrating the sum of squares of residuals for each number of clusters while changing the number of clusters. Here, the number of clusters for this clustering was set to 4. Next, in (2), the generated two-dimensional list was clustered. From the cluster information obtained here, the two-dimensional list in (2) was color-coded by cluster and plotted (
<Results and Discussions>
[0144] The deletion information for each of the WT and SNP sequences was compressed in two dimensions and classified into four clusters as shown in
[0145] RNA can form multiple structures from a single sequence, and the bases at plurality of locations for each structure react with low-molecular-weight compounds. Thus, we showed that Motif-MaP can not only detect the target RNA higher-order structure, but also distinguish binding patterns of co-occurring low-molecular-weight compounds and fluctuations (structural equilibrium state) among plurality of RNA higher-order structures. These results indicate that the combination of mutational profiling (MaP) and cluster analysis can be used to analyze the higher-order structure of target RNAs more precisely and in more detail.
(Example 3) Enrichment of Modified RNA Using RNA Pull-Down
1. Introduction
[0146] In Example 1, mutational profiling was performed using the molecule Sm-VQ, which modifies the binding site of a small molecule compound. That is, the deletion rate at each base of RNA was determined from the sequence data, and the base with a significantly high deletion rate according to the binding-modification reaction was considered to be the small molecule binding position, and the target higher-order structure of RNA was detected. Therefore, in order to efficiently detect the target higher-order structure of RNA from the limited sequence data, it was necessary to extract more information on deletions or modified RNAs.
[0147] When unmodified RNA is included in the RNA to be analyzed, uniform reverse transcription and amplification of modified and unmodified RNA in the same solution increases the sequencing cost. Therefore, we added a step to selectively enrich modified RNA from a mixture of modified and unmodified RNA and performed the Motif-MaP method.
[0148] The enrichment of modified RNA comprises three main steps. First, a specific modification reaction induced by RNA-small molecule interaction is performed using a small molecule-binding alkylating agent with an azide group. This adds an azide group to the modified RNA. Next, a click reaction converts the azide group added in the modification reaction to biotin. Finally, a pull-down assay of the RNA using biotin-avidin interaction is performed. In this pull-down assay, the RNA with biotin added, and thus the modified RNA, preferentially binds to the avidin beads, allowing the modified RNA to be enriched.
2. Experimental Method
<Sequence Used>
[0149] A target RNA library consisting of 9 sequences shown in Table 1 below was used. For the target RNAs to be analyzed contained in the library, RNAs consisting of 5-[cassette sequence]-[target sequence]-[cassette sequence]-3 were used for SEQ ID NOs: 5 to 13, respectively. These RNA sequences have been examined for modification efficiency of Sm-VQ.
TABLE-US-00001 TABLE1 SEQ Modification IDNo. SequenceName TargetSequence efficiency 5 (UGGU)6 5-UGGUUGGUUGGUUGGUUGGUUGGU-3 High 6 (UGGGU)6 5-UGGGUUGGGUUGGGUUGGGUUGGGUUGGGU-3 High 7 (GGGU)6 5-GGGUGGGUGGGUGGGUGGGUGGGU-3 High 8 hsa-mir-221_loop 5-AUUUCUGUGUUCGUUAGGCAACAG-3 High 9 hsa-mir-518d_loop 5-UUCUGUUGUCUGAAAGAAACCAA-3 Low 10 hsa-mir-3129_loop 5-GUUUGCCUGUUAAUGAAUUCAAAC-3 Low 11 hsa-mir-6850_loop 5-CGGGGGGGGAGGGGAAGGGACGCCCG-3 Low 12 hsa-mir-299_loop 5-CAUACAUUUUGAAUAUGUAUG-3 Low 13 hsa-mir-4520-1_loop 5-CCAAAUCAGAAAAGGAUUUGG-3 Low
<Modification Reaction Using a Modification Molecule Having an Azide Group>
[0150] First, target RNA library 1 containing 9 sequences was incubated at 95 C. for 5 minutes in a 20 mM phosphate buffer (pH 7.0), 80 mM KCl, and 20 mM NaCl solution (PKN Buffer), and then cooled to 4 C. to fold RNA. Next, acridine-VQ(NMe2) (whose structure is shown below), to which an azide group is covalently attached was reacted with target RNA library 1.
