A SUBSTRATE AND METHOD FOR THE GENERATION OF INDUCED PLURIPOTENT STEM CELLS

20200140827 · 2020-05-07

Assignee

Inventors

Cpc classification

International classification

Abstract

This disclosure relates a composition and method for promoting the reprogramming of somatic cells to induced pluripotent stem cells, the composition comprising gelatin and laminin. The disclosure further relates to a method of preparing somatic cells for producing induced pluripotent stem cells and a method for producing induced pluripotent stem cells, and thus provides method useful for the production of expanded somatic cells and induced pluripotent stem cells for use in research and therapy. Thus, the disclosure provides a method of preparing somatic cells for producing induced pluripotent stem cells, the method comprising: (i) isolating somatic cells from a sample, and (ii) expanding the somatic cells for a predetermined period of time, wherein the expanded somatic cells express TERT1, as well as a method for producing induced pluripotent stem cells from said expanded somatic cells by (a) introducing genetic elements, optionally episomal genetic elements, that express induced pluripotent stem cells reprogramming factors into said expanded somatic cells and (b) culturing said expanded somatic cells comprising the genetic elements, thereby producing induced pluripotent stem cells.

Claims

1. A composition for promoting the reprogramming of somatic cells to induced pluripotent stem cells, the composition comprising gelatin at a concentration of about 0.01 w/v % to about 10 w/v % and laminin at a concentration of about 1 g/mL to about 1000 g/mL.

2. The composition of claim 1, wherein the composition comprises gelatin at a concentration of about 0.04 w/v % to about 10 w/v %, optionally about 0.04 w/v % to about 5 w/v %, and laminin at a concentration of about 50 g/mL to about 200 g/mL.

3. The composition of claim 1 or 2, wherein the composition comprises gelatin at a concentration of about 0.04 w/v % to about 10 w/v %, optionally about 0.04 w/v % to about 5 w/v %, and laminin at a concentration of about 50 g/mL to about 100 g/mL.

4. The composition of claim 1 or 2, wherein the composition comprises gelatin at a concentration of about 0.5 w/v % to about 10 w/v %, optionally about 0.5 w/v % to about 5 w/v %, and laminin at a concentration of about 50 g/mL to about 200 g/mL.

5. The composition of any one of the preceding claims, wherein the composition comprises gelatin at a concentration of about 0.5 w/v % to about 10 w/v %, optionally about 0.5 w/v % to about 5 w/v %, and laminin at a concentration of about 50 g/mL to about 100 g/mL.

6. The composition of claim 1 or 2, wherein the composition comprises gelatin at a concentration of about 1 w/v % to about 10 w/v %, optionally about 1 w/v % to about 5 w/v %, and laminin at a concentration of about 50 g/mL to about 200 g/mL.

7. The composition of any one of the preceding claims, wherein the composition comprises gelatin at a concentration of about 1 w/v % to about 10 w/v %, optionally about 1 w/V % to about 5 w/v %, and laminin at a concentration of about 50 g/mL to about 100 g/mL.

8. The composition of any one of the preceding claims, wherein the laminin is recombinant human laminin.

9. The composition of any one of the preceding claims, wherein the gelatin is recombinant human gelatin.

10. The composition of any one of the preceding claims, wherein the composition is an aqueous composition, optionally wherein the aqueous composition comprises, or consists of, a liquid or a gel.

11. The composition of any one of the preceding claims, wherein the composition is provided as a dry, or substantially dry, composition which may be formed into an aqueous composition by the addition of a solvent.

12. The composition of claim 11, wherein the solvent is selected from one of more of saline, optionally phosphate buffered saline; cell culture medium; and water, optionally sterile water.

13. The composition of any one of the preceding claims, wherein the composition further comprises one or more additional extracellular matrix components.

14. The composition of claim 13, wherein the one or more additional extracellular matrix components are selected from collagen, elastin, fibronectin, nidogen, and heparan sulfate proteoglycan.

15. The composition of any one of the preceding claims, wherein the composition further comprises one or more growth factors.

16. The composition of claim 15, wherein the one or more growth factors are selected from one or more of transforming growth factor beta (TGF-beta) epidermal growth factor (EGF), insulin-like growth factor (IGF), and fibroblast growth factor (FGF).

17. The composition of any one of the preceding claims, wherein the composition further comprises a Rho-associated protein kinase (ROCK) inhibitor.

18. The composition of claim 17, wherein the ROCK inhibitor is selected from one or more of Y-27632 dihydrochloride (trans-4-[(1R)-1-Aminoethyl]-N-4-pyridinylcyclohexanecarboxamide dihydrochloride), GSK429286A (N-(6-fluoro-1H-indazol-5-yl)-6-methyl-2-oxo-4-[4-(trifluoromethyl)phenyl]-3,4-dihydro-1H-pyridine-5-carboxamide), Y-30141 (4-(1-aminoethyl)-N-(1H-pyrrolo(2,3-b)pyridin-4-yl)cyclohexanecarboxamide dihydrochloride), RKI-1447 (N-[(3-Hydroxyphenyl)methyl]-N-[4-(4-pyridinyl)-2-thiazolyl]urea dihydrochloride), Fasudil, and Ripasudil (trade name Glanatec).

19. The composition of claim 17 or 18, wherein the ROCK inhibitor is present in the composition at a concentration of about 1 M to 1 mM, optionally about 1 M to 100 mM, optionally about 1 M to 1 mM, optionally about 1 M to 100 M, optionally about 1 M to 50 M, optionally about 5 M to 50 M, optionally about 10 M to 50 M, further optionally about 10 M.

20. The composition of any one of the preceding claims, wherein the composition further comprises genetic elements, optionally episomal genetic elements, which comprise or consist of induced pluripotent stem cells reprogramming factors selected from one or more of Oct4, Sox2, Klf4, c-Myc, Lin28, Nanog and SV40 large T.

21. The composition of claim 20, wherein the genetic elements further comprise TERT1.

22. The composition of claim 20 or 21, wherein the genetic elements comprise nucleic acid sequences coding, optionally DNA nucleotide sequences, comprised in a plasmid or other vector suitable for transfection into somatic cells.

23. The composition of any one of the preceding claims, wherein the composition further a carrier which is suitable to deliver genetic elements inside somatic cells.

24. The composition of claim 23, wherein the carrier comprises nanoparticles for nanoparticle-mediated delivery of genetic elements to the somatic cells.

25. The composition of claim 23 or 24, wherein the carrier comprises lipid-based nanoparticles, optionally wherein the lipid-based nanoparticles nanoparticles comprise liposomes, optionally cationic liposomes.

26. Use of the composition of any one of claims 1 to 25 in a method for reprogramming of somatic cells to induced pluripotent stem cells.

27. A cell culture vessel comprising the composition of any one of claims 1 to 25.

28. A kit comprising the composition of any one of claims 1 to 25.

29. The kit of claim 28, further comprises a cell culture vessel.

30. The kit of claim 29, wherein the cell culture vessel comprises the composition.

31. A method of reprogramming somatic cells to induced pluripotent stem cells, the method comprising (i) contacting the somatic cells with the composition of any one of claims 1 to 25; (ii) introducing genetic elements, optionally episomal genetic elements, that express induced pluripotent stem cells reprogramming factors into the somatic cells; and (iii) culturing said expanded somatic cells comprising the genetic elements, thereby producing induced pluripotent stem cells.

