Thermoresponsive Microcarrier System and Uses Thereof
20200149001 ยท 2020-05-14
Inventors
- Jackie Y. Ying (Singapore, SG)
- Leng Leng Chng (Singapore, SG)
- Daniele Zink (Singapore, SG)
- Aysha Farwin (Singapore, SG)
Cpc classification
C08F222/385
CHEMISTRY; METALLURGY
C12N2500/90
CHEMISTRY; METALLURGY
C08F222/385
CHEMISTRY; METALLURGY
C08F2810/50
CHEMISTRY; METALLURGY
C08F220/54
CHEMISTRY; METALLURGY
C08F293/005
CHEMISTRY; METALLURGY
C08F220/60
CHEMISTRY; METALLURGY
C08F220/34
CHEMISTRY; METALLURGY
C12N2539/10
CHEMISTRY; METALLURGY
C08F220/60
CHEMISTRY; METALLURGY
C08F2810/20
CHEMISTRY; METALLURGY
C08F220/06
CHEMISTRY; METALLURGY
C08F220/34
CHEMISTRY; METALLURGY
C08G73/06
CHEMISTRY; METALLURGY
C08F220/06
CHEMISTRY; METALLURGY
C08F220/54
CHEMISTRY; METALLURGY
International classification
C12N5/00
CHEMISTRY; METALLURGY
C08L53/00
CHEMISTRY; METALLURGY
C08F293/00
CHEMISTRY; METALLURGY
Abstract
There is provided a polymeric microsphere comprising a thermally responsive monomer crosslinked with a functional group monomer, wherein the functional group monomer comprises at least one of a carboxylic acid functional group or an amine functional group. The thermally responsive monomer is preferably N-isopropylacrylamide (NIPAM), and the microspheres preferably comprise a coating of polymerized catecholamines (e.g. DOPA). There is also provided a method of preparing the polymeric microsphere and uses of the polymeric microsphere in culturing, harvesting, or expanding stem cells or stromal cells. Preferably, the cells, e.g. hMSCs (human mesenchymal stem/stromal cells), are expanded or harvested in serum-free and xeno-free medium.
Claims
1. A polymeric microsphere comprising a thermally responsive monomer crosslinked with a functional group monomer, wherein the functional group monomer comprises at least one of a carboxylic acid functional group or an amine functional group.
2. The polymeric microsphere of claim 1, wherein the thermally responsive monomer is selected from the group consisting of N-isopropylacrylamide, N,N-diethylacrylamide, 2-(dimethylamino)ethyl methacrylate, N,N-dimethylacrylamide, acrylamide, 2-(diethylamino)ethyl acrylate, 2-(acryloyloxyethyl) trimethylammonium chloride, poly(vinylcaprolactame), polyvinyl methyl ether, poly(hydroxyethylmethacrylate), 4-hydroxybutyl acrylate, 2-hydroxyethyl methacrylate, 3-hydroxypropyl methacrylate, 2-carboxyethyl acrylate, 2-carboxyethyl acrylate oligomers, and poly(ethylene glycol) methacrylate.
3. The polymeric microsphere of claim 1, wherein the carboxylic acid functional group monomer is selected from the group consisting of methacrylic acid, acrylic acid, and 2-carboxyethyl acrylate.
4. The polymeric microsphere of claim 1, wherein the amine functional group monomer is selected from the group consisting of primary amine, secondary amine, tertiary amine, and quaternary amine.
5. The polymeric microsphere of claim 1, wherein the amine functional group monomer is selected from the group consisting of 2-aminoethyl methacrylate hydrochloride, N-[3-(dimethylamino)propyl]methacrylamide, 3-acrylamidopropyl)trimethylammonium chloride, 3-aminopropyl methacrylate hydrochloride, N-(3-aminopropyl)methacrylamide hydrochloride, (2-boc-amino)ethyl methacrylate, 2-(tert-butylamino)ethyl methacrylate, 2-(dimethylamino)ethyl methacrylate, 2-(diethylamino)ethyl acrylate, 3-(dimethylamino)propyl acrylate, 2-(diethylamino)ethyl methacrylate, 2-(diisopropylamino)ethyl methacrylate, 2-(dimethylamino)ethyl acrylate, [3-(methacryloylamino)propyl]-trimethylammonium chloride, [2-(acryloyloxy)ethyl]trimethylammonium chloride, and [2-(methacryloyloxy)ethyl]trimethylammonium chloride.
6. The polymeric microsphere of claim 1, wherein the thermally responsive monomer is crosslinked with the functional group monomer by a crosslinker comprising N,N-methylenebis(acrylamide).
7. The polymeric microsphere of claim 1, wherein the microsphere further comprises a polymer coating.
8. The polymeric microsphere of claim 7, wherein the polymer coating is selected from the group consisting of polymerized catecholamines, dopamine, L-3,4-dihydroxyphenylalanine, epinephrine.sub.., and norepinephrine.
