Maintenance and Expansion of Pancreatic Progenitor Cells

Abstract

The present invention relates to a method of culturing a pancreatic progenitor cell. The method comprises contacting the cell with epidermal growth factor (EGF), retinoic acid (RA) and an inhibitor of transforming growth factor- (TGF-) and 3T3-J2 feeder cells. A cell produced by the method of the invention and a kit when used in the method are also provided.

Claims

1. A method of culturing a pancreatic progenitor cell comprising contacting said cell with: a. epidermal growth factor (EGF); b. retinoic acid (RA); c. an inhibitor of transforming growth factor- (TGF-) signaling; and d. 3T3-J2 fibroblast feeder cells.

2. The method of claim 1, wherein the inhibitor of transforming growth factor- (TGF-) signaling is an inhibitor of activin receptor-like kinase (ALK) receptor, optionally wherein the inhibitor of activin receptor-like kinase (ALK) receptor is SB431542.

3. (canceled)

4. The method of claim 1, wherein the pancreatic progenitor cell is further contacted with B27 supplement.

5. The method of claim 1, wherein the pancreatic progenitor cell is further contacted with an inhibitor of Notch signaling, optionally wherein the inhibitor of Notch signaling is a v-secretase inhibitor, optionally wherein the v-secretase inhibitor is DAPT.

6. and 7. (canceled)

8. The method of claim 1, wherein the pancreatic progenitor cell is further contacted with dexamethasone, fibroblast growth factor 10 (FGF10), N2 supplement or combinations thereof.

9. The method of claim 1, wherein the pancreatic progenitor cell is contacted with: a. about 1 ng/ml to about 100 ng/ml of EGF; b. about 100 nM to about 10M of RA; and c. about 1 M to about 100M of SB431542.

10. The method of claim 1, wherein the pancreatic progenitor cell is contacted with: about 1 ng/ml to about 100 ng/ml of EGF; about 1 ng/ml to about 100 ng/ml of FGF10; about 100 nM to about 10M of RA; about 1 nM to about 100 nM of dexamethasone; about 100 nM to about 10M DAPT; about 1 M to about 100M of SB431542; about 1 B27 supplement; and about 1 N2 supplement.

11. The method of claim 5, wherein the pancreatic progenitor cell is contacted with: about 50 ng/mL EGF; about 50 ng/ml FGF10; about 3 M RA; about 30 nM dexamethasone; about 1 M DAPT; about 10 M SB431542; about 1 B27 supplement; and about 1 N2 supplement.

12. The method of claim 1, wherein the pancreatic progenitor cell is a pancreatic progenitor cell population.

13. The method of claim 1, wherein the pancreatic progenitor cell population is substantially homogenous.

14. The method of claim 1, wherein the pancreatic progenitor cell population is at least 60%homogenous.

15. The method of claim 14, wherein the pancreatic progenitor cell population is at least 99% homogenous.

16. The method of claim 1, wherein the pancreatic progenitor cell is cultured for at least 5 passages, at least 10 passages, at least 15 passages, or at least 20 passages.

17. The method of claim 1, wherein the pancreatic progenitor cell is derived from a stem cell, optionally wherein the stem cell is a human embryonic stem cell (hESC), optionally wherein the stem cell is an induced pluripotent stem cell (iPSC).

18. and 19. (canceled)

20. The method of 19 claim 1, wherein the pancreatic progenitor cell expresses PDX1, SOX9, HNF6, FOXA2, and GATA6.

21. The method of claim 1, wherein the pancreatic progenitor cell does not express SOX2.

22. A cell produced according to the method of claim 1.

23. A kit when used in the method of claim 1, comprising one or more containers of cell culture medium, together with instructions for use.

24. The kit according to claim 23, wherein the kit further comprises 3T3-J2 feeder cells.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0055] The invention will be better understood with reference to the detailed description when considered in conjunction with the non-limiting examples and the accompanying drawings, in which:

[0056] FIG. 1 shows the generation of hiPSC lines from diabetic and healthy sibling fibroblasts. FIG. 1A shows the pedigree of a consanguineous Jordanian family with several diabetic siblings. All diabetic siblings developed the disease before 5 years of age. Skin biopsies taken from individuals AK5 and AK6 were used to generate fibroblasts from which hiPSC were derived. FIG. 1B shows the intracellular flow cytometric analysis of OCT4 expression and FIG. 10 shows immunostaining for established markers of pluripotency for hiPSC clones AK5-11, AK6-13 and AK6-8 (not shown). Scale bar, 100 m.

[0057] FIG. 2 shows the directed differentiation of pancreatic progenitor cells and generation of cultured pancreatic progenitor (cPP) cells from diverse human pluripotent stem cell lines. FIG. 2A shows the time-course of pancreatic progenitor differentiation protocol. In these experiments, stage 1 was extended to last 3 days, rather than 2 as per the manufacturer's instructions, by repeating the final day's treatment. FIG. 2B shows the intracellular flow cytometric analysis of PDX1 and NKX6-1 at days 8, 10 and 15 of differentiation using hES3 INS-GFP reporter hESC and the in-house hiPSC lines AK5-11 and AK6-8. PDX1 is detected before NKX6-1 in all cases, although individual lines exhibit variable differentiation kinetics. Gates are based on cells stained with isotype control antibodies. FIG. 2C shows the percentage of PDX1+ and/or NKX6-1+ at day 15 of differentiation. Each circle represents one of 31 independent experiments encompassing 2 hESC lines and 6 hiPSC lines. The vertical black bar shows the median percentage of cells that are PDX1+ (95%), NKX6-1+ (80%) or PDX1+NKX6-1+ (80%). FIG. 2D shows gene expression measured by qRT-PCR using samples harvested from cPP cell lines at passage 6. The study analyzed cPP cells derived from the following pluripotent cell lines: H9 and HES3 hESC, and AK5-11, AK6-8 and AK6-13 hiPSC. Two independent pedigrees were derived from H9 and AK5-11 cell lines. Expression levels are shown normalized to those of H9 hESC and are plotted on a loge scale. Error bars represent the standard error of three technical replicates.

[0058] FIG. 3 shows the derivation of cPP Cell Lines from hESC and hiPSC. FIG. 3A shows pancreatic progenitors generated after 15 days of differentiation using the STEMdiff directed differentiation kit (PPd15 cells) were plated and expanded on a layer of 3T3-J2 feeder cells in medium supplemented with the indicated growth factors and signaling inhibitors. FIG. 3B shows the intracellular flow cytometric analysis for PDX1 and NKX6-1 at days 8,10, and 15 of differentiation using H9 hESCs. FIG. 3C shows phase-contrast images of cPP cells passaged as aggregates (left) and as single cells (right). Scale bar, 100 m. FIG. D shows gene expression measured by qRT-PCR using samples harvested from PPd15 cells and cPP cells at early (6-8), middle (11-13), and late (14-18) passages. Cells were derived from both AK6-13 hiPSC and H9 hESC. Gene expression in definitive endoderm (H9 hESCs after 4 days STEMdiff differentiation) is shown for comparison. Values are plotted on a log.sub.2 scale and error bars represent the SE of three technical replicates. ND, not detected. FIG. 3E shows immunofluorescence staining of cPP cells for key pancreatic transcription factors. Scale bar, 100 m. FIG. 3F shows intracellular flow cytometric analysis of cPP cells for PDX1. Gray dots represent control cells stained with isotype control antibodies. Intracellular flow cytometric analysis of cPP cells for PDX1. Gray dots represent control cells stained with isotype control antibodies.

[0059] FIG. 4 shows that chromosome counting and M-FISH analysis reveals cPP Cells are genetically stable. FIG. 4A shows chromosome counting of cPP cells from diverse genetic backgrounds at different passage numbers. Values shown are the percentage of spreads with a given number of chromosomes, with the modal chromosome count for each cPP line highlighted. A modal (shared by >80% of cells) chromosome number of 46 is indicative of a normal karyotype and of karyotypic stability. Five out of six cPP cell lines analyzed exhibited a modal chromosome count of 46 after >6 passages, without evidence of fragments or dicentric chromosomes, and are considered karyotypically stable. In H9 pedigree #1, cells gradually acquired an additional isochromosome upon passaging. Traditional G-band karyotyping (data not shown) subsequently found this to be i(12) (p10)[20], an isochromosome commonly observed in hESC cultures. FIG. 4B shows multicolor fluorescence in situ hybridization (M-FISH) enables the detection of chromosomal structural abnormalities at significantly higher resolution than chromosome counting alone. M-FISH of passage 20 AK6-13 cPP cells failed to detect aneuploidy, translocations or deletions in 19/20 spreads analyzed. A representative image of a single chromosome spread is shown.

[0060] FIG. 5 shows transcriptome analysis of cPP cells by RNA-seq. FIG. 5A shows correlations between gene expression levels for cPP cells from three different genetic backgrounds (H9, AK6-13 and HES3) at early (6-8), mid (11-13) and late (18) passages. Log2-transformed gene counts measured by RNA-seq were plotted for each gene. Gene counts in cPP samples are compared to liver for comparison. The Spearman correlation coefficient for each pair of samples is shown on the corresponding plot. Heat colors denote the number of transcripts. Gene counts are strongly correlated between cPP samples regardless of genetic background or passage number, but not with liver. FIG. 5B shows the identification of specifically expressed genes in liver, lung and colon samples. Genes associated with early pancreatic development are not typically found to be specifically expressed by these tissues. FIG. 5C shows Z-score correlations for cPP, PPd15, CS16-18 PP and liver samples. Z-scores are strongly correlated between in vitro and in vivo pancreatic progenitor samples but not between these samples and liver.

