Surface display of antigens on gram-negative outer membrane vesicles
10639280 · 2020-05-05
Assignee
Inventors
Cpc classification
C07K14/20
CHEMISTRY; METALLURGY
A61P31/00
HUMAN NECESSITIES
A61K39/00
HUMAN NECESSITIES
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
A61K9/1275
HUMAN NECESSITIES
A61K39/0225
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
International classification
C07K1/00
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
A61P31/00
HUMAN NECESSITIES
C07K14/20
CHEMISTRY; METALLURGY
Abstract
The present invention relates to vaccine compositions based on Gram-negative outer membrane vesicles displaying antigens of pathogens expressed as part of a fusion protein comprising N-terminal parts of surface expressed lipoproteins of Gram-negative bacteria, and use of such compositions in vaccination. The invention further relates to the fusion lipoproteins comprising N-terminal parts of surface expressed lipoproteins of Gram-negative bacteria and antigens of pathogens fused thereto, DNA constructs and bacterial host cells for expressing these fusion lipoproteins and to methods for producing outer membrane vesicles displaying the fusion lipoproteins.
Claims
1. A fusion lipoprotein comprising an N-terminal and a C-terminal fusion partner, wherein: (a) the N-terminal fusion partner comprises in N- to C-terminal order: i) a lipidated N-terminal cysteine; ii) a tether of a surface exposed lipoprotein of a Gram-negative bacterium; and, optionally, iii) a stretch of at least 5 contiguous amino acids that are located C-terminally of the tether of a surface exposed lipoprotein of a Gram-negative bacterium; wherein the N-terminal fusion partner causes presentation of the fusion lipoprotein on the extracellular outer membrane surface of a Gram-negative bacterium upon expression therein; and, (b) the C-terminal fusion partner comprises at least one epitope of an antigen associated with an infectious disease and/or a tumour, wherein the C-terminal fusion partner does not comprise an amino acid sequence of at least 10 contiguous amino acids from the surface exposed lipoprotein from which the sequence of the N-terminal fusion partner originates; and wherein the amino acid sequence of the fusion lipoprotein does not occur in nature.
2. The fusion lipoprotein according to claim 1, wherein the tether is located adjacent to the lipidated N-terminal cysteine.
3. The fusion lipoprotein according to claim 1, wherein the N-terminal fusion partner comprises an N-terminal fragment from a surface exposed lipoprotein of a Gram-negative bacterium and wherein the fragment causes surface expression of the fusion lipoprotein when expressed in the Gram-negative bacterium.
4. The fusion lipoprotein according to claim 1, wherein the Gram-negative bacterium is of the genus Neisseria.
5. The fusion lipoprotein according to claim 3, wherein the surface exposed lipoprotein is selected from the group consisting of fHbp, LpbB, TbpB, NHBA and Ag473.
6. The fusion lipoprotein according to claim 1, wherein the N-terminal fusion partner comprises at least one of: a) the amino acid sequence in positions 20-38 of SEQ ID NO: 1; b) the amino acid sequence in positions 21-61 or positions 21-63 of SEQ ID NO: 2; or, c) the amino acid sequence in positions 23-51 of SEQ ID NO: 3.
7. The fusion lipoprotein according to claim 6, wherein the N-terminal fusion partner comprises at least one of: a) the amino acid sequence in positions 20-50 of SEQ ID NO: 1; b) the amino acid sequence in positions 21-73 or positions 21-75 of SEQ ID NO: 2; or, c) the amino acid sequence in positions 23-63 of SEQ ID NO: 3.
8. The fusion lipoprotein according to claim 1, wherein the C-terminal fusion partner does not comprise a contiguous amino acid sequence of at least 5 amino acids from the surface exposed lipoprotein from which the sequence of the N-terminal fusion partner originates.
9. The fusion lipoprotein according to claim 8, wherein the C-terminal fusion partner comprises surface exposed epitopes from a proteinaceous antigen of an infectious agent or tumour.
10. The fusion lipoprotein according to claim 9, wherein the C-terminal fusion partner comprises a surface exposed domain of a surface exposed bacterial protein or lipoprotein.
11. The fusion lipoprotein according to claim 10, wherein bacterial protein comprises a Borrelia surface lipoprotein selected from the group consisting of OspA, OspB, OspC, OspF, VlsE, BbCRASP1, Vsp1, P35 (BBK32), P37 (BBK50), P39, P66, DpbA and BB017.
12. The fusion lipoprotein according to claim 6, wherein the Borrelia surface lipoprotein comprises amino acids 29-273 of SEQ ID NO: 4, amino acids 29-273 of SEQ ID NO: 58 or amino acids 136-210 of SEQ ID NO: 59.
13. The fusion lipoprotein according to claim 1, wherein the N-terminal fusion partner comprises a stretch of at least 10 contiguous amino acids that are located C-terminally of the tether of a surface exposed lipoprotein of a Gram-negative bacterium.
Description
DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
EXAMPLES
(10) 1. Materials and Methods
(11) 1.1 Antibiotics
(12) Ampicillin (Amp) and chloramphenicol (Cam) were purchased from Sigma. Stock solution were prepared in Milli-Q (MQ) water, filter-sterilized using a 0.22 m Steriflip (Milipore), and stored at 4 C.
(13) 1.2 Bacterial Strains and Growth Conditions
(14) Escherichia coli strains JM109 (Promega) and TOP10F (Invitrogen) were used for cloning steps involving vectors pGEM-T Easy and pEN11, respectively. Both strains were grown at 37 C. on Luria Bertani medium (MP Biomedicals) supplemented with 15 gram agar/liter and appropriate antibiotics (50 g/ml Amp for pGEM-T Easy and 25 g/ml Cam for pEN11). For blue/white screening of JM109, plates were supplemented with 50 g/ml 5-bromo-4-chloro-3-indolyl-beta-D-galacto-pyranoside (X-gal, Fermentas) and 0.1 mM isopropyl-beta-D-thiogalactopyranoside (IPTG, Thermo Scientific). Liquid cultures were grown at 37 C. and 200 RPM.
(15) Neisseria meningitidis strain HB-1 carrying the lpxL1 deletion (52) was grown on Difco GC medium base supplemented with IsoVitaleX (both Becton Dickinson) at 37 C. in a humid atmosphere containing 5% CO.sub.2. Plates were supplemented with 3 g/ml Cam in case of transformation with pEN11. Liquid cultures were grown in Tryptic Soy Broth (TSB, Becton Dickinson) with 3 g/ml Cam and 1 mM IPTG at 37 C. and 150 RPM.
(16) Borrelia burgdorferi strain B31 was kindly supplied by the lab of J. Hovius (Amsterdam Medical Centre). Genomic DNA of B. burgdorferi was extracted using the DNeasy Blood & Tissue Kit (Qiagen) according to the manufacturer's instructions.