9. The polymeric microsphere of claim 1, wherein the microcarrier has a particle size in the range of 100 m to 200 m.
10. The polymeric microsphere of claim 9, wherein the particle size is in the range of 125 m to 177 m.
11. The polymeric microsphere of claim 1, wherein the particle size of the polymeric microsphere increases in the range of more than 1-fold to 300-fold of the original polymeric microsphere when the polymeric microsphere is subjected to a reduced temperature.
12. The polymeric microsphere of claim 1, wherein the microsphere has a hydrophilic surface when the microsphere is subjected to a reduced temperature.
13. A method of preparing a polymeric microsphere comprising a thermally responsive monomer crosslinked with a functional group monomer, wherein the functional group monomer comprises at least one of a carboxylic acid functional group or an amine functional group, wherein the method comprises the steps of: i. providing a microemulsion mixture of the thermally responsive monomer, the functional group monomer and the cross-linker stirring at a temperature for a period of time; and ii. polymerizing said microemulsion mixture with an initiator stirring at the temperature for a period of time to thereby synthesize said polymeric microsphere.
14. The method of claim 13, wherein the temperature is room temperature, and the initiator is ammonium persulfate and/or N,N,N,N-tetramethylethylenediamine.
15. The method of claim 13, wherein the temperature is in the range of 50 C. to 70 C., and the initiator is 2,2-azobis[2-(2-imidazolin-2-yl)propane]dihydrochloride.
16.-18. (canceled)
19. A method of culturing stem cells or stromal cells comprising the step of cultivating the stem cells or stromal cells on a surface coated on a polymeric microsphere, wherein said polymeric microsphere comprises a thermally responsive monomer crosslinked with a functional group monomer, and wherein the functional group monomer comprises at least one of a carboxylic acid functional group or an amine functional group.
20.-21. (canceled)
22. The method of claim 19, wherein the method is undertaken in a serum-free condition.
23. The method of claim 19, wherein the method is undertaken in a xeno-free condition.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0070] The accompanying drawings illustrate a disclosed embodiment and serves to explain the principles of the disclosed embodiment. It is to be understood, however, that the drawings are designed for purposes of illustration only, and not as a definition of the limits of the invention.
[0071]
[0072] [
[0073]
[0074] [
[0075]
[0076] [
[0077]
[0078] [
[0079]
[0080] [
[0081]
[0082] [
[0083]
[0084] [
[0085]
[0086] [
[0087]
[0088] [
[0089]
[0090] [
[0091]
[0092] [
[0093]
[0094] [
[0095]
[0096] [
[0097]
[0098] [
[0099]
[0100] [
[0101]
[0102] [
DETAILED DESCRIPTION OF DRAWINGS
[0103] Referring to
EXAMPLES
[0104] Non-limiting examples of the invention will be further described in greater detail by reference to specific Examples, which should not be construed as in any way limiting the scope of the invention.
Materials and Methods
[0105] All reagents for microcarrier synthesis and the stains for the differentiation procedures were purchased from commercial sources; Sigma Aldrich (St. Louis, Mo., United States), Merck Millipore (Bayswater, Victoria, Australia), 1st BASE (Selangor, Malaysia) and Wako Pure Chemical Industries, Ltd. (Tokyo, Japan) and used as received.
Microcarrier Characterization
[0106] X-ray photoelectron spectroscopy (XPS) analysis was conducted on a VG ESCALAB MKII spectrometer. Fourier transform infrared (FT-IR) spectra were recorded on a Digilab FTS 7000 series spectrometer equipped with a MTEC-300 photoacoustic detector. Thermogravimetric analyses (TGA) were performed on a Perkin Elmer Pyris 1 thermogravimetric analyzer. The samples were heated at 10 C. min.sup.1 from 25 C. to 700 C. using air for the carrying gas and N.sub.2 for the protective gas.
Determination of Thermal-Induced Microcarrier Changes
[0107] Microcarriers were suspended in water or cell culture medium, and imaged by light microscopy at 37 C. and after reducing the temperature to room temperature. The diameters of the microcarriers were measured from the micrographs by using Image J software. Based on the measured microcarrier diameters, their volumes and surface areas were calculated (see Example 3 for the details).
Initial Expansion and Pooling of hMSCs
[0108] Passage 1 (P1) bone marrow hMSCs (cat-no. AH005-F) from different donors were purchased from DV Biologics (Costa Mesa, California, USA). hMSCs were expanded in MSC NutriStem XF complete medium (Biological Industries, Kibbutz Beit Haemek, Israel) containing MSC NutriStem XF Supplement Mix (Biological Industries, Kibbutz Beit Haemek, Israel) and penicillin-streptomycin. All components of this complete serum-free medium were defined and from non-xenogenic origin. This medium was used for all experiments, unless otherwise indicated. hMSCs were expanded until P2 in T75 flasks coated with MSC attachment solution (Biological Industries, Kibbutz Beit Haemek, Israel), and harvested with recombinant trypsin (Biological Industries, Kibbutz Beit Haemek, Israel) at about 90% confluency. P2 hMSCs from three different donors were pooled and cryopreserved; such pooled cells were used in all subsequent experiments.
