KIT FOR GENOTYPING OF PLATELET AND NEUTROPHIL ANTIGENS AND GLYCOPROTEINS
20230235390 · 2023-07-27
Inventors
- Luyi YE (Shanghai, CN)
- Huijun ZHU (Shanghai, CN)
- Ruishu LI (Shanghai, CN)
- Min FU (Shanghai, CN)
- Ping LU (Shanghai, CN)
- Ziyan ZHU (Shanghai, CN)
Cpc classification
C12Q1/6806
CHEMISTRY; METALLURGY
International classification
C12Q1/6806
CHEMISTRY; METALLURGY
Abstract
The present invention provides a mass spectrometry-based method and a kit for genotyping of platelet and neutrophil antigens and glycoproteins, which are used for genotyping of platelet-specific antigens, platelet CD36 glycoproteins and neutrophil antigens; by designing an optimal primer combination, problems such as homologous sequences and rich GC are overcome, moreover, by improving amplification reaction conditions and using nucleic acid mass spectrometry as a platform, 35 platelet-specific antigen polymorphic sites, 10 CD36 polymorphic sites and 8 neutrophil antigen polymorphic sites can be simultaneously detected in 2 reactions. The present invention has the characteristics of high specificity and sensitivity, and fast and high throughput, and can be used in clinic, scientific research, platelet donor routine screening, etc.
Claims
1. A method for genotyping by mass spectrometry detection comprises the following steps: (1) using an amplification primers mix to amplify genes by an multiplex PCR reaction; (2) purifying an amplification product obtained in Step (1) by an alkaline phosphatase; (3) using an extension primers mix to extend and amplify the purified product in Step (2) by a single base; and (4) conducting sample application on a single-base extended product obtained in Step (3) onto a chip for mass spectrometry detection; Wherein the amplification primers mix and the extension primers are included to a tube, and the amplification primers and the extension primers are as below: TABLE-US-00024 Forward Reverse Extension SNP sites primers primers primers CD36 (1) rs550565800 SEQ ID NO: 1 SEQ ID NO: 2 SEQ ID NO: 3 CD36 (2) rs75326924 SEQ ID NO: 4 SEQ ID NO: 5 SEQ ID NO: 6 CD36 (3) rs572295823 SEQ ID SEQ ID SEQ ID NO: 7 NO: 8 NO: 9 CD36 (4) rs201355711 SEQ ID SEQ ID SEQ ID NO: 10 NO: 11 NO: 12 CD36 (5) rs148910227 SEQ ID SEQ ID SEQ ID NO: 13 NO: 14 NO: 15 CD36 (6) rs201765331 SEQ ID SEQ ID SEQ ID NO: 16 NO: 17 NO: 18 CD36 (7) rs545489204 SEQ ID SEQ ID SEQ ID NO: 19 NO: 20 NO: 21 CD36 (8) rs142186404 SEQ ID SEQ ID SEQ ID NO: 22 NO: 23 NO: 24 CD36 (9) rs201759307 SEQ ID SEQ ID SEQ ID NO: 25 NO: 26 NO: 27 CD36 (10) rs767892046 SEQ ID SEQ ID SEQ ID NO: 28 NO: 29 NO: 30
2. The method according to claim 1, wherein the tube further comprises amplification primers and extension primers are as below: TABLE-US-00025 Forward Reverse Extension SNP sites primers primers primers HPA-1 rs5918 SEQ ID SEQ ID SEQ ID NO: 31 NO: 32 NO: 33 HPA-2 rs6065 SEQ ID SEQ ID SEQ ID NO: 34 NO: 35 NO: 36 HPA-3 rs5911 SEQ ID SEQ ID SEQ ID NO: 37 NO: 38 NO: 39 HPA-4 rs5917 SEQ ID SEQ ID SEQ ID NO: 40 NO: 41 NO: 42 HPA-5 rs1801106 SEQ ID SEQ ID SEQ ID NO: 43 NO: 44 NO: 45 HPA-6w rs13306487 SEQ ID SEQ ID SEQ ID NO: 46 NO: 47 NO: 48 HPA-7w rs121918448 SEQ ID SEQ ID SEQ ID NO: 49 NO: 50 NO: 51 HPA-8w rs151219882 SEQ ID SEQ ID SEQ ID NO: 52 NO: 53 NO: 54 HPA-9w rs74988902 SEQ ID SEQ ID SEQ ID NO: 55 NO: 56 NO: 57 HPA-10w rs200358667 SEQ ID SEQ ID SEQ ID NO: 58 NO: 59 NO: 60 HPA-11w rs377302275 SEQ ID SEQ ID SEQ ID NO: 61 