[0061] FIG. 6 shows the transcriptome analysis of cPP Cells by RNA-Seq. FIG. 6A shows Hierarchical clustering of Euclidean distances between transcriptomes of diverse adult and embryonic tissues shows that in vitro and in vivo pancreatic progenitors exhibit similar patterns of gene expression. Log2-transformed gene count values were used to calculate Euclidian distances. For detailed information on the sources of data used here, see Table 1 FIG. 6B shows heatmaps of loge-transformed gene expression levels of key endodermal and pancreatic markers by in vitro and in vivo pancreatic progenitors. Levels in brain are shown for comparison. FIG. 6C shows genes specifically expressed by cPP, PPd15, and CS16-18 pancreatic progenitors. The coefficient of variance (CV) for each protein coding gene across the 25 tissues shown in FIG. 6A was plotted against the corresponding Z score. Specifically expressed genes are located in the upper right-hand quadrant (CV >1 and Z score >1) and include genes with well-characterized roles in early pancreatic development (labeled). The color scale denotes the number of genes. The Venn diagram shows overlap between genes specifically expressed by cPP, PPd15, and CS16-18 pancreatic progenitors. FIG. 6D shows biological process Gene Ontology (GO) terms associated with all genes specifically expressed by cPP cells (above) or genes specifically expressed by cPP cells but not PPd15 or CS16-18 pancreatic progenitors (below). Only GO terms associated with >5 genes and/or an adjusted p value <0.01 are shown. FIG. 6E shows the heatmap of expression levels of genes associated with the enriched GO terms mitotic recombination, DNA strand elongation, telomere maintenance, and DNA packaging. Levels are shown for individual cPP and PPd15 populations derived from three different genetic backgrounds (H9, AK6-13, and HES3) relative to the maximum detected value across the 25 different tissues shown in FIG. 6A. FIG. 6F shows the expression of selected telomerase pathway genes as measured by qRT-PCR in cPP and PPd15 cells. Error bars represent the SE of three technical replicates.

[0062] FIG. 7 shows that a layer of 3T3-feeder cells and exogenous signaling molecules are required for the maintenance and expansion of cPP cells. FIG. 7A shows phase-contrast images of H9 and AK6-13 cPP cells after 7 days culture in complete medium on 3T3-feeder cells plated at densities of 510.sup.4, 2.510.sup.4, and 1.2510.sup.4 cells/cm.sup.2. Scale bar, 100 m. FIG. 7B shows gene expression measured by qRT-PCR for samples harvested from cultures in FIG. 7A for endocrine (NGN3 and NKX2-2), ductal (KRT19 and CA2), and acinar (CPA1 and AMY2B) marker genes. Error bars represent the SE of three technical replicates. FIG. 7C shows phase-contrast images of cPP cells cultured for 6 days in complete medium with individual components omitted. Scale bar, 100 m. FIG. 7D shows PDX1 and SOX9 expression measured by qRT-PCR for samples harvested in (C). Error bars represent the SE of three technical replicates. FIG. 7E shows Microbioreactor array (MBA) screening of factors required to propagate PDX1+SOX9+ cPP cells. Effects of reducing or removing selected factors (EGF, RA, DAPT) from complete medium containing all factors at the following levels: EGF (50 ng/mL), RA (3 M), DAPT (1 M), SB431542 (10 M), and FGF10 (50 ng/mL). Top panels: effects on total nuclei per chamber, and PDX1 and SOX9 mean nuclear intensity. Lower panels: effects on the total number of PDX1+SOX9+ cells per chamber and percentage of PDX1+SOX9+ cells. Data represent the mean of ten chambers within a column treated with the given condition the SE. FIG. 7F shows a heatmap of RNA-seq expression levels of components of signaling pathways that regulate cPP proliferation: EGF (EGFR), FGF10 (FGFR1-4, 6 and FGFRL2), RA (RARA, RARB, RARG, RXRA, RXRB, and RXRG), SB431542 (ACVR1B [ALK4], TGFBR1 [ALKS], and ACVR1C [ALK7]), and DAPT (NOTCH1-4 and its ligands DLL1,3,4 and JAG1,2). Levels are shown relative to those observed across all 25 tissues shown in FIG. 6A.

[0063] FIG. 8 shows Microbioreactor Array (MBA) screening of factors required to propagate cPP cells. FIG. 8A shows Phase contrast images of PDX1+SOX9+ cPP cells seeded into Matrigel-coated MBAs and allowed to attach for 20 h with periodic feeding. Each MBA device has 270 chambers arranged as shown in S4D. Scale bar, 100 m. FIG. 8B shows the protocol used for MBA screening. FIG. 8C shows individual chambers of MBA device (270 culture chambers) stained with anti-PDX1 (green) and anti-SOX9 (red) antibodies. Hoechst 33342 (not shown) was used for nuclei identification. The chambers were selected to show the range of proliferation rates and protein expression observed across different signaling environments. Scale bar, 100 m. FIG. 8D shows endpoint measurements for each chamber in the MBA. Schematic above shows compositions of media applied to each column of the MBA (EGF, ng/mL; RA, pM; DAPT, pM). Cell culture media flow was from top (Row 1) to bottom (Row 10) down a column, thereby concentrating autocrine factors towards the bottom of the column. Mean measurements for each column are given below. QCF: data flagged for quality control issue during image processing. Values were extracted from images such as those in S4C using an image segmentation algorithm as described previously.

[0064] FIG. 9 shows the testing of cPP Potency in vitro and in vivo. FIG. 9A shows feeder-depleted passage 15 H9 cPP cells were replated on Matrigel and exposed to the indicated factors that promote multilineage differentiation toward the endocrine, duct, and acinar lineages. FIG. 9B shows endocrine, exocrine, and ductal gene expression analysis in FIG. 9A after 3, 6, and 12 days. Values are shown relative to levels in undifferentiated cPP cells (day 0). Error bars represent the SE of three technical replicates. FIG. 9C shows directed differentiation of passage 10 AK6-13 cPP cells to insulin+ b-like cells using a modified version of Russ et al. (2015). FIG. 9D shows phase-contrast image of differentiating spheres undergoing branching morphogenesis after 4 days. Scale bar, 100 m. FIG. 9E shows that intracellular flow cytometric analysis of day 4 cells shows approximately 70% reactivate NKX6-1 and maintain PDX1. FIG. 9F shows PDX1 and NKX6-1 immunostaining on day 4. Scale bar, 100 m. FIG. 9G shows that on day 9, the majority of cells are NKX2-2+ with a proportion of these transiently NGN3+. Scale bar, 100 m. FIG. 9H shows the phase contrast image of day 16 spheres. Scale bar, 100 m. FIG. 9I shows that approximately 20% of cells are C-peptide+ on day 16. FIG. 9J shows that day 16 C-peptide+ cells do not coexpress glucagon. Scale bar, 100 m. FIG. 9K shows gene expression measured by qRT-PCR of cPP cells on days 4, 9, and 16 harvested from the differentiation protocol in FIG. 9C. Levels are shown relative to those in undifferentiated cPP cells and human islets for comparison. Error bars represent the SE of three technical replicates. FIG. 9L shows immunostaining of transplanted cPP cells for markers of endocrine (C-peptide and glucagon), duct (keratin-19), and acinar (trypsin) lineages. Scale bar, 100 m.

[0065] FIG. 10 shows the optimization of cPP beta cell differentiation. FIG. 10A shows the application of NKX6-1 induction step of published beta cell differentiation protocols to cPP cells. This study established 2D-monolayer, 3D-matrigel and 3D-suspension cultures in complete cPP media before exposing cells to growth factor regimes based on published beta cell differentiation protocols. Phase contrast images were taken at the end of each treatment. Scale bar, 100 m. FIG. 10B shows gene expression measured by qRT-PCR using samples harvested in FIG. 10A. When cells were exposed to the Rezania and Pagliuca differentiation regimes using the 3D matrigel platform, sufficient material to carry out qRT-PCR analysis was unable to be recovered. Error bars represent the standard error of three technical replicates. FIG. 100 shows optimization of the NKX6-1 induction step of the Russ et al. differentiation regime. Differentiations were carried out using the 3D-suspension platform. The lengths of the two growth factor treatments were varied to maximize the percentage of cells that reactivate NKX6-1 expression. PDX1 and NKX6-1 were measured by intracellular flow cytometric analysis. Three independent experiments are shown for each condition. FIG. 10D shows the percentage PDX1+NKX6-1+ cells generated in FIG. 100.

EXPERIMENTAL SECTION

[0066] Non-limiting examples of the invention and comparative examples will be further described in greater detail by reference to specific Examples, which should not be construed as in any way limiting the scope of the invention.

[0067] Experimental Procedures

[0068] Human Pluripotent Stem Cell Culture and Differentiation

[0069] The following hESC lines were used in this study: H9 (WA09) were purchased from WiCell, HES3 (ES03) were provided by ES Cell International Pte. Ltd., and the HES-3 INSGFP/w reporter line was a gift from the Stanley lab (Micallef et al., 2011). The hiPSC lines used in this study were derived inhouse from human fibroblasts and are designated AK5-11, AK6-8 and AK6-13 (FIG. 1). Pluripotent stem cells were maintained on tissue culture plastic coated with Matrigel in mTeSR1 medium as described previously, and differentiated into pancreatic progenitors using the STEMdiff Pancreatic Progenitor kit (STEMCELLTechnologies, 05120) according to the manufacturer's instructions with the following modifications: (1) cells were initially seeded into 12-well plates (Corning, 353043) at a density of 106 cells/well, and (2) stage 1 was extended to 3 days by repeating the final day's treatment. All tissue culture was carried out in 5% CO2 at 37 C.