hMSC Cultivation on Thermoresponsive Microcarriers
[0109] Prior to cell seeding, thermoresponsive microcarriers were washed with phosphate buffered saline (PBS) and equilibrated with MSC NutriStem XF complete medium for 1 hour. The microcarriers were then added to 24-well ultra-low attachment plates (Corning, N.Y., USA), and the microcarrier surface area was adjusted to 1.0 cm.sup.2 per well. Pooled hMSCs were seeded onto the different thermoresponsive microcarriers at a density of 5000 cells cm.sup.2, and the final volume of MSC NutriStem XF complete medium was adjusted to 800 L per well. The plates were transferred to a shaker 2 hour after cell seeding, and shaking was performed consistently throughout cultivation at 30 rpm. For removal of non-attached cells, the microcarriers were allowed to settle after 24 hours, and 600 L of medium were removed from each well and replenished with fresh medium three times. Subsequent medium changes were performed every two days by exchanging 600 L of medium per well for fresh MSC NutriStem XF complete medium. The viability of hMSCs attached to thermoresponsive microcarriers was evaluated by staining the cells with LIVE/DEAD Viability/Cytotoxicity Assay Kit (Molecular Probes, Eugene, Oreg.). The numbers of microcarriers remained unchanged during cultivation periods of 7 days or less.
Scalable Expansion
[0110] AM-3.8 (control) and AM-3.8-LDP microcarriers were prepared as defined herein, and irradiated with UV light overnight before use. The microcarriers were added to 24-well ultra-low attachment plates (microcarrier surface area =1 cm.sup.2 per well, which corresponded to 1 mg of microcarriers per well). Freshly thawed cryopreserved cells were seeded at a density of 5000 cells per well. MSC NutriStem XF medium was used for cultivation with shaking, and non-attached cells were removed as described earlier. Medium was exchanged every 2 days. Cell cultures were expanded by bead-to-bead transfer and fresh microcarriers were added at intervals of 4 days. 0.5 mg per well of fresh microcarriers (i.e. 50% of the original amount) was each added on day 4 and day 8. Thus, 2 mg of microcarriers per well was present from day 8 onwards. These were transferred on day 12 to a 6-well ultra-low attachment plate in order to avoid overcrowding. 2 mg of fresh microcarriers per well was added after transfer, which resulted in a total microcarrier amount of 4 mg per well (6-well plate) on day 12. 2 mg of microcarriers per well was each added on day 16 and day 20. This resulted in a total microcarrier amount of 8 mg per well from day 20 onwards. Although this expansion process was theoretically not limited, no further beads were added after day 20, and the cells were harvested after this time point for further analyses. To determine cell numbers during the expansion period, cells from parallel cultures were harvested every 4 days by trypsinization or cold treatment, as described below. Four replicates were analyzed per time point for each type of microcarriers.
Determination of Cell Numbers and Cell Yield at 20 C.
[0111] To determine cell numbers, the microcarriers were washed three times with PBS and then treated with recombinant trypsin (Biological Industries, Kibbutz Beit Haemek, Israel) for 30 minutes at 37 C. at 300 rpm on a thermomixer (Eppendorf, Hamburg, Germany). Total cell numbers and the numbers of viable cells were determined with a ViCell XR cell counter (Beckman Coulter, California, USA). All calculations were based on the number of viable cells.
[0112] When thermally induced cell detachment was evaluated, the cell numbers were always determined in parallel by enzymatic detachment as described herein. For thermal-induced cell detachment, the microcarriers were washed three times with PBS, and then incubated in cell culture medium at 20 C. for 120 minutes at 300 rpm on a thermomixer (Eppendorf, Hamburg, Germany). Total cell numbers and the number of viable cells were determined with a ViCell XR cell counter. The cell yield at 20 C. was calculated in the following way: cell yield (%)=[(number of viable cells obtained at 20 C.)/(number of viable cells obtained by trypsinization)]100%.
Determination of Cell Morphology After Re-Plating
[0113] hMSCs harvested from AM-3.8 and AM-3.8-LDP microcarriers by trypsinization or thermal detachment were reseeded onto 24-well tissue culture plates coated with MSC attachment solution at a density of 2000 cells cm.sup.2. After incubation for 24 hours, the cells were fixed with 3.7% formaldehyde/PBS for 10 minutes, and immunostained with an antibody against vimentin or stained with rhodamine phalloidin (Life Technologies, Carlsbad, Calif., USA). Nuclei were stained with 4,6-diamidino-2-phenylindole (DAPI). To determine the percentage of rounded cells, 10 images from each experiment were analyzed using ImageJ software.
