REAGENT FOR EXTRACTING AND AMPLIFYING NUCLEIC ACID

20200140924 ยท 2020-05-07

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention addresses the problem of providing: a reagent for extracting/amplifying a nucleic acid of a nucleic acid extraction target, the reagent being characterized in that a nucleic acid is conveniently extracted quickly and efficiently from the nucleic acid extraction target and inhibition of a nucleic acid amplification reaction is minimized, and the problem of providing a method for extracting or amplifying a nucleic acid using said reagent. The problems are solved by using a kit for extracting and amplifying a nucleic acid of a nucleic acid extraction target from a sample containing the nucleic acid extraction target, the kit including (i) a nucleic acid extraction reagent containing at least a surfactant having a steroid skeleton, (ii) -cyclodextrin having a C1-4 hydroxyalkyl group, and (iii) a nucleic acid amplification reagent.

Claims

1. A kit for extracting and amplifying a nucleic acid of a nucleic acid extraction target from a sample containing the nucleic acid extraction target, comprising (i), (ii) and (iii), wherein the nucleic acid extraction target is selected from microorganisms, animal cells, plant cells, and extracellular vesicles: (i) a nucleic acid extraction reagent, containing at least a surfactant with a steroid skeleton; (ii) -cyclodextrin having a C1-4 hydroxyalkyl group; and (iii) a nucleic acid amplification reagent.

2. The kit according to claim 1, wherein the -cyclodextrin having a C1-4 hydroxyalkyl group is 2-hydroxypropyl--cyclodextrin.

3. The kit according to claim 1, wherein the -cyclodextrin having a C1-4 hydroxyalkyl group is contained in the nucleic acid amplification reagent.

4. The kit according to claim 1, wherein the concentration of the -cyclodextrin having a C1-4 hydroxyalkyl group is 4 or more times the concentration of the surfactant with a steroid skeleton.

5. The kit according to claim 1, wherein the nucleic acid extraction target is a microorganism.

6. A method for extracting and amplifying a nucleic acid of a nucleic acid extraction target from a sample containing the nucleic acid extraction target, comprising steps (i), (ii) and (iii), wherein the nucleic acid extraction target is selected from microorganisms, animal cells, plant cells, and extracellular vesicles: (i) a nucleic acid extraction step, which involves contacting a sample containing a nucleic acid extraction target with a nucleic acid extraction reagent containing at least a surfactant with a steroid skeleton, thereby obtaining a nucleic acid extract; (ii) a step of contacting the nucleic acid extract obtained in (i) with -cyclodextrin having a C1-4 hydroxyalkyl group; and (iii) a nucleic acid amplification step, which involves contacting the solution obtained in (ii) with a nucleic acid amplification reagent.

7. A method for extracting and amplifying a nucleic acid of a nucleic acid extraction target from a sample containing the nucleic acid extraction target, comprising steps (i) and (ii), wherein. the nucleic acid extraction target is selected from microorganisms, animal cells, plant cells, and extracellular vesicles: (i) a nucleic acid extraction step, which involves contacting a sample containing the nucleic acid extraction target with a nucleic acid extraction reagent containing at least a surfactant with a steroid skeleton, thereby obtaining a nucleic acid extract; and (ii) a nucleic acid amplification step, which involves contacting the nucleic acid extract obtained in (i) with a nucleic acid amplification reagent containing -cyclodextrin having a C1-4 hydroxyalkyl group.

8. The method according to claim 6, wherein the nucleic acid extraction target is a microorganism.

9. The method according to claim 7, wherein the nucleic acid extraction target is a microorganism.

Description

EXAMPLES

[0041] The present invention will be described in greater detail as follows with reference to examples and referential examples of the use of influenza virus or Mycoplasma pneumoniae as nucleic acid extraction targets, but the present invention is not limited by these examples.

Example 1 Preparation of Standard RNA

[0042] Primers, influenza virus SNA (hereinafter, denoted as standard RNA) and intercalating fluorescent dye standard nucleic acid probes used in the following examples were prepared by the methods described in Japanese Unexamined Patent Publication (Kokai) No. 2016-131498.

Example 2 Inclusion Effect of Cyclodextrin Derivative

[0043] The inclusion effects of cyclodextrin derivatives on a surfactant were examined by the following method.

[0044] (1) Type A (subtype H1N1) influenza virus standard RNA prepared in Example 1 was diluted with water for injection so that the concentration was 10.sup.3 copies/2.5 L, and then the resultant was used as an RNA sample.