(17) 1.3 Recombinant DNA Technology
(18) All primers used in this study are shown in Table 1. Hybrids were made of fHbp (N. meningitidis), TbpB (N. meningitidis), OspA (B. burgdorferi or B. afzelii), OspC (B. burgdorferi) and RmpM (N. meningitidis). All hybrids were constructed using Overlap Extension PCR (53). All PCRs were carried out using the Accuprime Taq DNA Polymerase System (Invitrogen) to ensure both high fidelity amplification and the addition of 3 A-overhangs. See
(19) TABLE-US-00001 TABLE1 Oligonucleotideprimersusedinthisstudy SEQ Primer ID Primer number NO name Sequence(5 .fwdarw. 3) 1 9 fHbp-F CATATGCGCCGTTCGGACGAC ATTTGATTTTTGC 2 10 fHbp-R GACGTCACGGTAAATTATCGT GTTCG 3 11 OspA-F CATATGAAGGAGAATATATTA TGAAAAAATATTTATTGG 4 12 OspA-R GACGTCTAAAGCTAACGCTAA AGCAAATCC 5 13 M13-F GTAAAACGACGGCCAG 6 14 M13-R CAGGAAACAGCTATGAC 7 15 pEN11-F AAACCGCATTCCGCACCACAA G 8 16 pEN11-R GGGCGACACGGAAATGTTGAA TAC 9 17 fA1-F GTGTCGCCGCCGACATCGGTG CGAGCGTTTCAGTAGATTTGC 10 18 fA1-R GCAAATCTACTGAAACGCTCG CACCGATGTCGGCGGCGACAC 11 19 fA2b-F GGCGACCCGGGTGGCTCAGGT GCTAGCGTTTCAGTAGATTTG C 12 20 fA2b-R AAACGCTAGCACCTGAGCCAC CCGGGTCGCCGATTCTGAACT G 13 21 fA3b-F TTAAAACCGGGTGGCTCAGGT GCTAGGGCGACATATCGCGGG ACG 14 22 fA3b-R CGCCCTAGCACCTGAGCCACC CGGTTTTAAAGCGTTTTTAAT TTC 15 23 fA4b-F AAGCAACCGGGTGGCTCAGGT GCTAGCGTTTCAGTAGATTTG C 16 24 fA4b-R AAACGCTAGCACCTGAGCCAC CCGGTTGCTTGGCGGCAAG 17 25 fA4c-F CCTTGCCGCCAAGCAATGTAA GCAAAATGTTAGC 18 26 fA4c-R GCTAACATTTTGCTTACATTG CTTGGCGGCAAGG 19 27 fA5c-F GAAATTAAAAACGCTTTAAAA TGCAGCAGCGGAGGGGGTGGT G 20 28 fA5c-R CACCACCCCCTCCGCTGCTGC ATTTTAAAGCGTTTTTAATTT C 21 29 fA6-F CCATAAAGACAAAGGTTTGAG CGTTTCAGTAGATTTGC 22 30 fA6-R GCAAATCTACTGAAACGCTCA AACCTTTGTCTTTATGG 23 31 fA7-F CAATACGGGCAAATTGAAGAG CGTTTCAGTAGATTTGC 24 32 fA7-R GCAAATCTACTGAAACGCTCT TCAATTTGCCCGTATTG 25 33 pfHbpTbpB-F CGTATGACTAGGAGTAAACCT ATGAACAATCCATTGGTGAAT CAGG 26 34 pfHbpTbpB-R CCAATGGATTGTTCATAGGTT TACTCCTAGTCATACG 27 35 TbpB-R GACGTCCGTCTGAAGCCTTAT TCTCG 28 36 OspAafz-R GACGTCTACTTTTTGGCTCAG long TACC 29 37 OspC-F CATATGAATAAAAAGGAGGCA CAAATTAATG 30 38 OspC-R GACGTCTTAATTAAGGTTTTT TTGGACTTTCTG 31 39 RmpM-R GACGTCGCATCGGCAAGATAT TGC 32 40 fA10-F CCATAAAGACAAAGGTTTGAG CGCTTCAGTAGATTTGC 33 41 fA10-R GCAAATCTACTGAAGCGCTCA AACCTTTGTCTTTATGG 34 42 fTA1-F CCTGTGTTTTTGTTGAGTGCT TGTAAGCAAAATGTTAGCAGC CTTG 35 43 fTA1-R CAAGGCTGCTAACATTTTGCT TACAAGCACTCAACAAAAACA CAGG 36 44 fTA2-F GCAAGCCCAAAAAGACCAAAG CGTTTCAGTAGATTTGC 37 45 fTA2-R GCAAATCTACTGAAACGCTTT GGTCTTTTTGGGCTTGC 38 46 fTA3-F CAAGCGGCGGAATTGGTATCA GAGGAGCGTTTCAGTAGATTT GC 39 47 fTA3-R GCAAATCTACTGAAACGCTCC TCTGATACCAATTCCGCCGCT TG 40 48 fTA4-F GGATGATGGTGATATCAAAAG CGTTTCAGTAGATTTGCCTGG TG 41 49 fTA4-R CACCAGGCAAATCTACTGAAA CGCTTTTGATATCACCATCAT CC 42 50 fTA5-F GCAAGCCCAAAAAGACCAAAG CGCTTCAGTAGATTTGC 43 51 fTA5-R GCAAATCTACTGAAGCGCTTT GGTCTTTTTGGGCTTGC 44 52 fC9-F GACCATAAAGACAAAGGTTTG AATAAATTAAAAGAAAAACAC ACAG 45 53 fC9-R CTGTGTGTTTTTCTTTTAATT TATTCAAACCTTTGTCTTTAT GGTC 46 54 fR1-F CCATAAAGACAAAGGTTTGCC GCAATATGTTGATGAAACC 47 55 fR1-R GGTTTCATCAACATATTGCGG CAAACCTTTGTCTTTATGG 48 56 fTR1-F GCAAGCCCAAAAAGACCAACC GCAATATGTTGATGAAACC 49 57 fTR1-R GGTTTCATCAACATATTGCGG TTGGTCTTTTTGGGCTTGC
(20) Amplicons were ligated blunt-end in the pGEM-T Easy vector (Promega) and subsequently heat-shock transformed into E. coli JM109 cells (Promega) according to the manufacturer's instructions. Transformants were screened for insert of the correct length using primers M13-F and M13-R (see Table 1). Plasmids were isolated from overnight cultures of positive JM109 transformants using the Wizard Plus SV Plasmid Miniprep System (Promega). Isolated plasmids were digested using restriction enzymes AatII and NdeI (Fermentas). The resulting fragments were then separated by gel-electrophoresis, and subsequently gel-purified using the Wizard SV Gel and PCR Cleanup System (Promega). Universal plasmid pEN11 (54) was used as vector after digestion with AatII and NdeI in the presence of Shrimp Alkaline Phosphatase (Roche). Inserts and vector were ligated using T4 DNA ligase (Promega) according to the manufacturer's instruction and the resulting plasmids were then heat-shock transformed into E. coli One Shot TOP10F competent cells (Invitrogen). Transformants were screened for insert of the correct length using primer pEN11-F and a reverse primer of the respective construct. Approximately 1 g of isolated pEN11 plasmid (isolation procedure as described before) carrying OspA or fHbp-OspA fusions was added to a 1 ml suspension of N. meningitidis cells (OD.sub.6000.2) and grown in TSB supplemented with 10 mM MgCl.sub.2 at 37 C. for 6 hours (no shaking). Bacteria were then plated on GC plates containing 3 g/ml Cam. Colonies were isolated after 24-48 hours and screened for the presence of pEN11 with correct insert as before.