Generation of hiPSC

[0070] Fibroblasts were obtained by punch skin biopsy and reprogrammed to generate hiPSC. Fibroblasts were reprogrammed using the CytoTune-iPS 2.0 Sendai Reprogramming Kit (Thermo Fisher Scientific, A16517) in accordance with the manufacturer's instructions. Cells were passaged and plated onto irradiated mouse embryonic feeders 7 days after viral transfection. Thereafter, hiPSC colonies were picked between days 17-28 and maintained in DMEM/F12 (Sigma, D6421) supplemented with 20% Knock Out Serum Replacement (Thermo Fisher Scientific, 10828-028), 0.1 mM 2-mercaptoethanol (Thermo Fisher Scientific, 21985-023), 2 mM L-glutamine (Thermo Fisher Scientific, 25030), 0.2 mM NEAA (Thermo Fisher Scientific, 11140-050) and 5 ng/mL bFGF (Peprotech, 100-18B). Staining with the following antibodies was used to confirm pluripotency (FIG. 1): NANOG (R&D Systems, AF1997, 1:200), OCT4 (Santa Cruz, 111351, 1:200), SOX2 (R&D Systems MAB2018, 1:200), SSEA3 (Millipore, MAB4303, 1:50), SSEA4 (Millipore, MAB4304, 1:200), TRA-1-81 (Millipore, MAB4381, 1:200), TRA-1-60 (Millipore, MAB4360, 1:200). Primary antibodies were recognized by Alexa-fluorophore conjugated secondary antibodies raised in Donkey (Thermo Fisher Scientific, 1:500). The study protocol was approved by the National University of Singapore Institutional Review Board (NUS IRB 10-051). The study was conducted in accordance with the Declaration of Helsinki and written informed consent was obtained from the participants.

Passaging and Maintenance of Cultured Pancreatic Progenitor (cPP) Cells

[0071] Gentle cell dissociation reagent (STEMCELL Technologies, 07174) was used to passage cPP cells as aggregates that were then seeded at a 1:6 split ratio onto a layer of 3T3-J2 feeders (0.510.sup.6 to 110.sup.6 cells/cm.sup.2) in medium composed of advanced DMEM/F12 (Thermo Fisher Scientific, 21634010), 2 mM L-glutamine (Thermo Fisher Scientific, 25030), 100 U/mL penicillin/streptomycin (Thermo Fisher Scientific, 15140122), 1 N2 supplement (Thermo Fisher Scientific, 17502-048), 1 B27 supplement (Thermo Fisher Scientific, 17504-044), 30 nM dexamethasone (STEMCELL Technologies, 72092), 50 ng/mL EGF (R&D Systems, 236-EG-200), 50 ng/mL FGF10 (Source Bioscience, ABC144), 3 M RA (Sigma, R2625), 10 M SB431542 (Calbiochem, 616464), and 1 M DAPT (Sigma, D5942). If plating single cPP cells, complete medium was supplemented with 10 M Y27632 for the first 48 hr (Sigma, Y0503). Medium was completely replenished every 2-3 days.

Expansion of 3T3-J2 feeders

[0072] 3T3-J2 feeder cells (passage 9) were expanded on tissue culture plastic (coated with 0.1% gelatin (Sigma, G2625) for 30 min) in 3T3-J2 culture media and passaged as single cells by treating with 0.25% Trypsin for 5 min (Thermo Fisher Scientific, 25200056). 3T3-J2 culture media is composed of the following: DMEM high glucose (Thermo Fisher Scientific, 11960), 10% Fetal Bovine Serum (FBS, ES cell qualified, Thermo Fisher Scientific, 16141079), 2 mM L-glutamine (Thermo Fisher Scientific, 25030), and 100 U/mL penicillin/streptomycin (Thermo Fisher Scientific, 15140122). Feeder cells were mitotically inactivated by gamma irradiation (20 grays for 30 min) then frozen in culture media +DMSO. Individual batches of FBS are selected to enable 3T3-J2 cells to maintain cPP cultures, whilst 3T3-J2 cells are never cultured beyond passage 12 and should be seeded at 3.5-510.sup.3 cells/cm.sup.2 and not allowed to exceed 1.310.sup.4 cells/cm.sup.2.

[0073] Preparation of 3T3-J2 Feeder-Coated Culture Vessels

[0074] Thawed 3T3-J2 cells were seeded at 0.5-110.sup.6cells/cm.sup.2 onto tissue culture plates coated with 0.1% gelatin (Sigma, G2625) for 30 min and maintained in 3T3-J2 culture media for up to 3 days until required. The optimal plating density must be determined empirically for each batch of feeders and is assessed based on the ability to maintain colony morphology without significantly hindering growth, since increasing feeder density improves colony morphology and blocks differentiation, but results in reduced proliferation rates. Tissue culture vessels containing feeders were washed once with DMEM to remove residual FBS prior to addition of cPP culture media.

Metaphase Spread Preparation, Chromosome Counting and M-FISH Karyotyping

[0075] Cells grown to 75-80% confluency were treated with 100 ng/ml Colcemid solution (Gibco, 15212012) for 6 h, trypsinized and centrifuged at 1000 rpm for 10 min. Cell pellets were resuspended in 75 mM KCl and incubated for 15 min in a 37 C. waterbath. 1/10 volume of 3:1 methanol/acetic acid was added to cells followed by centrifugation at 1000 rpm for 15 min. Cells were then fixed by resuspension in 3:1 methanol/acetic acid solution, incubated for 30 min at room temperature, centrifuged at 1200 rpm for 5 min and finally washed once more with fixative. Cells were resuspended in a small volume of fixative, dropped onto clean glass slides and left to air dry. Multicolor FISH (MFISH) was performed according to manufacturer's instructions (MetaSystems). Automated acquisition of chromosome spreads was performed using Metafer imaging platform (MetaSystem). Ikaros and Fiji software were used to determine the chromosome number per spread and analyze M-FISH images.

RNA-Seq Analysis of Gene Expression

[0076] RNA was isolated from samples harvested from cPP and PPd15 cultures using an RNeasy mini kit (QIAGEN, cat. no. 74104). Feeder removal microbeads (Miltenyi Biotec, 130-095-531) were used to deplete cPP cells of 3T3 feeders prior to RNA extraction. All RNA samples had an RNA integrity number >9. RNA-seq libraries were generated using the NEBNext Ultra RNA Library Prep Kit (NEB, E7530L) and sequenced on an Illumina HiSeq 2500 system generating single-end reads of 100 bp. Table 1 contains metadata for these and public datasets used for the RNA-seq gene expression analysis.

TABLE-US-00001 TABLE 1 Metadata used for RNA-seq gene expression analysis. Uniquely aligned Read Total reads (% length Sample Stage reads total) (bp) Source of data H9 cPP Passage 8 44620737 0.902 100 This study E-MTAB-5731 Early (ArrayExpress Archive) H9 cPP Passage 13 44869916 0.902 100 This study E-MTAB-5731 Mid (ArrayExpress Archive) H9 cPP Passage 18 41431366 0.897 100 This study E-MTAB-5731 Late (ArrayExpress Archive) AK6-13 Passage 6 45586537 0.903 100 This study E-MTAB-5731 cPP Early (ArrayExpress Archive) AK6-13 Passage 11 41439771 0.888 100 This study E-MTAB-5731 cPP Mid (ArrayExpress Archive) HES3 cPP Passage 8 37249318 0.900 100 This study E-MTAB-5731 Early (ArrayExpress Archive) H9 PPd15 Day 15 45700168 0.891 100 This study E-MTAB-5731 Pancreatic (ArrayExpress Archive) Progenitors AK6-13 Day 15 27282321 0.889 100 This study E-MTAB-5731 PPd15 (ArrayExpress Archive) Pancreatic Progenitors HES3 Day 15 30324745 0.919 100 This study E-MTAB-5731 PPd15 (ArrayExpress Archive) Pancreatic Progenitors Cebola In Day 12 42903206 0.784 90 E-MTAB-3061 (Cebola et al vitro 2015, ArrayExpress Archive) Pancreatic Progenitors Cebola CS16-18 46455693 0.761 90 E-MTAB-3061 (Cebola et al CS16-18 2015, ArrayExpress Archive) Pancreatic Bud Beta Cell 59 years 64513275 0.789 36 E-MTAB-1294 (Moran et al 2012, ArrayExpress Archive) Embryonic day 91 62760353 0.668 36 SRX214006 (SRA accession heart number) Embryonic day 91 42092063 0.644 36 SRX343530 (SRA accession muscle number) Embryonic day 112 60726935 0.738 36 SRX343522 (SRA accession spleen number) Embryonic day 115 76123335 0.706 36 SRX343526 (SRA accession thymus number) Embryonic 140-231 days 9896201 0.657 51 SRX208133 (SRA accession brain number) Adipose 73 years 76784649 0.790 50 E-MTAB-513 (ArrayExpress Archive, Illumina Human Body Map 2 project) Adrenal 60 years 75322220 0.811 50 E-MTAB-513 (ArrayExpress Archive, Illumina Human Body Map 2 project) Brain 77 years 68913126 0.856 50 E-MTAB-513 (ArrayExpress Archive, Illumina Human Body Map 2 project) Breast 29 years 76528738 0.802 50 E-MTAB-513 (ArrayExpress Archive, Illumina Human Body Map 2 project) Colon 68 years 81347600 0.812 50 E-MTAB-513 (ArrayExpress Archive, Illumina Human Body Map 2 project) Heart 77 years 79842823 0.819 50 E-MTAB-513 (ArrayExpress Archive, Illumina Human Body Map 2 project) Kidney 60 years 80084865 0.797 50 E-MTAB-513 (ArrayExpress Archive, Illumina Human Body Map 2 project) Liver 37 years 78751250 0.845 50 E-MTAB-513 (ArrayExpress Archive, Illumina Human Body Map 2 project) Lung 65 years 80276172 0.833 50 E-MTAB-513 (ArrayExpress Archive, Illumina Human Body Map 2 project) Lympho 86 years 81997309 0.798 50 E-MTAB-513 (ArrayExpress node Archive, Illumina Human Body Map 2 project) Muscle 77 years 82487888 0.844 50 E-MTAB-513 (ArrayExpress Archive, Illumina Human Body Map 2 project) Ovary 47 years 80974656 0.831 50 E-MTAB-513 (ArrayExpress Archive, Illumina Human Body Map 2 project) Prostate 73 years 82826989 0.846 50 E-MTAB-513 (ArrayExpress Archive, Illumina Human Body Map 2 project) Testis 19 years 81940259 0.848 50 E-MTAB-513 (ArrayExpress Archive, Illumina Human Body Map 2 project) Thyroid 60 years 81079772 0.852 50 E-MTAB-513 (ArrayExpress Archive, Illumina Human Body Map 2 project)