32. The method of claim 31, wherein, in step (i), the somatic cells are suspended in cell suspension medium when contacted with the composition.

33. The method of claim 32, wherein contacting the somatic cells suspended in the suspension medium with the composition causes the suspension medium to dissolve the composition.

34. The method of any one of claims 31 to 33, wherein the somatic cells comprise peripheral blood mononuclear cells, optionally wherein said peripheral blood mononuclear cells comprise monocytes.

35. The method of any one of claims 31 to 35, wherein the genetic elements that express induced pluripotent stem cells reprogramming factors are introduced into the somatic cells via the nanoparticles comprised in the composition.

36. The method of any one of claims 31 to 36, wherein the induced pluripotent stem cells produced from the somatic cells comprising the genetic elements are differentiated to endothelial cells.

37. A method of preparing somatic cells for producing induced pluripotent stem cells, the method comprising: (i) isolating somatic cells from a sample, and (ii) expanding the somatic cells for a predetermined period of time, wherein the expanded somatic cells express TERT1.

38. The method of claim 37, wherein the somatic cells are expanded for less than about 14 days, optionally less than about 13 days, optionally less than about 12 days, optionally less than about 11 days, optionally less than about 10 days, optionally less than about 9 days, optionally less than about 8 days, optionally less than about 7 days, further optionally about 7 days.

39. The method of claim 37 or 38, wherein the somatic cells are expanded for at least about 1 day, optionally at least about 2 days, optionally at least about 3 days, optionally at least about 4 days, optionally at least about 5 days, optionally at least about 6 days, further optionally at least about 7 days.

40. The method of any one of claims 37 to 39, wherein TERT1 expression is at least about 10%, optionally at least about 20%, optionally at least about 30%, optionally at least about 40%, optionally at least about 50%, optionally at least about 60%, optionally at least about 70%, optionally at least about 80%, optionally at least about 90%, optionally about 100%, of the expression of TERT1 in the somatic cells prior to expansion.

41. The method of any one of claims 37 to 40, wherein the sample is a biological sample obtained from a subject, optionally wherein the sample is a blood sample obtained from a subject.

42. The method of any one of claims 37 to 41, wherein the somatic cells are peripheral blood mononuclear cells, optionally wherein said peripheral blood mononuclear cells are monocytes.

43. The method of claim 41 or 42, wherein the volume of said blood sample is less than about 10 ml, optionally less than about 5 ml, optionally less than about 2.5 ml, optionally less than about 1 ml, further optionally about 1 ml.

44. The method of any one of claims 41 to 43, wherein the subject is a human subject, optionally wherein said subject suffers from diabetes.

45. The method of any one of claims 42 to 44, wherein the peripheral blood mononuclear cells have not been mobilized, optimally wherein the peripheral blood mononuclear cells have not been mobilized with extrinsically applied granulocyte colony stimulating factor (G-CSF) or granulocyte macrophage colony-stimulating factor (GM-CSF).

46. The method of any one of claims 37 to 45, wherein the somatic cells are expanded in an expansion medium, optionally wherein the expansion medium comprises serum free medium (SFM) supplemented with one or more of erythropoietin (EPO), IL-3, stem cell factor (SCF), insulin-like growth factor-1 (IGF-1), dexamethasone, and holo-transferrin.

47. The method of claim 46, wherein the somatic cells are expanded in the expansion medium for a first expansion period of about 1 to 7 days, optionally about 2 to 6 days, optionally about 2 to 5 days, optionally about 2 to 4 days, optionally 2 to 3 days, further optionally about 3 days.

48. The method of claim 47, wherein the somatic cells are expanded in the expansion medium for a second expansion period of about 1 to 7 days, optionally about 1 to 6 days, optionally about 1 to 5 days, optionally about 1 to 4 days, optionally 1 to 3 days, optionally 2 to 3 days, further optionally about 3 days.

49. The method of any one of claims 37 to 48, further comprising: (iii) cryopreserving the expanded somatic cells.

50. The method of any one of claims 37 to 49, wherein TERT1 expression is measured in the expanded and/or unexpanded somatic cells, optionally wherein the expanded somatic cells are determined to be suitable for producing the induced pluripotent stem cells if the expanded somatic cells express TERT1.

51. A method for producing induced pluripotent stem cells, the method comprising: (a) introducing genetic elements, optionally episomal genetic elements, that express induced pluripotent stem cells reprogramming factors into expanded somatic cells produced according to the method of any one of claims 37 to 50, and (b) culturing said expanded somatic cells comprising the genetic elements, thereby producing induced pluripotent stem cells.

52. The method of claim 51, wherein the genetic elements are introduced into the expanded somatic cells via a non-viral transfection method, optionally via electroporation.

53. The method of claim 51 or 52 wherein the induced pluripotent stem cells reprogramming factors are selected from one or more of Oct4, Sox2, Klf4, c-Myc, Lin28, Nanog and SV40 large T.

54. The method of any one of claims 51 to 53, wherein, in step (b), the expanded somatic cells comprising the genetic elements are cultured in expansion medium, optionally for about 2 days.

55. The method of claim 54, wherein, following culturing in expansion medium, the expanded somatic cells comprising the genetic elements are then seeded onto inactivated mouse embryonic fibroblasts (MEFs), optionally for about 1 day.

56. The method of claim 55, wherein, following culturing on the inactivated mouse embryonic fibroblasts (MEFs), the expanded somatic cells comprising the genetic elements are removed from the MEFs and cultured in reprogramming medium comprising sodium borate, optionally for about 1 day.

57. The method of claim 56, wherein, the reprogramming medium comprising sodium borate is replaced with fresh reprogramming medium comprising sodium borate every day, optionally the reprogramming medium comprising sodium borate is replaced with fresh reprogramming medium comprising sodium borate every day for about 4-8 days, optionally about 5-7 days, optionally about 6 days.

58. The method of claim 57, wherein, the reprogramming medium comprising sodium borate is replaced with conditioned medium comprising sodium borate and basic fibroblast growth factor every day until one or more cell colonies comprising induced pluripotent stem cells are formed.

59. An expanded somatic cell produced according to the method of any one of claims 37 to 50.

60. An expanded somatic cell expressing TERT1.

61. The expanded somatic cell according to claim 60, wherein TERT1 expression in said expanded somatic cell is at least about 20%, optionally at least about 30%, optionally at least about 40%, optionally at least about 50%, optionally at least about 60%, optionally at least about 70%, optionally at least about 80%, optionally at least about 90%, optionally about 100%, of the expression of TERT1 in the unexpanded somatic cells.

62. The expanded somatic cell according to claim 61, wherein the TERT1 expression wherein the TERT1 expression is measured by real time polymerase chain reaction, reverse transcriptase quantitative polymerase chain reaction, western blotting and/or immunofluorescence microscopy.

