Construction of MicroRNA gene-mediated novel tissue engineered nerve and applications thereof in repairing nerve defect

10639399 ยท 2020-05-05

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided is a use of one or more MicroRNA genes selected from miRNAs of Family Let-7, miR-21 or miR-222 in the construction of tissue engineered nerves and in the repair of peripheral nerve defects. An outer and/or internal surface or pores of a tissue engineered nerve graft are coated or adsorbed with polymeric nanomicrospheres carrying a Let-7 family miRNA inhibitor, miR-21, or miR-222, or a mimetic thereof, wherein the polymeric material is composed of biocompatible fibronectin and heparin. The regeneration of peripheral nerves and the construction of tissue engineered nerves are promoted by regulating the expression of MicroRNA genes which can effectively promote the proliferation of primary Schwann cells cultured in vitro and have an anti-apoptotic effect on neuronal cells. In-vivo test proves that bridging of the tissue engineered nerve graft can facilitate the regeneration of peripheral nerves, thus being useful in the treatment of peripheral nerve injury.

Claims

1. A method for construction of a tissue engineered nerve or repair of peripheral nerve defects, comprising administering a Let-7 family miRNA inhibitor, miR-222, or a mimetic thereof to a tissue engineered nerve graft.

2. The method according to claim 1, further comprising: depositing the Let-7 family miRNA inhibitor, miR-222, or a mimetic thereof on an surface of the tissue engineered nerve graft, wherein the surface is an outer surface, an inter surface, a surface of a pore in the tissue engineered nerve graft, or a mixture thereof.

3. The method according to claim 2, wherein the Let-7 family miRNA inhibitor, miR-222, or a mimetic thereof is present on the tissue engineered nerve graft material in an amount of 10 g/g-10 mg/g.

4. The method according to claim 1, further comprising embedding the Let-7 family miRNA inhibitor, miR-222, or a mimetic thereof in nanomicrospheres.

5. The method according to claim 4, wherein the embedded nanomicrospheres are polymeric nanomicrospheres carrying the Let-7 family miRNA inhibitor, miR-222, or a mimetic thereof, and the polymeric material is composed of biocompatible fibronectin and heparin.

6. The method according to claim 5, wherein the weight ratio of fibronectin to heparin is 1:10-1:1.

7. The method according to claim 1, wherein the Let-7 family miRNA inhibitor, miR-222, or a mimetic thereof is: TABLE-US-00003 SEQIDNo:1; rno-let-7a-5p:UGAGGUAGUAGGUUGUAUAGUU, SEQIDNo:2; rno-let-7a-3p:CUAUACAAUCUACUGUCUUUCC, SEQIDNo:3; rno-let-7b-5p:UGAGGUAGUAGGUUGUGUGGUU, SEQIDNo:4; rno-let-7b-3p:CUAUACAACCUACUGCCUUCCC, SEQIDNo:5; rno-let-7c-5p:UGAGGUAGUAGGUUGUAUGGUU, SEQIDNo:6; rno-let-7c-3p:CUGUACAACCUUCUAGCUUUCC, SEQIDNo:7; rno-let-7d-5p:AGAGGUAGUAGGUUGCAUAGUU, SEQIDNo:8; rno-let-7d-3p:CUAUACGACCUGCUGCCUUUCU, SEQIDNo:9; rno-miR-98-5p:UGAGGUAGUAAGUUGUAUUGUU, SEQIDNo:10; rno-miR-98-3p:CUAUACAACUUACUACUUUCC, SEQIDNo:13; rno-miR-222-5p:GGCUCAGUAGCCAGUGUAGAU, and SEQIDNo:14; rno-miR-222-3p:AGCUACAUCUGGCUACUGGGU.

8. A tissue engineered nerve graft, wherein a Let-7 family miRNA inhibitor, miR-222, or a mimetic thereof is deposited on an surface of the tissue engineered nerve graft and the surface is an outer surface, an inter surface, a surface of a pore in the tissue engineered nerve graft, or a mixture thereof.