RNA-seq Read Alignment, Gene Count Calculation and Normalization

[0077] Raw fastq files were downloaded with the fastq-dump function of the SRA-toolkit (v 2.8.0). This study mapped reads with STAR (v2.5.1a) using an index based on the soft masked primary assembly of reference genome GRCh38 and corresponding gene annotation gtf file (GRCh38.83). Both were obtained from the Ensembl FTP site. Read overhang was set to 99 bp for index generation. Default mapping parameters were retained with the following exceptions: outFilterType BySJout to reduce the number of spurious junctions, alignSJoverhangMin 10 minimum read overhang for unannotated junctions, alignSJDBoverhangMin 1 minimum overhang for annotated junctions, outFilterMatchNminOverLread 0.95 to allow up to 5% mismatched bases (per pair) if no better alignment can be found, align IntronMin 20 to allow short introns, alignlntronMax 2000000 to set an upper limit on intron length, outMultimapperOrder Random to randomize the choice of the primary alignment from the highest scoring alignments, outFilterIntronMotifs RemoveNoncanonicalUnannotated to bias mapping towards known transcripts and chimSegmentMin 0 to suppress any chimeric mapping output. The mapped reads of all samples were then jointly processed with featureCounts as implemented in the package Rsubread (v1.16.1) in R (v3.1.2). Default settings were used with the following exceptions: annot.ext=GTFfile, isGTFAnnotationFile=TRUE, GTF.featureType=exon to use the same gtf annotation file as in STAR index, useMetaFeatures=TRUE, GTF.attrType=gene to summarize counts to the gene level, allowMultiOverlap=TRUE to allow counting in overlapping genes, isPairedEnd was set as appropriate for the respective samples, strandSpecific=0 because not all libraries were strand-specific and finally countMultiMappingReads=TRUE. The resulting count table was normalized to account for sequencing depth and count distribution with the TMM method as implemented in edgeR (v3.8.6) using default settings.

Bioinformatics Analysis

[0078] RNA-seq gene expression analysis was carried out using normalized counts for each gene in each tissue type. Where technical replicates are available for samples described in other studies, these reads were aligned and gene counts determined separately, then average gene counts were calculated. Furthermore, unless otherwise stated, gene counts for cPP and PPd15 cells are the mean of three independent samples harvested from cells derived from H9 and HES3 hESC, and AK6-13 hiPSC. For global comparisons of gene expression profiles, we compared 60,675 ENSEMBL genes or (where stated) 19,875 ENSEMBL protein-coding genes expressed at >5 normalized counts in at least one sample. All of the following analysis was carried out in R, using base packages unless stated otherwise.

Hierarchical Clustering of RNA-Seq Transcriptomes (FIG. 6A)

[0079] Euclidian distances between pairs of log2-transformed global gene counts were calculated using the R function dist( )and the distances plotted as a Dendrogram using the hclust( )function.

Heatmaps (FIG. 6B, 6E and 6F)

[0080] Heatmaps were plotted using the function heatmap.2( ).

Specifically Expressed Genes (FIG. 6C)

[0081] Specifically expressed genes are defined as those with CV >1 (Coefficient of Variance) and Z-score >1. CV is defined as the mean divided by the standard deviation across all samples, in this case the aforementioned 23 published tissue datasets plus the cPP and PPd15 gene counts described here. Zscore is defined as the difference between expression in the sample of interest and the mean for all samples, divided by the standard deviation across all samples. When calculating the Z-score for pancreatic samples other pancreatic samples are excluded.

Gene Ontogeny Analysis (FIG. 6D)

[0082] The web-based gene set analysis tool kit at http://www.webgestalt.org/ was used to analyze Gene Ontogeny (GO) terms associated with genes specifically expressed by cPP cells. Protein-coding genes were ordered according to the product of the coefficient of variance and Z-score for cPP cells (see above) and the top 250 genes selected for enrichment analysis. The Over Representations Analysis (ORA) tool was used to calculate fold-enrichment for biological process GO terms across these 250 genes, using all protein coding genes as the reference set, and the corresponding p-value adjusted by the Benjamini-Hochberg multiple test adjustment. GO terms were ordered according to fold enrichment and those associated with <5 genes and/or an adjusted p-value >0.01 were eliminated from the enriched set.

Multilineage Differentiation

[0083] Monolayer differentiation cultures were established as described herein. Basal differentiation medium consists of advanced DMEM/F12 (Thermo Fisher Scientific, 21634010), 2.5 g/30 mL BSA (Sigma, A9418), 2 mM L-glutamine (Thermo Fisher Scientific, 25030), 100 U/mL penicillin/streptomycin (Thermo Fisher Scientific, 15140122), and 1 B27 supplement (Thermo Fisher Scientific, 17504-044). Supplements were added as follows: days 1-3 (3 M RA [Sigma, R2625], 1 M DAPT [Sigma, D5942], 100 M BNZ [Sigma, B4560]) and days 4, 7, and 10 (3 M RA, 167 ng/mL KAAD-cyclopamine [Calbiochem, 239807]).

In vitro Differentiation

Establishing Differentiation Cultures

[0084] Initially, cPP cells were cultured to confluency to eliminate feeder cells then treated with gentle cell dissociation reagent to generate single cells. Single cells were resuspended in cPP culture media +10 M Y27632 and seeded according to differentiation platform. To establish 3D sphere cultures, 210.sup.6 cells were seeded into each well of an ultra-low adhesion 6 well plate (Corning, 3471) in 2 mL media and placed on a nutator overnight. Compact spheres typically form after 24 hours. To establish 3D matrigel cultures, AggreWell 400 plates (Stemcell Technologies, 27840) were used to generate spheres of 200 cells according to the manufacturer's instructions. After 24 hours 1200 spheres were resuspended in 500 L 1:5-diluted hESC-qualified matrigel (Corning, 354277) and deposited into each well of a 24 well plate. Plates were incubated at 37 C. for 60 min to allow matrigel to solidify before addition of media. To establish 2D monolayer cultures, cells were seeded at 6.6510.sup.5cells/cm.sup.2 on tissue culture plastic coated with matrigel diluted 1:50.

NKX6-1 Induction Tests

[0085] Differentiation cultures were treated with the following signaling regimes, based upon several recently published protocols, with minor alterations (Pagliuca et al., 2014; Rezania et al., 2014; Russ et al., 2015; Zhang et al., 2009). Differentiation media 1 consists of MCDB 131 media (Thermo Fisher Scientific, 10372-01), 2.5 g/L sodium bicarbonate (Lonza, 17-613E), 2 mM L-glutamine, 100 U/mL penicillin/streptomycin, 10 mM glucose (VWR International, 101174Y), and 2% bovine serum albumin (Sigma, A9418). Differentiation media 2 consists of DMEM high glucose, 2 mM L-glutamine, and 100 U/mL penicillin/streptomycin. Media based on PP2 induction media described by Pagliuca et al. consists of differentiation media 1 supplemented with 50 ng/mL FGF7 (R&D Systems, 251-KG), 0.25 mM ascorbic acid (Sigma, A4544), 100 nM RA, 0.25 M SANT-1 (Sigma, S4572), and 0.5% ITS-X (Thermo Fisher Scientific, 51500056). Media was completely replenished daily for 5 days. Media based on stage 4 media described by Rezania et al. was additionally supplemented with 300 nM lndolactam-V (Stemcell Technologies, 72312) and 200 nM LDN-193189 (Stemcell Technologies, 72142), and was completely replenished daily for 5 days. Media based on day 13-20 media described by Zhang et al. consists of differentiation media 2 supplemented with 10 ng/mL bFGF, 10 mM nicotinamide (Sigma, 24,020-6), 50 ng/mL exendin-4 (Sigma, E7144), 10 ng/mL BMP4 (R&D Systems, 314-BP), and 1% ITS-X. Media was completely replenished daily for 5 days. Media based on day 7-9 media described by Russ et al. consists of differentiation media 2 supplemented with 1B27 supplement, 50 ng/mL EGF, 1 M RA (first 24 hours), and 50 ng/mL FGF7 (second 24 hours). Media was completely replenished daily for 2 days.