63. The expanded somatic cell according to any one of claims 60 to 62, wherein the cell is produced according to the method of any one of claims 37 to 50.

64. An induced pluripotent stem cell produced according to the method of any one of claims 51 to 58.

65. An induced pluripotent stem cell produced from the expanded somatic cell of any one of claims 59 to 63.

66. The induced pluripotent stem cell of claim 65, wherein the induced pluripotent stem cell is produced according to the method of any one of claims 51 to 58.

67. An induced pluripotent stem cell according to any one of claims 64 to 66 for use in therapy.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0141] The embodiments of the present invention will now be described, by way of example, with reference to the accompanying drawings, in which:

[0142] FIG. 1 demonstrates TERT1 to be a key mediator of iPS cells reprogramming. (A) The expression levels of TERT1 are unexpectedly abolished after 14 days of culture of the mononuclear cells (MNCs) obtained from the health volunteers and diabetic patients. (B) When TERT1 was knocked down in 7 days MNCs by shRNA, the reprogramming efficiency was reduced to 0% indicating that TERT1 expression is an important mediator of iPS cells generation. (C) Control MNCs with normal TERT1 levels generated iPS cells colonies which express pluripotency stem cell markers. Based on these findings, a new protocol of generating pluripotent stem cells, as described herein, has been developed. MNCs obtained from only few drops of blood may be expanded for only 7 days and subjected to iPS reprogramming. This protocol generates iPS cells colonies within one week in a reproducible and highly efficient manner. The establishment of such novel and short protocols are powerful tools for personalised and regenerative medicine.

[0143] FIG. 2 depicts generation and characterisation of iPS cells obtained from a few drops of blood based on the presently disclosed novel approach. (A) Diagram explaining the iPSC generation from a few drops of blood samples from health volunteers and diabetic patients. (B) iPSCs form round colonies with defined limits. (C) Immunofluorescence assays show that iPSCs express pluripotent markers such as CDy1 (in vitro live staining), Oct4, TRA-1-60 and Lin28. (D) iPSCs express Oct4, Lin28 and Nanog at an mRNA level. (E) iPSCs express TRA-1-60, Oct4 and Lin28 at a protein level. (F) iPSCs form teratomas in vivo. These data confirm that these cells are indeed pluripotent stem cells.

[0144] FIG. 3 depicts the differentiation of the iPS cells towards functional endothelial cells. (A) Diagram of iPS cell differentiation towards endothelial cell (EC) lineage. (B) iPS-ECs morphology. (C) qPCR data showing iPS-ECs express endothelial markers at a mRNA level. (D) When differentiated, iPS-ECs express VE-cadherin at a protein level and stop expressing pluripotent marker OCT4. (E) iPS-ECs form tight junctions in vitro and express VE-cadherin, PECAM-1 and ZO-1. (F) iPS-ECs take up LDL and they form vascular structures in in vitro Tube Formation Assays. These data confirm that these cells are functional ECs and are powerful tools for drug screening and cell based therapies.

[0145] FIG. 4 depicts the results of a screening assay to profile the expression levels of various factors potentially involved in the generation of iPS cells from monocular cells. Expression levels in the monocular cells on days 9 and 14 post-expansion was measured.

[0146] FIG. 5 depicts (A) iPS cells generated from expanded monocular cells transfected with the non-integrating episomal plasmid vectors pEB-05 (overexpressing Oct4, Sox2, Klf4, c-Myc and Lin28), and pEB-Tg vector (overexpressing SV40 large T antigen), supplemented by TERT1, and grown on a novel substrate. Typical iPS cell colonies with well-defined round limits are observed. (B) depicts the iPS cell colonies stained positive for the pluripotent marker CDy1.

DETAILED DESCRIPTION

[0147] Materials & Methods

[0148] Blood Mononuclear Cells (MNCs) Isolation and Expansion

[0149] 1 to 20 ml of non-mobilised peripheral blood were collected by venepuncture in EDTA-coated 4 ml tubes. The blood was separated by gradient centrifugation by layering it on Histopaque solution (1:1 ratio) and spinning for 30 minutes at 550 g at room temperature. The Mononuclear cells (MNCs) form a buffy coat between the plasma layer and the Histopaque buffer layer. The supernatant was discarded and the cells resuspended in 1 ml of MNC medium, which medium comprises serum free medium (SFM) supplemented with erythropoietin (EPO), IL-3, stem cell factor (SCF), insulin-like growth factor-1 (IGF-1), dexamethasone, and holo-transferrin. Specifically, the SFM (for 100 ml) comprises: 49 ml IMDM (Life Technologies 21056023), 49 ml F12 Nutrient Mix (Life Technologies 21765029), 1 ml ITS-X (Life Technologies 41400045), 1 ml Chemically defined lipid concentrate (Life Technologies 11905031), 1 ml Penicillin/Streptavidin, 1 ml Glutamax, 5 mg Ascorbic Acid (SIGMA A8960), 0.5 g BSA (SIGMA A9418), 1.8 l 1-Thioglycerol (SIGMA M6145), and the MNC comprises SFM supplemented with: 2 U ml Recombinant human erythropoietin (EPO; R&D Systems, cat. no. 287-TC-500), 10 ng/ml IL-3 (IL-3; PeproTech, cat no. 200-03), 100 ng/ml Recombinant human stem cell factor (SCF; PeproTech, cat. no. 300-07), 40 ng/ml Recombinant human insulin-like growth factor-1 (IGF-1; PeproTech, cat. no. 100-11), 1 M dexamethasone (Sigma-Aldrich, cat. no. D2915), and 100 g/ml Human holo-transferrin (R&D Systems, cat. no. 2914-HT-100MG). The cells were counted and plated at a density of 4 million cells per ml in 12-well (1 ml per well) or 6-well (1-4 mls per well) plates. On day 3 after plating, the medium was changed by collecting all cells and spinning for 5 minutes at 250 g. The cells were cryopreserved from day 7 in freezing medium (50% FBS, 40% SFM and 10% DMSO) or used for reprogramming straight away.

[0150] Reprogramming

[0151] 2 million cells were transfected with 10 g of plasmid (8 g of pEB-05 and 2 g of pEB-antigen T) via 35 electroporation using the Lonza CD34 nucleofector kit and Amaxa nucleofector (program T-016). After the electroporation, the cells were plated in 2 ml of MNC medium in a well of a 12-well plate, i.e. 2 million cells per well. On day 2 after transfection, the cells were collected, counted and seeded onto inactivated mouse embryonic fibroblasts (MEFs) in reprogramming medium at a density of 100,000-80,000 cells per well of a 12-well plate (i.e. each well has a growth surface are of 40 approximately 3.8 cm.sup.2). The reprogramming media comprises Knockout DMEM (Invitrogen, SKU-10829-018), 20% Knockout Serum Replacement (Invitrogen SKU 10828-028), 10 ng/ml basic fibroblast growth factor (bFGF Miltenyi Biotec, 130-093-837), 0.1 mM -mercaptoethanol and 0.1 mM MEM non essential amino acids (MEM NEAA). On day 3 after transfection, the medium was collected in tubes and centrifuged for 5 minutes at 300 g. The pellets were resuspended with the remaining volume of new medium and plated back into their wells. Sodium borate (NaB) was added at a concentration of 0.25 mM to the medium until colonies were picked. The reprogramming medium (with NaB) was changed every day with fresh reprogramming medium (with NaB). From day 9 after transfection and thereafter, the reprogramming medium (with NaB) was replaced with conditioned medium with FGF2 (10 ng/ml) and NaB (0.25 mM). The medium was changed every day, i.e. with fresh conditioned medium with FGF2 (10 ng/ml) and NaB (0.25 mM). Colonies appeared from 10 day 7-10. Once the colonies were picked, cell lines were established and cultured in reprogramming medium supplemented with FGF2 [at 10 ng/ml].