Colony-Forming Unit-Fibroblast (CFU-F) Assay
[0114] hMSCs harvested from AM-3.8 or AM-3.8-LDP microcarriers by thermal detachment on day 21 were resuspended at a final concentration of 150 cells mL.sup.1 in DMEM-low glucose medium (Life Technologies, Carlsbad, Calif., USA) with 10% MSC-qualified fetal bovine serum (Life Technologies, Carlsbad, Calif., USA), 2 mM L-glutamine and penicillin/streptomycin. The suspension was seeded into 35 mm dishes (1 mL per dish; 3 replicates each), and the cells were cultivated for 14 days. After staining with 0.5% crystal violet solution (Sigma Aldrich, St. Louis, Mo., USA), the colonies were imaged with a ChemiDoc XRS system (BioRad Laboratories Inc., Hercules, Calif., USA), and the number of colonies was determined by using the Quantity One 1-D analysis software (BioRad Laboratories Inc., Hercules, Calif., USA).
Immunophenotyping
[0115] hMSCs were expanded by bead-to-bead transfer with AM-3.8 and AM-3.8-LDP microcarriers as described herein. Cells were harvested from parallel cultures (4 replicates each) on day 21 after a temperature shift. For immunostaining, detached cells were re-seeded onto 24-well plates coated with MSC attachment solution (Biological Industries, Kibbutz Beit Haemek, Israel). The cells were grown to confluency and then fixed with 3.7% formaldehyde/PBS for 1 hour. Subsequently, the cells were washed and stained with antibodies specific for CD44, CD14 and CD19 from Merck Millipore (Billerica, Mass., USA) Human Mesenchymal Stem Cell Characterization Kit following manufacturer's instructions.
[0116] Fluorescence-activated cell sorting (FACS) was performed with the BD Stemflow Human hMSC Analysis Kit (BD Biosciences, Franklin Lakes, N.J., USA). hMSCs harvested by a temperature shift after 21 days of expansion were fixed with 4% paraformaldehyde/PBS for 30 minutes at room temperature, and washed with PBS. The cells were then incubated with the fluorochrome-conjugated antibodies provided in the kit for 30 minutes at room temperature. The kit contained individual fluorochrome-conjugated antibodies with respect to CD44, CD73, CD90 and CD105 (hMSC markers), and a mixture of fluorochrome-conjugated antibodies against CD11b, CD19, CD34, CD45 and HLA-DR (control for expression of non-hMSC markers). Cells were incubated with antibodies (dark grey histograms in
Osteogenic, Adipogenic and Chondrogenic Differentiation
[0117] hMSCs were harvested from AM-3.8-LDP microcarriers by thermal induction after expansion for 21 days. Following long-term expansion, hMSCs were differentiated into (
RNA Extraction and Quantitative Real-Time Reverse Transcription Polymerase Chain Reaction (qPCR)
[0118] Total RNA was extracted using RNeasy Mini Kit (Qiagen Singapore Pte Ltd, Singapore). The RNA concentration was determined using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, Mass., USA). The total RNA was subjected to DNase treatment before use. Total RNA was converted to cDNA using the SuperScript III First-Strand Synthesis System (Life Technologies, Carlsbad, Calif., USA). qPCR was performed with Bio-Rad (Hercules, Calif., USA) CFX-96 qPCR System with the following program: 95 C. for 10 minutes for 1 cycle, followed by 95 C. for 15 seconds and 60 C. for 1 minutes for 40 cycles. The melting curve program was run by performing a gradual temperature increment of 0.5 C./30 s from 40 C. to 95 C. Primer pairs used and amplicon sizes are provided in Table 1. The qPCR data were analyzed using Microsoft Office Excel 2010. All results on marker gene expression were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression levels.
TABLE-US-00001 TABLE1 MarkersusedforqPCR. Acronym/GeneID Amplicon Description PrimerPairs Size(bp) ACAN/ACANAggrecan F5ACTTCCGCTGGTCAGATGGA3 111 R5TCTCGTGCCAGATCATCACC3 CEBPA/CEBPA F5CGGCAACTCTAGTATTTAGGATAACCTT3 88 CCAAT/enhancer R5CACGATTTGCTCCCCCTACTC3 bindingprotein (C/EBP),alpha COLX/COL10A1 F5CAAGGCACCATCTCCAGGAA3 70 Collagen,typeX, R5AAAGGGTATTTGTGGCAGCATATT3 alpha1 COL1/COL1A1 F5CAGCCGCTTCACCTACAGC3 83 Collagen,type1, R5TTTTGTATTCAATCACTGTCTTGCC3 alpha1 COMP/COMP F5GGAGATCGTGCAGACAATGA3 147 Cartilageoligomeric R5GAGCTGTCCTGGTAGCCAAA3 matrixprotein FABP4/FABP4 F5TGGTGGAATGCGTCATGAAA3 70 Fattyacidbinding R5CAACGTCCCTTGGCTTATGC3 protein4, adipocyte GAPDH/GAPDH F5GAAGGTGAAGGTCGGAGT3 226 Glyceraldehyde- R5GAAGATGGTGATGGGATTTC3 3-phosphate dehydrogenase OPN/SPP1 F5GCCAGTTGCAGCCTTCTCA3 74 Secretedphosphoprotein R5AAAGCAAATCACTGCAATTCTCAT3 1,bone sialoprotein1, osteopontin OSX/SP7 F5TCCCTGCTTGAGGAGGAAGTT3 62 Sp7transcription R5CACGCTGCCGTCAGCAT3 factor,osterix PPARG/PPARG F5GAGGGCGATCTTGACAGGAA3 78 Peroxisome R5TCTCCCATCATTAAGGAATTCATG3 proliferator-activated receptorgamma RUNX2/RUNX2 F5CGTGGCCTTCAAGGTGGTA3 96 Runt-related R5-CGGAGCTCAGCAGAATAATTTTC-3 transcription factor2 SOX9/SOX9 F5AGTACCCGCACTTGCACAA3 68 SRY(sexdetermining R5CTCGTTCAGAAGTCTCCAGAGCTT3 regionY)-box9
[0119] The table lists all markers used for qPCR and their names, acronyms and gene IDs, which follow the nomenclature of the HUGO Gene Nomenclature Committee (HGNC) (http://www.genenames.org/). The primer pairs used for qPCR (F: forward, R: reverse), and amplicon sizes in base pairs (bp) are shown.