NO: 62 NO: 63 HPA-12w rs375285857 SEQ ID SEQ ID SEQ ID NO: 64 NO: 65 NO: 66 HPA-13w rs79932422 SEQ ID SEQ ID SEQ ID NO: 67 NO: 68 NO: 69 HPA-14w HPA-14w SEQ ID SEQ ID SEQ ID NO: 70 NO: 71 NO: 72 HPA-15 rs10455097 SEQ ID SEQ ID SEQ ID NO: 73 NO: 74 NO: 75 HPA-16w rs74708909 SEQ ID SEQ ID SEQ ID NO: 76 NO: 77 NO: 78 HPA-17w rs770992614 SEQ ID SEQ ID SEQ ID NO: 79 NO: 80 NO: 81 HPA-18w rs267606593 SEQ ID SEQ ID SEQ ID NO: 82 NO: 83 NO: 84 HPA-19w rs80115510 SEQ ID SEQ ID SEQ ID NO: 85 NO: 86 NO: 87 HPA-20w rs78299130 SEQ ID SEQ ID SEQ ID NO: 88 NO: 89 NO: 90 HPA-21w rs70940817 SEQ ID SEQ ID SEQ ID NO: 91 NO: 92 NO: 93 HPA-22w rs142811900 SEQ ID SEQ ID SEQ ID NO: 94 NO: 95 NO: 96 HPA-23w rs139166528 SEQ ID SEQ ID SEQ ID NO: 97 NO: 98 NO: 99 HPA-24w rs281864910 SEQ ID SEQ ID SEQ ID NO: 100 NO: 101 NO: 102 HPA-25w rs771035051 SEQ ID SEQ ID SEQ ID NO: 103 NO: 104 NO: 105 HPA-26w rs1156382155 SEQ ID SEQ ID SEQ ID NO: 106 NO: 107 NO: 108 HPA-27w rs149468422 SEQ ID SEQ ID SEQ ID NO: 109 NO: 110 NO: 111 HPA-28w rs368953599 SEQ ID SEQ ID SEQ ID NO: 112 NO: 113 NO: 114 HPA-29w rs544276300 SEQ ID SEQ ID SEQ ID NO: 115 NO: 116 NO: 117 HPA-30w rs377753373 SEQ ID SEQ ID SEQ ID NO: 118 NO: 119 NO: 120 HPA-31w rs202229101 SEQ ID SEQ ID SEQ ID NO: 121 NO: 122 NO: 123 HPA-32w rs879083862 SEQ ID SEQ ID SEQ ID NO: 124 NO: 125 NO: 126 HPA-33w rs1555572829 SEQ ID SEQ ID SEQ ID NO: 127 NO: 128 NO: 129 HPA-34w rs777748046 SEQ ID SEQ ID SEQ ID NO: 130 NO: 131 NO: 132 HPA-35w rs779974422 SEQ ID SEQ ID SEQ ID NO: 133 NO: 134 NO: 135
3. The method according to claim 2, wherein the tube further comprises amplification primers and extension primers are as below: TABLE-US-00026 Detected Forward Reverse Extension genes SNP sites primers primers primers HNA-1 rs448740 SEQ ID NO: SEQ ID NO: SEQ ID NO: 136 137 138 (1) rs5030738 SEQ ID SEQ ID SEQ ID HNA-1 NO: 139 NO: 140 NO: 141 (2) HNA-2 rs777225032 SEQ ID SEQ ID SEQ ID (1) NO: 142 NO: 143 NO: 144 HNA-2 rs1230516223 SEQ ID SEQ ID SEQ ID (2) NO: 145 NO: 146 NO: 147 HNA-3 rs147820753 SEQ ID SEQ ID SEQ ID (1) NO: 148 NO: 149 NO: 150 HNA-3 rs2288904 SEQ ID SEQ ID SEQ ID (2) NO: 151 NO: 152 NO: 153 HNA-4 rs1143679 SEQ ID SEQ ID SEQ ID NO: 154 NO: 155 NO: 156 HNA-5 rs2230433 SEQ ID SEQ ID SEQ ID NO: 157 NO: 158 NO: 159
4. The method according to 3, wherein a final concentration of each primer in the amplification primer mix is 0.1 to 1 μM.
5. The method according to 3, wherein the multiplex PCR reaction in Step (1) is as follows: TABLE-US-00027 Volume Components (μL) Water, HPLC grade 0.8 10 x PCR Buffer with 20 mM 0.5 MgCl.sub.2 25 mM MgCl.sub.2 0.4 25 mMdNTP Mix (dNTP mix) 0.1 0.5 to 5 uM Primer Mix 1 5 U/μl PCR Enzyme 0.2 5 to 20 ng/μL DNA template 2 Total volume 5
6. The method according to claim 5, wherein the DNA template to be PCR reaction are the DNA extracted from a blood sample and wherein the DNA template comprises platelet DNA, glycoprotein DNA and neutrophil DNA.
7. The method according to claim 6, wherein an annealing temperature of the multiplex PCR reaction in Step (1) is 65° C. to 53° C.
8. The method according to 7, wherein cycle conditions of the multiplex PCR reaction in Step (1) are as follows: 97° C., 5 minutes, 15 cycles, decreasing by 0.8° C. each cycle: 97° C., 30 seconds, 65° C., 45 seconds, 15 cycles); 72° C., 2 minutes; 97° C., 30 seconds, 53° C., 45 seconds, 72° C., 2 minutes, 32 cycles; 72° C., 7 minutes; keeping a temperature of 4° C.