[0152] In a further development of our method, mononuclear blood cells (MNC)s obtained from healthy donor and expanded, as described above, for about 7 days, were defrosted in MNC medium according to standard defrosting protocols. The wells of 6-well plates were coated with different substrates (see Table 4) overnight at 4 C. Each well of a 6-well plate typically has a growth surface area of approximately 9.5 cm.sup.2. The substrates were: a novel substrate of the present invention comprising gelatin 1%, laminin 50 g/mL, formulated to a thick gel-like solution by addition of phosphate buffered saline (PBS) and mixing the gelatin and laminin in the PBS (ES) Matrigel, Gelatin with Matrigel, Cell Matrix (CellMatrix Basement Membrane Gel (ATCC ACS-3035), Matrigel with Cell Matrix (CellMatrix Basement Membrane Gel (ATCC ACS-3035), and Matrigel. Next day, 2,000,000 MNCs were transfected, as described above, using the non-integrating episomal plasmid vectors pEB-05 (overexpressing Oct4, Sox2, Klf4, c-Myc and Lin28), and pEB-Tg vector (overexpressing SV40 large T antigen) (Chou et al. [5] and Dowey et al. [6]), optionally supplemented by TERT1. TERT1 was cloned to the vector (cloning sequence obtained from NM_198253.2), generating a plasmid which overexpresses TERT1, using standard cloning techniques known in the art. The 2,000,000 transfected MNCs were added into each well of a 6-well plate in 2 ml MNC medium. MNC medium and ReproTeSR medium were added according to manufacturer's instructions. ReproTeSR (Stem Cell Technologies) is a complete, defined, serum-free and xeno-free reprogramming medium. This medium is used during the generation of iPS cells from somatic cells, such as fibroblasts and other cell types, under feeder-free conditions, and according to manufacturer's instructions (which are available at https://cdn.stemcell.com/media/files/pis/DX20217-PIS_1_3_0. pdf?_ga=2.216708116.343397011.15 27158806-1504615269.1527158806). Rho-associated protein kinase (ROCK) inhibitor was added on day 3. The ROCK inhibitor, Y-27632 dihydrochloride (trans-4-[(1R)-1-Aminoethyl]-N-4-pyridinylcyclohexanecarboxamide dihydrochloride), was obtained from TOCRIS (Cat. No. 1254). Stock solution of 10 mM was further diluted during use to 1:1000. Colonies were observed from day 5. From day 5, the ReproTeSR medium was changed daily (2 ml) supplemented with ROCK Inhibitor (10 mM stock solution was diluted during use to 1:1000), and colonies were picked, expanded, characterised and frozen down according to standard protocols described herein and/or known in the art.

[0153] Again, in a further development of this method, the reprogramming factors were introduced into the MNCs via nanoparticles. That is, nanoparticles from a 2 mM stock were diluted 1:2 in 5% dextrose to obtain a 1 mM solution. The correct volumes for the nanoparticles and for the plasmids is determined based on the cell number used. Good results have been obtained by using 1.5 l of a 1 mM nanoparticle solution with 0.25 g of plasmid DNA (about 1 g of DNA is suitable for transfecting about 110.sup.6 cells). First, serum-free Optimem was added to the required volume of DNA (reprogramming plasmids) up to 125 L (for one well of a 6-well plate). Serum-free Optimem was also added to the volume of nanoparticles up to 125 L. Then, the 125 L of DNA-Optimem is added dropwise to the 125 L nanoparticles-Optimem. The DNA-nanoparticle mixture is incubated at room temperature for 30 minutes. Then, the DNA-nanoparticle mixture is added to the substrate, thus producing a product comprising a substrate embedded with reprogramming factors comprised on nanoparticles.

[0154] As will be understood, DNA is, itself, a polyelectrolytethe negatively charged sugar phosphate backbone of DNA influences, among other things: (i) the conformation and dynamics of DNA in solution, (ii) the nature of its chemical and physical interactions with both small and large molecules, and (iii) the manner in which it adsorbs at surfaces and interfaces. Owing to the above considerations, many approaches to the delivery of DNA have focused on the design of positively charged polymers. Cationic polymers can interact with DNA in solution through electrostatic interactions to form aggregates or assemblies with sizes, charges, and other properties that can promote the internalization and processing of DNA by cells.

[0155] The substrate may further comprise ROCK inhibitor as described herein, e.g. Y-27632 dihydrochloride, at a concentration of approximately 10-20 M.

Teratoma Formation Assay

[0156] iPS cells (110.sup.6) were mixed with Matrigel and subcutaneously injected into severe combined immunodeficiency (SCID) mice. Eight weeks later, the plugs were harvested, sectioned for HE staining and teratoma formation observed.

[0157] Cell Differentiation

[0158] Human induced pluripotent stem (iPS) cells cultured under feeder-free conditions were detached using dissociation medium and seeded on mouse collagen IV (BD mouse collagen IV-5 g/ml)-35 coated plates in EGM-2 media (Lonza) plus 10% FBS. The dissolution medium comprises a reagent to dissociate the human iPS colonies into single cells (RCHETP002, Reinnervate). The medium was supplemented with 25 ng/ml BMP4, 12 ng/ml Activin A, 8 M CHIR99021, and 20 ng/ml FGF2 (bFGF Miltenyi Biotec, 130-093-837) (day 0 of differentiation). After 48 hours (day 2), the medium was replaced with EGM-2 plus 10% FBS supplemented with 50 ng/ml VEGF, 10 ng/ml FGF2 and 10 M LY364947 (Sigma) and refreshed every other day. On day 6 of differentiation, MACS-mediated selection for CD144-expressing cells was performed and the selected cells were seeded on mouse collagen IV-coated plates. MACS Technology utilises microbead technology to isolate any cell type from a mixed population of cells by magnetically labelling cells of interest in a sample with MACS MicroBeads, applying the sample to a MACS Column placed in a MACS Separator, and capturing and then collecting the magnetically labeled cells on the column. The medium used was EGM-2 with 10% FBS supplemented with 50 ng/ml VEGF and 10 M LY364947.

