Caution chelator hot start
10633697 ยท 2020-04-28
Assignee
Inventors
Cpc classification
C12N9/22
CHEMISTRY; METALLURGY
C12Q2527/125
CHEMISTRY; METALLURGY
C12Q2527/125
CHEMISTRY; METALLURGY
International classification
C12N9/12
CHEMISTRY; METALLURGY
Abstract
The invention is in the field of regulation of enzymatic activity in nucleic acid modifying reactions. It describes a method of regulating enzymatic activity by adding chelating agents to the reaction composition and exploits the fact that both the binding of divalent cations to these chelating agents and the pH of commonly used buffers is temperature dependent. PCR experiments that are hampered by non-specific side products can be regulated such that the target sequence is amplified in a more specific manner.
Claims
1. A method for regulation of a nucleic acid modifying enzyme activity in a reaction composition, comprising: providing a reaction composition comprising: a. at least one nucleic acid modifying enzyme, wherein enzymatic activity of said enzyme depends on presence of divalent cations in the reaction composition and wherein the nucleic acid modifying enzyme is selected from: (1) a nucleic acid polymerase from an organism of genus Thermus, Aquifex, Thermotoga, Thermocridis, Hydrogenobacter, Thermosynchecoccus, Thermoanaerobacter, Pyrococcales, Thermococcus, Radius, or Sulfolobus; and (2) a nucleic acid polymerase from an organism selected from Aquifex aeolicus, Aquifex pyogenes, Thermus thermophilus, Thermus aquaticus, Thermotoga neopolitana, Thermus pacificus, Thermus eggertssonii and Thermotoga maritima; b. one or a plurality of divalent cations, c. a chelating agent of binding constant pK to which said divalent cation reversibly binds to form a complex, wherein binding of said divalent cation to the chelating agent is dependent on pH of the reaction composition and wherein the chelating agent has a log pK value of greater than 1.2 at pH 7.2, d. a buffering system having an acid dissociation constant that is temperature dependent, such that an increase in temperature in the reaction composition results in a lower pH of the reaction composition, and e. a substrate for said enzyme which comprises a nucleic acid target sequence; and (ii) amplifying the substrate for said enzyme in a temperature cycling amplification reaction which comprises a plurality of cycles of reversibly changing the temperature in the reaction composition to cause a reversible pH change in the reaction composition, such that the divalent cations which are reversibly bound to the chelating agent are released from the complex, wherein the enzyme is thereby activated or enzymatic activity of the enzyme is increased relative to the activity prior to said step of changing the temperature, and wherein the nucleic avid target sequence is specifically amplified to obtain a specific amplification product at a level that is greater than the level of the specific amplification product that is obtained when the chelating agent is not present.
2. The method of claim 1, wherein the enzymatic activity of said nucleic acid modifying enzyme comprises substrate binding and substrate processing.
3. The method of claim 1, wherein prior to changing the temperature, binding of the divalent cation to the chelating agent causes removal of said divalent cation from the nucleic acid modifying enzyme and results in decreased enzymatic activity or loss of enzymatic activity.
4. The method of claim 1, wherein the chelating agent is selected from the group consisting of ethylene diamine tetraacetate (EDTA), ethylene glycol bis(amino ethyl) N, N-tetraacetate (EGTA) and nitrilotriacetate (NTA).
5. The method of claim 1, wherein the divalent cation is selected from the group consisting of Mg.sup.2+, Ca.sup.2+, Mn.sup.2+, Cu.sup.2+, Fe.sup.2+, Ni.sup.2+, Zn.sup.2+ and Co.sup.2+.
6. The method of claim 1, wherein the chelating agent is EDTA and the divalent cation is selected from Mg.sup.2+, Ca.sup.2+, Mn.sup.2+, Cu.sup.2+, Ni.sup.2+, Zn.sup.2+ and Co.sup.2+.
7. The method of claim 1, wherein the chelating agent is EGTA and the divalent cation is either or both of Ca.sup.2+ and Mg.sup.2+.
8. The method of claim 1, wherein the chelating agent is NTA and the divalent cations are one or more of Ca.sup.2+, Cu.sup.2+ and Co.sup.2+.