Statistical Analysis
[0120] All calculations and the unpaired t-test were performed with Microsoft Office Excel 2010. Normal distribution of the data was confirmed using SigmaStat 3.5 (Systat Software Inc., Chicago, Ill., USA). All values were expressed as meanstandard deviation (s.d.) (n=3).
Example 1
[0121] A general synthetic method using a free radical polymerization within a water-in-oil (w/o) microemulsion system was developed for the synthesis of thermoresponsive microcarriers (
Synthesis of AM-3.8, AM-3.8-50 and AM-3.8-70 Microcarriers
[0122] For synthesis of AM-3.8 microcarriers, toluene (50 g) and SPAN 85 (3.0 g) were stirred at room temperature and purged with argon for 30 minutes in a 100-mL three-necked flask equipped with a mechanical stirrer. A solution of N-isopropylacrylamide (1.297 g, 11.46 mmol), 2-aminoethyl methacrylate hydrochloride (0.079 g, 0.48 mmol), N,N-methylenebis(acrylamide) (0.10 g, 0.65 mmol) and ammonium persulfate (0.10 g, 0.44 mmol) in water (4.4 mL) was purged with argon for 5 minutes and syringed into the stirred solution of toluene/SPAN 85. The milky suspension was stirred at room temperature under argon for 15 min at 300 rpm, and N,N,N,N-tetramethylethylenediamine (0.02 mL) was added. After 5 hours of reaction at room temperature, microcarriers were collected via filtration using a 100-m nylon mesh filter. The microcarriers were washed with acetone (60 mL) and dried at room temperature under vacuum overnight (1.2 g). The product (AM-3.8 microcarrier) was fractioned by sieving through to obtain the 125 to 177 m fraction (47%).
[0123] For synthesis of AM-3.8-50 and AM-3.8-70 microcarriers, they were synthesized in similar ways as AM-3.8 microcarriers, with the exception that the feed solution contained 2,2-azobis[2-(2-imidazolin-2-yl)propane]dihydrochloride (0.10 g, 0.39 mmol) instead of ammonium persulfate and N,N,N,N-tetramethylethylenediamine. A solution of N-isopropylacrylamide, 2-aminoethyl methacrylate hydrochloride, N,N-methylenebis(acrylamide) and 2,2-azobis[2-(2-imidazolin-2-yl)propane]dihydrochloride in water was purged with argon for 5 minutes and syringed into the stirred solution of toluene/SPAN 85. The milky suspension of the feed solution in toluene/SPAN 85 was heated for 2 hours after stirring, to 50 C. and 70 C. for AM-3.8-50 and AM-3.8-70 respectively, before cooling and filtration. The yield of the 125-177 m fraction was 34% and 48% for AM-3.8-50 and AM-3.8-70 respectively.
Synthesis of MA-9.5, AP-9.5, DM-9.5, AM-9.5, AM-9.0 and AM-3.6 Microcarriers
[0124] These microcarriers were synthesized in similar ways as AM-3.8 microcarriers. In the case of MA-9.5, 1.5 g of SPAN 85 was used. The feed composition for the different microcarriers is shown in Table 2. The feed solution was adjusted to pH 9.0 (MA-9.5) or pH 2.0 (DM-9.5). The reaction time before microcarrier collection was 5 hours (AM-9.5, AM-9.0, AM-3.6), 17 hours (MA-9.5), 18 hours (AP-9.5) or 19 hours (DM-9.5). MA-9.5 microcarriers were washed with 1 N aqueous HCl overnight, before washing with deionized water and drying. The 125-177 m fraction of microcarrier particles was 20% (MA-9.5, AP-9.5, DM-9.5), 37% (AM-3.6), 40% (AM-9.0) or 60% (AM-9.5).