[0159] RNA Extraction, Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) and Real-Time PCR

[0160] Cells were harvested and washed with cold PBS, lysed with Qiazol and the RNA was purified using the RNeasy mini kit (Qiagen) according to the manufacturer's instructions. RNA yield was determined using the NanoDrop spectrophotometer (NanoDrop Technologies). Total RNA (2 g) was converted to cDNA. Quantitative PCR (qPCR) was done using SYBR Green (Life Technologies) and detection was achieved using the thermocycler LightCycler 480 sequence detector (Roche). Primer sequences are listed in Table 1. Expression of target genes was normalized to reference gene GAPDH.

TABLE-US-00001 TABLE1 Primersequences. SEQ SEQ ID Gene Forward IDNO. Reverse NO. Oct4 AGAACATGTGTAAGCTGCGG 1 GTTGCCTCTCACTCGGTTC 2 Lin28 GCAGAAGCGCAGATCAAAAG 3 CGGACATGAGGCTACCATATG 4 Nanog GAAATACCTCAGCCTCCAGC 5 GCGTCACACCATTGCTATTC 6 KDR ATAGAAGGTGCCCAGGAAAA 7 GTCTTCAGTTCCCCTCCATTG 8 G CD144 AAACACCTCACTTCCCCATC 9 ACCTTGCCCACATATTCTCC 10 eNOS GGTACATGAGCACTGAGATC 11 GCCACGTTGATTTCCACTG 12 G TERT1 GCACGGCTTTTGTTCAGATG 13 CGGTTGAAGGTGAGACTGG 14 Cbp/300 ATGGACGCCGAACTCATC 15 CCAAGTCCGAGAAGCAGTC 16 CITED4 SOX18 TCATGGTGTGGGCAAAGG 17 CGTTCAGCTCCTTCCACG 18 SOX17 AGAATCCAGACCTGCACAAC 19 GCCGGTACTTGTAGTTGGG 20 TCF3 GAGAAGCCCCAGACCAAAC 21 ACCACACCTGACACCTTTTC 22 FOXC1 AGTAGCTGTCAAATGGCCTTC 23 TTAGTTCGGCTTTGAGGGTG 24 mTOR CAAGAACTCGCTGATCCAAAT 25 GCTGTACGTTCCTTCTCCTTC 26 G PFKF3 GGCAAGACCTACATCTCCAA 27 ATGGCTTCCTCATTGTCGG 28 G GLUT1 CATCAACCGCAACGAGGA 29 GGTCATGGGTCACGTCAG 30 PKM ATGGCTGACACATTCCTGG 31 CATCTCCTTCAACGTCTCCAC 32 SIRT1 CCCTCAAAGTAAGACCAGTA 33 CACAGTCTCCAAGAAGCTCTA 34 GC C HIF1 CCGCTGGAGACACAATCATA 35 ACTTCCTCAAGTTGCTGGTC 36 TC EPAS1 CCCATGTCTCCACCTTCAAG 37 GGCTTGCTCTTCATACTCCAG 38 GSK3 GGTCTATCTTAATCTGGTGCT 39 TGGATATAGGCTAAACTTCGGA 40 GG AC BMP2 CTACATGCTAGACCTGTATCG 41 CCCACTCGTTTCTGGTAGTTC 42 C PAX6 GCCCTCACAAACACCTACAG 43 TCATAACTCCGCCCATTCAC 44 SNAI1 GGAAGCCTAACTACAGCGAG 45 CAGAGTCCCAGATGAGCATTG 46 CD34 AGAAAGGCTGGGCGAAGAC 47 TAGCACGTGGTCAGATGCAG 48 JAK1 AACCTCTTTGCCCTGTATGAC 49 CTGCTCATTGTCGTTGGTTC 59 NOTCH1 TGCCTGGACAAGATCAATGA 51 CAGGTGTAAGTGTTGGGTCC 52 G STAT3 TTCTGGGCACAAACACAAAA 53 TCAGTCACAATCAGGGAAGC 54 G TWIST1 CTCAGCTACGCCTTCTCG 55 ACTGTCCATTTTCTCCTTCTCT 56 G YAP1 ACAAGCCATGACTCAGGATG 57 TGTTTCACTGGAGCACTCTG 58 RUNX1 CCAGGTTGCAAGATTTAATGA 59 TTTTGATGGCTCTGTGGTAGG 60 CC GATA3 GCGGGCTCTATCACAAAATG 61 TCCCCATTGGCATTCCTC 62 SOX7 CACAACGCCGAGCTCAG 63 GGCCGGTACTTGTAGTTGG 64 TEK CTGGGTTTATGGGAAGGACG 65 CAGGGAGACAGAACACATAAG 66 AC VEGF-A CGAGTACATCTTCAAGCCATC 67 TGGTGAGGTTTGATCCGC 68 C Klf2 CCTACACCAAGAGTTCGCAT 69 TGTGCTTTCGGTAGTGGC 70 C HEY1 TGGTACCCAGTGCTTTTGAG 71 CTCCGATAGTCCATAGCAAGG 72 MALL CTGTTCCTCACCATCCCTTTC 73 CAAGGAGATGAGAAACGAGGT 74 G ESM1 GGTGTCAGCCTTCTAATGGG 75 TCAGGCATTTTCCCGTCC 76 WARS TCAGCAACTCATTCCCACAG 77 GCAGGGCTGGTTTAGGATAG 78 JAG1 GGACTATGAGGGCAAGAACT 79 AAATATACCGCACCCCTTCAG 80 G

[0161] Immunofluorescence Staining

[0162] Cells were fixed with 4% paraformaldehyde for 15 min, permeabilised with 0.1% Triton X-100 in PBS for 5 min and blocked in 5% donkey serum in PBS for 30 min at room temperature. Cells were incubated with primary antibodies for 1 h at 37 C., the antibodies being: rabbit anti-VE-cadherin; rabbit anti-CD31 (human specific); rabbit anti-KDR; and mouse anti-SM22. The following incubation with the secondary antibodies was performed for 45 min at 37 C., using anti-rabbit Alexa488 and anti-mouse Alexa594. Cells were counterstained with 4-6-diamino-2-phenylindole (DAPI), mounted on glass slides and examined with a fluorescence microscope (Axioplan 2 imaging; Zeiss) or SP5 confocal microscope (Leica, Germany).

[0163] Immunoblotting

[0164] Cells were harvested and washed with cold PBS, re-suspended in RIPA buffer (Sigma) and lysed by ultrasonication (twice, 6 seconds each) (Bradson Sonifier150) to obtain whole cell lysate. The protein concentration was determined using the Biorad Protein Assay Reagent. 50 g of whole lysate was applied to SDS-PAGE and transferred to Hybond PVDF membrane (GE Health), followed by standard immunoblotting procedure. The bound primary antibodies were detected by the use of horseradish peroxidase (HRP)-conjugated secondary antibody and the ECL detection system (GE Health).

[0165] FACS Analysis

[0166] iPS-ECs were analysed with FACS to determine the percentage of CD144, KDR and other endothelial markers in the flow cytometer. Data analysis was performed using FlowJo software.

[0167] Ac-LDL Uptake Assay

[0168] To detect acetylated low-density lipoprotein (LDL) uptake, cells were incubated with Dil-ac-LDL (Molecular Probes) for 4 h and were examined and photographed under a fluorescence microscope (Axioplan 2 imaging; Zeiss).