Cell Differentiation

[0086] Differentiation sphere cultures were established as described in herein. Basal differentiation medium consists of DMEM high glucose, 2 mM L-glutamine, and 100 U/mL penicillin/streptomycin. Supplements were added as follows: days 1-4 (1B27 supplement, 50 ng/mL EGF, 1 M RA [days 1-2 only], 50 ng/mL FGF7 [days 3-4 only]); days 5-10 (1 B27 supplement, 500 nM LDN-193189 [STEMCELL Technologies, 72142], 30 nM TPB [EMD Millipore, 565740], 1 M RepSox [STEMCELL Technologies, 72392], 25 ng/mL FGF7); and days 11-17 (DMEM low glucose [Thermo Fisher Scientific, 12320-032], 2 mM L-glutamine, 1 MEM non-essential amino acids [Thermo Fisher Scientific, 11140-050]).

Transplantation Assays

[0087] cPP cells were grown to confluency to displace and eliminate feeder cells, then treated with gentle cell dissociation reagent to generate single cells. Approximately 310.sup.6 to 510.sup.6 cells were resuspended in 50 L of undiluted Matrigel and injected under the kidney capsule of 8- to 12-week-old immunocompromised (NOD/SCID) mice. After 23-27 weeks, transplanted mice were euthanized and their kidneys cryopreserved prior to sectioning and immunostaining. The study protocol was approved by the National University of Singapore Institutional Review Board (NUS IRB 12-181) and Biomedical Research Council IACUC committee (151040).

Quantitative RT-PCR

[0088] RNA was isolated from samples using an RNeasy mini kit (Qiagen, cat # 74104) and reverse transcribed to generate cDNA using a high-capacity reverse transcription kit and random hexamer primers (Applied Biosystems, 4368814,1 g RNA per 20 L reaction). Quantitative RT-PCR was carried out using SYBR Select Mastermix (Applied Biosystems, 4472908). Data were analyzed using the CT method, and normalized to expression of the housekeeping gene TBP in each sample. The primers used for qRT-PCR are shown in Table 2.

TABLE-US-00002 TABLE2 PrimersuseforqRT-PCR. Name Sequence SEQID AMY2B-Forward ATGCCTTCTGACAGAGCACT SEQIDNO.:1 AMY2B-Reverse ACAGCCTAGCATCCCAGAAG SEQIDNO.:2 BLM-Forward CAGACTCCGAAGGAAGTTGTATG SEQIDNO.:3 BLM-Reverse TTTGGGGTGGTGTAACAAATGAT SEQIDNO.:4 CAII-Forward GCCAAGTATGACCCTTCCCT SEQIDNO.:5 CAII-Reverse CCACGTTGAAAGCATGACCA SEQIDNO.:6 CPA1-Forward CTGACCATCATGGAGCACAC SEQIDNO.:7 CPA1-Reverse GCCAGAGAGGAGGACAAGAA SEQIDNO.:8 FEN1-Forward ATGACATCAAGAGCTACTTTGGC SEQIDNO.:9 FEN1-Reverse GGCGAACAGCAATCAGGAACT SEQIDNO.:10 FOXA2_Forward GGGAGCGGTGAAGATGGA SEQIDNO.:11 FOXA2_Reverse TCATGTTGCTCACGGAGGAGTA SEQIDNO.:12 GATA4_Forward TCCCTCTTCCCTCCTCAAAT SEQIDNO.:13 GATA4_Reverse TCAGCGTGTAAAGGCATCTG SEQIDNO.:14 GATA6_Forward CAGTTCCTACGCTTCGCATC SEQIDNO.:15 GATA6_Reverse TTGGTCGAGGTCAGTGAACA SEQIDNO.:16 GCG_Forward AAGCATTTACTTTGTGGCTGGATT SEQIDNO.:17 GCG_Reverse TGATCTGGATTTCTCCTCTGTGTCT SEQIDNO.:18 HNForwardB_Forward TCACAGATACCAGCAGCATCAGT SEQIDNO.:19 HNForwardB_Reverse GGGCATCACCAGGCTTGTA SEQIDNO.:20 HNF4A_Forward CATGGCCAAGATTGACAACCT SEQIDNO.:21 HNF4A_Reverse TTCCCATATGTTCCTGCATCAG SEQIDNO.:22 INS_Forward CAGGAGGCGCATCCACA SEQIDNO.:23 INS_Reverse AAGAGGCCATCAAGCAGATCA SEQIDNO.:24 ISL1-Forward AAACAGGAGCTCCAGCAAAA SEQIDNO.:25 ISL1-Reverse AGCTACAGGACAGGCCAAGA SEQIDNO.:26 KRT19-Forward AACGGCGAGCTAGAGGTGA SEQIDNO.:27 KRT19-Reverse GGATGGTCGTGTAGTAGTGGC SEQIDNO.:28 NGN3_Forward GCTCATCGCTCTCTATTCTTTTGC SEQIDNO.:29 NGN3_Reverse GGTTGAGGCGTCATCCTTTCT SEQIDNO.:30 NKX2-2_Forward GGGACTTGGAGCTTGAGTCCT SEQIDNO.:31 NKX2-2_Reverse GGCCTTCAGTACTCCCTGCA SEQIDNO.:32 NKX6-1_Forward CACACGAGACCCACTTTTTC SEQIDNO.:33 NKX6-1_Reverse CCGCCAAGTATTTTGTTTGT SEQIDNO.:34 ONECUT1_Forward GTGTTGCCTCTATCCTTCCCAT SEQIDNO.:35 ONECUT1_Reverse CGCTCCGCTTAGCAGCAT SEQIDNO.:36 PCNA-Forward CCTGCTGGGATATTAGCTCCA SEQIDNO.:37 PCNA-Reverse CAGCGGTAGGTGTCGAAGC SEQIDNO.:38 PDX1_Forward AAGTCTACCAAAGCTCACGCG SEQIDNO.:39 PDX1_Reverse GTAGGCGCCGCCTGC SEQIDNO.:40 POLE2-Forward TGAGAAGCAACCCTTGTCATC SEQIDNO.:41 POLE2-Reverse TCATCAACAGACTGACTGCATTC SEQIDNO.:42 PRIM1-Forward ATGGAGACGTTTGACCCCAC SEQIDNO.:43 PRIMI-Reverse CGTAGTTGAGCCAGCGATAGT SEQIDNO.:44 RFC4-Forward CCGCTGACCAAGGATCGAG SEQIDNO.:45 RFC4-Reverse AGGGAACGGGTTTGGCTTTC SEQIDNO.:46 RFX6_Forward AGCGGATCAATACCTGTCTCAGAA SEQIDNO.:47 RFX6_Reverse GCATAAAGAATGCACCGTGGTAAG SEQIDNO.:48 SOX9_Forward GAACGCACATCAAGACGGAG SEQIDNO.:49 SOX9_Reverse AGTTCTGGTGGTCGGTGTAG SEQIDNO.:50 SST_Forward CCCCAGACTCCGTCAGTTTC SEQIDNO.:51 SST_Reverse TCCGTCTGGTTGGGTTCAG SEQIDNO.:52 TBP_Forward TATAATCCCAAGCGGTTTGC SEQIDNO.:53 TBP_Reverse GCACACCATTTTCCCAGAAC SEQIDNO.:54 TERT-Forward AAATGCGGCCCCTGTTTCT SEQIDNO.:55 TERT-Reverse CAGTGCGTCTTGAGGAGCA SEQIDNO.:56 TRYP3-Forward CATCAATGCGGCCAAGATCA SEQIDNO.:57 TRYP3-Reverse GGAATTGATGACGGCAGGTG SEQIDNO.:58

Immunofluorescence Staining

[0089] The following primary antibodies were used for immunofluorescence staining: mouse monoclonal anti-PDX1 (R&D Systems, MAB2419, 1:50), rabbit anti-SOX9 (Sigma, HPA001758, 1:2000), rabbit anti-HNF6 (ONECUT1) (Santa Cruz, S.C.13050, 1:100), goat anti-FOXA2 (R&D Systems, AF2400, 1:200), rabbit anti-GATA6 (Cell Signaling Technologies, 5851, 1:1600), sheep anti-NGN3 (R&D Systems, AF3444, 1:200), mouse anti-NKX6-1 (developmental studies hybridoma bank, F55A12, 1:80), mouse monoclonal anti-KX2-2 (BD biosciences, 564731, 1:400), mouse monoclonal anti-pro-Insulin cpeptide (Millipore, 05-1109, 1:100), rabbit monoclonal anti-glucagon (Cell Signaling Technologies, 8233, 1:400), rat monoclonal anti-KRT19 (developmental studies hybridoma bank, TROMA-III-s, 1:10), sheep anti-trypsin (pan-specific) (R&D Systems, AF3586, 1:13). Primary antibodies were recognized by Alexa-fluorophore conjugated secondary antibodies raised in Donkey (Thermo Fisher Scientific, 1:500). Images were acquired using an Olympus FV1000 inverted confocal microscope.