9. The tissue engineered nerve graft according to claim 8, wherein: the Let-7 family miRNA inhibitor, miR-222, or a mimetic thereof is embedded in nanomicrospheres; the embedded nanomicrospheres are polymeric nanomicrospheres; and the polymeric material is composed of biocompatible fibronectin and heparin.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows the results of in vitro proliferation promotion experiment of Schwann cells as detected by flow cytometry (A. Let-7d inhibitor nanomicrosphere group; B. miR-98 inhibitor nanomicrosphere group; C. miR-21 nanomicrosphere group; D. miR-222 nanomicrosphere group; E. non-nanomicrosphere group with the combination of Let-7d inhibitor, miR-98 inhibitor, miR-21 mimetic and miR-222 mimetic; and F. nanomicrosphere group with the combination of Let-7d inhibitor, miR -98 inhibitor, miR-21 mimetic and miR-222 mimetic).

(2) FIG. 2 shows the results of immunohistochemical staining for cells in anti-apoptotic experiment of primary dorsal root ganglion (DRG) neurons cultured in vitro (A. Let-7d inhibitor nanomicrosphere group; B. miR-98 inhibitor nanomicrosphere group; C. miR-21 nanomicrosphere group; D. miR-222 nanomicrosphere group; E. non-nanomicrosphere group with the combination of Let-7d inhibitor, miR-98 inhibitor, miR-21 mimetic and miR-222 mimetic; and F. nanomicrosphere group with the combination of Let-7d inhibitor, miR-98 inhibitor, miR-21 mimetic and miR-222 mimetic).

(3) FIG. 3 shows the results of electrophysiological function detected in the experiment of repairing rats having nerve defects with the MicroRNA gene mediated novel tissue engineered nerve of the present invention (A. chitosan nanomicrosphere-loaded tube group; B. experimental group with tissue engineered nerve 6 of the present invention; C. autologous nerve group; and D. normal group).

(4) FIG. 4 shows the results of Masson Trichrome (MT) staining for muscles in the experiment of repairing rats having nerve defects with the MicroRNA gene mediated novel tissue engineered nerve of the present invention (A. chitosan nanomicrosphere-loaded tube group; B. experimental group with tissue engineered nerve 6 of the present invention; C. autologous nerve group; and D. normal group).

(5) FIG. 5 shows the results under optical microscope of trichrome staining for nerves in regenerated nerve trunk in the experiment of repairing rats having nerve defects with the MicroRNA gene mediated novel tissue engineered nerve of the present invention (A. chitosan nanomicrosphere-loaded tube group; B. experimental group with tissue engineered nerve 6 of the present invention; C. autologous nerve group; and D. normal group).

DETAILED DESCRIPTION

(6) Specific steps of the present invention will be described by way of examples; however, the present invention is not limited thereto.

(7) The terminology used in the present invention, unless otherwise specified, generally has the same meaning as commonly understood by one of ordinary skill in the art.

(8) The present invention will now be described in further detail with reference to specific examples and accompanying drawings. It should be understood that the examples are merely illustrative of the present invention and not intended to limit the scope of the present invention in any way.

(9) In the following examples, the various processes and methods not detailed herein are conventional methods known in the art.

(10) The present invention will now be further described with reference to specific examples.

Example 1: Preparation of Nanomicrospheres Carrying a Let-7 Family miRNA Inhibitor, miR-21, miR-222 or a Minetic Thereof

(11) The Let-7 family miRNA inhibitor, miR-21, miR-222 or a minetic thereof has the following sequence:

