SUPEROXIDE DISMUTASE GENE AND ITS CODING PROTEIN
20200149016 ยท 2020-05-14
Assignee
Inventors
Cpc classification
International classification
Abstract
The present invention discloses a superoxide dismutase gene and a protein encoded thereby, the DNA sequence of the superoxide dismutase gene is shown in SEQ ID NO. 1, and the encoded protein sequence of the superoxide dismutase gene is shown in SEQ ID NO 2. The superoxide dismutase encoded by the SOD gene of the invention has good heat resistance and freeze-thaw resistance, and can be widely applied in the fields of cosmetics, food, medicine, environmental protection and the like.
Claims
1. A superoxide dismutase gene characterized in that the DNA sequence of the gene is as shown in SEQ ID NO.1
2. The protein encoded by the superoxide dismutase gene according to claim 1, wherein the protein sequence is as shown in SEQ ID NO.2
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0011]
[0012]
[0013]
DESCRIPTION OF THE EMBODIMENTS
[0014] The following examples are provided for a better understanding of the present invention; however, the present invention is not limited thereto.
[0015] The DNA sequence of the superoxide dismutase gene of the present invention is shown in SEQ ID NO.1
[0016] The encoded protein sequence of the above superoxide dismutase gene is shown in SEQ ID NO.2
[0017] The source of the SOD gene of the present invention is from a natural environment water sample collected from Minhou, Fuzhou, Fujian Province. Using a 0.22 m membrane filter to retain various organisms therein, the metagenomic DNA of it was extracted with a kit (Mobio PowerDNA Isolation Kit, 14900-50-NF, USA), and the extracted DNA is directly used in PCR amplification as the template DNA.
Example 1
[0018] Construction of the protein expression vector for SOD gene by molecular cloning technology includes the following steps:
[0019] Step1, PCR system (50 L): template DNA 1 L, Sodinfupet15F primer (10 M) 2 L, Sodinfupet15R primer (10 M) 2 L, 2KOD PCR mix (ABM, Canada) 25 L, and ddH.sub.2O up to 50 L.
TABLE-US-00001 Sodinfupet15Fprimersequence: GTTAGCAGCCGGATCCTATTTTATCTGGTTATACCGTCTCTCAACCTCC Sodinfupet15Rprimersequence: ATATGCTCGAGGATCccATGAAGTTTAGAAGTATAATCCTTGCAGGGC
[0020] PCR program: 94 C. for 10 min, 30 cycles of (94 C. for 30 s, 50 C. for 30 s, and 72 C. for 45 s), and 72 C. for 5 min.
[0021] The PCR product was confirmed by agarose gel electrophoresis. The result was shown in
[0022] The PCR product obtained in this example was sequenced using the Sanger method by the ABI 3730x1 sequencer, and the sequencing primers were Sodinfupet15F and Sodinfupet15R. The sequencing experiment was performed by the Guangzhou Yingjun Biotech Co., Ltd. The full length DNA sequence of the superoxide dismutase gene in the present invention was obtained from the Sanger sequencing result, as shown in SEQ ID NO.1.
[0023] Step2, The gel purification of the target band of the PCR product from step 1 was carried out with an Omega Gel Extraction Kit (Cat No. D2500-01). The gel-purified PCR product (SOD enzyme gene) serves as a substrate for subsequent in fusion ligation reactions for the construction of the protein expression vector.
[0024] Step3, Preparation of the linearized expression plasmid. The pET15b plasmid was digested at 37 C. for 30 min in the follow system: pET15b plasmid (108.8 ng/L) 10 L, 10 FastDigest buffer 2 L, FastDigest BamHI 1 L, ddH.sub.2O 7 L. The digested product was identified by agarose gel electrophoresis, and the band of the digested product was purified by the above omega kit. The purified product's concentration was 32 ng/l. This prepared linearized plasmid was used for the subsequent In fusion ligation.
[0025] Step4, In-Fusion Ligation. The purified PCR product is ligated to the linearized pET15b plasmid to construct the expression vector.
[0026] The ligation system: 5 In-fusion HD Enzyme Premix (Clontech, USA) 2 L, linearized pET15b plasmid (32 ng/L) 1.6 L (in total about Song), gel-purified SOD gene (50 ng/L) 1 L, ddH.sub.2O
[0027] The total volume of ligation system is 10 L.
[0028] Incubate at 50 C. for 15 min and then place on ice.
[0029] Step5 Transformation.
[0030] Take 10 l of the In fusion ligation product, add to E. coli stb13 competent cells, mix, ice bath for 30 min, heat shock at 42 C. for 45 s, ice bath for 2 min, spread on LB plate (with ampicillin resistance). The plates were incubated for 16 hours in a 37 C. incubator to form single colonies on the plates.
[0031] Step6 Verification of Colonies
[0032] 10 single colonies were picked (numbers 1 to 10) to 10 tubes which containing 10 l of sterile water each, mixed by pipetting, and 1 l bacterial suspension of each tube was used as the template for colony PCR to verify whether the target gene was ligated to the plasmid.
