A Cell Model For In Vitro Evaluation Of Compound-Induced Skin Sensitization And A Constructing Method Therefor
20200140856 ยท 2020-05-07
Assignee
Inventors
- Lizhen HUANG (Guangdong, CN)
- Guorui ZHONG (Guangdong, CN)
- Haojian LI (Guangdong, CN)
- Shuilin XIE (Guangdong, CN)
- Shihui PANG (Guangdong, CN)
- Jing BAI (Guangdong, CN)
- Changsheng HE (Guangdong, CN)
- Xinyi DU (Guangdong, CN)
- Qixiao ZHANG (Guangdong, CN)
- Haijie WANG (Guangdong, CN)
- Hongli DU (Guangdong, CN)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N2800/80
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
C12N15/90
CHEMISTRY; METALLURGY
C12Q1/6897
CHEMISTRY; METALLURGY
G01N33/5008
PHYSICS
C12N2015/859
CHEMISTRY; METALLURGY
C12N5/0639
CHEMISTRY; METALLURGY
C12N5/0645
CHEMISTRY; METALLURGY
C12N2810/10
CHEMISTRY; METALLURGY
C12N2015/8527
CHEMISTRY; METALLURGY
International classification
C12N15/11
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
Abstract
A cell model for in vitro evaluation of compound-induced skin sensitization and a constructing method therefor. The method for constructing the cell model comprises the steps of: designing and constructing an sgRNA expression vector based on CRISPR/Cas9 vector system; designing and constructing a homologous recombinant vector capable of knocking a reporter gene linked to a self-cleaving peptide sequence into a specific site of the expression frame of the HMOX1 gene; co-transfecting the homologous recombinant vector, an hCas9 plasmid and the sgRNA expression vector into a cell, and carrying out monoclonal expansion to obtain the cell model. The present invention obtains a HaCaT cell model in which a luciferase gene is knocked in before the stop codon of the HMOX1 gene by combination of CRISPR/CAS9 and a monoclonal cell technique. The cell model realizes synchronous expression of the luciferase gene and the HMOX1 gene, thereby effectively distinguishing sensitizing compounds from non-sensitizing compounds.
Claims
1. A method for constructing a cell model where a reporter gene is targetedly knocked into a HMOX1 gene mediated by CRISPR/CAS9, characterized by comprising the following steps: (1) designing and constructing an sgRNA expression vector specific for a target site on the HMOX1 gene based on CRISPR/Cas9 vector system; (2) designing and constructing a homologous recombinant vector capable of knocking a reporter gene linked to a self-cleaving peptide sequence into a specific site of the expression frame of the HMOX1 gene; (3) co-transfecting the homologous recombinant vector, an hCas9 plasmid and the sgRNA expression vector into a mammalian keratinocyte, a mammalian dendritic cell or a mammalian monocyte, and carrying out monoclonal expansion to obtain the cell model where a reporter gene is targetedly knocked into a HMOX1 gene mediated by CRISPR/CAS9.
2. The method for constructing a cell model where a reporter gene is targetedly knocked into a HMOX1 gene mediated by CRISPR/CAS9 according to claim 1, characterized in that: the sequence of the sgRNA in step (1) is as shown by SEQ ID NO: 1 or SEQ ID NO: 3.
3. The method for constructing a cell model where a reporter gene is targetedly knocked into a HMOX1 gene mediated by CRISPR/CAS9 according to claim 1, characterized in that: in step (1), the sgRNA is expressed using U6 promoter, and the designed sgRNA sequences are used to synthesize an Oligo to construct the sgRNA expression vector.
4. The method for constructing a cell model where a reporter gene is targetedly knocked into a HMOX1 gene mediated by CRISPR/CAS9 according to claim 1, characterized in that: the reporter gene in step (2) is one of a luciferase gene, a chloramphenicol acetyltransferase gene, a -galactosidase gene or a dihydrofolate reductase gene.
5. The method for constructing a cell model where a reporter gene is targetedly knocked into a HMOX1 gene mediated by CRISPR/CAS9 according to claim 1, characterized in that: the self-cleaving peptide in step (2) is one of a T2A peptide, an E2A peptide, an F2A peptide or a P2A peptide.
6. The method for constructing a cell model where a reporter gene is targetedly knocked into a HMOX1 gene mediated by CRISPR/CAS9 according to claim 1, characterized in that: the specific site in step (2) is located between No. 17529 base and No. 17530 base of the HMOX1 gene.
7. The method for constructing a cell model where a reporter gene is targetedly knocked into a HMOX1 gene mediated by CRISPR/CAS9 according to claim 1, characterized in that: the sequence of the homologous recombinant vector in step (2) is as shown by SEQ ID NO: 4.