(12) TABLE-US-00002 (SEQIDNo:1) rno-let-7a-5p: UGAGGUAGUAGGUUGUAUAGUU; (SEQIDNo:2) rno-let-7a-3p: CUAUACAAUCUACUGUCUUUCC; (SEQIDNo:3) rno-let-7b-5p: UGAGGUAGUAGGUUGUGUGGUU; (SEQIDNo:4) rno-let-7b-3p: CUAUACAACCUACUGCCUUCCC; (SEQIDNo:5) rno-let-7c-5p: UGAGGUAGUAGGUUGUAUGGUU; (SEQIDNo:6) rno-let-7c-3p: CUGUACAACCUUCUAGCUUUCC; (SEQIDNo:7) rno-let-7d-5p: AGAGGUAGUAGGUUGCAUAGUU; (SEQIDNo:8) rno-let-7d-3p: CUAUACGACCUGCUGCCUUUCU; (SEQIDNo:9) rno-miR-98-5p: UGAGGUAGUAAGUUGUAUUGUU; (SEQIDNo:10) rno-miR-98-3p: CUAUACAACUUACUACUUUCC; (SEQIDNo:11) rno-miR-21-5p: UAGCUUAUCAGACUGAUGUUGA; (SEQIDNo:12) rno-miR-21-3p: CAACAGCAGUCGAUGGGCUGUC; (SEQIDNo:13) rno-miR-222-5p: GGCUCAGUAGCCAGUGUAGAU; and (SEQIDNo:14) rno-miR-222-3p: AGCUACAUCUGGCUACUGGGU.

(13) An appropriate amount of fibronectin was dissolved in sterilized pure water to obtain a 1 mg/ml aqueous fibronectin solution. An appropriate amount of heparin was also dissolved in sterilized water to form a 1 mg/ml aqueous heparin solution. The aqueous fibronectin solution was then added to the aqueous heparin solution with stirring, and the reaction was continued at room temperature for 90 min. After the reaction was completed, the biocompatible crosslinking agent Genipin was added to the above solution, mixed until uniform, and reacted overnight at 4 C. to form light blue nanomicrospheres with uniform particle size, in which the weight ratio of Genipin to fibronectin was 1:5.

(14) One or more of the Let-7 family miRNA inhibitor, miR-21, miR-222 or a minetic thereof was dissolved in saline to form a solution containing 250 ng/mL of the Let-7 family miRNA inhibitor, miR-21, miR-222 or a minetic thereof. The solution was then added to the above-mentioned nanomicrosphere solution, fully stirred and mixed at 4 C., and incubated for 2 hrs, to finally form a dispersion containing fibronectin-heparin nanomicrospheres carrying the Let-7 family miRNA inhibitor, miR-21, miR-222 or a minetic thereof.

Example 2. Preparation of Tissue Engineered Nerves Load with Nanomicrospheres

(15) A nerve tube was prepared following the method as described in Electrospun, Reinforcing Network-Containing, Silk Fibroin-Based Nerve Guidance Conduits for Peripheral Nerve Repair Journal of Biomaterials and Tissue Engineering Vol. 6, 53-60, 2016. The nerve tube was incubated for 2 hrs with the nanomicrospheres prepared in Example 1 at room temperature for physical adsorption, to obtain a tissue engineered nerve loaded with nanomicrospheres. Alternatively, the nerve tube was incubated for 2 hrs with one or more of the Let-7 family miRNA inhibitor, miR-21, miR-222 or a minetic thereof at room temperature for physical adsorption, to obtain a tissue engineered nerve directly loaded with the Let-7 family miRNA inhibitor, miR-21, miR-222 or a minetic thereof.

(16) Tissue engineered nerve 1: tissue engineered nerve loaded with Let-7d inhibitor nanomicrospheres.

(17) Tissue engineered nerve 2: tissue engineered nerve loaded with miR-98 inhibitor nanomicrospheres.

(18) Tissue engineered nerve 3: tissue engineered nerve loaded with miR-21 minetic nanomicrospheres

(19) Tissue engineered nerve 4: tissue engineered nerve loaded with miR-222 minetic nanomicrospheres.

(20) Tissue engineered nerve 5: tissue engineered nerve loaded with Let-7d inhibitor, miR-98 inhibitor, miR-21 minetic, and miR-222 minetic.

