DNA MODIFICATION INDUCING PROTEIN COMPLEX AND RECOMBINANT VECTOR COMPRISING A GENE ENCODING THE SAME

20200128802 ยท 2020-04-30

    Inventors

    Cpc classification

    International classification

    Abstract

    Provided are a protein complex in which estrogen receptor 2 (ERT2) is fused to CRISPR associated protein 9 (Cas9), and a recombinant vector carrying a gene coding the protein complex, wherein ERT2 is bonded to the N-terminus and C-terminus of nuclear localization sequence (NLS)-removed Cas9 and the complex has the advantage of translocating from the cytosol into the nucleus at a certain time point upon treatment with tamoxifen and modifying a specific DNA with the aid of guide RNA (gRNA), ultimately enabling a more elaborate DNA modification operation in a desired part at a desired time point.

    Claims

    1. A protein complex comprising estrogen receptor 2 (ERT2) fused to CRISPR associated protein 9 (Cas9), wherein ERT2 is bound to N-terminus and C-terminus of Cas9 from which a nuclear localization sequence (NLS) is removed.

    2. The protein complex of claim 1, wherein the protein complex is transported from the cytoplasm into the nucleus by tamoxifen treatment.

    3. A recombinant vector comprising a gene encoding the protein complex of claim 1, wherein the gene consists of a nucleotide sequence of SEQ ID NO: 12.

    4. The recombinant vector of claim 3, further comprising guide RNA (gRNA) and a promoter.

    5. The recombinant vector of claim 4, wherein the promoter is a cytomegalovirus (CMV) promoter.

    6. A transgenic animal produced by implanting, into a recipient animal, an embryo with the recombinant vector of claim 3 microinjected thereinto.

    7. The transgenic animal of claim 6, wherein the animal is a mouse.

    8. A method of producing a transgenic animal, the method comprising the following processes: a) constructing the recombinant vector of claim 3; b) microinjecting the recombinant vector into an embryo of a recipient animal; and c) implanting the embryo into the fallopian tube of the recipient animal by using a surgical method.

    9. The method of claim 8, wherein the recombinant vector of process a) further comprises gRNA and a promoter.

    10. The method of claim 8, wherein the recipient animal is a mouse.

    Description

    BRIEF DESCRIPTION OF DRAWINGS

    [0023] FIG. 1 is a view illustrating a process for the transport of a Cas9-ERT2 protein complex, which is present in the cytoplasm, into the nucleus by tamoxifen (TMX) treatment.

    [0024] FIG. 2a illustrates the structure of a Cas9-ERT2 protein complex in which ERT2 is fused to the N-terminus and C-terminus of Cas9 from which a nuclear localization signal (NLS) is removed, and FIG. 2b illustrates the structure in which guide RNA (gRNA) of a specific gene to be inhibited, a U6 promoter, a cytomegalovirus (CMV) promoter, and Cas9-ERT2 are linked to one another.

    [0025] FIG. 3 illustrates the map of a recombinant vector including a gene encoding a protein complex according to an embodiment of the present invention.

    [0026] FIG. 4 schematically illustrates a process for constructing a recombinant vector according to an embodiment of the present invention.

    [0027] FIG. 5 illustrates DNA for microinjection, which is produced to microinject a recombinant vector according to an embodiment of the present invention into an embryo.

    [0028] FIG. 6a illustrates the results of confirming the expression pattern of a Cas9-ERT2 protein complex when not treated with tamoxifen (TMX), and FIG. 6b illustrates the results of confirming the expression pattern of the Cas9-ERT2 protein complex when treated with TMX.

    [0029] FIG. 7 illustrates the results of comparing ROI 1 (up cell) and ROI 2 (down cell), which is a cell on which vector transfection was not performed.

    [0030] FIG. 8 illustrates the results of analyzing the expression patterns of ROI 1 and ROI 2 upon tamoxifen treatment according to intensity.

    BEST MODE

    [0031] The inventors of the present invention confirmed that, by treating a Cas9-ERT2 protein complex with tamoxifen, the Cas9-ERT2 could be transported from the cytoplasm into the nucleus at a specific time, and the Cas9-ERT2 protein complex transported into the nucleus was able to modify specific DNA by recognizing guide RNA, and thus completed the present invention based on these findings.