[0045] (2) The RNA sample (2.5 L) prepared in (1) was added to 12.5 L of a surfactant-containing solution (hereinafter, denoted as viral extract) composed of the following composition and preheated at 46 C. The solution was agitated and maintained at 46 C. for 4 minutes, thereby preparing 15 L of viral RNA extract.

[0046] Composition of a viral extract: The concentration thereof was the final concentration after addition of a virus sample (in 15 L).

TABLE-US-00001 44.4 mM magnesium chloride 110 mM potassium chloride 2.4% glycerol 22.0% DMSO 0.1% (v/v) Tween20 1.5% (w/w) sodium cholate.

[0047] (3) A cyclodextrin derivative-containing reaction solution (15 L) composed of the following composition was dispensed to 0.5-mL PCR tubes (Individual Dome Cap PCR Tube, SSI and then maintained at 46 C. for 4 minutes. Immediately after 4 minutes of maintaining the temperature at 46 C., 15 L of the viral RNA extract obtained in (2) was added. In addition, as first primers and second primers, oligonucleotides having sequences and concentrations listed in Table 1 were used in combination. Further, to each first primer, T7 promoter sequence (SEQ ID NO: 3) was added to the 5 end side of the nucleotide sequence described in each SEQ ID NO listed in Table 1.

TABLE-US-00002 TABLE 1 SEQ ID Concen- NO: tration Remarks First 1 0.4 M Nucleotide 616 to nucleotide 635 of the primer nucleotide sequence under GenBank No. FJ969536 (for type A (subtype HIN1)) 4 0.2 M Nucleotide 662 to nucleotide 681 of the nucleotide sequence under GenBank No. KJ741989 (for type A (subtype H3N2)) 6 0.6 M Nucleotide 432 to nucleotide 452 of the nucleotide sequence under GenBank No. CY115184 (for type B) Second 2 0.4 M Complementary strand of nucleotide 717 to primer nucleotide 743 of the nucleotide sequence under GenBank No. FJ969536 (for type A (subtype HIN1)) 5 0.2 M Complementary strand of nucleotide 762 to nucleotide 788 of the nucleotide sequence under GenBank No. KJ741989 (for type A (subtype H3N2)) 7 0.6 M Complementary strand of nucleotide 543 to nucleotide 565 of the nucleotide sequence under GenBank No. CY115184 (for type B)

[0048] Composition of reaction solution: The concentration was the final concentration after addition of viral RNA extract (in 30 L).

TABLE-US-00003 60 mM Tris-HCl (pH 8.6) 0.25 mM each: dATP, dCTP, dGTP and dTTP 2.7 mM each: ATP, CTP, UTP and GTP 3.06 mM ITP 70 mM trehalose 9.1 U AMV reverse transcriptase 142 U T7 RNA polymerase 20 nM each INAF probe (prepared in Example 1)

[0049] First primer (for type A (subtype H1N1)) with the concentration described in Table 1

[0050] Second primer (for type A (subtype H1N1)) with the concentration described in Table 1

[0051] Cyclodextrin derivatives with concentrations each described in Table 2 to Table 11

[0052] (4) Subsequently, with the use of a spectrophotofluorometer (TRC Rapid-160, TOSOH CORPORATION) having a temperature-controlling function and being capable of directly measuring PCR tubes, the fluorescence intensity (excitation wavelength: 470 nm, and fluorescent wavelength: 520 nm) of the reaction solution was measured over time for 30 minutes simultaneously with reaction at 46 C. A case where the fluorescence intensity ratio (the value obtained by dividing the value of the fluorescence intensity at a predetermined time by the value of the fluorescence intensity of the background) of the reaction solution was higher than 1.2 was determined positive. The time upon mixing with the reagent was designated as 0 minutes, and the time required to obtain a positive determination was designated as the detection time.

[0053] The results are depicted in Table 2 to Table 11.

TABLE-US-00004 TABLE 2 Final concentration Detection time Cyclodextrin derivative (in 30 L) (mm) 2-hydroxypropyl--cyclodextrin 2 N.D. 4 N.D. 6 N.D. 6.8 4.50 8 3.56 -cyclodextrin 6.8 4.13 No addition 0 N.D.

TABLE-US-00005 TABLE 3 Final concentration Detection time Cyclodextrin derivative (in 30 L) (min) 2-hydroxypropyl--cyclodextrin 8 4.21 10 3.67 12 3.70 14 4.09 -cyclodextrin 6.8 5.67 No addition 0 N.D.