(21) 1.4 Expression of Constructs in N. meningitidis Cells and nOMVs
(22) N. meningitidis cells were streaked out on GC II plates (Becton Dickinson) and grown overnight as described. The following day, colonies were harvested with a sterile cotton swab were suspended in TSB containing 1 mM IPTG and 3 g/ml Cam and further diluted to an OD.sub.600 of 0.2 in 5 ml of the same broth with supplements. Cells were grown for 4 hours at 37 C. and 170 RPM after which OD.sub.600 was again determined and aliquots corresponding to 4.010.sup.8 CFU were centrifuged for 5 min at 13,000 RPM and resuspended in phosphate buffered saline (PBS). Cells were then centrifuged as before, after which the resulting pellet was dissolved in 40 l MQ, combined with 10 l 5 sample buffer (50% glycerol, 0.25% Tris pH 6.8, 10% Sodium Dodecyl Sulphate, 10% dithiothreitol and 0.05% Bromophenol blue), and boiled for 10 minutes. Samples were then stored at 20 C. for further analysis.
(23) N. meningitidis native OMVs (nOMVs) were diluted to 20 g total protein per ml in PBS, after which 40 l nOMV suspension was boiled with 10 l 5 sample buffer as before.
(24) Protein samples of cells of nOMVs were separated by SDS-PAGE on 12% Precise Protein Gels (Thermo Scientific). Separated proteins were then transferred to 0.45 m nitrocellulose membranes (BioRad). Membranes were incubated for 1 hour on a rolling table in a 1:1000 dilution of anti-OspA (Rockland) in buffer containing 0.1M Tris, 1.54 M NaCl, and 5% Tween-80. The membrane was then transferred to a 1:2000 dilution of goat-anti-rabbit IgG AP (Southern BioTech) in the same buffer supplemented with 0.5% Protifar (Nutricia). Blots were developed using the AP Conjugate Substrate Kit (BioRad).
(25) 1.5 Immunostaining
(26) N. meningitidis cells carrying pEN11 with the various constructs were immobilized on coverslips coated with poly-1-lysine (Sigma). Cells were fixated with 2% formaldehyde in PBS for 10 minutes. After blocking in PBS containing 3% Bovine Serum Albumin (BSA, Sigma), the coverslips were first incubated in a 1:300 dilution of a mix of anti-OspA (Rockland) and anti-fHbp (variant 1, NIBSC) in PBS with 0.5% BSA. After washing, they were incubated in a 1:300 dilution of a mix of Alexa Fluor 488 goat-anti-rabbit IgG and Alexa Fluor 594 goat-anti-mouse IgG (Life Technologies). Slides were post-fixed in 2% formaldehyde in PBS and viewed under an Olympus CKX41 fluorescence microscope at 40 magnification using appropriate filters.
(27) 1.6 Purification of nOMV Vaccines
(28) Glycerol-stocks of clones selected for the immunization experiment were streaked out on GC II plates and grown overnight under conditions described above. The following day, colonies were harvested and used to start a 200 ml culture of OD.sub.600=0.05 in TSB with 1 M IPTG and 3 g/ml Cam. These cultures were grown at 37 C. and 130 RPM and OD.sub.600 was measured at regular intervals. When cultures reached an OD.sub.600 of 1.5 (after 6 hours) they were placed on ice and subsequently centrifuged at 3,500 RPM and 4 C. for 30 minutes. Pellets were resuspended in a Tris-EDTA buffer (100 mM Tris, 10 mM EDTA, pH=8.6) and incubated on a horizontal shaking table for 30 minutes. Since this buffer contains a chelating agent (EDTA) that destabilizes the OM, the release of OMVs is stimulated. The suspensions were centrifuged at 13,000 RPM for 30 minutes and the supernatant was sterilized using a Steriflip 0.22 m filter (Millipore). The sterile supernatant was then centrifuged at 40,000 RPM for 65 minutes, after which the resulting OMV pellet was allowed to dry before being resuspended in 1 ml sucrose buffer. Suspensions were again filtered as before and stored at 4 C.
(29) The nOMV isolation procedure described above was developed in order to harvest as many nOMVs as possible without the hitchhiking of other cellular proteins due to lysis. As we noticed that the expression of OspA, fA1, fA2b, fA3b, and fA5c in nOMVs harvested using this procedure could be increased by allowing the respective cultures to grow for 12 hours, without significantly increasing the hitchhiking of other bacterial proteins (data not shown). We therefore decided to use the alternative isolation procedure for these constructs, in order to equalize the expression of constructs as much as possible.
(30) The total protein concentration of the isolated nOMVs was measured using the BCA Protein Assay Kit (Pierce) and nOMVs were then further diluted in PBS to 5 or 20 g total protein per ml on the day of vaccination.
(31) 1.7 Mice and Immunization
(32) Groups of five female, six- to eight-week-old BALB/cOlaHsd mice (Harlan) were immunized subcutaneously with 200 l of nOMVs, at either low concentration (5 g/ml) or high concentration (20 g/ml). Next to the groups that received nOMVs loaded with OspA (two groups) or fHbp-OspA fusions (sixteen groups), two control groups received empty nOMVS harvested form cells carrying the pEN11 plasmid with the imp gene replacing the ospA-constructs (54). An additional control group was immunized with PBS, resulting in a total of 21 groups. Mice were immunized at days 0 and 28 and sacrificed 14 days after the last immunization. Blood was collected in Vacuette Z Serum Clot Activator tubes (Greiner Bio-One) and centrifuged at 2000 RPM for 15 minutes. Subsequently, sera were collected and stored at 20 C. for further analysis.
(33) 1.8 Analysis of Sera
(34) Sera were first pooled by group (five mice) and analyzed for the presence of antibodies by Western blot. Membranes were loaded with proteins from E. coli TOP10F cells carrying either pEN11-Imp or pEN11-OspA. Membranes were incubated for one hour on a rolling table with pooled sera diluted 1:1000 in Tris buffer (described previously), followed by incubation in a 1:2000 dilution of secondary antibody (goat-anti-mouse IgG AP, Southern BioTech) in the same buffer and blot development as described previously. The ten individual sera of all mice from the two most strongly reacting groups (fA4b, 20 g/ml and fA6, 20 g/ml) were analyzed in the same manner.