9. The method according to claim 8, wherein the alkaline phosphatase in Step (2) is a shrimp alkaline phosphatase, and a premixed solution system for purification with the alkaline phosphatase in Step (2) is shown below: TABLE-US-00028 Volume Components (μL) Nanopure Water, Autoclaved 1.53 (ultrapure water) SAP Buffer 0.17 SAP Enzyme (1.7 U/ul) (shrimp 0.30 alkaline phosphatase) Total volume 2
10. The method according to claim 8, wherein the single-base extension premixed solution system in Step (3) is shown as below: TABLE-US-00029 Volume Components (μL) Nanopure Water, Autoclaved 0.619 (ultrapure water) iPLEX Buffer (extension buffer) 0.200 iPLEX Termination Mix (extension 0.200 termination mix) Extend Primer Mix (extension 0.94 primer combination) iPLEX Enzyme (single-base 0.041 extension reaction enzyme) Total volume 2
Description
BRIEF DESCRIPTION OF DRAWINGS
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
DETAILED DESCRIPTION OF EMBODIMENTS
[0058] The present invention will be further described in detail below in combination with embodiments. It should be pointed out that the following embodiments are intended to facilitate the understanding of the present invention, but do not have any limiting effect on it. Reagents used in the embodiments are all known products, and are obtained by purchasing commercially available products.
Embodiment 1 Methods and Steps for Genotyping Detection of Platelet Antigens, Neutrophil Antigens and CD36
[0059] In this embodiment, 35 platelet-specific antigen polymorphic sites, 10 CD36 polymorphic sites and 8 neutrophil antigen polymorphic sites are simultaneously detected on 400 cases of blood gene DNAs, so as to conduct genotyping. Although this embodiment only provides that the 35 platelet-specific antigen polymorphic sites, the 10 CD36 polymorphic sites and the 8 neutrophil antigen polymorphic sites are simultaneously detected, it can be understood that primer groups for the 10 CD36 polymorphic sites can also be used for simultaneous detection of the 10 polymorphic sites of CD36; primer groups for any one or more of the 35 platelet-specific antigen polymorphic sites, the 10 CD36 polymorphic sites and the 8 neutrophil antigen polymorphic sites can also be used for genotyping detection of any one or more thereof.
[0060] The genotyping detection of this embodiment includes the following steps.
[0061] 1. Sample Preparation:
[0062] Genes (DNAs) of 400 cases of blood samples are extracted, and concentrations thereof are normalized to 5 to 20 ng/μL for subsequent detection experiments.
[0063] 2. Primer Design
[0064] Amplification primers and extension primers are designed to detect 35 polymorphic sites of HPA1-35, 8 polymorphic sites of HNA1-5 and 10 polymorphic sites related to a CD36 deletion phenotype in CD36 protein coding genes. Amplification is divided into 2 test tubes or PCR tubes (repeated 2 times). In each test tube, forward and reverse primers in Table 11 are added one time to detect each site one time, and primer sequences are shown in Table 12.
TABLE-US-00011 TABLE 11 Designed primer groups Detected Forward Reverse Extension genes SNP sites primers primers primers CD36 (1) rs550565800 SEQ ID NO: 1 SEQ ID NO: 2 SEQ ID NO: 3 CD36 (2) rs75326924 SEQ ID NO: 4 SEQ ID NO: 5 SEQ ID NO: 6 CD36 (3) rs572295823 SEQ ID NO: 7 SEQ ID NO: 8 SEQ ID NO: 9 CD36 (4) rs201355711 SEQ ID NO: 10 SEQ ID NO: 11 SEQ ID NO: 12 CD36 (5) rs148910227 SEQ ID NO: 13 SEQ ID NO: 14 SEQ ID NO: 15 CD36 (6) rs201765331 SEQ ID NO: 16 SEQ ID NO: 17 SEQ ID NO: 18 CD36 (7) rs545489204 SEQ ID NO: 19 SEQ ID NO: 20 SEQ ID NO: 21 CD36 (8) rs142186404 SEQ ID NO: 22 SEQ ID NO: 23 SEQ ID NO: 24 CD36 (9) rs201759307 SEQ ID NO: 25 SEQ ID NO: 26 SEQ ID NO: 27 CD36 (10) rs767892046 SEQ ID NO: 28 SEQ ID NO: 29 SEQ ID NO: 30 HPA-1 rs5918 SEQ ID NO: 31 SEQ ID NO: 32 SEQ ID NO: 33 HPA-2 rs6065 SEQ ID NO: 34 SEQ ID NO: 35 SEQ ID NO: 36 HPA-3 rs5911 SEQ ID NO: 37 SEQ ID NO: 