[0125] Four different types of thermoresponsive microcarriers (MA-9.5, AP-9.5, DM-9.5 and AM-9.5; see Table 2) with different functional groups (e.g. carboxylic acid, quaternary amine, tertiary amine or primary amine) were produced. The thermal response between 37 C. and room temperature was determined in both water and cell culture medium. Of these four types of microcarriers, the microcarrier with the primary amine functional group (AM-9.5) showed the largest percentage of volume and surface area increase (
TABLE-US-00002 TABLE 2 The feed composition, reaction temperature and catecholamines that were used for the synthesis. Feed composition (mol %) Microcarrier IPAAm MA APTACl DMAPM AMHCl MBA Temperature Coating MA-9.5 85.3 9.5 5.2 25 AP-9.5 85.3 9.5 5.2 DM-9.5 85.3 9.5 5.2 AM-9.5 85.3 9.5 5.2 AM-9.0 81.1 9.0 9.9 AM-3.6 86.6 3.6 9.8 AM-3.8 91.1 3.8 5.1 AM-3.5-50 91.1 3.8 5.1 50 AM-3.8-70 91.1 3.8 5.1 70 AM-9.5-PD 85.3 9.5 5.2 25 Dopamine AM-9.5-LDP 85.3 9.5 5.2 DOPA AM-3.8-LDP 91.1 3.8 5.1 AM-3.8-70-LDP 91.1 3.8 5.1 70
[0126] The table shows the feed composition, reaction temperature and catecholamines used for the 13 microcarriers that were synthesized and the respective coatings that were utilized.
[0127] To further increase the thermal response, the composition of the microcarrier containing the primary amine functional group was varied, which resulted in AM-9.0, AM-3.6 and AM-3.8 microcarriers (Table 2). It was found that a larger thermal response could be attained by decreasing the quantity of the primary amine functional group to 3.8 mol % and maintaining the crosslinker quantity at 5.1 mol % (Table 2 and
Example 2
Coating with Polymerized L-3,4-dihydroxyphenylalanine (DOPA) or Dopamine
[0128] To generate AM-3.8-LDP microcarriers, 0.007 g AM-3.8 microcarriers were washed four times with phosphate buffered saline (PBS). In the last wash, 0.5 mL of the PBS solution was pipetted out, and a solution of L-3,4-dihydroxyphenylalanine (DOPA) (0.5 mL, 2 mg mL.sup.1) in 10 mM Tris HCl buffer (pH 8.5) was added (final volume: 1 mL) (step 8). The microcarriers were then shaken at room temperature under air for 22 hours. The reaction mixture was removed after centrifugation at 13000 rpm for 30 seconds, and the coated microcarriers were washed with deionized water. The microcarriers were dried at room temperature under vacuum overnight.
[0129] AM-9.5-LDP and AM-3.8-70-LDP microcarriers were synthesized via a similar method with AM-9.5 and AM-3.8-70 microcarriers respectively. An overview of the polymer coated microcarriers is provided in
[0130] To generate AM-9.5-PD microcarriers, AM-9.5 microcarriers (0.020 g) were shaken in 0.5 mL dopamine hydrochloride solution (2 mg mL.sup.1 in 10 mM potassium phosphate buffer, pH 8.2) (step 6) and in a 1.5-mL centrifuge tube at room temperature under air for 20 hours. The solution reaction mixture was pipetted out (after centrifugation at 14680 rpm for 5 minutes), and the coated microcarriers were washed with deionized water and acetone. The microcarriers were dried at room temperature under vacuum overnight.
[0131] Coating with the polymerized catecholamines, dopamine and L-3,4-dihydroxyphenylalanine (DOPA), have been shown to improve the performance of various mammalian cell types on synthetic substrates. It was shown in earlier reports that coating with polymerized DOPA would allow synthetic substrates to be compatible for the large-scale expansion of human pluripotent stem cells under defined serum-free conditions. As the goal was the synthesis of thermoresponsive microcarriers that can be applied under such similar conditions, the microcarriers with large thermal responses (AM-9.5, AM-3.8 and AM-3.8-70) were coated with polymerized dopamine or DOPA (Table. 2 and
Example 3
Calculation of Microcarrier Volume and Surface Area
[0132] Microcarrier volume increase was calculated using the following equation:
where V.sub.RT and V.sub.37 C. represent the volume of the microcarrier at room temperature and 37 C., respectively, and the volume of the microcarrier was calculated using the following equation:
where d represents the diameter of the microcarrier. The percent volume increase was calculated as meanstandard deviation (S.D.) for ten microcarriers.
[0133] Microcarrier surface area increase was calculated using the following equation:
where SA.sub.RT and SA.sub.37 C. represent the surface area at room temperature and 37 C., respectively, and the microcarrier surface area was calculated using the following equation:
The percent surface area increase was calculated as mean standard deviation (S.D.) for ten microcarriers.