(35) For ELISAs, 100 l of 0.5 g/ml OspA control protein (Rockland) diluted in PBS was coated on the surface of wells in Microlon 96-well plates (GreinerBio) and incubated overnight at room temperature (RT). The following day, plates were blocked by adding 200 l 0.5% Protifar in PBS followed by incubation for 30 minutes at RT. Plates were then washed three times in wash buffer (water with 0.05% tween-80). Sera of individual mice were suitably diluted in PBS with 0.1% tween-80 and 100 l was added per well, followed by incubated for 1 hour at RT. Plates were then again washed three times in wash buffer, after which 100 l of goat-anti-mouse IgG HRP (SouthernBiotech) was added (diluted 1:4000 in PBS with 0.1% tween-80). After incubation for 1 hour, the plates were washed as before and 100 l of TMB was added. Plates were then incubated for 10 minutes after which coloring was stopped with 100 l 2M H.sub.2SO.sub.4. OD.sub.450 was subsequently measured on a SynergyMx plate-reader (Biotek).
(36) 2. Results
(37) 2.1 Construction of fHbp-OspA Fusion-Genes
(38) Adjacent to their lipidated N-terminal cysteine, most characterized lipoproteins contain a stretch of amino acids with a low propensity for the formation of secondary structure. This so-called tether is thought to act as a flexible linker between the lipid anchor (the lipidated cysteine) and the structurally confined part of the protein (55). Tethers also play a role in the transport of lipoproteins over the outer membrane, since deletions in this region can result in mislocalization of surface-exposed lipoproteins to the inside of the outer membrane (55).
(39) Since we found no evidence for the surface exposure of OspA expressed in Neisseria, we hypothesized that the switch of bacterial host resulted in mislocalization of the protein to the inside of the outer membrane. We then set out to test whether the addition of parts of fHbp, a surface-exposed Neisserial lipoprotein, might correct this mislocalization. Since the sorting rules for transport over the outer membrane in Neisseria have not yet been elucidated, we designed hybrid genes that combined various parts of fHbp with the globular domain of OspA.
(40) A schematic overview of fHbp and OspA, as well as the fusion genes created from these two genes by overlap extension PCR, is given in
(41) Genomic DNA of N. meningitidis strain 44/76 was used as template in all PCR reactions involving the amplification of parts of fHbp. The fHbp-F primer anneals upstream of the fHbp promoter (57), and therefore all fusion-genes contain the fHbp promoter. OspA was amplified from genomic DNA of B. burgdorferi strain B31 using primers OspA-F and OspA-R (Table 1), and was successfully expressed in E. coli TOP10F from the pEN11 plasmid, which contains an IPTG-inducible tac-lacUV5 promoter (54).
(42) The six amino acid linker peptide that was introduced in constructs fA2b, fA3b, and fA4b was previously used to successfully link OspA to calmodulin (58). We created eight different fusion constructs between fHbp and OspA. From here on we refer to these constructs as fA. Primers used for the construction of fusion genes are shown above (forward primers) or below (reverse primers) the schematic genes in
(43) In fA1, the signal peptide and tether of fHbp were fused to the globular domain of OspA. In constructs fA2b and fA3b, the C-terminal domain (fA2b) or N-terminal domain (fA3b) of fHbp was replaced by the globular domain of OspA and connected via an artificial linker (PGGSGA). In constructs fA4b and fA4c, the complete fHbp gene was linked to the globular domain of OspA using the artificial linker (fA4b) or the OspA tether (fA4c). Construct fA5c is fA1 linked to the globular domain of fHbp via the fHbp tether. Constructs fA6 is similar to fA1, but in addition to signal peptide and tether also contains the first alpha-helix and subsequent loop of the N-terminal domain of fHbp. Construct fA7 is similar to fA6, but additionally contains the first four beta-sheets of the N-terminal domain of fHbp. All constructs were successfully expressed from pEN11 in E. coli TOP10F before transformation in Neisseria (data not shown).
(44) 2.2 Construction of TbpB-OspA Fusion Genes
(45) TbpB of N. meningitidis H44/76 contains a signal peptide (residues 1-20), a 38 amino acid flexible linker or tether (residues 21-58), and a large globular domain (residues 59-691). In order to test whether fusion of N-terminal parts of TbpB to OspA could rescue surface expression of OspA in N. meningitidis, four TbpB-OspA fusion constructs were designed. Because TbpB has an iron-regulated promoter, the TbpB promoter was first exchanged for the constitutive fHbp promoter using overlap extension PCR with primers 1, 25-27 (see Table 1). The resulting construct (TbpB with fHbp promoter, see
(46) An overview of constructs fTA1-4 can be found in
(47) Construct fTA1 contained residues 1-20 (the signal peptide) of TbpB fused to residues 17-273 (tether and globular domain) of OspA. Construct fTA2 contained residues 1-58 (signal peptide and tether) of TbpB fused to residues 29-273 (globular domain) of OspA. Construct fTA3 contained residues 1-75 (signal peptide, tether and first seventeen N-terminal amino acids of the globular domain) of TbpB fused to residues 29-273 (globular domain) of OspA. Construct fTA4 contained residues 1-99 (signal peptide, tether and first 41 N-terminal amino acids of the globular domain) of TbpB fused to residues 29-273 (globular domain) of OspA. TbpB fusion points for fTA3 and fTA4 were chosen in loops between secondary structure elements, based on the TbpB crystal structure (63).
(48) To test whether OspA serotypes other than serotype 1 (B. burgdorferi B31) could be transported to the meningococcal cell surface with the help of N-terminal parts of fHbp or TbpB, fusion constructs similar to fA6 and fTA2 were made, the only difference being that they contained the globular domain of OspA serotype 2 from Borrelia afzelii PKo (residues 29-273). All constructs were made by overlap extension PCR, see
(49) 2.3 Construction of fHbp-OspC Fusion Genes
(50) OspC is a surface-exposed borrelial lipoprotein. It is generally considered to be the most interesting vaccinogen after OspA (64). However, the expression of full-length OspC including its signal sequence has proven difficult in E. coli (65), possibly due to its tendency to aggregate; in the Borrelia outer membrane, it is present in the form of large multimeric complexes. Expression of full-length OspC in both E. coli and N. meningitidis previously led to similar problems in our hands, resulting in poor expression on Western blots (data not shown).