Immunofluorescence Staining Transplanted Kidneys

[0090] Mouse kidneys were dissected, cleaned, longitudinally sectioned, embedded in Jung freezing medium (Leica, 020108926), and cryopreserved in liquid nitrogen. Sections (6 m) were mounted on APEScoated glass slides, dried and fixed in 4% paraformaldehyde for 10 min at room temperature. After washing 3 with PBS for 15 min, samples were permeabilised with PBS containing 0.3% Triton X-100 for 10 min, then blocked for 1 hour each in Rodent block M (Biocare medical, RBM961 H) and blocking buffer (PBS+20% normal donkey serum+1% BSA+0.3% Triton X-100). After washing 3 with wash buffer (PBS+0.1% Tween-20+0.1% BSA) for 15 min, samples were incubated overnight at 4oC with primary antibodies diluted in blocking buffer. After washing 3 with wash buffer for 15 min, samples were incubated at room temperature for 1 hour with secondary antibodies diluted 1:500 in blocking buffer. All subsequent steps were carried out in the dark. After washing 1 with wash buffer, samples were incubated at room temperature for 20 min with 2 g/mL Hoechst-33342 (Thermo Fisher Scientific, 62249) diluted in PBS. Finally, after washing 3 with wash buffer for 15 min, samples were covered with Vectashield hard set mounting medium (Vector Laboratories, H-1400), covered with a coverslip and sealed.

Immunofluorescence Staining Cultured Cells

[0091] Adherent cells were washed 2 with PBS then fixed in 4% paraformaldehyde for 20 min at room temperature. After washing 3 with wash buffer (PBS +0.1% BSA), samples were incubated with blocking buffer (PBS+20% normal donkey serum+0.1% BSA+0.3% Triton X-100) for 1 hour at room temperature. Samples were then incubated overnight at 4oC with primary antibodies diluted in blocking buffer. After washing 3 with wash buffer for 15 min, samples were incubated at room temperature for 1 hour with secondary antibodies diluted 1:500 in blocking buffer. All subsequent steps were carried out in the dark. After washing 3 with wash buffer for 15 min, samples were incubated at room temperature for 15 min with 2 g/mL Hoechst-33342 (Thermo Fisher Scientific, 62249) diluted in PBS. Finally, samples were washed 2 with PBS for 15 min and imaged.

Immunofluorescence Staining Differentiation Spheres

[0092] Differentiation spheres were washed 1 with PBS+2% serum then fixed in 4% paraformaldehyde for 30 min at room temperature. After washing 1 for 15 min with wash buffer (PBS+0.1% BSA+0.1% Tween-20), samples were blocked for 6 hours in blocking buffer (PBS+20% normal donkey serum+1% BSA+0.3% Triton X-100). Samples were then incubated overnight at 4oC with primary antibodies diluted in blocking buffer. After washing 2 with wash buffer for 15 min, samples were incubated at 4 C. for 6 hours with secondary antibodies diluted 1:500 in blocking buffer. All subsequent steps were carried out in the dark. After washing 1 with wash buffer for 15 min, samples were incubated at room temperature for 1 hour with 2 g/mL Hoechst-33342 (Thermo Fisher Scientific, 62249) diluted in PBS. Finally, spheres were washed 2 with PBS for 30 min, resuspended in Vectashield hard set mounting medium (Vector Laboratories, H-1400), mounted on glass slides, covered with a coverslip and sealed. All washing and incubation steps are carried out in 1.5mL Eppendorf tubes.

Flow Cytometry

[0093] Single cells were generated using accutase (Thermo Fisher Scientific, 14190), washed 1 with PBS+1% serum, then fixed in 4% paraformaldehyde for 10 min at room temperature. Cells were washed 1 with wash/permeabilization buffer (BD, 554723), then up to 10.sup.6 cells were incubated with primary or isotype control antibody diluted in 250 L wash/permeabilization buffer for the required length of time (see below for antibody dilutions and incubation times). For unconjugated antibodies, cells were washed 1 with wash/permeabilization buffer then incubated for 15 min with secondary antibody diluted in wash/permeabilization buffer. If staining for a second antigen, cells were washed 1 with wash/permeabilization buffer then subject to the aforementioned incubation step(s). After washing 1 with wash/permeabilization buffer, cells were resuspend cells in PBS+1% serum and analyzed using a BD FACSCalibur flow cytometer. All steps were carried out at room temperature and cells were pelleted by centrifugation at 6000 rpm for 5 min in a microcentrifuge.

[0094] The following antibodies were used: mouse monoclonal anti-PDX1 PE-conjugate (BD biosciences, 562161, 1:50, 45 min), mouse IgG1 PE-conjugate (BD biosciences, 556650, 1:50, 45 min), mouse monoclonal anti-NKX6.1 (developmental studies hybridoma bank, F55A12, 1:25, 45 min), goat antimouse IgG APC-conjugate (BD biosciences, 550828, 1:400, 15 min), mouse monoclonal anti-October3/4 Alexa Fluor 488-conjugate (BD biosciences, 560253, 1:5, 60 min), mouse monoclonal anti-pro-Insulin c-peptide (Millipore, 05-1109, 1:100, 60 min), anti-mouse IgG Alexa Fluor 488-conjugate (Thermo Fisher Scientific, A21202, 1:300, 30 min). All flow cytometry experiments were gated using cells stained only with fluorophore-conjugated isotype control (in the case of directly conjugated primary antibodies) or fluorophore-conjugated secondary antibodies.

Microbioreactor Array (MBA) Screening of cPP Maintenance and Proliferation

[0095] Microbioreactor arrays were used to screen the effects of combinations of exogenous signaling molecules on cPP cells. MBAs provide combinatorial mixing of input factors, combined with continuous flow of culture media over culture chambers. MBAs were autoclaved and filled with sterile PBS, then coated (2-4 h, room temperature) with a single 1 mL injection of hESC-qualified matrigel at the manufacturer's recommended concentration. cPP cells in suspension in complete medium at 5106/mL were then seeded in the MBA, giving a surface density of 5010.sup.6cells/cm.sup.2. Cells were allowed to attach for a total of 20 h, with a media exchange performed every 6 h. Subsequently, factor provision was commenced with an initial filling step of 300pL, followed by constant perfusion of factors at 36 L/h, for a total culture time of 3 days. At the endpoint, cells were rinsed with PBS, fixed with 2% PFA/PBS solution for 30 min, then rinsed with PBS and blocked/permeabilised with PBS+20% normal donkey serum+0.1% BSA+0.3% Triton X-100 for 30 min. Then, cells were labeled with primary antibodies against PDX1 (R&D Systems, MAB2419, 1:25), and SOX9 (Sigma, HPA001758, 1:1000) diluted in blocking buffer, overnight at 4 C. Cells were then washed with 0.1% BSA/PBS and labeled with Alexa-fluorophore conjugated secondary antibodies (Thermo Fisher Scientific, 1:500 dilution) and Hoechst 33342 (2 pg/mL) for 1 hour. Finally, cells were rinsed with PBS, and the MBA inlets and outlets plugged closed. The MBA was then mounted in a microplate adapter and imaged. Nuclear segmentation and quantification of nuclear intensities of PDX1 and SOX9 then proceeded similarly as previously described.

Accession Numbers

[0096] Primary RNA-seq datasets generated in this study are available at ArrayExpress under accession number ArrayExpress: E-MTAB-5731.

RESULTS

[0097] Maintenance and Expansion of cPP Cells Derived from hESCs and hiPSCs

[0098] Directed differentiation guided by growth factors and small molecules facilitates the generation of diverse cell types from pluripotent stem cells. Pancreatic progenitors were produced from hESCs and hiPSCs (FIG. 1) using reagents based on the early stages of a protocol designed to generate mature cells (FIG. 2A; Rezania et al., 2014). This differentiation strategy induced the sequential expression of PDX1 followed by NKX6-1 and yielded a median of 80% PDX1+NKX6-1+ cells after 15 days (PPd15 cells; FIG. 3B and 2C). However, as is often observed during directed differentiation from pluripotent cells, the kinetics of PDX1 and NKX6-1 expression varied between cell lines (FIG. 2B). Therefore, this study sought to capture, synchronize, and expand PPd15 cells in culture.

[0099] The 3T3-J2 mouse embryonic fibroblast cell line has been used to culture progenitor cells derived from a variety of human tissues, including endoderm-derived intestinal stem cells. This study therefore determined whether pancreatic progenitor cells could be similarly expanded, if provided with appropriate stimuli. A series of signaling agonists and inhibitors previously shown to regulate pancreatic development were tested, including EGFL7, BMP4, nicotinamide, LIF, WNT3A, R-Spondin-1, Forskolin (cAMP agonist), GSK3b inhibition (CHIR99021), and inhibitors of BMP (LDN-193189) and SHH (KAAD-cyclopamine) signaling. Ultimately, a combination of EGF, retinoic acid, and inhibitors of transforming growth factor (TGF-, SB431542) and Notch signaling (DAPT) was found to support long-term self-renewal of pancreatic progenitors (FIG. 3A). To establish stable cPP cell lines, PPd15 cells were replated on a layer of 3T3-J2 feeder cells in the presence of these factors. Thereafter, cPP cells were routinely passaged once weekly as aggregates at an average split ratio of 1:6, although they were also capable of forming colonies at clonal density (FIG. 3C). This suggests a doubling time of 65 hr in culture, similar to the 61 hr routinely observed for hESCs when cultured on a layer of mouse embryonic fibroblasts.

[0100] This study was able to generate self-renewing cPP cell lines from four different genetic backgrounds using two hESC (H9 and HES3) and three hiPSC cell lines (AK5-11, AK6-8, and AK6-13 derived in house); these diverse cPP cells expressed comparable levels of genes encoding key pancreatic transcription factors, including PDX1 and SOX9 (FIG. 2D). Two cPP cell lines selected for further analysis (H9#1 and AK6-13) have been maintained in culture for >20 passages to date enabling >1018-fold expansion over 20 weeks. Crucially, cPP cells can be frozen and thawed with no apparent loss of proliferation or viability, suggesting cPP cells could replace pluripotent cells as a starting point for further differentiation to mature pancreatic cell types such as insulin-secreting cells.