TABLE-US-00006 TABLE 4 Final concentration Detection time Cyclodextrin derivative (in 30 L) (min) 2-hydroxyethyl--cyclodextrin 2 N.D. 4 N.D. 6 N.D. 8 N.D. 10 N.D. 12 8.96 14 5.08 16 5.38 -cyclodextrin 6.8 5.00 No addition 0 N.D.

TABLE-US-00007 TABLE 5 Final concentration Detection time Cyclodextrin derivative (in 30 L) (min) 2-hydroxypropyl--cyclodextrin 2 N.D. 4 N.D. 6 N.D. 8 N.D. 10 11.10 12 7.48 14 6.02 16 6.39 -cyclodextrin 6.8 5.00 No addition 0 N.D.

TABLE-US-00008 TABLE 6 Final concentration Detection time Cyclodextrin derivative (in 30 L) (min) Methyl--cyclodextrin 2 N.D. 4 N.D. 6 N.D. 8 N.D. 10 N.D. 12 N.D. 14 N.D. 16 N.D. -cyclodextrin 6.8 5.02 No addition 0 N.D.

TABLE-US-00009 TABLE 7 Final concentration Detection time Cyclodextrin derivative (in 30 L) (min) 2-hydroxypropyl--cyclodextrin 2 N.D. 4 N.D. 6 N.D. 8 N.D. 10 N.D. 12 N.D. 14 N.D. 16 N.D. -cyclodextrin 6.8 5.29 No addition 0 N.D.

TABLE-US-00010 TABLE 8 Final concentration Detection time Cyclodextrin derivative (in 30 L) (min) Monoacetyl--cyclodextrin 2 N.D. 4 N.D. 6 N.D. 8 N.D. 10 N.D. 12 N.D. 14 N.D. 16 N.D. -cyclodextrin 6.8 5.80 No addition 0 N.D.

TABLE-US-00011 TABLE 9 Final concentration Detection time Cyclodextrin derivative (in 30 L) (min) 3A-amino-3A-deoxy-(2AS,3AS)-- 2 N.D. cyclodextrin 4 N.D. 6 N.D. 8 N.D. 10 N.D. 12 N.D. 14 N.D. 16 N.D. -cyclodextrin 6.8 5.93 No addition 0 N.D.

TABLE-US-00012 TABLE 10 Final concentration Detection time Cyclodextrin derivative (in 30 L) (min) Mono-2-O-(p-toluenesulfonyl)-- 2 N.D. cyclodextrin 4 N.D. 6 N.D. 8 N.D. 10 N.D. 12 N.D. 14 N.D. 16 N.D. -cyclodextrin 6.8 5.28 No addition 0 N.D.

TABLE-US-00013 TABLE 11 Final concentration Detection time Cyclodextrin derivative (in 30 L) (min) -cyclodextrin phosphate 2 N.D. 4 N.D. 6 N.D. 8 N.D. 10 N.D. 12 N.D. 14 N.D. 16 N.D. -cyclodextrin 6.8 5.14 No addition 0 N.D.

[0054] 2-hydroxypropyl--cyclodextrins of Table 2 and Table 3 were confirmed to exhibit the inclusion effect at 6.8% (w/w) or more, to exhibit the shortest time required for a positive determination at 10% (w/w), suggesting the high effect at 10% (w/w), and to exhibit the effect at 8% (w/w) higher than that of 6.8% (w/w) -cyclodextrin.

[0055] 2-hydroxyethyl--cyclodextrin of Table 4 was confirmed to exhibit the inclusion effect at 12% (w/w) or more, and to exhibit the shortest time required for a positive determination at 14% (w/w), suggesting the high effect at 14%(w/w), but to never exhibit the time required for a positive determination shorter than that of 6.8% (w/w) -cyclodextrin.

[0056] 2-hydroxypropyl--cyclodextrin of Table 5 was confirmed to exhibit the inclusion effect at 10% (w/w) or more, and to exhibit the shortest time required for a positive determination at 14% (w/w), suggesting the high effect at 14% (w/w), but to never exhibit the time required for a positive determination shorter than that of 6.8% (w/w) -cyclodextrin.

[0057] Methyl--cyclodextrin of Table 6, 2-hydroxypropyl--cyclodextrin of Table 7, monoacetyl-cyclodextrin of Table 8, 3A-amino-3A-deoxy-(2AS, 3AS)--cyclodextrin of Table 9, mono-2-O-(p-toluenesulfonyl)--cyclodextrin of Table 10, and -cyclodextrin phosphate of Table 11 were confirmed to exhibit no inclusion effect at any concentration described in each Table.