(51) In Borrelia, OspC forms homo-dimers on the cell-surface, mostly by interactions between the N-terminal 1-helices (66, 67). Since most murine and human OspC epitopes are located on the C-terminal side of the protein (68, 69), fusion construct fC9 (
(52) 2.4 Construction of fHbp-RmpM and TbpB-RmpM Fusion Genes
(53) RmpM is an outer membrane protein of N. meningitidis that is thought to associate non-covalently with the peptidoglycan layer (70). It consists of a signal peptide, a flexible N-terminal domain (which binds to integral outer membrane proteins), and an OmpA-like C-terminal domain (which is thought to associate with peptidoglycan). Since RmpM is generally considered to be mostly periplasmic, an attempt was made to express RmpM at the cell surface of N. meningitidis. It was decided to leave out the first 89 residues that consist of signal peptide and the unstructured N-terminal domain. The remaining C-terminal domain (residues 90-242) was fused to N-terminal parts of fHbp (residues 1-50) and TbpB (residues 1-58) that had been used previously for the successful surface localization of OspA. Genomic DNA of N. meningitidis strain H44/76 was used as template for the amplification of fHbp, TbpB, and RmpM. The constructs were named fR1 and fTR1 (see
(54) 2.5 OspA and fHbp-OspA Fusions are Expressed in N. meningitidis Cells and nOMVs
(55) The expression of the different constructs in N. meningitidis is shown in
(56) 2.6 At Least Four fHbp-OspA Hybrids are Surface Exposed
(57) We tested whether or not OspA and the eight fHbp-OspA fusions were surface-localized in N. meningitidis using immunostaining. Briefly, cells containing plasmid pEN11 with the various constructs were incubated with a mix of anti-OspA and anti-fHbp (positive control), followed by incubation with fluorescent secondary antibodies (green for OspA and red for fHbp). Cells containing constructs fA4b, fA4c, fA6, and fA7 showed clear green fluorescence, indicating surface exposure of these constructs (data not shown). No green fluorescence was observed for OspA or any of the other constructs (data not shown), indicating that they were not surface exposed, although we cannot rule out the possibility that this is due to their lower expression level (see
(58) 2.7 Expression and Surface-Exposure TbpB-OspA Hybrids
(59) Successful expression of all four constructs in E. coli and N. meningitidis was confirmed by Western blot using a polyclonal antiserum against OspA (Rockland Immunochemicalssee
(60) 2.8 Expression and Surface-Exposure of Alternative C-Protein Fusion Partners
(61) 2.8.1 Expression and Surface Exposure of an Alternative OspA Serotype
(62) Successful expression of both constructs in E. coli and N. meningitidis was confirmed by Western blot using a polyclonal antiserum against OspA (Rockland Immunochemicals see
(63) 2.8.2 Expression and Surface Exposure of OspC
(64) Despite poor expression in N. meningitidis (
(65) 2.8.3 Expression and Surface Exposure of the Non-Borrelial Non-Lipoprotein RmpM
(66) Both constructs (named fR1 and fTR1), were successfully expressed in E. coli and N. meningitidis.
(67) Although immunostaining yielded bright signals for both constructs, the negative control (N. meningitidis cells without construct) showed bright fluorescence as well. This indicated either a-specific binding of the MN2D6D monoclonal antibody to Neisseria cells, or unanticipated surface localization of (parts of) RmpM. Therefore, a RmpM knockout was created using plasmid pCF13 (71). Plasmids carrying constructs fR1 and fTR1 were transformed in this RmpM strain as before and successful expression of both constructs was determined by Western blot.
(68) Immunostaining of N. meningitidis cells and the RmpM knockout showed that there was a-specific binding of the RmpM antibody at high antibody concentrations (strong staining of the knockout at 1:300 dilution and weak staining of the knockout at 1:2000 dilution, data not shown), while at low antibody concentrations (1:10,000) staining of the knockout completely vanished (data not shown). However, some normal Neisseria cells still showed staining at this low concentration (data not shown), indicating that at least for part of the cells RmpM might be (partially) surface exposed.
(69) When placed in the RmpM knockout background, both fR1 and fTR1 showed a fluorescent signal at the lowest antibody concentration (1:10,000), while staining was completely absent for the RmpM knockout without construct at this concentration (data not shown). This indicates that the N-terminal parts of both fHbp and TbpB that were previously used for the surface localization of OspA can also be used for the surface localization of an otherwise (predominantly) periplasmic non-lipoprotein of Neisseria meningitidis.
(70) 2.9 Immunogenicity of nOMVs Carrying OspA and fHbp-OspA Hybrids
(71) Next, we investigated the sera of mice immunized with nOMVs carrying heterologous (fusion) proteins using Western blot. Pooled sera of all 21 groups were blotted on membranes loaded with total protein content of E. coli with either pEN11-OspA or pEN11-Imp (see
(72) To see whether all individual mice raised OspA-specific antibodies, we blotted the sera of all ten individual mice from two highly responsive groups (20 g/ml fA4b and 20 g/ml fA6). In all cases a 28 kDa band was detected (see
(73) In order quantify the immune response, sera of all individual mice immunized with 20 g/ml nOMVs carrying constructs fA4b, fA4c, fA6, or fA7 were tested for their binding capacity to purified OspA protein. Results for constructs fA4b and fA6 are shown in
(74) 3. Discussion
(75) OMVs are gaining attention as a robust and engineerable vaccine platform against many bacterial diseases. With the recognition of their vaccine potential, interest in heterologous expression in OMVs has flourished. One of the unresolved issues regarding heterologous expression in OMVs is whether the location of the heterologous antigen (lumen, inside of OM, outside of OM) affects the immune response that it evokes. For whole cells, some studies indicate that heterologous antigens are more immunogenic when they are located on the cell surface than when they reside beneath it (59, 60), and it has been suggested that the same may be true for OMVs (21). This makes the display of heterologous proteins on the OMV surface of special interest.
(76) Here, we demonstrate a novel approach for the surface display of heterologous antigens in OMVs. A detergent-free OMV extraction process was recently developed for Neisseria that allows surface-exposed lipoproteins to remain attached to the OMV. This new extraction protocol opens up the possibility to decorate the surface of Neisseria OMVs with heterologous lipoproteins. We therefore expressed OspA, a Borrelial surface lipoprotein, in N. meningitidis. Although OspA could be detected in Neisseria cells and OMVs, we found no evidence for its surface exposure. We then constructed fusions between OspA and fHbp, a meningococcal surface lipoprotein. Several of these constructs consisting of N-terminal parts of fHbp linked to OspA could be detected at the cell surface using immunostaining. Furthermore, we have demonstrated that technology is more broadly applicable as lipoprotein mediated surface expression could also be mediated by N-terminal parts of other lipoproteins, such as TbpB. In addition we demonstrated that a variety of antigenic proteins, including non-borrelial non-lipoproteins such as RmpM, could be surface expressed by fusion to N-terminal parts of lipoproteins. Hence, we have shown that the technology is broadly applicable to mediate the surface expression of specific antigens. The antigens may be associated with an infectious disease and/or a tumour. The fusion proteins of the invention cause surface expression of such antigens on e.g. OMVs, which triggers an immune response, resulting in the prevention or treatment of an infectious disease or tumour associated with the antigen.
(77) In this respect, OMVs carrying these constructs elicited a strong immune response in immunized mice, while OMVs carrying constructs that showed no evidence of surface exposure did not.