    [0032] Hereinafter, the present invention will be described in detail.

    [0033] The present invention provides a protein complex in which estrogen receptor 2 (ERT2) is fused to CRISPR associated protein 9 (Cas9), wherein the ERT2 is bound to the N-terminus and C-terminus of Cas9 from which a nuclear localization sequence (NLS) is removed.

    [0034] In the present invention, Cas9, which is an abbreviation of CRISPR associated protein 9, refers to CRISPR-CAS9, and CRISPR-CAS9 is a third generation gene scissors, which recognizes a specific nucleotide sequence to be used and cleaves and edits the sequence, and is useful for simple, rapid, and efficient manipulation of inserting a specific gene into a target location of a genome or stopping the activity of a specific gene.

    [0035] In the present invention, ERT2, which is an abbreviation of Estrogen receptor 2, refers to an estrogen receptor, and the estrogen receptor acts as a transcriptional regulator that promotes hormone-dependent transcription by binding, as a homodimer, to an estrogen-responsive amplicon sequence present in target gene promoters (common sequence: 5-AGGTCANNNTGACCT-3).

    [0036] In the present invention, gRNA is an abbreviation of guide RNA and refers to a small RNA of 45 to 70 nucleotides that has nucleotide sequence information, which is a template for a modification reaction when editing RNA, in which the 5-side region of gRNA is in an order complementary to a portion of mRNA that is RNA-edited, enabling gRNA to bind to mRNA via this region, a nucleotide sequence complementary to the order of the final mRNA after editing is present in the 3-side region of gRNA, and RNA modification, such as the insertion or deletion of uridine, occurs according to the sequence information.

    [0037] The present invention also provides a recombinant vector including a gene encoding the protein complex, wherein the gene consisting of the nucleotide sequence of SEQ ID NO: 12.

    [0038] In the present invention, vector refers to DNA used in a DNA recombination experiment, which enables the introduction of a target DNA fragment into a host bacterium or the like and proliferation thereof, and is also referred to as a cloning vehicle, and vector DNA is cleaved and opened by an restriction enzyme or the like, and a target DNA fragment is inserted thereinto and linked thereto, followed by introduction into a host bacterium. The vector DNA to which the target DNA fragment is linked replicates as the host bacterium proliferates and is distributed to each daughter cell as well as the division of the bacterium, thereby maintaining the target DNA fragment from generation to generation, and plasmids and phage chromosomes are mainly used.

    [0039] The present invention also provides a transgenic animal produced by implanting, into a recipient animal, an embryo into which a recombinant vector constructed according to the present invention is microinjected.

    [0040] Another embodiment of the present invention provides a method of producing a transgenic animal, including: a) constructing a recombinant vector according to the present invention; b) microinjecting the recombinant vector into an embryo; and c) implanting the embryo into the fallopian tube of a recipient animal by using a surgical method.

    [0041] In one embodiment of the present invention, to produce a protein complex capable of inducing DNA modification at a desired time and a specific site by using Cas9, a structure for linking Cas9 and ERT2 was designed (see Example 1).

    [0042] In another embodiment of the present invention, a recombinant vector including a gene encoding the protein complex was constructed (see Example 2). An embryo with the recombinant vector microinjected thereinto was generated to produce transgenic mice (see Example 3).

    [0043] In another embodiment of the present invention, immunostaining was performed to confirm an expression pattern of the protein complex (see Example 4).

    [0044] Hereinafter, exemplary examples will be described to aid in understanding of the present invention. However, the following examples are provided only to facilitate the understanding of the present invention and are not intended to limit the scope of the present invention.