Example 3 Method for Preparing Amplification Reagent Evaporated to Dryness

[0058] A 2-hydroxypropyl--cyclodextrin-containing reagent solution (18.5 L) composed of the following composition was dispensed to 0.5-ml, PCR tubes (Individual Dome Cap PCR Tube, SSI), and then evaporated to dryness in Virtis advantage Plus at 25 C. and 100 torr for 16 hours, and then at 50 C. for 1.5 hours until the temperature within the freeze dryer was stable at 25 C. In addition, as first primers and second primers, oligonucleotides having sequences and concentrations listed in Table 1 were used in combination as appropriate. Specifically, in preparation of a reagent for detection of type A (subtype H1N1), a primer including the nucleotide sequence of SEQ ID NO: 1 and a primer including the nucleotide sequence of SEQ ID NO: 2 were used in combination. In preparation of a reagent for detection of type A (subtype H3N2), a primer including the nucleotide sequence of SEQ ID NO: 4 and a primer including the nucleotide sequence of SEQ ID NO: 5 were used in combination. In preparation of a reagent for detection of type B, a primer including the nucleotide sequence of SEQ ID NO: 6 and a primer including the nucleotide sequence of SEQ ID NO: 7 were used in combination. Further, to each first primer, T7 promoter sequence (SEQ ID NO: 3) was added to the 5 end side of the nucleotide sequence described in each SEQ ID NO listed in Table 1. Amplification reagents after drying were sealed and then stored with a drying agent at 4 C.,

[0059] Composition of reagent solution: The concentration was the final concentration of TRC reaction (in 30 L).

TABLE-US-00014 6 mM Tris-HCl (pH 8.65) 0.25 mM each: dATP, dCTP, dGTP and dTTP 2.7 mM each: ATP, CTP, UTP and GTP 3.06 mM ITP 198.9 mM trehalose 9.1 U AMV reverse transcriptase 142 U T7 RNA polymerase 20 nM each INAF probe (prepared in Example 1)

[0060] First primer with the concentration described in Table 1

[0061] Second primer with the concentration described in Table 1

[0062] 2-hydroxypropyl--cyclodextrin at each concentration of 5.2% (w/w), 6.7% (w/w), 8.2% (w/w), 9.7% (w/w), 11.2% (w/w), and 12.7% (w/w).

Example 4 Evaluation of Amplification Reagent Evaporated to Dryness

[0063] A cyclodextrin derivative-containing amplification reagent evaporated to dryness in the present invention was evaluated by the thilowing method.

[0064] (1) Type A (subtype H1N1) influenza virus standard RNA prepared in Example 1 was diluted with water for injection, so that the concentration was 10.sup.3 copies/2.5 L, and then the resultant was used as an RNA sample.

[0065] (2) The RNA sample (2.5 L) prepared in (1) was added to 27.5 L of a viral extract composed of the following composition. The solution was agitated and maintained at 46 C. for 4 minutes.

[0066] Composition of a viral extract (liquid): The concentration was the final concentration upon addition of 2.5 L of RNA sample (in 30 L).

TABLE-US-00015 22.2 mM magnesium chloride 55.0 mM potassium chloride 1.2% glycerol 11.0% DMSO 0.05% (v/v) Tween20 1.5% (w/w) sodium cholate 54 mM Tris-HCl (pH 8.65) 4 mM Tris (2-carboxyethyl)phosphine hydrochloride 3 mM KOH

[0067] (3) The viral extract (30 L) of (2) was added to and mixed with the amplification reagent evaporated to dryness (for type A (subtype H1N1)), which had been prepared in Example 3.

[0068] (4) Measurement was performed in a manner similar to Example 2 (4). The results are depicted in Table 12.

TABLE-US-00016 TABLE 12 2-hydroxypropyl--cyclodextrin concentration Detection time (min) 5.2% 10.5 6.7% 5.5 8.2% 4.4 9.7% 4.6 11.2% 5.1 12.7% 7.2

[0069] TRC reaction was confirmed for the amplification reagent evaporated to dryness containing 2-hydroxypropyl--cyclodextrin at a concentration of at least 5.2%, and the reagent containing the same at 8.2% exhibited the shortest detection time.

Example 5 Detection Sensitivity of Amplification Reagent Evaporated to Dryness for Influenza virus

[0070] Various influenza viruses were detected by the following method using the reagent for extracting/amplifying a nucleic acid of the present invention.

[0071] (1) influenza viruses listed in Table 13 were diluted with water for injection at concentrations listed in Table 14, thereby preparing virus samples.

[0072] (2) Each virus sample (50 L) prepared in (1) was added to 1000 L of a viral extract composed of the following composition. The resultant was agitated and then maintained at 46 C. for 4 minutes.