Example 4
Physico-Chemical Characterization of the Seven Microcarriers
[0134] Thirteen microcarriers were synthesized and only seven (7) microcarriers were chosen for further characterization and cell culture studies. AM-9.5, AM-3.8, AM-9.5-LDP, AM-3.8-LDP and AM-9.5-PD were selected based on their large thermal response in cell culture medium, and potentially improved cytocompatibility after coating with polymerized catecholamines. AM-3.8-70 and AM-3.8-70-LDP were selected as a higher degree of crosslinking might improve cell adhesion and growth.
[0135] Thermogravimetric analysis revealed that the seven selected thermoresponsive microcarriers were stable up to 100 C. (
[0136] X-ray photoelectron spectroscopy (XPS) was employed to track the changes in the surface characteristics of the microcarriers upon coating with polymerized DOPA or dopamine (
TABLE-US-00003 TABLE 3 Summary of the C 1s Area (%) for the 7 microcarriers C 1s Area (%) 284.5 eV 286.0 eV 287.6 eV Microcarrier CC CO, CN OCO, NCO AM-9.5 73.8 16.0 10.2 AM-3.8 77.3 11.9 10.8 AM-3.8-70 72.4 15.8 11.8 AM-9.5-LDP 82.0 10.0 8.0 AM-3.8-LDP 91.7 4.7 3.6 AM-3.8-70-LDP 82.4 10.2 7.4 AM-9.5-PD 83.7 9.5 6.8
TABLE-US-00004 TABLE 4 Summary of the N 1s Area (%) for the 7 microcarriers N 1s Area (%) 398.4 eV 399.3 eV 401.3 eV 401.5 eV Microcarrier NH.sub.2 NCO N.sup.+H.sub.3 N.sup.+C AM-9.5 78.2 21.8 AM-3.8 96.5 3.5 AM-3.8-70 97.1 2.9 AM-9.5-LDP 4.0 94.9 1.1 AM-3.8-LDP 2.9 95.6 1.5 AM-3.8-70-LDP 4.2 91.7 4.1 AM-9.5-PD 5.5 85.6 8.9
TABLE-US-00005 TABLE 5 Summary of the O 1s Area (%) for the 7 microcarriers O 1s Area (%) 531.2 eV 532.9 eV Microcarrier CO CO AM-9.5 80.4 19.6 AM-3.8 74.1 25.9 AM-3.8-70 66.5 33.5 AM-9.5-LDP 85.7 14.3 AM-3.8-LDP 91.9 8.1 AM-3.8-70-LDP 88.2 11.8 AM-9.5-PD 84.8 15.2
Example 5
hMSC Performance on Thermoresponsive Microcarriers
[0137] The next series of experiments addressed the performance of hMSCs on the seven selected microcarriers. Bone marrow-derived hMSCs were cultivated under serum- and xeno-free conditions for seven days.
[0138] As shown in
[0139] As shown in
[0140] hMSCs did not grow on the surfaces of uncoated AM-3.8 and AM-3.8-70 microcarriers (
[0141] In contrast, hMSCs displayed attachment to and spreading on the surfaces of AM-3.8-LDP and AM-3.8-70-LDP microcarriers (
[0142] In summary, hMSC compatibility was only observed when the microcarriers contained relatively low amounts of AMHCI and when the microcarrier surfaces were coated with polymerized DOPA, as in case of AM-3.8-LDP and AM-3.8-70-LDP microcarriers. These microcarriers supported hMSC attachment, spreading, growth and survival under serum- and xeno-free conditions.