8. The method for constructing a cell model where a reporter gene is targetedly knocked into a HMOX1 gene mediated by CRISPR/CAS9 according to claim 1, characterized in that: the mammalian keratinocyte in step (3) is a HaCaT cell; the mammalian dendritic cell in step (3) is a CD34-derived dendritic cell; the mammalian monocyte in step (3) is a THP-1 cell.
9. A cell model where a reporter gene is targetedly knocked into a HMOX1 gene mediated by CRISPR/CAS9, characterized by being obtained through the constructing method claim 1.
10. Use of the cell model where a reporter gene is targetedly knocked into a HMOX1 gene mediated by CRISPR/CAS9 in recognizing sensitization of a compound.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
DETAILED DESCRIPTION OF THE EMBODIMENTS
[0045] The present invention will be further described in detail below with reference to the embodiments and drawings, but the embodiments of the present invention are not limited thereto.
[0046] The tests without specific experimental conditions in the following examples are usually carried out according to conventional experimental conditions or according to the experimental conditions recommended by the manufacturers.
EXAMPLE 1
[0047] In the present invention, a method for constructing a cell model where a reporter gene is targetedly knocked into a HMOX1 gene mediated by CRISPR/CAS9 used for non-diagnostic or non-treating purpose comprises the following steps:
[0048] 1. Target-site-specific sgRNA for HMOX1 gene was designed, its expression vector was constructed, and its target cleavage efficiency was detected.
[0049] Specific sgRNA near the stop codon of HMOX1 gene (NCBI accession number: NG_023030 HMOX1) was designed, and off-target analysis was performed to screen three sgRNAs with good specificity and low possibility of off-target. The results are shown in Table 1.
TABLE-US-00001 TABLE1 SequenceofthespecificsgRNA Genome name sgRNAsequence(5-3) position sgRNA-1 TTAACAGGTGGGCGTGCATCAGG Exon5 sgRNA-10 GGTCCTTACACTCAGCTTTCTGG Exon5 sgRNA-13 GCTTTATGCCATGTGAATGCAGG Exon5
[0050] U6 promoter was used to express the sgRNA, and the designed sgRNA sequence was used to synthesize an Oligo to construct a sgRNA expression vector pU6-sgRNA. The sequencing analysis revealed that the construction was successful. The specific method is as follows:
Construction of the U6-sgRNA Plasmid
[0051] (1) The designed sgRNA was used to synthesize the Oligo, sense strand (i.e., the same sequence as the target site): 5-CACC-GN19-3, antisense strand: 5-AAAC-19NC-3 (antisense strand N19 was a reverse complement of the sense strand N19);
[0052] (2) The Oligo was annealed; U6 was subjected to Bbsl digestion and linearization, and reacted at 37 C. for 2 h, then the linearized fragment was recovered by gel extraction;
[0053] (3) The annealed Oligo was ligated to the linearized U6 digestion product overnight; the ligated product was transformed into E. coli DH5 competent cells, which were then plated on LB plates containing kanamycin; single colonies were picked and placed in 1 mL LB liquid medium (containing kanamycin), and cultured at 37 C. for 2-3 h; after that, PCR was carried out for the colonies using sp6 primer and sense chain, wherein a sequencing analysis was conducted for positive monoclonal bacteria after PCR of the colonies. Those with the correct sequence were subjected to expansion and plasmid preparation.
[0054] The sequence of the sp6 primer was 5-GATTTAGGTGACACTATAG-3 (SEQ ID NO: 5).
[0055] sgRNA-1, sgRNA-10, sgRNA-13 plasmid and hCas9 plasmid were co-transfected into 293T cells respectively. After 72 hours, the genome was extracted and expanded with the primers in Table 2 on the target site, and the PCR product was identified by T7EI digestion. Results showed that sgRNA-1 has four light bands, sgRNA-10 has two clear bands, and sgRNA-13 has four light bands as shown in
[0056] Transfection of 293T Cells
[0057] The sgRNA-1, sgRNA-10, and sgRNA-13 plasmids were co-transfected into the 293T cells with a H-Cas9 plasmid (using liposome transfection), and the transfection steps were as follows:
[0058] (1) The prior medium was discarded, and 2 mL of fresh medium for incubation was added;
[0059] (2) 0.5 g of the sgRNA recombinant plasmid and 0.5 g of the hCas9 plasmid were dissolved in 100 L of DMEM (H), 3 L of a liposome transfection reagent was diluted to 100 L, and the diluted liposome transfection reagent was added to the diluted plasmid solution. The mixture was gently blew evenly, formulated into a transfection complex, and reacted at room temperature for 15 min;
[0060] (3) The transfection complex was dropped into 6 wells, and reacted at 37 C. for 5 h. Then the reaction solution was discarded, and fresh medium was added for cultivation.