[0101] To determine whether cPP cultures consist of a stable and homogeneous population of cells, the expression of key pancreatic transcription factors was measured at the mRNA and protein levels. Gene expression of numerous markers of pancreatic bud cells, including PDX1 and SOX9, remained constant over extended periods in culture, indicating

[0102] that the culture conditions maintain a stable population of pancreatic progenitors (FIG. 3D).

[0103] To determine whether cPP cultures represent a homogeneous population, immunostaining was carried out for a selection of pancreatic markers and found these to be expressed near ubiquitously at the protein level (FIG. 3E). Furthermore, flow cytometric analysis showed that approximately 85% of cPP cells were PDX1+ (FIG. 3F).

[0104] However, NKX6-1 expression was rapidly downregulated in culture, and NKX6-1 protein was not detected by immunostaining. Furthermore, we were able to establish cPP cell lines from day 7, 10, and 15 differentiation cultures (data not shown), the earliest time point being prior to expression of NKX6-1 and suggesting that cPP culture conditions stabilize pancreatic progenitors in a developmental state that precedes NKX6-1 activation. Very few cells were NGN3+, which marks early endocrine progenitors, indicating that differentiation was blocked at the progenitor stage under our culture conditions. Finally, chromosome counting showed that five out of six cPP cells carried 46 chromosomes without signs of structural changes, such as presence of fragments or dicentric chromosomes (FIG. 4A). Multiplex fluorescence in situ hydridization (M-FISH) analysis on the AK6-13 line at passage 20 confirmed the absence of karyotypic abnormalities (FIG. 4B). Collectively, these data demonstrate that the cPP culture conditions capture pancreatic progenitors as a near homogeneous population that is maintained stably over extended periods of time and is capable of extensive expansion.

Transcriptome Analysis Demonstrates cPP Cells Are Closely Related to Their In Vivo Counterparts

[0105] Next, this study determined the transcriptome-wide gene counts by RNA-seq for cPP lines from three different genetic backgrounds and the PPd15 differentiation cultures from which they were established. Samples for RNA-seq were also taken from cPP cells at early, mid, and late passages. Gene expression levels correlated strongly between different cPP samples, indicating that neither genetic background nor time in culture significantly affect the cPP transcriptome (FIG. 5A). However, to completely eliminate donor-specific effects on gene expression, the following analysis used mean gene counts for cPP (early passage) and PPd15 cells derived from H9 and HES3 hESCs and AK6-13 hiPSCs.

[0106] To determine how similar cPP cells are to their in vitro and in vivo counterparts, the cPP transcriptome was compared with the published transcriptomes of pancreatic progenitors differentiated in vitro (Cebola PP) and from CS16-18 human embryos (CS16-18 PP), and a diverse collection of adult and embryonic tissues. Relative to non-pancreatic tissues, cPP cells exhibited similar patterns of gene expression to both PPd15 and Cebola PP cells (FIG. 6A). Furthermore, cPP, PPd15, and Cebola PP cells closely resembled in vivo pancreatic progenitors at CS16-18, and all four cell populations expressed similar levels of genes associated with endodermal and pancreatic development (FIG. 6B). However, as expected, cPP cells do not express the late-stage pancreatic progenitor markers NKX6-1, PTF1A, and CPA1. When taken together, these data demonstrate that the culture conditions described here maintain cPP cells in a developmental state closely related to both the embryonic human pancreas and pancreatic progenitors generated by directed differentiation.

[0107] To further characterize the transcriptional identity of cPP cells, this study sought to identify genes that distinguish them from other lineages. Specifically expressed genes were defined as those that are variably expressed across the aforementioned panel of 25 tissues (coefficient of variance >1) and whose expression is upregulated in cPP cells (Z score >1). In total 1,366 genes were identified, including numerous well-characterized markers of pancreatic progenitor cells, such as PDX1, SOX9, MNX1, and RFX6 (FIG. 6C). To confirm the validity of this method, this study demonstrated that these genes are not expressed by other endodermal derivatives, including liver, colon, and lung (FIG. 5B). Encouragingly, around 80% of genes specifically expressed by cPP cells were shared with CS16-18 pancreatic progenitors and/or PPd15 cells. Furthermore, gene Z scores were highly correlated between these three pancreatic cell types but not with liver (FIG. 5C), further demonstrating the transcriptional similarities between cPP cells and other pancreatic progenitors.

[0108] To determine the functional roles of cPP-specific genes, this study analyzed associated Gene Ontology (GO) terms. The most enriched terms were those associated with endocrine pancreas development (FIG. 3D, above). In order to determine how the culture conditions affect the behavior of cPP cells, this study analyzed GO terms associated with genes expressed by cPP cells but not PPd15 or CS16-18 pancreatic progenitor cells (FIG. 6D, below). Interestingly, the most enriched terms were those associated with aspects of cell division and telomere maintenance. Indeed, genes associated with these enriched terms, such as those encoding telomerase reverse transcriptase (TERT) and proliferating cell nuclear antigen (PCNA), were consistently upregulated in cPP cells from different genetic backgrounds, compared with the PPd15 populations from which they were derived (FIG. 6E and 6F). The inventors concluded that the feeder-based culture system maintains pancreatic progenitors as a stable population while upregulating genes required for long-term self-renewal.

A Feeder Layer of 3T3-J2 Cells Prevents cPP Differentiation while Exogenous Signals Promote Proliferation

[0109] This study next investigated the roles played by the individual components of the culture system, specifically the layer of irradiated 3T3-J2 feeder cells, stimulation with EGF, FGF10, and retinoic acid (RA), and inhibition of the TGF and Notch signaling pathways. To assess the importance of the feeder layer, cPP cells were subcultured onto a layer of 3T3-J2 cells plated at decreasing densities and maintained in complete cPP culture media for 7 days. At reduced feeder densities, cPP cells continued to proliferate rapidly but quickly altered their morphology and could not be serially passaged (FIG. 7A). The levels of PDX1 and SOX9 remained stable, indicating cPP cells are committed to the pancreatic lineage, while markers of duct (KRT19 and CA2) and acinar (CPA1 and AMY2B) differentiation were upregulated (FIG. 7B). However, upregulation of endocrine markers (NGN3 and NKX2-2) was not observed, suggesting that 3T3-J2 feeder cells are required to block further differentiation toward the ductal and acinar linages.

[0110] To establish the roles played by the growth factors and small molecules in our culture media, each was removed individually and the effect on differentiation and proliferation was assessed. Exclusion of EGF or RA prevented cPP expansion, while removal of the TGF- inhibitor SB431542 caused colonies to detach from the feeder layer (FIG. 7C). Removal of either FGF10 or the g-secretase inhibitor DAPT did not significantly affect colony size or morphology in the short term but, when removed from the culture media over multiple passages, led to a noticeable loss of viability. Interestingly, none of the growth factors or signaling inhibitors was individually required for maintenance of PDX1 or SOX9 expression (FIG. 7D). Indeed, removal of RA actually increased PDX1 expression. These results suggest that the growth factors and inhibitors present in our culture media are primarily required to drive proliferation of cPP cells rather than maintain their developmental state.

[0111] To quantify the effect of exogenous signaling molecules on the maintenance and expansion of cPP cells, this study used a microbioreactor array (MBA) screening platform to measure differentiation and proliferation. Single cPP cells were seeded in Matrigel-coated culture chambers in the absence of feeders and exposed for 3 days to complete cPP culture media in which the levels of EGF, RA, and DAPT were varied (FIG. 8). The study then used an image-segmentation algorithm to identify individual nuclei and quantify immunofluorescence staining for PDX1 and SOX9, thereby enabling the determination of the percentage of double-positive cells following exposure to different growth factor regimes. Reducing the levels of any of the three factors led to a reduction in both the total number of cells and the number of PDX1+ SOX9+cells (FIG. 7E). However, neither the mean levels of PDX1/SOX9 nor the percentage of PDX1+ SOX9+cells were dependent on the levels of these factors, suggesting they act primarily as mitogens. Interestingly, an increase in the number and percentage of PDX1+SOX9+ cells was noticed, but no change in the overall proliferation rate, when cells were exposed to higher concentrations of autocrine signals, particularly when provided with maximal levels of EGF, RA, and DAPT (FIG. 8D). Exposure to endogenous soluble signaling molecules is therefore required to maintain PDX1 and SOX9 independently of proliferation.

[0112] When taken together, these observations demonstrate that self-renewal of cPP cells is dependent on activation of the EGF, FGF10, and RA pathways and inhibition of Notch signaling. Indeed, cPP cells and their in vitro (PPd15) and in vivo (CS16-18 pancreatic progenitor) equivalents expressed high levels of multiple receptors of EGF, FGF, RA, and Notch signaling, as well as the TGF receptors ALK4 and ALKS (encoded by ACVR1 B and TGFBR1, respectively) that are inhibited by SB431542 (FIG. 7F). Consistent with the observations, production of FGF10 and RA by the surrounding mesenchyme is essential for expansion of the murine pancreatic bud, while EGFR is expressed throughout the pancreas and regulates islet development. Intracellular Notch signaling promotes expansion of pancreatic progenitors and prevents their further differentiation into endocrine cells. Therefore, this study's observation that the g-secretase inhibitor DAPT promotes proliferation of cPP cells is somewhat surprising. However, FGF10 has been shown to promote Notch activity in the developing pancreatic epithelium, and cPP cells express intermediate levels of the Notch effector HES1 relative to the 23 tissues described in FIG. 6A (data not shown). Therefore, the relatively low concentration of DAPT added to cPP cultures most likely serves to temper Notch activity, and exceptionally high levels of Notch activity might actually suppress proliferation.