    MODE OF INVENTION

    Example 1. Preparation of DNA Modification-Inducing Protein Complex

    [0045] To prepare a DNA modification-inducing protein complex, as illustrated in FIG. 1, to more precisely regulate Cas9 which is transported into the nucleus upon expression, the inventors of the present invention allowed Cas9 to be present in the cytoplasm by removing a nuclear localization signal (NLS) therefrom, and designed the structure of a Cas9-ERT2 protein complex (ERT2-Cas9-ERT2) capable of being transported into the nucleus at a specific time by treating tamoxifen (TMX), a Cas9-ERT2 protein complex prepared by fusing ERT2 to the N-terminus and C-terminus of Cas9 from which the NLS was removed (see FIG. 2a).

    [0046] Specifically, to modify a specific gene at a desired time, the inventors designed a structure in which guide RNA (gRNA) of a specific gene, a U6 promoter, a CMV promoter, and the Cas9-ERT2 protein complex were linked to each other (see FIG. 2b). At this time, ubiquitous expression is possible due to the use of the CMV promoter.

    Example 2. Construction of Recombinant Vector

    [0047] In one embodiment of the present invention, a recombinant vector including a gene encoding the protein complex of the present invention was constructed (see FIG. 4). Specifically, pCAG-ERT2CreERT2 (#13777) and pX330-U6-Chimeric_BB-CBh-hSpCas9 (#42230) plasmids were purchased from Addgene, and a mouse TIF1 CRISPR/Cas9 knockout (KO) plasmid (sc-430111) was purchased from Santa Cruz. For the mouse lecithin retinol acyltransferase (LRAT) promoter sequence, sequences (5,500 to +72 bps) expected to have high activity were selected using promoter prediction (http://gpminer.mbc.nctu.edu.tw/index.php), and PCR was carried out using specific primers shown in Table 1 below using normal mouse DNA (C57BL/6N) to obtain a LRAT promoter.

    TABLE-US-00001 TABLE1 Primersequence(5-3) Forward GACTTGATTATTGACTAGTCCTTAAAGAGAGGCATCCGGGGTC Reverse GTTCTTCTCCTTTGCTAGCCATGACGCTCACGCTAAAGAGCTT GAAG

    [0048] To produce a plasmid which is dependent on the LRAT promoter and in which the regulation of liver fibrosis inhibitory gene (TIF1) expression is induced by tamoxifen, a CAG promoter and Cre of pCAG-ERT2CreERT2 were replaced with the LRAT promoter and Streptococcus pyogenes Cas9 (SpCas9), respectively.

    [0049] Next, TIF1 gRNAs shown in Table 2 below having a U6 promoter were inserted into the plasmid, respectively.

    TABLE-US-00002 TABLE2 gRNAse1uence(5-3) gRNA1 GGTGCGGCTGGGCCCGACGA gRNA2 CTACATTCTTGACGACATAC gRNA3 GAAGATAATGCAAGTGCAGT

    [0050] The prepared pLrat-ERT2Cas9ERT2-TIF1 gRNA plasmid was identified by Sanger sequencing.

    Example 3. Production of Transgenic Mice

    [0051] To produce transgenic (TG) mice in which specific gene expression is regulated by tamoxifen at a specific time, pregnant mare serum gonadotrophin (PMSG) (7.5 IU) and human chorionic gonadotropin (hCG) (5 IU) were intraperitoneally (IP) injected into 5- to 8-week-old C57BL/6N female mice at intervals of 48 hours each to induce superovulation, and after hCG injection, the female mice were crossed with C57BL/6N male mice. Virginal plugs were used to determine whether the female mice were pregnant, and fertilized embryos were harvested from the female mice.

    [0052] As one embodiment for the production of transgenic mice, as illustrated in FIG. 5, 3 DNAs (pLrat-ERT2Cas9ERT2-TIF1 gRNAs) in which the regulation of liver fibrosis inhibitory gene (TIF1) expression is induced by tamoxifen were double-cut with AvrII/PvuI and linearized to be prepared for microinjection, and the 3 DNAs were microinjected into one cell-stage embryos at the same concentration. Standard microinjection procedures were used to produce such transgenic mice (Macrogen, Seoul, Korea).

    [0053] A total of 4 ng/l of a mixture of the 3 DNAs was directly injected into the pronucleus of a zygote using a micromanipulator, and embryos into which the DNA mixture was microinjected were incubated at 37 C. for 1 to 2 hours. 14 to 16 embryos were implanted into the fallopian tubes of pseudo-pregnant recipient mice (ICR) using a surgical method.