[0061] Genome Extraction Process
[0062] (1) After transfection for 72 hours, 293T cells in 60 mm dish were all digested with 0.25% trypsin and centrifuged at 1000 rpm for 3 min, followed by discarding the supernatant;
[0063] (2) The cells were resuspended in 1 mL PBS, transferred to a 1.5 mL centrifuge tube, and centrifuged at 1000 rpm for 3 min followed by discarding the supernatant. Then 200 L of PBS was added to suspend the cells;
[0064] (3) Genomic DNA was extracted by genomic extraction kit, and finally eluted with 40 L of ddH.sub.2O;
[0065] (4) Concentration of the DNA was determined;
[0066] (5) 1% agarose gel electrophoresis was carried out on the genomic DNA.
[0067] Amplification on the Target Site
[0068] PCR amplification of sgRNA-1, sgRNA-10, and sgRNA-13 was carried out using the extracted genome after transfection as a template; PCR amplification was performed using the wild type (WT) as a template and primers with SEQ ID NO: 6-7 as shown in Table 2.
TABLE-US-00002 TABLE2 PCRamplificationprimers Product size Primername PrimerSequence(5-3) (bp) HMOX1-sgRNA-JD-F TGTTTTCACAATGTGGCCTGG 578 HMOX1-sgRNA-JD-R CCATTGCCTGGATGTGCTTT
[0069] PCR amplification reaction procedure: 95 C. for 3 min; 95 C. for 45 s, 61 C. for 45 s, 72 C. for 30 s, 30 cycles; 72 C. for 5 min; storage under 4 C.
[0070] Identification after T7EI Digestion:
[0071] (1) 200 ng of the PCR product was diluted to 20 L for denaturation and annealing, wherein the procedure were as follows: 95 C., 5 min; 95-85 C. at -2 C./s; 85-25 C. at -0.1 C./s; Hold at 4 C.
[0072] (2) 0.2 L of T7EI was added to the 20 L system to allow digestion at 37 C. for 30 minutes. Then 2 L of 10loading buffer was added and 2% agarose gel electrophoresis was carried out for identification.
[0073] 2. Using pcDNA3.1(-) (Invitrogen) as a backbone, a luciferase gene linked to a T2A peptide sequence was inserted between the homologous left arm (500 bp, SEQ ID NO: 4 from No. 934 base to No. 1433 base counting from the 5 end) and the homologous right arm (800 bp, SEQ ID NO: 4 from No. 3138 base to No.3937 base counting from the 3 end) (where the homologous left arm is a sequence 500 bp upstream from the No.17529 base (inclusive) of NG_023030, and the homologous right arm is a sequence 800 bp downstream from the No.17530 base (inclusive) of NG_023030), and a homologous recombinant vector was obtained with a sequence as shown in SEQ ID NO: 4. The specific method is as follows:
[0074] (1) using the wild type genome as a template and the primers in Table 3, with SEQ ID NO: 8-9, a fragment containing the homologous left arm and the homologous right arm was amplified;
[0075] (2) The luciferase gene on pGL4.10 (Promega) (with a sequence of No. 1488 base to No. 3137 base counting from the 5 end of SEQ ID NO: 4) was ligated to the T2A peptide sequence (SEQ ID NO:4 No. 1434 base to No. 1487 base counting from the 5 end) to recombine homologously between the homologous left arm and the homologous right arm;
[0076] (3) A NotI/BamHI restriction site was added to the homologous left arm-T2A-luciferase gene-the homologous right arm fragment, which was in turn ligated to a Not-I/BamHI-digested linearized pcDNA3.1(-) vector. The ligation product was transformed, plasmid extracted, and verified by sequencing analysis.