38 SEQ ID NO: 39 HPA-4 rs5917 SEQ ID NO: 40 SEQ ID NO: 41 SEQ ID NO: 42 HPA-5 rs1801106 SEQ ID NO: 43 SEQ ID NO: 44 SEQ ID NO: 45 HPA-6w rs13306487 SEQ ID NO: 46 SEQ ID NO: 47 SEQ ID NO: 48 HPA-7w rs121918448 SEQ ID NO: 49 SEQ ID NO: 50 SEQ ID NO: 51 HPA-8w rs151219882 SEQ ID NO: 52 SEQ ID NO: 53 SEQ ID NO: 54 HPA-9w rs74988902 SEQ ID NO: 55 SEQ ID NO: 56 SEQ ID NO: 57 HPA-10w rs200358667 SEQ ID NO: 58 SEQ ID NO: 59 SEQ ID NO: 60 HPA-11w rs377302275 SEQ ID NO: 61 SEQ ID NO: 62 SEQ ID NO: 63 HPA-12w rs375285857 SEQ ID NO: 64 SEQ ID NO: 65 SEQ ID NO: 66 HPA-13w rs79932422 SEQ ID NO: 67 SEQ ID NO: 68 SEQ ID NO: 69 HPA-14w HPA-14w SEQ ID NO: 70 SEQ ID NO: 71 SEQ ID NO: 72 HPA-15 rs10455097 SEQ ID NO: 73 SEQ ID NO: 74 SEQ ID NO: 75 HPA-16w rs74708909 SEQ ID NO: 76 SEQ ID NO: 77 SEQ ID NO: 78 HPA-17w rs770992614 SEQ ID NO: 79 SEQ ID NO: 80 SEQ ID NO: 81 HPA-18w rs267606593 SEQ ID NO: 82 SEQ ID NO: 83 SEQ ID NO: 84 HPA-19w rs80115510 SEQ ID NO: 85 SEQ ID NO: 86 SEQ ID NO: 87 HPA-20w rs78299130 SEQ ID NO: 88 SEQ ID NO: 89 SEQ ID NO: 90 HPA-21w rs70940817 SEQ ID NO: 91 SEQ ID NO: 92 SEQ ID NO: 93 HPA-22w rs 142811900 SEQ ID NO: 94 SEQ ID NO: 95 SEQ ID NO: 96 HPA-23w rs139166528 SEQ ID NO: 97 SEQ ID NO: 98 SEQ ID NO: 99 HPA-24w rs281864910 SEQ ID NO: SEQ ID NO: SEQ ID NO: 100 101 102 HPA-25w rs771035051 SEQ ID NO: SEQ ID NO: SEQ ID NO: 103 104 105 HPA-26w rs1156382155 SEQ ID NO: SEQ ID NO: SEQ ID NO: 106 107 108 HPA-27w rs 149468422 SEQ ID NO: SEQ ID NO: SEQ ID NO: 109 110 111 HPA-28w rs368953599 SEQ ID NO: SEQ ID NO: SEQ ID NO: 112 113 114 HPA-29w rs544276300 SEQ ID NO: SEQ ID NO: SEQ ID NO: 115 116 117 HPA-30w rs377753373 SEQ ID NO: SEQ ID NO: SEQ ID NO: 118 119 120 HPA-31w rs202229101 SEQ ID NO: SEQ ID NO: SEQ ID NO: 121 122 123 HPA-32w rs879083862 SEQ ID NO: SEQ ID NO: SEQ ID NO: 124 125 126 HPA-33w rs1555572829 SEQ ID NO: SEQ ID NO: SEQ ID NO: 127 128 129 HPA-34w rs777748046 SEQ ID NO: SEQ ID NO: SEQ ID NO: 130 131 132 HPA-35w rs779974422 SEQ ID NO: SEQ ID NO: SEQ ID NO: 133 134 135 HNA-1 (1) rs448740 SEQ ID NO: SEQ ID NO: SEQ ID NO: 136 137 138 HNA-1 (2) rs5030738 SEQ ID NO: SEQ ID NO: SEQ ID NO: 139 140 141 HNA-2 (1) rs777225032 SEQ ID NO: SEQ ID NO: SEQ ID NO: 142 143 144 HNA-2 (2) rs1230516223 SEQ ID NO: SEQ ID NO: SEQ ID NO: 145 146 147 HNA-3 (1) rs147820753 SEQ ID NO: SEQ ID NO: SEQ ID NO: 148 149 150 HNA-3 (2) rs2288904 SEQ ID NO: SEQ ID NO: SEQ ID NO: 151 152 153 HNA-4 rs1l43679 SEQ ID NO: SEQ ID NO: SEQ ID NO: 154 155 156 HNA-5 rs2230433 SEQ ID NO: SEQ ID NO: SEQ ID NO: 157 158 159
[0065] 3. Detection Steps
[0066] 1) PCR Amplification
[0067] All amplification primer combinations shown in Table 12 are used to be added to each amplification test tube (including forward primers and reverse primers), and genes to be detected obtained in Step 1 are amplified by multiplex PCR to obtain target sequence amplification products of samples to be detected.
[0068] A PCR amplification reaction system is shown in Table 12.
TABLE-US-00012 TABLE 12 Multiplex PCR amplification reaction system Components Volume (μL) Water, HPLC grade 0.8 10 x PCR Buffer with 20 mM MgCl.sub.2 0.5 25 mM MgCl.sub.2 0.4 25 mMdNTP Mix (dNTP mix) 0.1 0.5 to 5 uM Primer Mix (primer 1 combination) 5 U/μl PCR Enzyme (PCR polymerase) 0.2 5 to 20 ng/μL DNA (DNA to be 2 detected) Total volume 5
[0069] Cycle conditions of PCR amplification reaction are as follows: (97° C., 5 minutes, 15 cycles, decreasing by 0.8° C. each cycle): (97° C., 30 seconds, 65° C. (decreasing by 0.8° C. each cycle from a second cycle), 45 seconds, 15 cycles); 72° C., 2 minutes; (97° C., 30 seconds, 53° C., 45 seconds, 72° C., 2 minutes, 32 cycles); 72° C., 7 minutes; keeping a temperature of 4° C.
[0070] 2) Treatment with a Shrimp Alkaline Phosphatase (SAP)
[0071] Remaining dNTPs are treated by the shrimp alkaline phosphatase (SAP) to prevent interference with subsequent base extension. An SAP premixed solution system is shown in Table 13.