[0169] In Vitro Tube Formation Assay

[0170] Cell suspensions containing 510.sup.4 iPS, iPS-ECs or HUVECs were placed on top of 50 l/well Matrigel (BD Matrigel Basement Membrane Matrix Growth Factor Reduced) in 8-well chamber slides and incubated for 30-60 min at 37 C. to allow the gel to solidify.

[0171] Results and Discussion TERT1 is a Key Mediator of iPS Cells Reprogramming

[0172] In an attempt to develop a robust protocol of generation of induced pluripotent stem cell from health volunteers and diabetic patients, mononuclear cells (MNCs) have been isolated from 1 ml of blood. In order to define the best time point of the mononuclear cell expansion which makes the cells responsive to cell reprogramming, a large screening assay profiling of monocular cells on days 9 and 14 was performed (FIG. 4). This large screening assays including reprogramming genes, epigenetic modulators, vascular progenitors, and early and late endothelial cell lineage genes. Remarkably, telomerase reverse transcriptase (TERT1), which is seems to have an extratelomeric 35 function in somatic cell reprogramming has been found to be a key mediator of iPS cells reprogramming. Telomerase reverse transcriptase (abbreviated to TERT, TERT1, or hTERT in humans) is a catalytic subunit of the enzyme telomerase, which, together with the telomerase RNA component (TERC), comprises the most important unit of the telomerase complex. As indicated in FIG. 1A, the expression levels of TERT1 were totally abolished after 14 days of cultured MNCs (FIG. 1A), at which time-point reprogramming efficiency is almost zero. Table 2 below demonstrates colony formation after 7 days expansion, but only a single colony was formed from MNCs expanded for 14 days.

TABLE-US-00002 TABLE 2 Comparison of iPSC colony formation after 7 and 14 days expansion. MNCs - day 7 MNCs - day 14 Number of colonies 8 1 Cells seeded 280 000 (in 3 wells) 280 000 (in 3 wells)

[0173] In order to confirm the role of TERT1 in reprogramming of cells, TERT1 was knocked down in 7-day MNCs by shRNA (FIG. 1B) and the reprogramming efficiency was reduced to 0% (Table 3) thus indicating that TERT1 expression is an important mediator of iPS cell generation. Control MNCs with normal TERT1 levels generated iPS cell colonies (Table 3), which cells express pluripotency stem cell markers such as CDy1 (FIG. 1C). Based on these findings, a new protocol of generating pluripotent stem cells has been developed. MNCs obtained from only few drops of blood may be expanded for only 7 days and subjected to iPS reprogramming. This protocol generates iPS cells colonies, for the first time, within one week in a reproducible and highly efficient manner. The establishment of such novel and short protocols are powerful tools for personalised and regenerative medicine.

TABLE-US-00003 TABLE 3 Generation iPS cell colonies in control and TERT1 knockdown cells. Cells Sample reprogrammed Number of colonies Efficiency CONTROL 1 000 000 6 0.002% TERT1 knockdown 1 000 000 0 0.000%

[0174] Generation and Characterisation of iPS Cells Obtained from Few Drops of Blood Based on a Novel Approach

[0175] This powerful, fast and highly efficient reprogramming method from few drops of blood has been generated and the derived iPS cells have been fully characterised. In FIG. 2A, a diagram is shown explaining the iPSC generation from few drops of blood samples from health volunteers and diabetic patients. iPS cells formed round colonies with defined limits revealing a typical morphology of pluripotent stem cells (FIG. 2B). Immunofluorescence staining has been performed showing that iPS cells express pluripotent markers such as CDy1 (in vitro live staining), Oct4, TRA-1-60 and Lin28see FIG. 2C. Moreover, iPS cells express Oct4, Lin28 and Nanog at an mRNA level (FIG. 2D). Importantly, iPS cells express TRA-1-60, Oct4 and Lin28 at a protein level (FIG. 2E). Finally, the pluripotency of the iPS cells derived based on our novel approach was tested in vivo by performing teratoma formation in SCID Mice. Indeed, the iPS cells formed teratomas within 6-8 weeks in vivo (FIG. 2F). These results highlight that iPS cells are generated based on a novel, fast, and highly efficient method from few drops of blood from health volunteers and diabetic patients.

[0176] Experiments were conducted to identify a suitable feeder-free and xeno-free substrate on which to grow and reprogramme somatic cells (MNCs) to iPS cells. Various concentrations of gelatin and laminin were mixed with a suitable buffer (phosphate buffered saline) and allowed to set. As noted in Table 4, we discovered that only certain substrates comprising a combination of gelatin and laminin, in the indicated quantities, produced a suitable gel consistency and produced colonies of iPS cells.

TABLE-US-00004 TABLE 4 iPS cell colony formation using different formulations of substrates. Concentration Range Gelatin 0.02% 0.04%-0.1.sup. 0.5-0.8% 1-5% 1-5% >10% Gel is not Gel is not Gel is Gel is Gel is Gel is formed fully formed formed formed formed crystalized Laminin 1-10 g/ml 50-100 g/ml 50-100 g/ml 50-100 g/ml 200 g/ml 50-100 g/ml Colonies No colonies Few colonies Some Many Very few No colonies colonies colonies colonies

[0177] Experiments were also conducted using feeder-free media with modifications in the coating substrate, seeding density, transfection method and/or use of high passage MNCs. No colonies were obtained using high passage cells (i.e. somatic cells (MNCs) expanded for days before reprogramming). Also, no colonies were obtained using other transfection methods such as Lipofectamine and Fugene 6 (data not shown). A seeding density of about 1-210.sup.6 cells per well of 6-well plate produced best results for reprogramming efficiency. As noted from Table 5, standard coating substrates produced no, or very few, iPS cell colonies whereas our novel substrates produced colonies after only about 5-7 days.

TABLE-US-00005 TABLE 5 iPS cell colony formation using different plating substrates. Substrate Colonies (ES) Matrigel No Gelatin with Matrigel No Cell Matrix No Matrigel with Cell Matrix No Matrigel* Few (and delayed appearance) Novel substrate** Yes *Standard protocol based on viruses as disclosed in Kishino et al. [7]. **Produced as described above under Materials and Methods.

[0178] Thus, at around day 5-7, typical iPS cell colonies with well-defined round limits were observed on the novel substrate (see FIG. 5A), through the assessment of extensively characterised pluripotency-associated markers. The iPS cell colonies stained positive for the pluripotent marker CDy1 (FIG. 5B).