[0073] Composition of a viral extract:

TABLE-US-00017 22.2 mM magnesium chloride 75.0 mM potassium chloride 1.2% glycerol 11.0% DMSO 0.05% (v/v) Tween20 1.5% (w/w) sodium cholate 54 mM Tris-HCl (pH 8.65) 4 mM Tris (2-carboxyethyl)phosphine hydrochloride 3 mM KOH

[0074] (3) The viral extract (30 L) of (2) was added to and mixed with each of 8.2% 2-hydroxypropyl --cyclodextrin-containing reagents evaporated to dryness (the reagent for detection of type A (subtype H1N1), the reagent for detection of type A (subtype H3N2), and the reagent for detection of type B) prepared in Example 3.

[0075] (4) Measurement was performed in a manner similar to Example 2 (4). The results are depicted in Table 14.

TABLE-US-00018 TABLE 13 Type Strain Type A (subtype H1N1) A/California/07/2009 Type A (subtype H3N2) A/Texas/50/2012 Type B B/Massachusetts/2/2012

TABLE-US-00019 TABLE 14 Virus concentration Detection time Detection target virus [TCID.sub.50/ml] [min] Type A Subtype H1N1 1.0 10.sup.0 4.2 .sup.1.0 10.sup.1 6.3 Type A Subtype H3N2 1.0 10.sup.0 3.3 .sup.1.0 10.sup.1 N.D. Type B 1.0 10.sup.1 4.8 1.0 10.sup.0 6.7 .sup.1.0 10.sup.1 N.D. N.D.: not detected

[0076] As a result, it was demonstrated that various influenza viruses can be detected using the reagent for extracting/amplifying a nucleic acid of the present invention.

Example 6 Comparison of Performance Among Cyclodextrin Derivatives

[0077] Performance was compared among the cyclodextrin derivatives in the present invention by the following method.

[0078] (1) A 8.2% 2-hydroxypropyl--cyclodextrin-containing reagent evaporated to dryness was prepared by the method described in Example 3. Further, a reagent evaporated to dryness containing 8.2% 2-hydroxypropyl--cyclodextrin instead of 2-hydroxypropyl--cyclodextrin, and a reagent evaporated to dryness containing 8.2% 2-hydroxyethyl--cyclodextrin instead of 2-hydroxypropyl --cyclodextrin were prepared respectively.

[0079] (2) H1N1 viral extract was prepared by the method described in (1) and (2) of Example 5.

[0080] (3) The above viral extract was added, 30 L each, to and mixed with the 3 types of reagents evaporated to dryness of (1).

[0081] (4) Measurement was performed in a manner similar to Example 2 (4). The results are depicted in Table 15.

TABLE-US-00020 TABLE 15 H1N1 influenza virus concentration (TCID.sub.50/mL) Reagent evaporated to dryness 1000 100 10 1 2-hydroxypropyl--cyclodextrin 3.48 4.12 5.13 2-hydroxypropyl--cyclodextrin 3.62 5.07 5.34 5.62 2-hydroxyethyl--cyclodextrin N.D. N.D. N.D. Numerical value: TRC rise time : not performed N.D.: not delected

[0082] As a result, 2-hydroxyethyl--cyclodextrin was not confirmed to exhibit any inclusion effect and detection could be not be performed. Detection was confirmed in the case of 2-hydroxypropyl --cyclodextrin and 2-hydroxypropyl--cyclodextrin. Whereas the virus concentration, which could be detected within three-something minutes, was 1000 TCID.sub.50/mL in the case of 2-hydroxypropyl--cyclodextrin, the same in the case of 2-hydroxypropyl--cyclodextrin was 100 TCID.sub.50/mL. Specifically, the virus concentration in the case of 2-hydroxypropyl --cyclodextrin was 10 times greater than the other.

Example 7 Preparation of Standard RNA

[0083] Mycoplasma pneumoniae standard samples to be used in examples below were prepared by the following method.

Mycoplasma pneumoniae Culture Solution

[0084] Mycloplasma pneumoniae was cultured according to the method described in Mycoplasma pneumoniae detection manual (National Institute of Infectious Diseases (NIID), September, 2011) using a modified Hayflick liquid medium supplemented with glucose. The culture solution was aseptically dispensed and then stored at 80 C. The CFU (colony forming unit)/mL, of the thus prepared culture solution was calculated using a modified Hayflick agar medium supplemented with glucose.