Differentiation of cPP Cells into Pancreatic Cell Types In Vitro and In Vivo

[0113] The canonical property of pancreatic progenitors is their ability to differentiate into each of the three lineages that constitute the pancreas as well as their functional derivatives. Initially, this study sought to determine whether cPP cells are capable of commitment to the endocrine, duct, and acinar lineages in vitro. Since robust protocols for the directed differentiation of pancreatic duct and acinar cells have yet to be developed, cPP cells were replated in the absence of feeders and exposed to a minimal signaling regime that promotes multilineage differentiation (FIG. 9A). Over the course of 12 days, upregulation of endocrine (NKX6-1, INS, and GCG), acinar (CPA1, AMY2B, and TRYP3), and duct (SOX9, KRT19, and CA2) markers was observed, demonstrating that cPP cells retain multilineage potency in vitro (FIG. 9B).

[0114] Of particular interest is the ability to generate b-like cells capable of secreting insulin in response to elevated glucose levels. Several groups recently published protocols that describe the differentiation of particular hESC and hiPSC cell lines into b-like cells. Activation of NKX6-1 prior to expression ofNGN3is thought to be essential for the formation of mature, functional cells. Therefore, the four most promising protocols (Pagliuca et al., 2014; Rezania et al., 2014; Russ et al., 2015; Zhang et al., 2009) were selected and assessed their ability to induce NKX6-1 expression while maintaining low levels of NGN3. Specifically, cPP cells were cultured as monolayers or aggregates, then exposed to the section of each differentiation protocol shown to induce NKX6-1 expression (FIG. 10A). The protocol described by Russ et al. (2015) produced the highest levels of NKX6-1 expression and minimal activation of NGN3, with monolayer and suspension cultures yielding a very similar response (FIG. 10B). Since the original protocol demonstrated the generation of insulin-secreting b-like cells when cells were differentiated as aggregates, this study chose to use the 3D suspension platform for subsequent experiments. Using the Russ et al. (2015) protocol, the study found that around 40% of cPP cells reactivate NKX6-1. However, doubling the length of each of the first two treatments enabled the generation of nearly 70% double-positive cells, similar to the number originally reported (FIG. 9E, 10C, and 10D). Interestingly, these PDX1+NKX6-1+ cells generated convoluted structures reminiscent of the branching morphogenesis of the embryonic pancreas (FIG. 9D and 9F). Further differentiation induced expression of the endocrine markers NKX2-2 and NGN3, the latter in a smaller subset of cells, reflecting its transient expression during endocrine commitment (FIG. 9G). Finally, after 16 days, 20% of cells contained C-peptide, a proxy for insulin production, similar to the 25% reported by Russ et al. (2015). Crucially, C-peptide+ cells did not co-express the a cell hormone glucagon, suggesting that these cells are unlike the polyhormonal cells produced by earlier generations of protocols, which are unable to secrete insulin in response to elevated glucose levels. However, NGN3 levels remained high at the end of the protocol and INS mRNA levels were significantly lower than in isolated human islets, suggesting that further optimization of the protocol is required (FIG. 9K).

[0115] The most stringent test of developmental potency is whether a progenitor can differentiate into a particular lineage in vivo. To assess the potency of cPP cells, these cells were injected under the renal capsules of immunodeficient mice and immunostained for markers of the three major pancreatic lineages after >23 weeks. Large areas of cells expressing the b-cell marker C-peptide were able to be identified as well as the duct marker keratin 19 (KRT19), but this study was unable to find trypsin+ acinar cells or glucagon+ endocrine cells (FIG. 9L). However, trypsin+ cells were also observed rarely in prior studies following transplantation of pancreatic progenitors, possibly because acinar cells cannot survive in the absence of ducts to carry away the digestive enzymes they secrete. The absence of cells expressing glucagon was surprising, but likely reflects generation of C-peptide+ cells by default in the absence of inductive signals required to form glucagon+a cells.

[0116] The C-peptide+ cells did not form classical islet-like structures, but instead formed a series of interconnected cystic structures, as others have observed previously. Furthermore, this study did not observe expansion of the progenitor population once transplanted, suggesting cPP cells differentiate rapidly into less proliferative cells in vivo. Accordingly, none of the 12 mice assessed exhibited teratoma formation, despite transplanting >3 million cells into each mouse. These observations demonstrate that cPP cells retain the ability to differentiate into endocrine and duct cells in vivo, although it remains to be seen whether they are capable of forming acinar cells. Furthermore, the absence of teratoma formation suggests cPP cells may represent a safer alternative for transplantations than cells differentiated directly from pluripotent stem cells.

DISCUSSION

[0117] Pluripotent stem cells have been proposed as an unlimited source of cells for modeling and treating diabetes. However, the routine generation of functional cells from diverse patient-derived hiPSC remains a challenge, partly because of the variability inherent in long, multi-step directed differentiation protocols. This study describes a platform for long-term culture of self-renewing pancreatic progenitor cells derived from human pluripotent stem cells. These cPP cells are capable of rapid and prolonged expansion, thereby offering a convenient alternative source of cells. Furthermore, cPP cells can be stored and transported as frozen stocks, and cPP cells have been cultured for at least 25 passages with no loss of proliferation. It was observed that cPP cells express markers of pancreatic endocrine, duct, and acinar cells when differentiated in vitro, thereby demonstrating their multipotency, and this study was able to generate up to 20% C-peptide+ cells using a modified version of the cell differentiation protocol described by Russ et al. (2015). The definitive test of developmental potency is whether a cell can differentiate into a particular lineage in vivo, and cPP cells indeed generate significant numbers of keratin-19+ duct cells and C-peptide+b-like

[0118] cells when transplanted under the renal capsule of an immunodeficient mouse, although it is unclear whether they retain the ability to form acinar cells in vivo.

[0119] Cells differentiating in vitro typically do so in an unsynchronized manner, causing cultures to become progressively more heterochronic with time and reducing the efficiency with which cells can be directed toward particular lineages. Therefore, the ability to capture and synchronize differentiating progenitors is essential for developing robust protocols for generating functional cells from diverse genetic backgrounds. Extensive molecular characterization revealed that cPP cultures generated from both hESC and hiPSC represent stable populations of cells that express early pancreatic transcription factors consistently over time. The cPP transcriptome is closely related to that of the progenitor cells of the CS16-18 pancreas. However, comparison with human embryos at different stages of development suggests that cPP cells most closely resemble cells of the pancreatic bud between CS12 and CS13, based on robust expression of PDX1, SOX9, FOXA2, and GATA.sup.4/.sub.6 and the absence of NKX6-1 and SOX17.

[0120] In recent years, several groups reported methods for culturing human endodermal derivatives. Two separate reports demonstrated that hESC-derived definitive endoderm can be serially passaged and expanded if cultured on a feeder layer in the presence of appropriate mitogenic signals. Subsequently, another group showed that foregut progenitor cells can be cultured in feeder-free conditions. However, slow growth and variable gene expression between different lines have limited their utility. More recently, it was shown that pancreatic progenitors derived from reprogrammed endodermal cells could be expanded and passaged. However, these cultures are highly heterogeneous, and it is not clear whether the minimal combination of signaling molecules and inhibitors used is sufficient to culture cells from different genetic backgrounds. Therefore, the culture system described here is the first to enable long-term self-renewal of multipotent pancreatic progenitors derived from genetically diverse hESC and hiPSC.

REFERENCES

[0121] 1. Russ, H. A., Parent, A.V., Ringler, J. J., Hennings, T. G., Nair, G. G., Shveygert, M., Guo, T., Puri, S., Haataja, L., Cirulli, V., et al. (2015). Controlled induction of human pancreatic progenitors produces functional beta-like cells in vitro. EMBO J. 34, 1759-1772. [0122] 2. Pagliuca, F. W., Millman, J. R., Grtler, M., Segel, M., Van Dervort, A., Ryu, J. H., Peterson, Q. P., Greiner, D., and Melton, D. A. (2014). Generation of functional human pancreatic cells in vitro. Cell 159, 428-439. [0123] 3. Rezania, A., Bruin, J. E., Arora, P., Rubin, A., Batushansky, I., Asadi, A., O'Dwyer, S., Quiskamp, N., Mojibian, M., Albrecht, T., et al. (2014). Reversal of diabetes with insulin-producing cells derived in vitro from human pluripotent stem cells. Nat. Biotechnol. 32, 1121-1133. [0124] 4. Zhang, D., Jiang,W., Liu, M., Sui, X., Yin, X., Chen, S., Shi, Y., and Deng, H. (2009). Highly efficient differentiation of human ES cells and iPS cells into mature pancreatic insulin-producing cells. Cell Res. 19, 429-438. [0125] 5. Micallef, S. J., Li, X., Schiesser, J. V., Hirst, C. E., Yu, Q. C., Lim, S. M., Nostro, M. C., Elliott, D. A., Sarangi, F., Harrison, L. C., Keller, G., Elefanty, A.G., Stanley, E. G., 2011. INS GFP/w human embryonic stem cells facilitate isolation of in vitro derived insulin-producing cells. Diabetologia 55,694-706.