##STR00015##
[0151] The scale of the reaction solution is 20 L and the composition is 1 M Target RNA Library 1, 1PKN Buffer, and 20 IM of each Sm-VQ precursor. For the negative control sample, dimethyl sulfoxide (DMSO) and 20 mM EDTA (diluted with 1PKN Buffer) were added instead of 20 M acridine-VQ (NMe2) precursor. After the reaction, target RNA library 1 was purified. Zymo Research RNA Clean & Concentrator-5 or AMvPure XP (Beckman Coulter) was used for purification.
<Crick Reaction>
[0152] To 1500 ng of RNA sample after modification reaction, 2 L of 2 mM Click-iT Biotin sDIBO Alkyne (Thermo Fisher Scientific Corporation) and 1 L of RiboLock RNase Inhibitor (Thermo Fisher Scientific, Inc.) were added, and then each sample was volume-constituted to 30 L using ultrapure water. All reaction solutions were then mixed in an Eppendorf Thermomixer at 37 C., 1000 rpm for 2.5 hours. After the reaction, target RNA library 1 was purified. For purification, RNA Clean & Concentrator-5 from Zymo Research was used.
<RNA Pull-Down>
[0153] In 1.5-mL tubes, 20 L of SpeedBeads Magnetic Neutravidin Coated particles (Merck Cytiva) were dispensed, and the supernatant was removed after the tubes were placed on a magnetic rack. Next, 500 L of 1PKN Buffer was added and mixed by inversion. The tubes were then placed on a magnetic rack and the supernatant was removed. Next, the RNA sample after the click reaction was added, and 1PKN Buffer was added until the total volume was 1000 L. The tubes were then agitated in an Eppendorf Thermomixer at 25 C., 1200 rpm for 1 hour, and then the tubes were placed on a magnetic rack and the supernatant was removed. As a washing operation, 1000 L of 1PKN Buffer was added and mixed by inversion. After spin-down, the tubes were placed on the magnetic rack and the supernatant was removed. This series of washing was performed three times in total. After washing, 50 L of Elution Buffer (95% formamide, 10 mM EDTA, pH 8.2) was added, and heat treatment was performed at 80 C. for 5 minutes. The tubes were then placed on a magnetic rack and the supernatant was transferred to a new DNA LoBind tube for purification of the target RNA library 1 after 5 minutes at room temperature. For purification, RNA Clean & Concentrator-5 from Zymo Research, Inc. was used.
<Preparation of Reverse Transcription Reaction and Illumina Sequence Libraries of Target RNA Libraries 1>
[0154] Reverse transcription reaction and Illumina Sequence Libraries were prepared in the same manner as in Example 1.
<Illumina Sequence>
[0155] For sequencing, iSeq 100 i1 Reagent v2 (300-cycle) using paired end reads and standard read primers was used.
<Experimental Results>
[0156] The deletion profiling graphs for the four target sequences in the target RNA library 1 that were found to have high modification efficiency in other assays and high binding affinity to small molecules are shown in
[0157]
[0158] These results indicate that the enrichment of modified RNAs increases the deletion rate depending on the strength of their binding affinity to small molecules. In Motif-MaP, the information on deletions induced and generated by modification reactions at each base of each sequence is used to identify the target RNA higher-order structure. Therefore, bases with higher deletion rates are more likely to be recognized as small molecule binding positions in a limited number of sequencing reads. In other words, the selective enrichment of modified RNAs described in this example is expected to enable the identification of the target RNA higher-order structure with higher detection efficiency than the existing Motif-MaP method.