TABLE-US-00003 TABLE3 Primersforamplificationofthefragment containingthehomologousleftarmand thehomologousrightarm Product size Primername Primersequence(5-3) (bp) HMOX1-LR-F AACCAGGGATGGGACTGAAC 1652 HMOX1-LR-R TCGCCCACCAGCTACTTAAA
[0077] 3. Construction and identification of targetedly knocking the luciferase gene into the HMOX1 gene in a HaCaT monoclonal cell
[0078] The constructed sgRNA-13 plasmid, luciferase gene homologous recombination vector and hCas9 plasmid were co-transfected into HaCaT cells. After 72 hours, 800 g/mL G418 (geneticmycin) was added for screening. The reagent was changed once every 2 days, and the cells were digested after 7 days followed by limited dilution. The cells were plated in five 10 cm plates at a density of 100 cells per well, and the cells were picked up after about 15 days when the monoclonal cells were grown to about 0.5 cm. 45 monoclonal cells were picked and cultured in 24-well plates. After overgrown, 1/10 of the cells were used to identify genotypes, and 9/10 of the cells were transferred to 12-well plates for expansion, which were frozen for storage after they were overgrown. According to the sequencing analysis, a series of monoclonal knock-in cells were obtained, which were clones No. 6, No. 8, No. 10, No. 38 and No. 43 (see
[0079] After the monoclonal cells were expanded and cultured, PCR amplification and sequencing analysis were performed using the primers with SEQ ID NOs: 10 to 11 in Table 4, respectively. The identification results are shown in
TABLE-US-00004 TABLE4 PCRamplificationprimers Product size Primername Primersequence(5-3) (bp) HMOX1-HRL-F CAGGTGGCACATCTACCCAG 1248 HMOX1-HRL-R GCAAGCTATTCTCGCTGCAC
[0080] 4. Analysis of sensitization of compounds after gene knock-in Sensitization of compounds was detected using clone No. 38.
[0081] (1) A sensitizing compound cinnamyl alcohol was selected for the experiment. The luciferase expression assay and MTT activity assay results are shown in
[0082] (2) A sensitizing compound 2-mercaptobenzothiazole was selected for the experiment. The results of luciferase expression assay and MTT activity assay are shown in
[0083] (3) A non-sensitizing compound sulfonamide was selected for the experiment. The results of luciferase expression assay and MTT activity assay are shown in
[0084] Administration Process:
[0085] Pre-cultured cells were centrifuged followed by removal of the supernatant, and were resuspended in fresh complete medium. The cell concentration was calculated with a cell counter after dilution for 10 times, and finally was adjusted to 50,000 cells/well. 200 L of the cell solution was added to each well of a white opaque 96-well plate to ensure that the number of cells per well was substantially the same. The cell was incubated for 24 h at 37 C. in a 5% CO2 incubator. After 24 h, the medium was removed, and a working solution was prepared with 1% FBS medium. The working solution was diluted to 50% each time from 1000 M to obtain 9 concentrations, then 200 L of the working solution was added to each well, and a negative control was provided. The DMSO concentration in the working solution was 0.5%. 1 to 2 drops of paraffin oil was added to each well and the cells were incubated for 48 hours. After 48 h, luciferase expression was measured and cell viability was detected using MTT.
[0086] Luciferase Detection Process:
[0087] (1) 48 hours after treatment, the medium containing the reagent was discarded, and the plate was washed twice with PBS;
[0088] (2) 100 L of PBS was added to each well, and then an equal volume of the luciferase substrate was added;
[0089] (3) The plate was shaken at 200 rpm for 2 min to fully lyse the cells;
[0090] (4) A Tecan Infinite 200 Pro multi-function microplate reader selecting luminescence, integration 0.5s was used and the reading was recorded.
[0091] MTT Assay for Cell Activity:
[0092] (1) 48 hours after treatment, the medium containing the reagent was discarded, the plate was washed twice with PBS and 200 L of fresh 1% FBS medium was added;
[0093] (2) 27 L of MTT solution was added to each well and the cells were incubated in an incubator for 4 h;
[0094] (3) After the incubation, the medium was carefully removed with a 1mL syringe without removing the purple crystal at the bottom of the well, so as not to affect the experimental results. The cells were lysed by adding 200 L of DMSO and shaking at 250 rpm for 5 min, and the purple crystals were sufficiently dissolved.
[0095] (4) The absorbance at OD 570 nm was measured by a Tecan Infinite 200 Pro multi-function microplate reader.
[0096] Calculation Method:
[0097] A. Calculation of fold induction
Fold induction=(L.sub.sampleL.sub.blank)/(L.sub.solventL.sub.blank);
[0098] wherein:
[0099] L.sub.sample: fluorescence reading of the sample;
[0100] L.sub.blank: blank fluorescence reading (without cells and sample);
[0101] L.sub.solvent: mean fluorescence reading of solvent control(negative control).
[0102] B. Cell viability calculation (viability)
Cell viability=[(V.sub.sampleV.sub.blank)/(V.sub.solventV.sub.blank)]* 100;
[0103] wherein:
[0104] V.sub.sample: MTT absorption of the sample;
[0105] V.sub.blank: MTT absorption of the blank (without cells and sample);
[0106] V.sub.solvent: MTT absorption of the solvent control (negative control).
[0107] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and scope of the invention should all be equivalent replacements and are included in the scope of the present invention.