(78) 3.1 Outer Membrane Translocation
(79) Knowledge of factors that govern the translocation of lipoproteins over the OM is frugal and incomplete. In Borrelia, the lipoprotein tether (the unstructured region adjacent to the N-terminal cysteine) of several surface lipoproteins (OspA, OspC, and Vsp) seems to contain essential information for OM translocation, since deletion or mutation of amino acids in this region can lead to subsurface localization. Furthermore, fusion of the signal peptide and tether of these three lipoproteins to red fluorescent protein leads to surface localization of this otherwise periplasmic reporter-protein in Borrelia (47, 51, 55).
(80) Neisseria has only a few surface lipoproteins and what factors affect their translocation over the OM is unknown. Our data indicate that, at least for fHbp, these factors are different from those found in Borrelia.
(81) In our hands, expression of OspA in N. meningitidis leads to mislocalization in the periplasm or periplasmic side of the outer membrane. This is in line with previous findings that expression of a lipoprotein in an alternative host can lead to mislocalization, probably because host factors define the localization rules (51). We reasoned that hybridization with an autologous surface exposed lipoprotein from Neisseria like fHbp or TbpB might rescue this mislocalization and therefore constructed fusions between OspA and different parts of fHbp or TbpB. Replacement of the OspA signal peptide and tether with that of fHbp (construct fA1) did not restore OspA surface localization. However, when the fHbp part of this fusion gene was extended with the first 17 N-terminal amino acids of the globular domain of fHbp (consisting of the first alpha-helix and subsequent loop), the resulting construct (fA6) could be detected at the cell surface. This indicates that sorting rules may differ between Neisseria and Borrelia, since in the former the region affecting outer membrane translocation seems to extend beyond the tether region.
(82) Almost all constructs that consists of fusion of OspA to an N-terminal part of fHbp longer than that in fA6 were detected at the cell surface (fA4b, fA4c, fA7). The only exception is construct fA2b, which contains amino acids 1-152 of fHbp (the so-called N-terminal domain) coupled to OspA via an artificial linker. It is however important to stress that considering the extremely poor expression level of fA2b in cells (see
(83) 3.2 Effect of Antigen Location on Immunogenicity
(84) We found evidence for surface exposure of constructs fA4b, fA4c, fA6, and fA7 in Neisseria cells. Coinciding with this, OMVs carrying these constructs were the only ones to elicit strong antibody responses in immunized mice. This suggests that only antigens that are located on the surface of the OMV can elicit antibody responses. However, it is important to realize that the expression level of the four surface constructs is clearly higher than that of the other constructs, both in cells and nOMVs (see
(85) If we compare the Western blots of the groups of mice immunized with high dose OspA and low dose fA6 carrying OMVs (
(86) 3.3 Vaccine Potential
(87) Borrelia vaccines that are currently in development are subunit vaccines that are based on various recombinant lipidated OspA serotypes (38, 39). However, subunit vaccines suffer from poor immunogenicity and require the use of adjuvants. The presentation of OspA on the surface of Neisserial nOMVs may result in better immunogenicity because of the intrinsic adjuvant activity of the nOMV and the presentation of the antigen in its native conformation.
(88) Our OMV surface display method is generally applicable to other antigenic proteins from pathogens, including also non-lipoproteins, especially since it has been shown that lipidation of non-lipoproteins via fusion to lipoproteins can enhance immunogenicity (62). Furthermore it is possible to combine the expression and OMV surface display of multiple heterologous antigens in order to facilitate the production of multivalent heterologous OMVs.
REFERENCES
(89) 1. Ellis T N, Kuehn M J. Virulence and immunomodulatory roles of bacterial outer membrane vesicles. Microbiology and molecular biology reviews: MMBR. 2010; 74(1):81-94. 2. Chen D J, Osterrieder N, Metzger S M, Buckles E, Doody A M, DeLisa M P, et al. Delivery of foreign antigens by engineered outer membrane vesicle vaccines. Proceedings of the National Academy of Sciences of the United States of America. 2010; 107(7):3099-104. 3. Muralinath M, Kuehn M J, Roland K L, Curtiss R, 3rd. Immunization with Salmonella enterica serovar typhimurium-derived outer membrane vesicles delivering the pneumococcal protein PspA confers protection against challenge with Streptococcus pneumoniae. Infection and immunity. 2011; 79(2):887-94. 4. Alaniz R C, Deatherage B L, Lara J C, Cookson B T. Membrane vesicles are immunogenic facsimiles of Salmonella typhimurium that potently activate dendritic cells, prime B and T cell responses, and stimulate protective immunity in vivo. J Immunol. 2007; 179(11):7692-701. 5. Gaillard M E, Bottero, D., Errea, A. Acellular pertussis vaccine based on outer membrane vesicles capable of conferring both long-lasting immunity and protection against different strain genotypes. Vaccine. 2014; 32:931-7. 6. Zollinger W D, Donets M A, Schmiel D H, Pinto V B, Labrie J E, 3rd, Moran E E, et al. Design and evaluation in mice of a broadly protective meningococcal group B native outer membrane vesicle vaccine. Vaccine. 2010; 28(31):5057-67. 7. Nieves W, Petersen H, Judy B M, Blumentritt C A, Russell-Lodrigue K, Roy C J, et al. A Burkholderia pseudomallei outer membrane vesicle vaccine provides protection against lethal sepsis. Clinical and vaccine immunology: CVI. 2014; 21(5):747-54. 8. Camacho A I, de Souza J, Sanchez-Gomez S, Pardo-Ros M, Irache J M, Gamazo C. Mucosal immunization with Shigella flexneri outer membrane vesicles induced protection in mice. Vaccine. 2011; 29(46):8222-9. 9. Kim O Y, Hong B S, Park K S, Yoon Y J, Choi S J, Lee W H, et al. Immunization with Escherichia coli outer membrane vesicles protects bacteria-induced lethality via Th1 and Th17 cell responses. J Immunol. 2013; 190(8):4092-102. 10. Keenan J I, Rijpkema S G, Durrani Z, Roake J A. Differences in immunogenicity and protection in mice and guinea pigs following intranasal immunization with Helicobacter pylori outer membrane antigens. FEMS immunology and medical microbiology. 