[0033] The system of colony PCR (Samples):
[0034] T7 universal forward sequencing primer 0.4 l, T7 universal reverse sequencing primer 0.4 l, Bacterial suspension 1 l, 2Taq mix (Cwbiotech, CHINA) 5 l, ddH.sub.2O 3.2 L.
[0035] The system of colony PCR (Negative Control):
[0036] T7 universal forward sequencing primer 0.4 l, T7 universal reverse sequencing primer 0.4 l, pET15b plasmid 1 l, 2Taq mix (Cwbiotech, CHINA) 5 l, ddH.sub.2O 3.2 L.
[0037] PCR program: 94 C. for 10 min, 30 cycles of (94 C. for 30 s, 50 C. for 30 s, and 72 C. for 60 s), and 72 C. for 5 min. The PCR product was confirmed by agarose gel electrophoresis which was shown in
[0038] Step7, Sequencing verification and construction of protein expression strain.
[0039] The sample No. 5 in
Example 2
[0040] Protein Expression
[0041] 1. Induced Expression
[0042] 1) 300 L of the overnight cultured bacteria in the step 7 of Example 1 was added to 30 mL LB with ampicillin, cultured at 37 C., 200 rpm.
[0043] 2) The OD value was measured after about 2 hours. When the OD value reached 0.5 (0.3 to 0.5), IPTG was added to a final concentration of 0.1 mM, and then cultured at 20 C., 200 rpm for 12 hours.
[0044] 2, enzymatic lysis of cells (30 mL bacterial suspension)
[0045] 1) Collect the cells by centrifugation at 4000 g for 10 min, remove the supernatant, wash once with ddH.sub.2O (resuspend the precipitate in ddH.sub.2O and centrifuge to remove the supernatant).
[0046] 2) The precipitate corresponding to each 30 mL of bacteria culture is resuspended in 1.2 mL cell lysis buffer (pH 8.5), and the buffer needs to ensure the addition of PMSF.
[0047] 3) Add lysozyme powder to a final concentration of 1 mg/mL, mix and place at ice bath for 30 min.
[0048] 4) Transfer the centrifuge tube to the shaker, screw the lid, tilt at 45 degrees, 230 rpm, 25 C., shake for 10 min.
[0049] 5) Add Triton X-100 12 L (final concentration 1%), DNase 0.5 L and RNase 1 l, (final concentration 5 g/mL) to the tube, then placed it on a shaker at 230 rpm, 25 C., and shaken for 15 min.
[0050] 6) Centrifugation at 12000 g for 15 min at 4 C., the supernatant is a soluble protein component. The supernatant was used for subsequent experiments.
[0051] The sequence of SOD protein expressed in the supernatant is shown in SEQ ID NO.2
[0052] 3, SOD Activity Detection
[0053] The SOD activity detection kit (WST-8 method) was purchased from the Beyotime Co., Ltd., and the supernatant was directly tested for SOD activity.
[0054] The test results are shown in
[0055] The pET15b-SOD-ER2566 carrying the SOD gene of the present invention has a SOD activity of at least 15 units in the lysate supernatant. The pET15b-ER2566 (negative control) without the SOD gene of the present invention had an activity in the lysate supernatant less than 2.5 Units.
[0056] 1. Thermal Stability Test
[0057] The lysate supernatant of pET15b-SOD-ER2566 carrying the SOD gene of the present invention was incubated at 80 C. for 10 minutes, and the SOD activity was determined, and it was found to retain 90% of the activity, indicating that the SOD enzyme of the present invention has a good thermal stability.
[0058] 2, Anti-Freezing and Melting Ability
[0059] The lysate supernatant of pET15b-SOD-ER2566 carrying the SOD gene of the present invention was placed in an ultra-low temperature refrigerator at 86 C., frozen for 12 hours, taken out, thawed at room temperature (25 C.), and the activity of SOD was measured, and it was found 95% activity remained, indicating that the SOD enzyme of the present invention has good freeze-thaw resistance.
Example 3
[0060] Comparative Test
[0061] The SOD enzyme gene under the accession number of SDL36756.1 in GenBank was synthesized by the General Biosystems company, and the gene was cloned into an expression vector according to the methods of Example 1 and Example 2, and the expression of the target protein was induced.
[0062] 1. Thermal Stability Test
[0063] The lysate supernatant of strain which expressing this recombinant protein was incubated at 80 C. for 10 minutes, and the activity of SOD was measured, and it was found to retain 60% of activity compared with the control group which was not treated with high temperature.
[0064] 2, Anti-Freezing and Melting Ability
[0065] The lysate supernatant of strain which expressing this recombinant protein was placed in an ultra-low temperature refrigerator at 86 C., frozen for 12 hours, taken out, and thawed at room temperature (25 C.), and the activity of SOD was measured again, and the control group was treated with no freeze-thaw treatment. In comparison, it was found to retain 75% activity.
[0066] According to the heat stability test and the freeze-thaw resistance test of Examples 2 and 3, the superoxide dismutase encoded by the SOD gene of the present invention has good heat resistance and freezing-thawing resistance as compared with the conventional SOD enzyme, broadening its application in cosmetics, food, medicine, environmental protection and other fields.