9. The method of claim 1, wherein one or more of: the reaction composition comprises a Tris buffer system; (ii) the divalent cation is Mg.sup.2+ at a concentration between 0.01 and 20 mM; (iii) the chelating agent is EGTA at a concentration between 0.05 and 50 mM; and (iv) the nucleic acid modifying enzyme is a DNA polymerase.
10. The method of claim 1, wherein one or more of: (i) the reaction composition comprises a Tris buffer system; (ii) the divalent cation is selected from the group consisting of Mg.sup.2+, Ca.sup.2+, Mn.sup.2+, Cu.sup.2+, Fe.sup.2+, Ni.sup.2+, Zn.sup.2+ and Co.sup.2+; and (iii) the chelating agent is selected from EGTA, EDTA and NTA.
11. The method of claim 9 wherein the DNA polymerase is a hot start polymerase.
Description
DETAILED DESCRIPTION OF THE INVENTION
(1) The present invention relates to a method for the regulation of enzyme activity in a reaction composition. The reaction composition comprises at least one enzyme, wherein the activity of said enzyme is dependent on divalent cations; a chelating agent; a divalent cation, wherein the binding of said cation to said chelating agent is dependent on pH and/or temperature of the reaction composition; a buffering system, wherein the acid dissociation constant is temperature dependent, such that a change in temperature results in a change of pH of the aqueous solution; and a substrate of said enzyme. In addition, changing the temperature in the reaction composition results in divalent cations which are bound to chelating agents being released from these complexes and thereby the enzyme is activated or increases activity. Chelating said cation does not have structural consequences; selectively complexing said cation modulates activity. The change in activity is reversible; inactivation by chelating can be reversed by releasing said cation upon temperature increase.
(2) In a preferred embodiment, the present invention relates to a method for the regulation of enzyme activity in a reaction composition. The reaction composition comprises at least one enzyme, wherein the activity of said enzyme is dependent on divalent cations; a chelating agent; a divalent cation, wherein the binding of said cation to said chelating agent is dependent on pH of the reaction composition; a buffering system, wherein the acid dissociation constant is temperature dependent, such that a change in temperature results in a change of pH of the aqueous solution; and a substrate of said enzyme. In addition, changing the temperature in the reaction composition results in divalent cations which are bound to chelating agents being released from these complexes and thereby the enzyme is activated or increases activity. Chelating said cation does not have structural consequences; selectively complexing said cation modulates activity. The change in activity is reversible; inactivation by chelating can be reversed by releasing said cation upon temperature increase.
(3) In one embodiment of the invention the enzyme is a nucleic acid modifying enzyme.
(4) In one embodiment, the activity of the nucleic acid modifying enzyme comprises substrate binding and substrate processing activity.
(5) In a preferred embodiment the nucleic acid modifying enzyme is selected from the group of polymerases, transcriptases and cation-dependent nucleases.
(6) In a more preferred embodiment the polymerase is selected from the group of organisms comprising Thermus, Aquifex, Thermotoga, Thermocridis, Hydrogenobacter, Thermosynchecoccus, Thermoanaerobacter, Pyrococcales, Thermococcus, Bacilus, Sulfolobus and non-thermophiles. Preferably the viral reverse transcriptases are from MMLV, AMV HIV, EIAV and/or the nuclease is a bovine DNase.
(7) In the most preferred embodiment the polymerase is selected from the group of organisms comprising Aquifex aeolicus, Aquifex pyogenes, Thermus thermophilus, Thermus aquaticus, Thermotoga neopolitana, Thermus pacificus, Thermus eggertssonii and Thermotoga maritima.
(8) In particular, the invention also describes a method, wherein the removal of said divalent cation results in decreased or loss of activity of said nucleic acid modifying enzyme.
(9) This represents an option to regulate enzymatic activity and substrate binding is at the level of the concentration of divalent cations in the reaction composition. For instance, in the case of polymerases and many nucleases, the concentration of divalent ions such as magnesium, calcium and others is crucial to the activity of the enzyme. A reduced level of said cations leads to vastly decreased activity or even abolishes enzymatic activity. In the case of polymerases, stability of hybridization of the primers to the target sequence is greatly reduced. Many nucleases possess a divalent cation in the active site that is crucial to substrate processing. A way to regulate enzymatic activity on the level of ion concentration exploits the fact that both the pH value of buffers routinely used in enzymatic reaction mixtures and the ability of chelating agents to bind ions is temperature-dependent. In addition to polymerases, other nucleic acid modifying enzymes such as nucleases also depend on divalent ions in their active site and therefore can be regulated as described above.