TABLE-US-00013 TABLE 13 SAP premixed solution system Components Volume (μL) Nanopure Water, Autoclaved (ultrapure 1.53 water) SAP Buffer 0.17 SAP Enzyme (1.7 U/ul) (shrimp alkaline 0.30 phosphatase) Total volume 2
[0072] In Step 1), 2 μl of an SAP premixed solution is added to each reaction well of the 2 test tubes after PCR amplification, a total volume after the mixed solution is added is 7 and then SAP reaction is conducted in an amplification instrument. Reaction programs are as follows: 37° C., 40 minutes; 85° C., 5 minutes; keeping a temperature of 4° C.
[0073] 3) Base Extension
[0074] All extension primer combinations shown in Table 12 are used to be added to test tubes respectively, and purified products in Step 2) are amplified by single-base extension. Through this amplification, a sequence-specific single base is extended at a 3′ end of an extension probe as a molecular weight marker. A single-base extension premixed solution system is shown in Table 14.
TABLE-US-00014 TABLE 14 Single-base extension premixed solution system Components Volume (μL) Nanopure Water, Autoclaved (ultrapure 0.619 water) 0.200 iPLEX Buffer (extension buffer) iPLEX Termination Mix (extension 0.200 termination mix) Extend Primer Mix (extension primer 0.94 combination) iPLEX Enzyme (single-base extension 0.041 reaction enzyme) Total volume 2
[0075] In Step 2), 2 μl of an extension premixed solution is added to each test tube after treatment with the shrimp alkaline phosphatase (SAP), a total volume after the mixed solution is added is 9 and then extension reaction is conducted in an amplification instrument.
[0076] Single-base extension reaction programs are as follows: 95° C., 30 seconds; (95° C., 5 seconds; (52° C., 5 seconds, 80° C., 5 seconds; 5 cycles) 40 cycles); 72° C., 3 minutes; keeping a temperature of 4° C.
[0077] 4) Desalination with Resin
[0078] 41 μl of HPLC water is added to each tube, resin is used for sample desalination, and extension reaction products are purified.
[0079] 5) Mass Spectrometry Detection
[0080] After 2 test tubes of final desalination and purification, samples are subjected to sample application onto a chip (Manufacturer: Agena Bioscience, Model: SpectroCHIP CPM96). Molecular weight detection is performed by a mass spectrometer to determine the species of specific bases and the type of samples to be detected.
[0081] 6) Result Analysis
[0082] Mass spectrometry detection is performed on the 400 cases of samples, and all sites have good results in all the samples (mass spectrometry software is rated A (Conservative) or B (Mordarate)). An obtained representative detection mass spectrogram is shown in
Sensitivity=true positive results/(true positive results+false negative results)*100%=100%.
Specificity=the number of true negatives/(the number of true negatives+the number of false positives)*100%=100%.
TABLE-US-00015 TABLE 15 Table for statistics of sequencing verification results Genes Genotyping results HPA-1 HPA-1aa HPA-1ab HPA-1bb 32 2 0 HPA-2 HPA-2aa HPA-2ab HPA-2bb 33 1 0 HPA-3 HPA-3aa HPA-3ab HPA-3bb 13 16 5 HPA-4 HPA-4aa HPA-4ab HPA-4bb 33 1 0 HPA-5 HPA-5aa HPA-5ab HPA-5bb 32 2 0 HPA-6w HPA-6aa HPA-6ab HPA-6bb 29 4 0 HPA-7w HPA-7aa HPA-7ab HPA-7bb 34 0 0 HPA-8w HPA-8aa HPA-8ab HPA-8bb 34 0 0 HPA-9w HPA-9aa HPA-9ab HPA-9bb 34 0 0 HPA-10w HPA-10aa HPA-10ab HPA-10bb 34 0 0 HPA-11w HPA-11aa HPA-11ab HPA-11bb 34 0 0 HPA-12w HPA-12aa HPA-12ab HPA-12bb 34 0 0 HPA-13w HPA-13aa HPA-13ab HPA-13bb 34 0 0 HPA-14w HPA-14aa HPA-14ab HPA-14bb 34 0 0 HPA-15 HPA-15aa HPA-15ab HPA-15bb 8 20 6 HPA-16w HPA-16aa HPA-16ab HPA-16bb 34 0 0 HPA-17w HPA-17aa HPA-17ab HPA-17bb 34 0 0 HPA-18w HPA-18aa HPA-18ab HPA-18bb 34 0 0 HPA-19w HPA-19aa HPA-19ab HPA-19bb 34 0 0 HPA-20w HPA-20aa HPA-20ab HPA-20bb 34 0 0 HPA-21w HPA-21aa HPA-21ab HPA-21bb 31 3 0 HPA-22w HPA-22aa HPA-22ab HPA-22bb 34 0 0 HPA-23w HPA-23aa HPA-23ab HPA-23bb 34 0 0 HPA-24w HPA-24aa HPA-24ab HPA-24bb 34 0 0 HPA-25w HPA-25aa HPA-25ab HPA-25bb 34 0 0 HPA-26w HPA-26aa HPA-26ab HPA-26bb 34 0 0 HPA-27w HPA-27aa HPA-27ab HPA-27bb 34 0 0 HPA-28w HPA-28aa HPA-28ab HPA-28bb 34 0 0 HPA-29w HPA-29aa HPA-29ab HPA-29bb 34 0 0 HPA-30w HPA-30aa HPA-30ab HPA-30bb 34 0 0 HPA-31w HPA-31aa HPA-31ab HPA-31bb 34 0 0 HPA-32w HPA-32aa HPA-32ab HPA-32bb 34 0 0 HPA-33w HPA-33aa HPA-33ab HPA-33bb 34 0 0 HPA-34w HPA-34aa HPA-34ab HPA-34bb 34 0 0 HPA-35w HPA-35aa HPA-35ab HPA-35bb 34 0 0 HNA-1 HNA-1a HNA-1ab HNA-1bc HNA-1abc HNA-1b 7 23 0 0 6 HNA-2 HNA-2 HNA-2 null 34 0 HNA-3 HNA-3a HNA-3ab HNA-3b 12 17 5 HNA-4 HNA-4a HNA-4ab HNA-4b 34 0 0 HNA-5 HNA-5a HNA-5ab HNA-5b 26 7 1 CD36 CD36+ CD36het CD36− 28 6 0