Example 8 Preparation of Oligonucleotide Labeled with Intercalating Fluorescent Dye

[0085] An oligonucleotide probe (hereinafter, described as INAF probe) labeled with an intercalating fluorescent dye, as depicted in the following (A), was prepared based on the method disclosed in Japanese Unexamined Patent Publication (Kokai) No. 2000-316587.

[0086] (A) The probe was labeled with thiazole orange via a linker between the 4.sup.th guanine and the 5.sup.th cytosine from the 5 end of the oligonucleotide represented by the nucleotide sequence (nucleotide 2193 to nucleotide 2208 of the nucleotide sequence under GenBank No. NR_077056.1) described in SEQ ID NO: 8.

Example 9 Detection of Mycoplasma Pneumoniae

[0087] A combination of a first primer, a second primer and an INAF probe listed in Table 16 was used and evaluated by the following method. Note that the INAF probe described in Table 16 was a probe prepared in Example 8.

[0088] (1) Standard samples prepared in Example 7 were each diluted with physiological saline so that the concentrations were the final concentrations (CFU/test) listed in Table 17, and then used as detection samples.

[0089] (2) A reaction solution composed of the following composition was dispensed to tubes for evaporation to dryness and then evaporated to dryness.

[0090] Composition of amplification reagent: The concentration was the final concentration (in 30 L) after addition of an RNA sample and an initiator solution.

TABLE-US-00021 60 mM Tris-HCl buffer solution (pH 8.35) 150 mM trehalose 0.48 mM each: dATP, dCTP, dGTP and dTTP 2.1 mM each: ATP, CTP, UTP and GTP 3.2 mM ITP 0.2 M first primer (SEQ ID NO: 9) 0.2 M second primer (SEQ ID NO: 10) 100 nM INAF probe (prepared in Example 2) 0.025 mg/mL bovine serum albumin 142 U T7 RNA polymerase 6.4 U AMV reverse transcriptase 8.2% (w/v) 2-hydroxypropyl--cyclodextrin

[0091] (3) Each detection sample (1 L) prepared in (1) was added to 29 L of Mycoplasma extract composed of the following composition, agitated, and then maintained at 46 C. for 1 minute.

[0092] Composition of Mycoplasma extract: The concentration was the final concentration (in 30 L) when 1 L of a detection sample was added.

TABLE-US-00022 21.0 mM magnesium chloride 50.0 mM potassium chloride 10.07% DMSO 0.05% (v/v) Tween20 1.5% (w/w) sodium cholate

[0093] (4) Thirty (30) L of the Mycoplasma extract of (3) was added to and mixed with the amplification reagent evaporated to dryness (for Mycoplasma pneumoniae) prepared in (2).

[0094] (5) Subsequently, with the use of a spectrophotometer having a temperature-controlling function and being capable of directly measuring the tubes for evaporation to dryness, the fluorescence intensity of the reaction solution was measured over time for 20 minutes simultaneously with reaction at 46 C.

[0095] The time upon completion of the addition of Mycoplasma extract and the agitation of the mixture was designated as 0 minutes. A case where the fluorescence intensity ratio (the value obtained by dividing the value of the fluorescence intensity at a predetermined time by the value of the fluorescence intensity of the background) of the reaction solution was higher than 1.2 was determined positive, and the time of this positive determination was designated as detection time. The results are depicted in Table 17, N.D. in Table 17 means that the fluorescence intensity ratio at 20 minutes after the initiation of reaction was 1.5 or less (negative determination).

[0096] As a result, it was demonstrated that 23S rRNA of Mycoplasma pneumoniae can be rapidly detected with high sensitivity by the use of this method.

TABLE-US-00023 TABLE16 Sequence Content First AATTCTAATACGACTCACTATA Primerfor primer GGGAGACCCTTACACCATTACA amplificationof CTCTAC Mycoplasma nucleicacid, havingT7 promotersequence Second TTAATATTGATCAGGACATTAT Primerfor primer CATGTAGA amplificationof Mycoplasma nucleicacid INAF TGTGCTGTTCTAATTG Probewith probe fluorescenttag betweenthe4.sup.th guanineandthe5.sup.th cytosinefromthe 5end

TABLE-US-00024 TABLE 17 Final concentration Average detection (CFU/test) Detection time (min) time (min) 1000 5.29 5.39 5.17 5.28 100 6.79 5.95 6.13 6.29 10 7.96 8.11 7.98 8.02 1 12.87 8.92 10.31 10.7 0.1 N.D. N.D. N.D. N.D.