    [0054] Transgenic mice produced in this manner were bred under conditions free of pathogens at Macrogen (Seoul, Korea), and all manipulations were carried out with the approval of the Experimental Animal Management Committee of Macrogen.

    Example 4. Expression Analysis of DNA Modification-Inducing Protein Complex

    [0055] Immunostaining was performed to confirm an expression pattern of the DNA modification-inducing protein complex according to the present invention. To this end, LX2 cells (Human hepatic stellate cell lines) were transfected therewith, and then treated with 1 nM tamoxifen (TMX), and after 4 hours, a decrease in a target gene (TIF1 gamma; TIF1) and an increase in an opposite gene (alpha SMA; -SMA) according to whether or not TMX was treated were examined.

    [0056] As a result, as illustrated in FIGS. 6a and 6b, when TMX was not treated, the transport of the Cas9-ERT2 protein complex expressed in the cytoplasm (cytosol) into the nucleus was inhibited, -SMA was low, and TIF1 was highly expressed in the nucleus (see FIG. 6a). In contrast, it was confirmed that, upon TMX treatment, the Cas9-ERT2 protein complex expressed in the cytoplasm was transported into the nucleus, -SMA was high, and the expression of TIF1 in the nucleus was reduced (see FIG. 6b).

    [0057] In addition, as a result of conducting analysis according to intensity using software, as illustrated in FIGS. 7 and 8, it was confirmed that, when comparing ROI 1 (up cell) and ROI 2 (down cell), which is a cell on which vector transfection was not performed (see FIG. 7), the Cas9-ERT2 protein complex expressed in the cytoplasm was transported into the nucleus by TMX treatment, intranuclear Cas9 was higher in ROI 1 than in ROI 2, -SMA was high in the cytoplasm, and TIF1 expression in the nucleus was reduced (see FIG. 8).

    [0058] For reference, the sequence list of the present invention is shown in Table 3 below.

    TABLE-US-00003 TABLE 3 SEQ ID NO: 1 Forward Primer SEQ ID NO: 2 Reverse Primer SEQ ID NO: 3 transcriptional intermediary factor 1 gamma gRNA 1 SEQ ID NO: 4 transcriptional intermediary factor 1 gamma gRNA 2 SEQ ID NO: 5 transcriptional intermediary factor 1 gamma gRNA 3 SEQ ID NO: 6 Cas9-ERT2 Forward Primer SEQ ID NO: 7 Cas9-ERT2 Reverse Primer SEQ ID NO: 8 transcriptional intermediary factor 1 gamma gRNA U6-F SEQ ID NO: 9 transcriptional intermediary factor 1 gamma gRNA gRNA1-R SEQ ID NO: 10 transcriptional intermediary factor 1 gamma gRNA gRNA2-R SEQ ID NO: 11 transcriptional intermediary factor 1 gamma gRNA gRNA3-R SEQ ID NO: 12 ERT2-Cas9-ERT2 SEQ ID NO: 13 RNA polymerase III promoter for human U6 snRNA SEQ ID NO: 14 human cytomegalovirus (CMV) immediate early promoter SEQ ID NO: 15 Cas9 (Csn1) endonuclease from the Streptococcus pyogenes Type II CRISPR/Cas system

    [0059] The foregoing description of the present invention is provided for illustrative purposes only, and it will be understood by those of ordinary skill in the art to which the present invention pertains that the present invention may be easily modified into other particular forms without changing the technical spirit or essential characteristics of the present invention. Thus, the above-described examples should be construed as being provided for illustrative purposes only and not for purposes of limitation.

    INDUSTRIAL APPLICABILITY

    [0060] A protein complex according to the present invention can modify specific DNA through guide RNA (gRNA) and also enables more precise DNA modification work at a desired time and a desired site by using a promoter of a gene that exhibits desired tissue- or cell-specific expression. Accordingly, the present invention is expected to be applied to develop new and convenient DNA modification techniques.