Embodiment 2 Exploration of Mass Spectrometry PCR Conditions for Platelet-Specific Antigen HPA12w
[0083] HPA-12w is located on a GP1Bbeta gene (NM_000407), and is not on the same gene as other HPA systems. Its SNP site is located at rs375285857, and on a fragment of about 1,000 bp before and after 500 bp and is rich in GC (>75%). In a process of designing a mass spectrometer chip for HPA-1-35, existing primer sequences do not work well for first-step amplification of HPA-12w. This embodiment is optimized by the following steps: (1) available primers for monoplex PCR are screened; (2) PCR conditions are changed (a Touchdown annealing temperature is used); (3) primer concentrations in multiplex PCR reaction are explored and optimized, HPA-12w is successfully introduced into a platelet group panel (gene combination), and conversion efficiency thereof is greater than 70%.
[0084] (1) Screening of Available Primers
[0085] In this embodiment, three pairs of primers shown in Table 16 are used, of which one pair cannot be amplified in monoplex PCR reaction (the primers are subjected to PCR reaction singly), and the other two pairs have products in monoplex PCR reaction of some samples, but they cannot be amplified in multiplex PCR reaction.
TABLE-US-00016 TABLE 16 List for screening of available primers for monoplex PCR Serial number Forward primers Reverse primers Amplification results 1 ACGTTGGATGAGCTTAC ACGTTGGATGTTGTGTCG They cannot be amplified in TGCTCCTGCTG ACAGGGAAGGC monoplex PCR reaction (results (SEQ ID NO: 160) (SEQ ID NO: 161) shown) 2 ACGTTGGATGAGCTTAC ACGTTGGATGGTTGTGTC There are products in monoplex TGCTCCTGCTGCT GACAGGGAAGG reaction, but they cannot be (SEQ ID NO: 162) (SEQ ID NO: 163) amplified in multiplex reaction (FIG. 2) 3 ACGTTGGATGAGCTTAC ACGTTGGATGTTGTGTCG They can be successfully TGCTCCTGCTGCT ACAGGGAAGGC amplified and introduced into (SEQ ID NO: 64) (SEQ ID NO: 65) the platelet group panel (FIG. 3) Note: primers involved in multiplex reaction here include primer pairs for 35 genetic sites on platelet-specific antigens. For example, when primers for other sites in Table 2 are combined, compared with the above three pairs of primers, the primers with serial number 3 can participate in multiplex amplification, and it can be successful.
[0086] It can be seen from Table 16 that the use of different amplification primers has a significant impact on the amplification effect of HPA12w during multiplex PCR reaction, so it is preferred to use the third group of amplification primers, so that HPA12w can be successfully introduced into a platelet group amplification system. Primer design is particularly important when multiplex amplification is used.
[0087] (2) Change of PCR Conditions (Using a Touchdown Annealing Temperature)
[0088] In this embodiment, three annealing temperatures shown in Table 17 are respectively used for multiplex PCR (35-plex amplification), to examine the influence of different annealing temperatures on detection results of HPA12w.
TABLE-US-00017 TABLE 17 Influence of different annealing temperatures Serial Annealing number temperature (° C.) Amplification results 1 72-64 Low conversion efficiency (20% to 51%) 2 70-62 General conversion efficiency (28% to 65%) 3 68-60 Highest conversion efficiency (70% to 95%)
[0089] It can be seen from Table 17 that different annealing temperatures have a great impact on the conversion efficiency during multiplex PCR (35-plex amplification) reaction by using the above primer groups, and when the annealing temperature is too high, the conversion efficiency will be significantly reduced, therefore, a preferred annealing temperature is 68° C. to 60° C. in a process of designing a mass spectrometer chip for HPA1-35.
[0090] (3) Exploring and Optimizing of Amplification Primer Concentrations of an rs375285857 Site in Multiplex PCR Reaction
[0091] When the multiplex PCR reaction (35-plex amplification) is performed according to the method shown in Embodiment 1, primer concentrations shown in Table 19 are respectively used for multiplex PCR amplification results. The primer concentrations mentioned here refer to final combinations of all primer combinations, in which, a final concentration of each primer is also 0.1 to 1 μM, as shown in Table 18.