Comparative Example 1 Examination of Cyclodextrin Derivatives in Detection of Mycoplasma Pneumoniae

[0097] A combination of a first primer, a second primer and an INAF probe listed in Table 16 was used in a manner similar to Example 9 except for using cyclodextrin derivatives listed in Table 18 instead of 2-hydroxypropyl--cyclodextrin, and then evaluation was performed by the following method. Note that the INAF probe described in Table 16 was the probe prepared in Example 8.

[0098] (1) Standard samples prepared in Example 7 were each diluted with physiological saline so that the concentrations were the final concentrations (CFU/test) listed in Table 17, and then used as detection samples.

[0099] (2) A reaction solution composed of the following composition was dispensed to tubes for evaporation to dryness and then evaporated to dryness.

[0100] Composition of amplification reagent: The concentration was the final concentration after addition of an RNA sample, an initiator solution (in 30 L)

TABLE-US-00025 60 mM Tris-HCl buffer solution (pH 8.35) 150 mM trehalose 0.48 mM each: dATP, dCTP, dGTP and dTTP 2.1 mM each: ATP, CTP, UTP and GTP 3.2 mM ITP 0.2 M first primer (SEQ ID NO: 9) 0.2 M second primer (SEQ ID NO: 10) 100 nM INAF probe (prepared in Example 2) 0.025 mg/mL bovine serum albumin 142U T7 RNA polymerase 6.4 U AMV reverse transcriptase

[0101] Cyclodextrin derivatives listed in Table 18

[0102] (3) One L (1000 CFU/test) of the detection sample prepared in (1) was added to 29 L of Mycoplasma extract composed of the following composition, agitated, and then maintained at 46 C. for 1 minute.

[0103] Composition of Mycoplasma extract: The concentration was the final concentration (in 30 L when 1 L of a detection sample was added.

TABLE-US-00026 21.0 mM magnesium chloride 50.0 mM potassium chloride 10.07% DMSO 0.05% (v/v) Tween20 1.5% (w/w) sodium cholate

[0104] (4) Thirty (30) L of the Mycoplasma extract of (3) was added to and mixed with the amplification reagent evaporated to dryness (for Mycoplasma pneumoniae) prepared in (2).

[0105] (5) Subsequently, with the use of a spectrophotofluorometer having a temperature-controlling function and being capable of directly measuring the tubes for evaporation to dryness, the fluorescence intensity of the reaction solution was measured over time for 20 minutes simultaneously with reaction at 46 C.

[0106] The time upon completion of the addition of Mycoplasma extract and agitation was designated as 0 minutes. A case where the fluorescence intensity ratio (the value obtained by dividing the value of the fluorescence intensity at a predetermined time by the value of the fluorescence intensity of the background) of the reaction solution was higher than 1.2 was determined positive, and the time of this positive determination was designated as detection time. The results are depicted in Table 18, N.D. in Table 18 means that the fluorescence intensity ratio at 20 minutes after the initiation of reaction was 1.5 or less (negative determination).

[0107] As a result, the use of derivatives other than -cyclodextrin resulted in negative determination and measurement could not be performed. The detection time in the case of -cyclodextrin was 8.89 minutes, revealing that the effect thereof was lower than that of 2-hydroxypropyl--cyclodextrin.

TABLE-US-00027 TABLE 18 Concen- tration Detection (%(w/v)) Cyclodextrin derivative name time (min) 8.2 2-Hydroxypropyl--cyclodextrin N.D. 8.2 Methyl--cyclodextrin N.D. 8.2 Monoacetyl--cyclodextrin N.D. 8.2 2-Hydroxyethyl--cyclodextrin N.D. 8.2 -cyclodextrin 8.89 8.2 2-Hydroxypropal--cydodextrin N.D. 8.2 3A-Amino-3A-deoxy-(2AS,3As)--cyclodextrin N.D. 8.2 Mono-2-O-(p-toluenesulfonyl)--cyclodextrin N.D. 8.2 2-Hydroxypropyl--cyclodextrin N.D.

Example 10 Real-Time PCR

[0108] Recovery from reaction inhibition by sodium cholate and that from reaction inhibition by 2-hydroxypropyl--cyclodextrin in real-time PCR were evaluated by the following method.

[0109] (1) A reagent with the reaction composition described in Table 19 was prepared on a 96-well PCR plate (Applied biosystems) and then sealed with 8 cap strips (Applied biosystems).

[0110] (2) Next, with the use of Quant Studio 5 (Applied biosystems), after heating at 95 C. for 30 seconds, 40 cycles (95 C. for 10 seconds, 60 C. for 34 seconds) of amplification reaction was performed to calculate Ct value. The results are depicted in Table 20.