Example 6
Thermal Detachment
[0143] Next, the thermal-induced hMSC detachment was tested, and the yield of cells after 7 days of cultivation when the temperature was decreased from 37 C. to 20 C. was tabulated. Cells were always harvested in parallel by trypsinization, and the numbers obtained by trypsinization were set to 100%. A similar cell yield (99%) after a temperature shift to 20 C. (without trypsinization) was only obtained with AM-3.8-LDP microcarriers (
[0144] In contrast, the cell yield after the temperature shift (relative to trypsinization) was only 29% in case of AM-3.8-70-LDP microcarriers (
[0145] Although in all other cases, cells did not attach to the microcarriers during cultivation (
Scalable Expansion
[0146] Thus far, the result showed that proper growth on microcarrier surfaces and efficient thermal detachment occurred only in case of AM-3.8-LDP microcarriers. Next, it was tested whether these microcarriers were suitable for scalable expansion under serum- and xeno-free conditions. Freshly thawed cryopreserved hMSCs were directly seeded on AM-3.8-LDP and AM-3.8 (control) microcarriers, and the cells were expanded for 24 days in a rocking bioreactor system (
[0147] In the AM-3.8 cultures, the average cell numbers slowly increased by -30-fold from 1600 on day 1 to 48600 on day 24 (
Example 7
Re-Plating and Colony-Forming Capacity
[0148] Subsequently, the performance of cells that had been re-plated after expansion on thermoresponsive microcarriers was attended to. For these experiments, hMSCs were expanded in AM-3.8-LDP and AM-3.8 (control) cultures. The cells were harvested on day 21 either by trypsinization or a temperature shift to 20 C., and re-plated into adhesion-coated tissue culture plates. After 24 hours, the cells were stained for F-actin or vimentin (red) and the cell nuclei were counterstained with DAPI (blue), and subsequently the cells were imaged (
[0149] Furthermore, cells from AM-3.8-LDP and AM-3.8 cultures harvested by trypsinization did not display the typical elongated morphology (
[0150] Cells derived from the spheroids that formed in AM-3.8 cultures displayed improved spreading when harvested after a temperature shift (
[0151] The colony-forming unit-fibroblast (CFU-F) assay was also performed where the colonies were obtained under all conditions (
Example 8
Maintenance of the hMSC Immunophenotype and Multipotency During Long-Term Expansion
[0152] Next, it was determined whether hMSCs maintained their characteristic immunophenotype during long-term expansion. hMSCs must express CD73, CD90 and CD105, and lack expression of CD45, CD34, CD14, CD11b, CD79a, CD19 and HLA-DR. CD44 is generally expressed by hMSCs. Cells harvested on day 21 by thermal detachment from AM-3.8-LDP cultures were analyzed by fluorescence-activated cell sorting (FACS). The hMSCs were fixed with 4% paraformaldehyde/PBS for 30 minutes at room temperature, and washed with PBS. The cells were then incubated with the fluorochrome-conjugated antibodies provided in the kit for 30 minutes at room temperature. The kit contained individual fluorochrome-conjugated antibodies with respect to CD90, CD44, CD73 and CD105 (hMSC markers). More than 98% of the cells showed expression of CD44, CD73, CD90 and CD105, whereas only 0.03% of cells gave a positive result when a cocktail of antibodies against CD45, CD34, CD11b, CD19 and HLA-DR was applied (
[0153] In order to address the maintenance of multipotency, hMSCs were harvested from AM-3.8-LDP microcarriers by thermal induction after expansion for 21 days, and reseeded into a 12-well tissue culture plate at a density of 5000 cells cm.sup.2. Subsequently, cells were cultivated under conditions inducing adipogenic, osteogenic and chondrogenic differentiation. In the case of
[0154] The details are that the cells were incubated in MSC NutriStem XF medium for 2 hours. Nutristem MSC XF medium was replaced with pre-warmed StemPro Complete Osteogenesis Differentiation medium or StemPro Complete Adipogenesis Differentiation medium. After 21 days of differentiation, the cells were fixed. They were stained with 2% Alizarin Red S solution (pH 4.2) in the case of osteogenic differentiation. In the case of adipogenic differentiation, they were incubated with 60% isopropanol for 5 minutes, and subsequently stained with Oil Red 0.
[0155] For chondrogenic differentiation, hMSCs were harvested after 21 days of expansion from AM-3.8-LDP microcarriers by thermal induction and reseeded into a 1.5-mL Eppendorf tube at a density of 2.510.sup.5 cells mL.sup.1 in MSC NutriStem XF medium. The cells were then centrifuged at 400 g for 5 minutes to generate a tight pellet. The medium was removed, and pre-warmed Stem Pro Complete Chondrogenesis medium was gently added without disrupting the pellet. The pellets were harvested after 14 days of cultivation. Histological processing of the chondrogenic pellets was performed by the Advanced Molecular Pathology Laboratory at the Institute of Molecular and Cell Biology (IMCB, Agency for Science, Technology and Research, Singapore).
INDUSTRIAL APPLICABILITY
[0156] The microsphere of the present disclosure may be a thermoresponsive system that combines key features that are required for clinical applications of hMSCs. The microsphere may be suitable for the scalable expansion of hMSCs under defined serum- and xeno-free conditions. In addition to allowing expansion of hMSCs under fully defined conditions, as required for clinical applications, cell numbers can be increased at least 130-fold. The potential for producing large cell numbers by scalable expansion is essential for generating the large cell numbers required in clinical applications. In addition, the microcarrier system may allow efficient non-invasive harvesting. Efficient non-invasive harvesting is important for obtaining large quantities of non-compromised high-quality cells, and also this is a requirement for clinical applications. This may be achieved by (i) generating entirely thermoresponsive microsphere that contained a thermally responsive monomer crosslinked with a functional group monomer throughout the matrix, and displayed a significant volume and surface area change when the temperature was reduced. Additionally, the microsphere may have a polymer coating thereon.
[0157] The polymer coated microspheres may be used to prepare a wide variety of synthetic substrates that are compatible for a wide range of different cell types, including various types of human stem cells.
[0158] For example, about 90% of the cells may be easily harvested by thermal detachment from the microcarrier system, while hMSC morphology, immunophenotype and multipotency are being maintained after long-term scalable expansion (21 days) under xeno-free and fully defined conditions. The scalable thermoresponsive microcarrier systems may greatly facilitate hMSC applications in the future.