TABLE-US-00018 TABLE 18 Influence of different primer concentrations Serial Primer concentration number (μM) Amplification results 1 0.1 General conversion efficiency (68% to 85%) 2 0.2-0.3 High conversion efficiency without affecting other sites (72% to 98%) 3 0.3-0.5 High conversion efficiency (75% to 97%) but affecting other sites, making HPA-5 or HPA-15 undetectable in some samples 4 0.5-0.7 High conversion efficiency (82% to 98%) but affecting other sites, making HPA-5 or HPA-15 undetectable in some samples
[0092] It can be seen from Table 18 that different primer concentrations also have a significant impact on the multiplex PCR amplification reaction, when the primer concentration increases, although the conversion efficiency will also be improved, it will cause mutual influence between detection of different sites, resulting in that some sites cannot be detected, so a preferred primer concentration is 0.1 to 0.3 μM.
Embodiment 3 Exploration of Mass Spectrometry PCR Conditions for Neutrophil Antigen HNA-1
[0093] In a mass spectrometry kit, HNA-1 genotyping is determined by two SNP sites, namely rs5030738 and rs448740. Among them, rs448740 is located on an FCGR3B gene, and has a homologous gene FCGR3A, and a sequence thereof has a very high homology (˜98%) with a sequence around rs448740. Therefore, rs448740 site amplification primers (V1) in existing mass spectrometry panel are non-specific (homologous sequences can be amplified), resulting in an error in a final typing result of mass spectrometry. In order to specifically amplify a fragment containing the rs448740 site and enable the fragment to be used for subsequent mass spectrometry steps, appropriate PCR primers need to be selected.
[0094] This embodiment adopts the following ways: (1) multiple random samples are selected, longer fragments containing rs448740 are amplified and sequencing is conducted to obtain accurate bases of the rs448740 site; (2) multiple PCR primers are designed, the above samples are used for test, and primers that can specifically amplify bands are selected; (3) the primers obtained in (2) are tested, primers with higher conversion efficiency after subsequent mass spectrometry steps are selected, and their concentrations in multiplex mass spectrometry are optimized. The selected primers can specifically amplify the fragment where rs448740 is located. Mass spectrometry typing results are completely consistent with sequencing typing results, and the conversion efficiency is greater than 70%.
[0095] (1) Screening of Available Primers
[0096] Primers selected in this embodiment are shown in Table 19. Different primers are respectively used for multiple PCR reaction (8 plexes), to examine an amplification effect of the rs448740 site.
TABLE-US-00019 TABLE 19 List for screened primers Serial number Forward primers Reverse primers Amplification results 1 ACGTTGGATGCCTGTACTC ACGTTGGATGCtTGGGAATG They cannot be amplified TCCACTGTCGTT GCAGTGTAGA (SEQ ID NO: 164) (SEQ ID NO: 165) 2 ACGTTGGATGCCTGTACTC ACGTTGGATGAAGCACGCTG They cannot be amplified or TCCACTGTCGTT TACCATTGAG they are non-specifically (SEQ ID NO: 166) (SEQ ID NO: 167) amplified. 3 ACGTTGGATGCCTGTACTC ACGTTGGATGCTCAATGGTA They are non-specifically TCCACTGTCGTT CAGCGTGCTT amplified. (FIG. 4) (SEQ ID NO: 168) (SEQ ID NO: 169) 4 ACGTTGGATGTTGTCTGGC ACGTTGGATGCCCCTACTCA The fragment where rs448740 ACCTGTACTCT ATATTTGATTTAC is located is specifically (SEQ ID NO: 118) (SEQ ID NO: 119) amplified (FIG. 5)
[0097] It can be seen from Table 19 that the use of different amplification primers has a significant impact on the amplification effect of the rs448740 site during multiplex PCR reaction (8 plexes). When a first group of primers is used, the rs448740 site (8 plexes) cannot be amplified during genotyping detection of 8 sites of neutrophil antigens. When a second group of primers is used, sometimes they cannot be amplified, and sometimes they are non-specifically amplified, that is, a homologous gene FCGR3A is amplified simultaneously. When a third group of primers is used, there is also a problem of non-specific amplification. Only when a fourth group of primers is used, specific amplification can be successfully achieved. Therefore, it is preferable to use the fourth group of amplification primers, so that the rs448740 site can be successfully introduced into the neutrophil panel.
[0098] (2) Exploring and Optimizing of Amplification Primer Concentrations of the rs448740 Site in Multiplex PCR Reaction
[0099] When the multiplex PCR reaction is performed according to the method shown in Embodiment 1, primer concentrations shown in Table 19 are respectively used for multiplex PCR amplification results, as shown in Table 20.
TABLE-US-00020 TABLE 20 Influence of different primer concentrations Serial number Primer concentration (μM) Amplification results 1 0.2 General conversion efficiency (70% to 85%) 2 0.4 High conversion efficiency (72% to 96%) without affecting other sites 3 0.6 High conversion efficiency (78% to 96%) but affecting other sites, making HNA-2 (rs777225032), HPA-5 and HPA-12 undetectable in some samples
[0100] It can be seen from Table 20 that different primer concentrations also have a significant impact on the multiplex PCR amplification reaction, when the primer concentration increases, although the conversion efficiency will also be improved, it will cause mutual influence between detection of different sites, resulting in that HNA-2 (rs777225032), HPA-5 and HPA-12 cannot be detected in some samples, so a preferred primer concentration is 0.2 to 0.4 μM.