(21) Tissue engineered nerve 6: tissue engineered nerve loaded with nanomicrospheres of Let-7d inhibitor, miR-98 inhibitor, miR-21 minetic, and miR-222 minetic.

Example 3: In Vitro Proliferation Promotion Experiment of Schwann Cells

(22) Tissue engineered nerves 1-6 of 1 cm in length were totally immersed in 2 ml of a culture media (which is, depending on the experimental purposes, DMEM+10% FBS in the Schwann cell proliferation experiment; and 97% Neurobasal+2% B27+1% GluMAX in the apoptosis detection experiment of DRG neuron) for 24 hrs at room temperature respectively, and then stored at 4 C. for later use.

(23) Newborn SD rats aged 1-2 days was frozen, and disinfected by spraying 75% alcohol, followed by the steps below which are conducted on a sterile ultraclean bench in a culture room. The sciatic nerve was removed by exposing it via the muscular space posterolateral to the femur and then placed in a pre-cooled HBSS solution. After the epineurium was peeled off under a dissecting microscope, the sciatic nerve was placed in a 1.5 ml EP tube containing 200 l of 1 mg/ml collagenase, and digested at 37 C. for 30 min. Then, the collagenase was removed, and 0.125% trypsin was added, for digestion at 37 C. for 12 min. The digested solution was transferred to a 5 ml EP tube, 3 ml Schwann cell culture medium was added and pipetted repeatedly until substantially no tissue mass was visible. After centrifugation, the supernatant was discarded. The pellet was washed twice with a Schwann cell culture medium, then inoculated at a density of 110.sup.6 cells in a plate previously coated with PLL, and placed in a humidified incubator at 37 C. with 95% air and 5% CO.sub.2. The culture medium was refreshed with a cytosine arabinoside containing medium (1:1000) in 24 hrs. After 24 hrs, the culture medium was refreshed with a medium containing 2 M forsokolin and 10 ng/ml HRG, and refreshed once every 3 days. After the cells were grown to 50% confluent, the culture medium was refreshed completely with a leachate of tissue engineered nerves 1-6 respectively, and continuously cultured for 24 hrs. After digestion with 0.25% trypsin, the cell density was adjusted to 510.sup.5/ml. 0.5 ml of 50 ug/ml PI staining solution was added, and the cells were stained for 30 min at room temperature in the dark. The cell cycle was detected by flow cytometry following a standard procedure

(24) The detection results by flow cytometry are shown in FIG. 1 (A. Let-7d inhibitor nanomicrosphere group; B. miR-98 inhibitor nanomicrosphere group; C. miR-21 nanomicrosphere group; D. miR-222 nanomicrosphere group; E. non-nanomicrosphere group with the combination of Let-7d inhibitor, miR-98 inhibitor, miR-21 mimetic and miR-222 mimetic; and F. nanomicrosphere group with the combination of Let-7d inhibitor, miR-98 inhibitor, miR-21 mimetic and miR-222 mimetic). The results show that 74.93% and 88.58% of the Schwann cells in the experimental groups E and F are in the proliferation cycle, which is significantly higher than the 64.71% in FIG. 1 Panel A, 68.57% in FIG. 1 Panel B, 66.34% in FIG. 1 Panel C, and 60.15% in FIG. 1 Panel D, suggesting that the effect of the combination of Let-7d inhibitor, miR-98 inhibitor, miR-21 mimetic and miR-222 mimetic is better than that of any one alone. Moreover, the tissue engineered nerve loaded with nanomicrospheres containing the Let-7d inhibitor, miR-98 inhibitor, and miR-21 and miR-222 mimetics has an obviously better effect on the Schwann cell proliferation than the tissue engineered nerve directly adsorbed with the Let-7d inhibitor, miR-98 inhibitor, and miR-21 and miR-222 mimetics. It is concluded that the tissue engineered nerve loaded with nanomicrospheres containing the combination of Let-7d inhibitor, miR-98 inhibitor, and miR-21 and miR-222 mimetics can promote the proliferation of primary Schwann cells cultured in vitro.