[0179] Differentiation of the iPS Cells Towards Functional Endothelial Cells

[0180] The next step was to differentiate the iPS cells towards endothelial cell (EC) lineages. In FIG. 3A, a schematic diagram of iPS cell differentiation towards ECs is shown. Briefly, iPS cells were cultured under feeder-free conditions and seeded on mouse collagen IV-coated plates in EGM-2 media (Lonza) 10% FBS. The medium was supplemented with 25 ng/ml BMP4, 12 ng/ml Activin A, 8 M CHIR99021, and 20 ng/ml FGF2. After 48 hours (day 2), the medium was replaced with EGM-2 plus 10% FBS supplemented with 50 ng/ml VEGF, 10 ng/ml FGF.sub.2 and 10 M LY364947 (Sigma) and refreshed every other day. In day 6 of differentiation, MACS-mediated selection for CD144-expressing cells was performed and the selected cells were seeded on mouse collagen IV-coated plates. The media used was EGM-2 10% FBS supplemented with 50 ng/ml VEGF and 10 M LY364947. The derived iPS-ECs reveal a typical morphology of ECs (FIG. 3B). Real time data are also shown that iPS-ECs express EC markers such as KDR, CD144, eNOS at the mRNA level (FIG. 3C). Importantly, upon EC differentiation, iPS-ECs express VE-cadherin at a protein level and stop expressing the pluripotent marker OCT4 (FIG. 3D). Remarkably, iPS-ECs form tight junctions in vitro and express VE-cadherin, PECAM-1 and ZO-1 (FIG. 3E). Functionally, iPS-ECs take up LDL and they form vascular structures in in vitro Tube Formation Assays (FIG. 3F). These results clearly demonstrate that functional ECs are derived and are powerful tools for drug screening and cell based therapies.

[0181] In a further development, the human induced pluripotent stem (iPS) cells cultured under feeder-free conditions were detached using dissociation solution (Reprocell) and seeded on mouse collagen IV (Cultrex Mouse Collagen IV (3410-010-01, R&D) in EGM-2 media (Lonza) 10% FBS. The medium was supplemented with 25 ng/ml BMP4, 12 ng/ml Activin A, 8 M CHIR99021 and 20 ng/ml FGF2 (MACS). After 48 hours (day 2 of differentiation), the medium was replaced with EGM-2 10% FBS supplemented with 200 ng/ml VEGF (Life Technologies), 10 ng/ml FGF.sub.2 and 10 M LY364947 (Sigma) and was refreshed every other day. On day 6 of differentiation, MACS-mediated magnetic selection for CD144-expressing cells was performed using MicroBeads Kit (Miltenyi Biotec), as we have previously shown (Cochrane et al., 2017). The positively selected cells were seeded on mouse collagen IV-coated plates in EGM-2 10% FBS media supplemented with 50 ng/ml VEGF and 10 M LY364947.

[0182] Discussion

[0183] In this study, we developed, for the first time, a reprogramming method to generate iPS cells based on a novel, fast and highly efficient strategy. Our laboratory has extensive experience in reprogramming somatic cell populations (fibroblasts or mononuclear cells) to iPS cells [3], as well as, partial-iPS cells (PiPS) [4]. The process uses somatic cells from diabetic patients and healthy controls, making use of a DNA-free integration technique. In this study, we have gone further by proposing a novel and short approach to iPS cells reprogramming. Stem cell based therapies represent an emerging field within medical research, with the potential to revolutionize health care, offering the ability to apply personalised medicine, without the associated risks of tissue rejection or use of immunosuppressive drugs. By definition, stem cells harbour a high self-renewal potential, and innate ability to differentiate into a multitude of different cell types, depending upon their relative surrounding chemical milieu, or niche. The applications of stem cells are as far reaching as treating cardiovascular disease (CVD), various malignancies, and Alzheimer's disease. In general, stem cells can be classified according to their potency, that is, their relative ability to differentiate into the various cell types of the body. Those described as pluripotent are capable of forming all cell lineages of the body, while those of a multipotent state are yet further terminally differentiated, and are, as consequence, more restricted with regards to the repertoire of cell types that they can adopt. It would therefore follow that those cells of greatest potency are of most use to cell-based treatment strategies. Embryonic stem cells represent the only natural pluripotent human stem cells, and are generally isolated following somatic cell nuclear transfer and extraction from the inner cell mass of the resultant blastocyst. Nonetheless, there remains a number of barriers in the application of the former cells, including concerns regarding tumorigenesis, the relative supply of human embryos and ethical apprehensions of the general public. However, it has been reasoned by scientists that the very same factors responsible for the maintenance of pluripotency in embryonic stem cells could potentially prompt such potency in somatic cells. Remarkably, it was found that the combination of only four select factors was sufficient to generate induced pluripotent stem (iPS) cells from mouse fibroblast cultures. These factors included the gene regulatory proteins, Oct3/4, Sox2, Klf4, and c-Myc. It was subsequently found that the generation of human iPS cells from adult human dermal fibroblast was possible, again through ectopic expression of the same four factors. Subsequent analysis revealed that human iPS cells shared a number of distinctive features with human embryonic cells, including proliferative potential, epigenetic status of pluripotent cell-specific genes, and of great importance for medical application, the ability to generate all three germ layers. Such findings were instrumental in providing conclusive evidence that human iPS cells can indeed be generated from somatic cell lines. Other work re-affirmed the capacity of human somatic cells to adopt a pluripotent state upon expression of these seemingly quintessential factors. Incredibly, in 2009, it was reported that over-expression of a single Yamanaka transcription factor, Oct4, was sufficient for the reprogramming of adult mouse neural stem cells into iPS cells. A comprehensive description of the exact global targets and signal networks regulated by the Yamanaka factors was defined by the combined work of two later studies in which the precise cis-acting targets of nine transcription factors was identified, including the aforementioned factors, and further target promoters were identified and extended this work to analysis of the signalling cascades controlled by the Yamanaka factors in mouse embryonic cells. The sheer complexity of these pathways can be appreciated when considering the array of signalling cascades involved. With regard to the field of regenerative medicine, these cells harbour significant potential, offering the prospect to treat some of the most debilitating diseases affecting modern society; it may very well be the case that their application is limited only by our creativity. Beyond their use in a clinical environment, iPS cells may represent an invaluable tool for disease modelling and novel drug screening trials.

[0184] Re-Programming of Somatic Cells

[0185] Within the past decade, several methods have been employed to successfully produce iPS cells from various human somatic cell lines. Yet more complex vectors were devised and produced in an effort to improve retroviral gene transfer; namely vectors based upon the lentiviruses, and adopted in further studies.

[0186] Despite the apparent success of the aforementioned protocols, retroviral vectors are incredibly inefficient, creating substantial genetic heterogeneity in the infected somatic cells, with as little as 0.001 to 0.1% of the cells acquiring a subsequent pluripotent state. In light of these inefficiencies, a drug-inducible lentivirus vector system was developed, and reported increased efficacies, in comparison to early methods, of over two orders of magnitude. Nevertheless, the fact that many of the reprogramming factors are oncogenes, and the use of retroviral vectors increases the risk of insertional mutagenesis, confers an appreciable risk of oncogenic transformation. As a result, iPS cell generation with retroviral vectors is only appropriate when applied to in vitro studies, such as modelling the pathogenesis of disease. It could be inferred that iPS cell production with fewer factors could potentially evade tumorigenesis, and indeed select studies have demonstrated the successful exclusion of the c-myc oncogene. This, however, is not without consequence, as a subsequent decline in re-programming efficiency begets an increase in the accumulation of deleterious mutations.