Embodiment 4 Overall Condition Optimization
[0101] In this embodiment, the primers and primer concentrations obtained by exploration in Embodiment 3 are used for experiments, and it is found that there are 3 sites, namely HPA-5 (rs1801106), HPA-15 (rs10455097), and CD36 (1) (rs550565800) with reduced efficiency or even no peaks. In order to stabilize peak appearance at all sites of the entire panel, no call is eliminated. This embodiment adopts the following ways: (1) two new PCR primer pairs (new1 and new2) are designed for the three sites respectively, and tested to select appropriate primer combinations; (2) PCR conditions are changed according to the characteristics of annealing temperatures of primers to select optimal amplification conditions; (3) a large number of samples are verified.
[0102] (1) Screening of available primers for monoplex PCR
[0103] In this embodiment, 9 pairs of primers shown in Table 15 are used for three combinations (shown in Table 22), to examine an amplification effect on an overall site.
TABLE-US-00021 TABLE 21 selected primer sequences (5′-3′) Sites Primer old Primer new 1 Primer new2 rs1801106 Forward ACGTTGGATGGG ACGTTGGATGAGACG ACGTTGGATGGAAGG AAGAGTCTACCT TGCTCTTGGTAGGTG AAGAGTCTACCTGTTT GTTTAC (SEQ ID (SEQ ID NO: 43) AC (SEQ ID NO: 171) NO: 170) Reverse ACGTTGGATGGTA ACGTTGGATGCCAAA ACGTTGGATGGAAATG AACCATACTATCT TGCAAGTTAAATTAC TAAACCATACTATCTGT GTGC (SEQ ID NO: CAGT GC (SEQ ID NO: 173) 172) (SEQ ID NO: 44) rs10455097 Forward ACGTTGGATGCA ACGTTGGATGTCAGT ACGTTGGATGTTATTTC AAATGTATCAGTT TCTTGGTTTTGTGATG AAAATGTATCAGTTCT CTTGG (SEQ ID TT TGG (SEQ ID NO: 175) NO: 174) (SEQ ID NO: 73) Reverse ACGTTGGATGAG ACGTTGGATGCACAA ACGTTGGATGAGCCAC CCACCCAAGAAG AACCAGTAGCCACCC CCTGATAG (SEQ ID TGATAG (SEQ ID (SEQ ID NO: 74) NO: 177) NO: 176) rs550565800 Forward ACGTTGGATGCA ACGTTGGATGGGAAC ACGTTGGATGAATTAG GCTGCAAATACA AAAATCAAATTAGCA CAACAGCAACTAATTT AACCTC (SEQ ID ACAGC ATG (SEQ ID NO: 179) NO: 178) (SEQ ID NO: 1) Reverse ACGTTGGATGGC ACGTTGGATGTTTTAA ACGTTGGATGACAGCT AACAGCAACTAA TGACTAACAGCTGCA GCAAATACAAACCTC TTTATG (SEQ ID AA (SEQ ID NO: 181) NO: 180) (SEQ ID NO: 2)
TABLE-US-00022 TABLE 22 Influence of different primer pairs Sites Serial numbers of primer pairs included in primer combinations rs1801106 old new1 new2 rs10455097 old new1 new2 rs550565800 old new1 new2 Amplification Three sites cannot Three sites can be successfully rs10455097 is results be successfully detected and introduced into a successfully detected, detected (FIGS. 7, platelet group panel (FIGS. 10, and the remaining 8 and 9) 11 and 12) two sites cannot be successfully detected
[0104] It can be seen from Tables 21 and 22 that the use of different primer pair combinations has a significant impact on detection results of each site. Only when the primer pair combination of new1 is used, three sites of HPA-5 (rs1801106), (rs10455097), and CD36 (1) (rs550565800) can be successfully detected when 53 sites of the entire panel are detected simultaneously, and simultaneous detection of the overall 53 sites can be successfully carried out.
[0105] (2) Change of PCR conditions (using a Touchdown annealing temperature)
[0106] In this embodiment, three annealing temperatures shown in Table 18 are respectively used for PCR, to examine effects of different annealing temperatures on the amplification and detection results of the overall site.
TABLE-US-00023 TABLE 23 Influence of different annealing temperatures Serial Annealing number temperature (° C.) Amplification results 1 68-60 Low conversion efficiency (52% to 85%) 2 68-56 General conversion efficiency (65% to 90%) 3 65-53 Highest conversion efficiency (75% to 98%)
[0107] It can be seen from Table 23 that when the overall 53 sites are detected, the influence of annealing temperatures is examined again, and it is found that different annealing temperatures still have a great impact on the conversion efficiency of the entire panel during multiple PCR reaction, and the previously determined annealing temperature of 68° C. to 60° C. is still too high, resulting in low conversion efficiency. Therefore, a preferred annealing temperature is 65 to 53° C. in a process of designing a mass spectrometer chip for the entire panel.
[0108] (3) Through overall screening and optimization, and by verifying the 53 sites of the entire panel in Embodiment 1 in 400 samples, stable results are obtained, and both detection sensitivity and specificity are very good.
[0109] Although the present invention is disclosed above, the present invention is not limited thereto. Any person skilled in the art can make various changes and amendments without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention shall be based on the scope defined by the claims.