(25) DRG L4, 5, and 6 from SD rat embryos of 16 days were digested with 0.25% trypsin at 37 C. for 15 min, and inoculated in a 24-well culture plate at a cell density of 10.sup.5 cells/ml. After 1 day of conventional culture in vitro, it was found through observation under a phasecontrast microscope that cells adherent occurred and a few neurites were grown. After pretreatment with 40 ng/ml TNF-for 12 hrs, the primary DRG neurons cultured were treated with a leachate of tissue engineered nerves 1-6 for 12 hrs respectively. The culture medium was aspirated off and the cells were washed once with 0.01 M PBS. 4% paraformaldehyde was added, and the cells were immobilized at room temperature for 30 min. The fixative was removed and the cells were washed for 10 min with 0.01 M PBS at room temperature (3). The cells were blocked for 60 min at 37 C. with 0.01 M PBS containing 10% goat serum and 0.3% Triton X-0100, and then the blocking solution was aspirated off. The primary antibodies, i.e. the Rabbit antibodies against cleaved caspase-3 (1:500) and the Mouse rabbit antibody against total caspase-3 (1:800), were added dropwise and incubated overnight at 4 C. The cells were washed for 10 min with 0.01 M PBS (3). The secondary antibodies, i.e. the TRITC labeled secondary antibody donkey anti-mouse IgG (1:600), and the FITC labeled secondary antibody donkey anti-rabbit IgG (1:600) were added dropwise, and the nucleus was labeled with Hoechst (5 g/ml), stood for 1 hr at room temperature in the dark, and then washed for 10 min with 0.01 M PBS (3). The immunofluorescence cytochemical detection results were observed under a laser confocal microscope (FITC excitation wavelength: 488 nm, and emission wavelength: 500-535 nm; and Hoechst Ar ion excitation wavelength: 353-364 nm, and emission wavelength: 460-480 nm).

(26) The immunohistochemical staining results of cells are shown in FIG. 2 (A. Let-7d inhibitor nanomicrosphere group; B. miR-98 inhibitor nanomicrosphere group; C. miR-21 nanomicrosphere group; D. miR-222 nanomicrosphere group; E. non-nanomicrosphere group with the combination of Let-7d inhibitor, miR-98 inhibitor, miR-21 mimetic and miR-222 mimetic; and F. nanomicrosphere group with the combination of Let-7d inhibitor, miR-98 inhibitor, miR-21 mimetic and miR-222 mimetic). In the figure, the blue indicates Hoechst labeled nucleus; the red indicates total caspase-3 which is expressed generally in all of the normal cells; the green indicates activated caspase-3, which is expressed merely in apoptotic cells. The results show that the immunohistochemistry of Let-7d inhibitor nanomicrosphere group (FIG. 2 Panel A), the miR-98 inhibitor nanomicrosphere group (FIG. 2 Panel B), the miR-21 nanomicrosphere group (FIG. 2 Panel C), and the miR-222 nanomicrosphere group (FIG. 2 Panel D) indicates the presence of a lot of green, that is, activated caspase-3, suggesting the apoptosis of cells. FIG. 2 Panel E shows the result of the non-nanomicrosphere group with the combination of Let-7d inhibitor, miR-98 inhibitor, miR-21 mimetic and miR-222 mimetic. Although activated caspase-3 is still expressed, the level is obviously lower than that of the experimental group with a single MicroRNA. FIG. 2 Panel F shows the result of the nanomicrosphere group with the combination of Let-7d inhibitor, miR-98 inhibitor, miR-21 mimetic and miR-222 mimetic. The result shows that no activated caspase-3 is expressed, suggesting that almost no apoptosis of cells occurs. It is concluded that the tissue engineered nerve with the combination of Let-7d inhibitor, miR-98 inhibitor, and miR-21 and miR-222 mimetics can greatly inhibit the apoptosis caused by TNF-a of primary DRG neurons cultured.