(10) The invention also relates to a method, wherein the activity of said nucleic acid modifying enzyme is selected from the group comprising amplification, reverse transcription, isothermal amplification, sequencing and hydrolytic cleavage of ester bonds, preferably amplification, reverse transcription, and hydrolytic cleavage of ester bonds.
(11) In a preferred embodiment of the invention the chelating agent is selected from the group comprising ethylene di amine tetra acetic acid (EDTA), ethylene glycol bis(amino ethyl) N,N-tetra acetic acid and nitrile acetic acid (NTA). Particularly preferred is EGTA.
(12) In one embodiment the divalent cation is selected from the group comprising Mg.sup.2+, Ca.sup.2+, Mn.sup.2+, Cu.sup.2+, Fe.sup.2+, Ni.sup.2+, Zn.sup.2+ and Co.sup.2+. In a preferred embodiment, the chelating agent is EDTA and the cations are selected from Mg.sup.2+, Ca.sup.2+, Mn.sup.2+, Cu.sup.2+, Ni.sup.2+, Zn.sup.2+ and/or Co.sup.2+.
(13) In one embodiment, several cations selected from the group comprising Mg.sup.2+, Ca.sup.2+, Mn.sup.2+, Cu.sup.2+, Fe.sup.2+, Ni.sup.2+, Zn.sup.2+ and Co.sup.2+ are present in the reaction.
(14) In one embodiment the chelating agent is EGTA and the cations are Ca.sup.2+ and/or Mg.sup.2+.
(15) In one embodiment the chelating agent is NTA and the cations are Ca.sup.2+ and/or Cu.sup.2+ and/or Co.sup.2+.
(16) In another embodiment of the invention the buffer is suitable for enzymatic reactions. Preferably the buffer is selected from Table 4. Tris buffer is used in enzymatic reactions, preferably in PCR experiments. The pH value of Tris buffer is temperature dependent. At room temperature, the pH is around 8.7. A shift in pH of 0.03 pH units per C. is observed. Therefore, at 95 C. the pH is 6.6.
(17) In one embodiment, the concentration of the buffer system is between 0.01 and 100 mM, preferably between 0.1 and 50 mM, more preferably between 1 and 30 mM and most preferably between 5 and 15 mM.
(18) In one embodiment, the concentration of the divalent cation in the reaction is between 0.01 and 20 mM, preferably between 0.1 and 10 mM, most preferable between 1 and 8 mM.
(19) In one embodiment, the concentration of the chelating agent is between 0.05 and 50 mM, more preferably between 0.1 and 20 mM, even more preferably between 0.5 and 10 mM, and most preferably between 1 and 8 mM.
(20) In one embodiment, the pH varies during the reaction in response to the temperature change by at least 0.05 pH units, preferably by at least 0.1, more preferably by at least 0.5, even more preferably by at least 1 and most preferably by at least 2 pH units.
(21) The invention relates to a method, wherein the reaction composition comprises a buffer system, preferably a Tris buffer system, wherein the divalent cation is Mg.sup.2+, preferably at a concentration between 0.01 and 20 mM; wherein the chelating agent is EGTA at a concentration between 0.05 and 50 mM and wherein the nucleic acid modifying enzyme is a DNA polymerase, preferably a hot start polymerase. Preferred EGTA concentration is between 0.1 mM and 20 mM, more preferred between 0.5 mM and 10 mM.
(22) The invention also relates to a method, wherein the reaction composition comprises a buffer system, preferably a Tris buffer system; wherein the divalent cation is selected from the group of Mg.sup.2+, Ca.sup.2+, Mn.sup.2+, Cu.sup.2+, Fe.sup.2+, Ni.sup.2+, Zn.sup.2+ and Co.sup.2+; wherein the chelating agent is selected from the group of EGTA, EDTA and NTA and wherein the nucleic acid enzyme is a nuclease.
(23) Further, the invention relates to a kit for performing a nucleic acid modifying reaction comprising a buffer system, a chelating agent, a nucleic acid modifying enzyme and a divalent cation for said enzyme.