2003; 36(3): 199-205. 11. Roberts R, Moreno G, Bottero D, Gaillard M E, Fingermann M, Graieb A, et al. Outer membrane vesicles as acellular vaccine against pertussis. Vaccine. 2008; 26(36):4639-46. 12. Bartolini E, Ianni E, Frigimelica E, Petracca R, Galli G, Berlanda Scorza F, et al. Recombinant outer membrane vesicles carrying Chlamydia muridarum HtrA induce antibodies that neutralize chlamydial infection in vitro. Journal of extracellular vesicles. 2013; 2. 13. Holst J, Martin D, Arnold R, Huergo C C, Oster P, O'Hallahan J, et al. Properties and clinical performance of vaccines containing outer membrane vesicles from Neisseria meningitidis. Vaccine. 2009; 27 Suppl 2:B3-12. 14. Nokleby H, Aavitsland P, O'Hallahan J, Feiring B, Tilman S, Oster P. Safety review: two outer membrane vesicle (OMV) vaccines against systemic Neisseria meningitidis serogroup B disease. Vaccine. 2007; 25(16):3080-4. 15. Acevedo R, Fernandez S, Zayas C, Acosta A, Sarmiento M E, Ferro V A, et al. Bacterial Outer Membrane Vesicles and Vaccine Applications. Frontiers in immunology. 2014; 5:121. 16. Kesty N C, Kuehn M J. Incorporation of heterologous outer membrane and periplasmic proteins into Escherichia coli outer membrane vesicles. The Journal of biological chemistry. 2004; 279(3):2069-76. 17. Fantappie L, de Santis M, Chiarot E, Carboni F, Bensi G, Jousson O., et al. Antibody-mediated immunity induced by engineered Escherichia coli OMVs carrying heterologous antigens in their lumen. Journal of extracellular vesicles. 2014; 3. 18. Schild S, Nelson E J, Bishop A L, Camilli A. Characterization of Vibrio cholerae outer membrane vesicles as a candidate vaccine for cholera. Infection and immunity. 2009; 77(1):472-84. 19. Kim J Y, Doody A M, Chen D J, Cremona G H, Shuler M L, Putnam D, et al. Engineered bacterial outer membrane vesicles with enhanced functionality. Journal of molecular biology. 2008; 380(1):51-66. 20. Barat S, Willer Y, Rizos K, Claudi B, Maze A, Schemmer A K, et al. Immunity to intracellular Salmonella depends on surface-associated antigens. PLoS pathogens. 2012; 8(10):e1002966. 21. Daleke-Schermerhorn M H, Felix T, Soprova Z, Ten Hagen-Jongman C M, Vikstrom D, Majlessi L, et al. Decoration of outer membrane vesicles with multiple antigens by using an autotransporter approach. Applied and environmental microbiology. 2014; 80(18):5854-65. 22. Galen J E, Curtiss R, 3rd. The delicate balance in genetically engineering live vaccines. Vaccine. 2014; 32(35):4376-85. 23. Hess J, Gentschev I, Miko D, Welzel M, Ladel C, Goebel W, et al. Superior efficacy of secreted over somatic antigen display in recombinant Salmonella vaccine induced protection against listeriosis. Proceedings of the National Academy of Sciences of the United States of America. 1996; 93(4):1458-63. 24. Kang H Y, Curtiss R, 3rd. Immune responses dependent on antigen location in recombinant attenuated Salmonella typhimurium vaccines following oral immunization. FEMS immunology and medical microbiology. 2003; 37(2-3):99-104. 25. Cornelis P. Expressing genes in different Escherichia coli compartments. Current opinion in biotechnology. 2000; 11(5):450-4. 26. Georgiou G, Stathopoulos C, Daugherty P S, Nayak A R, Iverson B L, Curtiss R, 3rd. Display of heterologous proteins on the surface of microorganisms: from the screening of combinatorial libraries to live recombinant vaccines. Nature biotechnology. 1997; 15(1):29-34. 27. van Bloois E, Winter R T, Kolmar H, Fraaije M W. Decorating microbes: surface display of proteins on Escherichia coli. Trends in biotechnology. 2011; 29(2):79-86. 28. Lee S Y, Choi J H, Xu Z. Microbial cell-surface display. Trends in biotechnology. 2003; 21(1):45-52. 29. Samuelson P, Gunneriusson E, Nygren P A, Stahl S. Display of proteins on bacteria. Journal of biotechnology. 2002; 96(2):129-54. 30. Jong W, Daleke-Schermerhorn M H, Vikstrom D, Ten Hagen-Jongman C M, de Punder K, van der Wel N N, et al. An autotransporter display platform for the development of multivalent recombinant bacterial vector vaccines. Microbial cell factories. 2014; 13(1):162. 31. Park M, Sun Q, Liu F, DeLisa M P, Chen W. Positional assembly of enzymes on bacterial outer membrane vesicles for cascade reactions. PloS one. 2014; 9(5):e97103. 32. Schroeder J, Aebischer T. Recombinant outer membrane vesicles to augment antigen-specific live vaccine responses. Vaccine. 2009; 27(48):6748-54. 33. Jong W S, Sauri A, Luirink J. Extracellular production of recombinant proteins using bacterial autotransporters. Current opinion in biotechnology. 2010; 21(5):646-52. 34. Jose J, Meyer T F. The autodisplay story, from discovery to biotechnical and biomedical applications. Microbiology and molecular biology reviews: MMBR. 2007; 71(4):600-19. 35. Jung H C, Lebeault J M, Pan J G. Surface display of Zymomonas mobilis levansucrase by using the ice-nucleation protein of Pseudomonas syringae. Nature biotechnology. 1998; 16(6):576-80. 36. Sigal L H, Zahradnik J M, Lavin P, Patella S J, Bryant G, Haselby R, et al. A vaccine consisting of recombinant Borrelia burgdorferi outer-surface protein A to prevent Lyme disease. Recombinant Outer-Surface Protein A Lyme Disease Vaccine Study Consortium. The New England journal of medicine. 1998; 339(4):216-22. 37. Steere A C, Sikand V K, Meurice F, Parenti D L, Fikrig E, Schoen R T, et al. Vaccination against Lyme disease with recombinant Borrelia burgdorferi outer-surface lipoprotein A with adjuvant. Lyme Disease Vaccine Study Group. The New England journal of medicine. 1998; 339(4):209-15. 38. Wressnigg N, Barrett P N, Pollabauer E M, O'Rourke M, Portsmouth D, Schwendinger M G, et al. A Novel Multivalent OspA Vaccine against Lyme Borreliosis Is Safe and Immunogenic in an Adult Population Previously Infected with Borrelia burgdorferi Sensu Lato. Clinical and vaccine immunology: CVI. 2014; 21(11): 1490-9. 39. Comstedt P, Harmer M, Schuler W, Meinke A, Lundberg U. Design and Development of a Novel Vaccine for Protection against Lyme Borreliosis. PloS one. 2014; 9(11):e113294. 40. Fletcher L D, Bernfield L, Barniak V, Farley J E, Howell A, Knauf M, et al. Vaccine Potential of the Neisseria meningitidis 2086 Lipoprotein. Infection and immunity. 2004; 72(4):2088-100. 41. Masignani V, Comanducci M, Giuliani M M, Bambini S, Adu-Bobie J, Arico B, et al. Vaccination against Neisseria meningitidis using three variants of the lipoprotein GNA1870. The Journal of experimental medicine. 