Example 4. Use of MicroRNA Gene-Meditated Novel Tissue Engineered Nerve in the Repair of Nerve Defects

(27) 1. Grouping of Animal Experiment and Model Preparation

(28) 1.1. Animal Experiment and Grouping

(29) The rats were randomly divided into 4 groups (each group having 15 animals), including a tissue engineered nerve group (experimental group with tissue-engineered nerve 6 described in Example 2), an autologous nerve group, a chitosan nanomicrosphere-loaded tube group (negative control group), and a sham operation group (normal group).

(30) Preparation of chitosan nanomicrosphere-loaded tube:

(31) As described in Kawadkar J, Chauhan M K. I Intra-articular delivery of genipin cross-linked chitosan nanomicrospheres of flurbiprofen: preparation, characterization, in vitro and in vivo studies. [J]. European Journal of Pharmaceutics and Biopharmaceutics, 2012,81(3):563-572, 3 ml of a 30 g/L chitosan solution in acetic acid/water was added dropwise to 40 ml of liquid paraffin containing 20 g/L span-80 and magnetically stirred at room temperature to form a stable W/O emulsion system. Biological cross-linking agent Genipin with 2 ml volume fraction of 70% ethanol solution dissolved, into the emulsion for cross-linking curing. After completion of the reaction, the resulting chitosan nanomicrospheres were collected by centrifugal dispersion. The biocompatible crosslinking agent Genipin was dissolved in 2 ml of a 70 vol % ethanol solution, and added dropwise into the emulsion for curing by cross-linking. After completion of the reaction, the resulting chitosan nanomicrospheres were collected by centrifugation. The Let-7d inhibitor, miR-98 inhibitor, miR-21 and miR-222 mimics described in Example 1 were dissolved in physiological saline to form a 250 ng/mL solution containing the Let-7d inhibitor, miR-98 inhibitor, miR-21 and miR-222 mimics. The solution was then added to the above-mentioned nanomicrosphere solution, mixed fully by stirring at 4 C., and incubated for 2 hrs to finally form a dispersion of chitosan nanomicrospheres carrying the Let-7d inhibitor, miR-98 inhibitor and miR-21 and miR-222 mimetics.

(32) A nerve tube was prepared following the method described in Electrospun, Reinforcing Network-Containing, Silk Fibroin-Based Nerve Guidance Conduits for Peripheral Nerve Repair Journal of Biomaterials and Tissue Engineering Vol. 6, 53-60, 2016. The nerve tube was incubated for 2 hrs with the nanomicrospheres for physical adsorption, to obtain a chitosan tube loaded with nanomicrospheres.

(33) 1.2. Model Preparation

(34) The animals were intraperitoneally anesthetized with a compound anesthetic (0.2-0.3 ml/100 g body weight). After the success of anesthesia, conventional skin preparation, disinfection, and draping were done in a surgical area at the left femur. An incision was made right in the center posterior to the left femur, followed by cutting the skin and fascia, to free and fully expose the sciatic nerve. The sciatic nerve was dissected in the middle of the femur and a 10 mm defect was caused. For the tissue engineered nerve group (TENG) and the fibroin tube group (Scaffold), the dissected ends at both sides of the nerve were inserted 1 mm into the tube, and immobilized by suturing the epineurium with an atraumatic suture. For the autologous nerve group, the dissected sciatic nerve was reversed before suturing. The incision was conventionally closed. The model preparation and subsequent feeding and observation were all carried out in an SPF barrier system.