[0187] Non-integrating lentiviral vectors were thus developed, generating more fitting therapeutic iPS cells, with a reduction in insertional mutagenesis and a concurrent decline in the development of malignancies amongst cell lines.

[0188] Therefore, more advanced strategies are urgently needed to generate iPS cells in a shorter timeframe and a more efficient manner. In the present study, we have found that 7-days MNCs express high levels of the epigenetic gene TERT1, which makes the cells respond to cell reprogramming and be transformed quickly and efficiently towards iPS cells in very short time. For the first time, a robust method of generating iPS cells using cells isolated from a tiny amount of blood has been demonstrated. However, while iPS cells can be derived from blood cells, there is a major problem relating to low efficiency of reprogramming and safety which relates to requirement for large blood volumes and also, in some instances, drug-induced mobilisation of blood cells using granulocyte-macrophage colony stimulating factor (GM-CSF). Currently, there are a limited number of blood-based kits that can generate iPS cells in a fast and safe way. In this study, we have developed a novel approach of iPS cells generation, which is less invasive. The use of blood mononuclear cells (MNCs) for patient/donor-specific cell reprogramming is less invasive for the subject than the use of fibroblasts and requires only as little as 1 ml of blood, and importantly, without blood mobilisation. It does not require previous growth factor treatment of the donor and the peripheral blood is extracted by venipuncture. There is applicability in both healthy donor and diabetic patient samples. This is especially important for diabetic patients who have healing difficulties due to their condition. It is a rapid approach: we are able to reprogram cells from very small volume of blood cells (1 ml), which are expanded in only 7 days and generate fully reprogrammed iPS cells colonies only 9 days after reprogramming. It is a faster and more efficient expansion: MNCs can be expanded with an up to 2.5-fold increase in 7 days. It is highly efficient: the reprogramming efficiency of the MNCs is up to 0.02%, which is high when compared to the efficiency obtained by other protocols that use integration free and virus-free gene delivery methods. The establishment of fully reprogrammed iPS cells colonies is reported throughout the present protocol: this is very important since other protocols can lead to generation of partially reprogrammed cells that fail in the characterisation or differentiation steps. The iPS cells obtained with this method have been characterised as fully reprogrammed pluripotent stem cells and have been successfully differentiated towards ECs. The present method is virus-free: no need for use of a virus to deliver the reprogramming genes into the cells, and non-integrating episomal vectors can be used instead. This reduces any mutations in the reprogrammed cells and makes them safer for regenerative medicine uses. The present method is feeder-free: no need for use of feeder cells such as mouse embryonic fibroblasts (MEFs), which are commonly used when growing human iPS cells. Thus, there is no external contamination risk, which is a great advantage when studying human diseases or making it capable of translation into patient treatment and applicable for future clinical use. It is cost effective: the replication and use of episomal vector is highly cost-effective when compared to other non-integrating gene delivery methods for cell reprogramming such as Sendai virus or episomal vector transfection kits. Finally, it is a flexible method: the production and use of the vectors do not need a specific kit.

[0189] The Method can be Used Widely to Generate Patient Specific iPS Cells for Drug Screening and Cell Based Therapies

[0190] Importantly, in this study, iPS cells from diabetic patients have been generated and differentiated toward ECs. It is projected that by 2025, there will be 380 million people with diabetes, making diabetes the 7.sup.th leading cause of death by 2030. Diabetes is a major global cause of premature mortality. Diabetes is a major cause of heart attacks, stroke, lower limb amputation, kidney failure and blindness, all are devastated conditions which severely affect the quality of life and cause death. Approximately one half of patients with type 2 diabetes die prematurely of a cardiovascular cause and approximately 10% die of renal failure. The pathogenic basis for macro- and micro-vascular complications arising from both Type 1 and Type 2 diabetes is complex and multifactorial, but a progressive EC dysfunction is critical. As a consequence of the hyperglycaemia, hypertension and dyslipidaemia which characterise the diabetic milieu, a vicious circle of events can occur in the vascular endothelium involving oxidative stress, low-grade inflammation and platelet hyperactivity. How hyperglycaemia in particular influences endothelial dysfunction remains incompletely understood. Therefore, there is a very urgent necessity for studies to be conducted based on pioneering ideas and novel tools such as the potential of deriving ECs from diabetic patients through the remarkable technology of the iPS cells. iPS cells hold an enormous potential with regards to targeting therapeutic strategies to the downstream causal factors of diabetes; that is pronounced EC dysfunction. Indeed, the generation of functional vascular tissue to replace that which has become lost or damaged in the process of diabetes and prevent diabetic complications, especially when considering the fact that the spontaneous regeneration of ECs is incredibly slow, may represent a possible breakthrough in what has been an exceedingly challenging disease to treat. In addition to this re-endothelization of blood vessels, cell-based therapies could also be directed towards vasculogenesis; supporting angiogenesis within ischemic tissues following acute myocardial infarction, which is a major complication of diabetes. Therefore, the derived ECs from a diabetic patient are unique tools which represent the patient-specific cells in a petii-dish which can be used for the first time to study the causes of the disease; to screen an unlimited number of potential drugs; to develop new therapies; and to generate functional cell to be used for cell based therapies. Diabetes and diabetic complication are only one example that our novel method could have an enormous impact. The list is endless and countless numbers of patients are waiting for novel treatments based on this promising and powerful strategy.

[0191] The invention is not limited to the embodiments described herein but can be amended or modified without departing from the scope of the present invention.

REFERENCES

[0192] [1] Worringer K A, Rand T A, Hayashi Y, Sami S, Takahashi K, Tanabe K et al. The let-7/LIN-41 pathway regulates reprogramming to human induced pluripotent stem cells by controlling expression of prodifferentiation genes. Cell Stem Cell 2014; 14(1): 40-52. [0193] [2] Takahashi K and Yamanaka S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 2006; 126(4): 663-676. [0194] [3] Cochrane, A., et al. Quaking Is a Key Regulator of Endothelial Cell Differentiation, Neovascularization, and Angiogenesis. Stem Cells (2017). [0195] [4] Margariti, A., et al. Direct reprogramming of fibroblasts into endothelial cells capable of angiogenesis and reendothelialization in tissue-engineered vessels. Proc Natl Acad Sci USA 109, 13793-13798 (2012). [0196] [5] Chou, B.-K., Mali, P., Huang, X., Ye, Z., Dowey, S. N., Resar, L. M. S., Zou, C., Zhang, Y. A., Tong, J., and Cheng, L. (2011). Efficient human iPS cell derivation by a non-integrating plasmid from blood cells with unique epigenetic and gene expression signatures. Cell Research 21, 518. [0197] [6] Dowey, S. N., Huang, X., Chou, B.-K., Ye, Z., and Cheng, L. (2012). Generation of integration-free human induced pluripotent stem cells from postnatal blood mononuclear cells by plasmid vector expression. Nature Protocols 7, 2013. [0198] [7] Kishino et al., Generation of Induced Pluripotent Stem Cells from Human Peripheral T Cells Using Sendai Virus in Feeder-free Conditions, J Vis Exp. 2015; (105): 53225