2003; 197(6):789-99. 42. Koeberling O., Seubert A, Granoff D M. Bactericidal antibody responses elicited by a meningococcal outer membrane vesicle vaccine with overexpressed factor H-binding protein and genetically attenuated endotoxin. The Journal of infectious diseases. 2008; 198(2):262-70. 43. van de Waterbeemd B, Streefland M, van der Ley P, Zomer B, van Dijken H, Martens D, et al. Improved OMV vaccine against Neisseria meningitidis using genetically engineered strains and a detergent-free purification process. Vaccine. 2010; 28(30):4810-6. 44. Brightbill H D, Libraty D H, Krutzik S R, Yang R B, Belisle J T, Bleharski J R, et al. Host defense mechanisms triggered by microbial lipoproteins through toll-like receptors. Science. 1999; 285(5428):732-6. 45. Thoma-Uszynski S, Stenger S, Takeuchi O, Ochoa M T, Engele M, Sieling P A, et al. Induction of direct antimicrobial activity through mammalian toll-like receptors. Science. 2001; 291(5508):1544-7. 46. Okuda S, Tokuda H. Lipoprotein sorting in bacteria. Annual review of microbiology. 2011; 65:239-59. 47. Schulze R J, Zuckert W R. Borrelia burgdorferi lipoproteins are secreted to the outer surface by default. Molecular microbiology. 2006; 59(5):1473-84. 48. Mascioni A, Bentley B E, Camarda R, Dilts D A, Fink P, Gusarova V, et al. Structural Basis for the Immunogenic Properties of the Meningococcal Vaccine Candidate LP2086. The Journal of biological chemistry. 2009; 284(13):8738-46. 49. Steere A C, Livey I. Lyme disease vaccines. Plotkin S A, Orenstein W A, editors. Saunders, Pa., USA2013. 50. Poland G A. Vaccines against Lyme disease: What happened and what lessons can we learn? Clinical infectious diseases: an official publication of the Infectious Diseases Society of America. 2011; 52 Suppl 3:s253-8. 51. Kumru O S. Surface localization determinants of Borrelia burgdorferi lipoproteins. Kansas: University of Kansas; 2011. 52. van der Ley P, Steeghs L, Hamstra H J, ten Hove J, Zomer B, van Alphen L. Modification of lipid A biosynthesis in Neisseria meningitidis lpxL mutants: influence on lipopolysaccharide structure, toxicity, and adjuvant activity. Infection and immunity. 2001; 69(10):5981-90. 53. Horton R M, Hunt H D, Ho S N, Pullen J K, Pease L R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 1989; 77(1):61-8. 54. Bos M P, Tefsen B, Geurtsen J, Tommassen J. Identification of an outer membrane protein required for the transport of lipopolysaccharide to the bacterial cell surface. Proceedings of the National Academy of Sciences of the United States of America. 2004; 101(25):9417-22. 55. Schulze R J, Chen S, Kumru O S, Zuckert W R. Translocation of Borrelia burgdorferi surface lipoprotein OspA through the outer membrane requires an unfolded conformation and can initiate at the C-terminus. Molecular microbiology. 2010; 76(5):1266-78. 56. Li H, Dunn J J, Luft B J, Lawson C L. Crystal structure of Lyme disease antigen outer surface protein A complexed with an Fab. Proceedings of the National Academy of Sciences of the United States of America. 1997; 94(8):3584-9. 57. Oriente F, Scarlato V, Delany I. Expression of factor H binding protein of meningococcus responds to oxygen limitation through a dedicated FNR-regulated promoter. Journal of bacteriology. 2010; 192(3): 691-701. 58. Chen S, Zuckert W R. Probing the Borrelia burgdorferi surface lipoprotein secretion pathway using a conditionally folding protein domain. Journal of bacteriology. 2011; 193(23):6724-32. 59. Lee J S, Shin K S, Pan J G, Kim C J. Surface-displayed viral antigens on Salmonella carrier vaccine. Nature biotechnology. 2000; 18(6):645-8. 60. Rizos K, Lattemann C T, Bumann D, Meyer T F, Aebischer T. Autodisplay: efficacious surface exposure of antigenic UreA fragments from Helicobacter pylori in Salmonella vaccine strains. Infection and immunity. 2003; 71(11):6320-8. 61. Lee S J, Liang L, Juarez S, Nanton M R, Gondwe E N, Msefula C L, et al. Identification of a common immune signature in murine and human systemic Salmonellosis. Proceedings of the National Academy of Sciences of the United States of America. 2012; 109(13):4998-5003. 62. Cote-Sierra J, Bredan A, Toldos C M, Stijlemans B, Brys L, Cornelis P, et al. Bacterial lipoprotein-based vaccines induce tumour necrosis factor-dependent type 1 protective immunity against Leishmania major. Infection and immunity. 2002; 70(1):240-8. 63. Noinaj N, Easley N C, Oke M, Mizuno N, Gumbart J, Boura E, et al. Structural basis for iron piracy by pathogenic Neisseria. Nature. 2012; 483(7387):53-8. 64. Steere A C, Livey I. Lyme disease vaccines. In: Plotkin S A, Orenstein W A, Offit P A, editors. Vaccines. 6th ed: Saunders, and imprint of Elsevier Inc.; 2013. p. 1122-32. 65. Probst C, Ott A, Scheper T, Meyer W, Stocker W, Komorowski L. N-terminal disulfide-bridging of Borrelia outer surface protein C increases its diagnostic and vaccine potentials. Ticks and tick-borne diseases. 2012; 3(1):1-7. 66. Eicken C, Sharma V, Klabunde T, Owens R T, Pikas D S, Hook M, et al. Crystal structure of Lyme disease antigen outer surface protein C from Borrelia burgdorferi. The Journal of biological chemistry. 2001; 276(13):10010-5. 67. Kumaran D, Eswaramoorthy S, Luft B J, Koide S, Dunn J J, Lawson C L, et al. Crystal structure of outer surface protein C (OspC) from the Lyme disease spirochete, Borrelia burgdorferi. The EMBO journal. 2001; 20(5):971-8. 68. Buckles E L, Earnhart C G, Marconi R T. Analysis of antibody response in humans to the type A OspC loop 5 domain and assessment of the potential utility of the loop 5 epitope in Lyme disease vaccine development. Clinical and vaccine immunology: CVI. 2006; 13(10):1162-5. 69. Earnhart C G, Buckles E L, Dumler J S, Marconi R T. Demonstration of OspC type diversity in invasive human lyme disease isolates and identification of previously uncharacterized epitopes that define the specificity of the OspC murine antibody response. Infection and immunity. 2005; 73(12):7869-77. 70. Grizot S, Buchanan S K. Structure of the OmpA-like domain of RmpM from Neisseria meningitidis. Molecular microbiology. 2004; 51(4): 1027-37. 71. van der Voort E R, van der Ley P, van der Biezen J, George S, Tunnela O, van Dijken H, et al. Specificity of human bactericidal antibodies against PorA P1.7,16 induced with a hexavalent meningococcal outer membrane vesicle vaccine. Infection and immunity. 1996; 64(7):2745-51.