(35) 2. Evaluation of Postoperative Functional Recovery

(36) 2.1. Test of Electrophysiological Functions

(37) 12 weeks after operation, the rats were subjected to electrophysiological examination at room temperature. The rats were weighed and intraperitoneally injected with compound anesthetic (0.2-0.3 ml per 100 g body weight of rat). After the success of anesthesia, the sciatic nerve was exposed and carefully separated with a glass dissecting needle. The compound muscle action potentials (CMAPs) were recorded. The recording electrode was inserted into the muscle belly of the gastrocnemius muscle, and the interference electrode was placed on the skin surface of the rat knee. The stimulation electrodes were sequentially placed proximal and distal to the sciatic nerve trunk of the injured site to stimulate the nerve. The CMAPs were recorded and the amplitude and latency of the CMAPs were measured. Similarly, the amplitude and latency of the CMAPs at the normal side were recorded. The amplitude of CMAPs is proportional to the nerve fibers that dominate the target muscle. Therefore, the detection of CMAPs provides an important parameter for the recovery of the conduction function of peripheral nerves. The CMAP recovery index was calculated according to the formula: recovery index =maximal amplitude of CMAPs at the operated side/maximal amplitude of CMAPs at the normal side.

(38) The experimental results are shown in FIG. 3 (A. chitosan nanomicrosphere-loaded tube group; B. experimental group with tissue engineered nerve 6 of the present invention; C. autologous nerve group; and D. normal group). The results show that the recovery of CMAP and nerve conduction velocity in the gastrocnemius muscle of the rats in the experimental group with tissue engineered nerve 6 of the present invention is significantly better than that of the chitosan nanomicrosphere group, and is close to that of the positive control autologous nerve group.

(39) 2.3. Perfusion Fixation and Acquisition of Tissue

(40) 2.3.1. Perfusion Fixation

(41) At weeks 4 and 12 after surgery, rats were given an operation with a compound anesthetic and the chest was opened to expose the heart. The right auricle was pierced, and the needle was pierced into the left ventricle to perfuse it with physiological saline (where the perfusion volume was about 2 times of the body weight) until the color of the liver became light, and the fluid in the mesenteric vessels became nearly colorless from the red. Then, equal volume of 4% paraformaldehyde was perfused.

(42) 2.3.2. Acquisition of Tissue

(43) Three rats in each group were perfused and fixed. The regenerated sciatic nerve trunk was removed, immersed in a pre-cooled glutaraldehyde fixative solution, and left for being embedded with a resin and observed under an electron microscope.

(44) After perfusion, the bilateral gastrocnemius muscles with a volume of about 0.5 cm0.3 cm0.3 cm were carefully dissected and cut intact, and immersed overnight in a suitable amount of a pre-cold post-fixative solution (4% PA) at 4 C. The regenerated sciatic nerve trunk on the operated side was carefully dissected and removed, and a segment of sciatic nerve in a corresponding site at the normal side was removed and taken as the control. The sciatic nerve sample was straightly attached on a cardboard and immersed overnight in a suitable amount of a pre-cold post-fixative solution (4% PA) at 4 C.

(45) 2.4. Sample Treatment and Observation

(46) 2.4.1. Treatment of Samples for Electron Microscopy

(47) At weeks 4 and 12 after operation, the sciatic nerve and gastrocnemius muscle samples were fixed with glutaraldehyde, followed by post-fixation with 1% osmic acid, fast staining with uranyl acetate, dehydration over ethanol gradient, and embedding in Epon 812 epoxy resin.

(48) 2.4.2. Masson Trichrome (MT) Staining for Muscles

(49) At weeks 4 and 12 after operation, the gastrocnemius muscle was precipitated in a sucrose solution, then embedded in 5% sucrose (formulated in 0.1 M PB), frozen, and laterally sliced into 10 m. The slices were placed at room temperature for about 24 hours, for facilitating the tissue attachment. Masson trichrome staining was performed as follows. The collagen fibers appeared blue, the muscle fibers appeared red and the nuclei appeared black and blue.

(50) (1) The slices were placed in ddH.sub.2O for 3-5 min.

(51) (2) The slices were stained with Ehrlich hematoxylin for 20 min.