[0111] As a result, at least 0.5% sodium cholate contained completely inhibited real-time PCR. On the other hand, it was demonstrated that even in the case of adding 1.5% sodium cholate, addition of 8.2% 2-hydroxypropyl--cyclodextrin alleviates the reaction inhibition and real-time PCR can be performed.

[0112] It was confirmed by the above results that nucleic acid amplification in the present invention is also applicable to real-time PCR.

TABLE-US-00028 TABLE 19 Amount of reagent used Purchased from Reagent (L) SEQ ID NO: SYBR Premix Ex Taq II 10 Takara Bio Inc. ROX Reference Dye II 0.4 Takara Bio Inc. 10 M F primer 0.8 SEQ ID NO: 11 10 M R primer 0.8 SEQ ID NO: 12 Target nucleic acid 0.5 SEQ ID NO: 13 (54.98 pg/L) Sodium cholate Amount described DOJINDO in Table 20 LABORATORIES 2-hydroxypropyl-- Amount described Wako Pure Chemical cyclodextrin in Table 20 Industries, Ltd.
Finally, the volume of the solution was adjusted with sterile water to 20 L.

[0113] Finally, the volume of each solution was adjusted with sterile water to 20 L.

TABLE-US-00029 TABLE 20 Sodium cholate 2-hydroxypropyl--cyclodextrin Ct concentration (%) concentration (%) value 0 0 21.4 0 8.2 21.4 0.5 0 N.D. 1.0 0 N.D. 1.5 0 N.D. 1.5 8.2 29.9

Example 11 Real-Time PCR Using Virus

[0114] Recovery from reaction inhibition by sodium cholate and recovery from reaction inhibition by 2-hydroxypropyl--cyclodextrin in real-time PCR were evaluated by the following method using virus.

[0115] (1) Of influenza viruses listed in Table 13, 10 L of type H3N2 (concentration of 10.sup.5.39TCID.sub.50/mL) was mixed with 1000 L of aqueous sodium etiolate solution (concentration of 30.6% (w/w)), thereby preparing a viral extract.

[0116] (2) Subsequently, a reagent with the reaction composition described Table 21 was adjusted on a 96-well PCR plate (Applied biosystems) and then sealed with 8 cap strips (applied biosystems).

[0117] (3) Next, with the use of Quant Studio 5 (Applied biosystems), after heating at 42 C. for 5 minutes and then heating at 95 C. for 10 seconds, 40 cycles (95 C. for 10 seconds, 60 C. for 34 seconds) of amplification reaction was performed to calculate Ct value. The results are depicted in Table 22.

[0118] As a result, it was demonstrated that when a nucleic acid is extracted with sodium cholate from the virus, one-step real-time PCR is inhibited, but the addition of 2-hydroxypropyl--cyclodextrin causes recovery from the reaction inhibition.

[0119] It was confirmed by the above results that nucleic acid amplification in the present invention is also applicable to real-time PCR.

TABLE-US-00030 TABLE 21 Amount of reagent used Purchased from Reagent (L) SEQ ID NO: 2XOne Step SYBR RT-PCR 10 Takara Bio Inc. Buffer 4 PrimeScript. 1step enzyme 0.8 Takara Bio Inc. Mix2 ROX Reference Dye II 0.4 Takara Bio Inc. 10 M F primer (for H3N2) 0.8 SEQ ID NO: 8 10 M R primer (for H3N2) 0.8 SEQ ID NO: 11 Viral extract 1.0 2-hydroxypropyl-- Amount described Wako Pure Chemical cyclodextrin in Table 22 Industries, Ltd.
Finally, the volume of the solution was adjusted with sterile water to 20 L. The final concentration of sodium cholate was 1.5%.

[0120] Finally, the volume of each solution was adjusted with sterile water to 20 L. The final concentration of sodium cholate was 1.5%.

TABLE-US-00031 TABLE 22 Sodium cholate 2-hydroxypropyl--cyclodextrin Ct concentration (%) concentration (%) value 1.5 0 N.D. 1.5 8.2 21.7

[0121] The present invention is as described above in detail with reference to specific embodiments. It is obvious for persons skilled in the art that various modifications and changes of the present invention are feasible within the technical idea and the scope of the invention.

[0122] Note that the entire contents of Japanese Patent Application No. 2017-047428 filed Mar. 13, 2017, Japanese Patent Application No. 2017-097209 filed May 16, 2017, and Japanese Patent Application No. 2017-215697 filed Nov. 8, 2017 including the Descriptions, Sequence Listings, Claims and Abstracts, are incorporated herein by reference as the disclosure of the Description of the present invention.