(52) (3) The slices were immersed in ddH.sub.2O for about 1 min, and amenable to color separation for about lmin in 1% hydrochloric acid in ethanol.

(53) (4) Bluing with tap water is continued for about 20 min under a microscope.

(54) (5) The slices were stained with Ponceau Sacid complex red for 5 min.

(55) (6) The slices were washed with ddH.sub.2O.

(56) (7) The slices were stained with 1% phosphomolybdic acid.

(57) (8) The slices were directly stained with toluidine blue for 5 min without washing with water.

(58) (9) The slices were washed with ddH.sub.2O, and amenable to color separation for about 1 min with 1% glacial acetic acid.

(59) (10) The slices were dehydrated with 95% ethanol for 5 min (3), followed by dehydration in absolute ethanol for 5 min (2).

(60) (11) The slices were transparented with xylene for 5 min (3), mounted with resin, air dried at room temperature, and then observed under an optical microscope.

(61) The experimental results are shown in FIG. 4 (A. chitosan nanomicrosphere-loaded tube group;

(62) B. experimental group with tissue engineered nerve 6 of the present invention; C. autologous nerve group; and D. normal group, where the red indicates muscle fiber; and the blue indicates collagen fiber). The results show that the cross-sectional area of the muscle fibers in the experimental group with tissue engineered nerve 6 of the present invention is close to that of the autologous nerve group, both of which is significantly higher than that of the chitosan nanomicrosphere group; and the percent of area of the collagen fibers is significantly lower than that of the chitosan nanomicrosphere group.

(63) 2.5. Electron Microscopic Analysis of Nerve Tissue

(64) (1) Harris hematoxylin: 0.5 g of hematoxylin was added to and dissolved in 5 ml of absolute ethanol. 10 g of potassium aluminum sulfate was added to and dissolved in 100 ml of double distilled water. The two solutions were mixed until uniform and heated to boiling. Then, 0.25 g of mercury oxide yellow was added, and cooled in ice water after dissolution. After filtering, 5 ml of glacial acetic acid was added. (2) Trichrome stain solution: 0.3 g of solid green FCF, 0.6 g of chromotrope 2R and 0.6 g of phosphotungstic acid were added in sequence to and dissolved in 100 ml of double distilled water, and then 2 ml of glacial acetic acid was added to adjust the pH to 3.4. The stain solution might be stored at room temperature for two weeks. If the preservation time is too long or the pH value changes, the color shifts towards purple and the green become lighter. (3) The 0.3% glacial acetic acid solution was formulated immediately before use.

(65) Referring to the experimental method of Meyer et al with modification, the slices were (1) conventionally deparaffinized into ddH.sub.2O; (2) stained with Harris hematoxylin for 5 min; (3) washed for 5 min with double distilled water, and controlled in terms of bluing under a microscope; (4) stained with the trichrome stain solution for 30 min; (5) washed twice with 0.3% glacial acetic acid for 20 seconds each; and washed for 5-10 min with running water, until the color of the tissue slice was unchanged; and (7) dehydrated, transparented, and mounted with resin.

(66) The results are shown in FIG. 5 (A. chitosan nanomicrosphere-loaded tube group; B. experimental group with tissue engineered nerve 6 of the present invention; C. autologous nerve group; and D. normal group, where the purple indicates Schwann cell nuclei; and the green indicates the nerve axon). The results show that the formation of myelin sheath of the regenerated nerve trunk in the experimental group with tissue engineered nerve 6 of the present invention is significantly better than that of the chitosan nanomicrosphere group, and is close to that of the positive control autologous nerve group.

(67) 3. Data Statistics

(68) In this study, the data of group design and morphometric analysis was analyzed by one-way ANOVA using the STATA7 statistical analysis software. If the difference between the groups was statistically significant, the Turkey's method was used to compare pairwise. The results are expressed as meanstandard deviation (XSD), and p<0.05 indicates that the difference was statistically significant.