EXAMPLES
(24) Selection of Chelating Agent
(25) Tris buffer is routinely used in PCR buffers. At room temperature the pH of a Tris based PCR buffer is 8.7. Tris shows a temperature-dependent shift in pH value of 0.03 pH units per C. This means that at 95 C. the pH value is 6.6. In order to select a chelating agent for PCR experiments, the pH-dependency of the binding constants of three different chelating agents, NTA; EDTA and EGTA, was investigated. Known pK values from literature for every chelating agent were used to determine the pH dependency of the complex formation (
(26) Endpoint PCR
(27) An amplification experiment was performed using a test system that is known to be prone to produce non-specific side products. A genomic DNA sequence of 1.2 kb was the target sequence. Primers HugA and HugB were used.
(28) The primer sequences are as follows:
(29) TABLE-US-00001 TABLE1 PrimersequencesusedforendpointPCRexperiment. SEQ IDNO Primername Sequence 1 HugA CACACAGCGATGGCAGCTATGC 2 HugB CCCAGTGATGGGCCAGCT
(30) Reactions with and without EGTA were performed in parallel. In set A, the magnesium concentration was varied in 1 mM steps, start and end point were 5 and 10 mM respectively. In set B, the start point was 0.5 mM and the end point was 4 mM Mg. The setup is described in Table 2.
(31) TABLE-US-00002 TABLE 2 HugI PCR reactions mixture. MM A MM B Puffer (Mg) 1 1 X Taq 0.625 0.625 Units Primer HugA 0.5 0.5 M Primer HugB 0.5 0.5 M dNTPs 0.2 0.2 mM gDNA 10 10 ng EGTA 5 0 mM
(32) The amplification program was as follows (Table 3):
(33) TABLE-US-00003 TABLE 3 Amplification program of HugI PCR. Time [min:sec] Temp [ C.] 03:00 95 00:30 94 01:00 59 01:00 72 10:00 72 4
(34) 35 cycles were performed.
(35) The analysis of the PCR reactions on the agarose gel (
(36) TABLE-US-00004 TABLE 4 List of buffers commonly used in enzymatic reactions. Buffer Product Useful pH ID No. # Description Range CAS Number pKa 1 A3594 ACES BioPerformance Certified, 99.0% 6.1-7.5 7365-82-4 6.80 2 B4554 BES BioPerformance Certified, cell culture 6.4-7.8 10191-18-1 7.10 tested, 99.0% 3 B4429 BIS-TRIS BioPerformance Certified, cell 5.8-7.2 6976-37-0 6.50 culture tested, suitable for insect cell culture, 98% 4 B4679 BIS-TRIS propane BioPerformance 6.3-9.5 64431-96-5 6.80 Certified, cell culture tested, 99.0% 5 E0276 EPPS BioPerformance Certified, cell 7.3-8.7 16052-06-5 8.00 culture tested, 99.5% (titration) 6 G3915 Gly-Gly BioPerformance Certified, cell 7.5-8.9 556-50-3 8.20 culture tested, 99% 7 H4034 HEPES BioPerformance Certified, 99.5% 6.8-8.2 7365-45-9 7.50 (titration), cell culture tested 8 H3784 HEPES sodium salt BioPerformance 6.8-8.2 75277-39-3 7.50 Certified, suitable for cell culture, 99.5% 9 H3662 HEPES sodium salt solution 1M, 75277-39-3 BioReagent, suitable for cell culture 10 H3537 HEPES solution 1M, BioReagent, suitable 6.8-8.2 7365-45-9 for cell culture, suitable for molecular biology, 0.2 m filtered 11 M2933 MES hydrate BioPerformance Certified, 5.5-6.7 4432-31-9 6.10 suitable for cell culture, 99.5% (anhydrous) 12 M3058 MES sodium salt BioPerformance 5.5-6.7 71119-23-8 6.10 Certified, suitable for cell culture 13 M1317 MES solution 1M, BioReagent, for 5.5-6.7 molecular biology, suitable for cell culture 14 M3183 MOPS BioPerformance Certified, cell 6.5-7.9 1132-61-2 7.20 culture tested, 99.5% (titration) 15 M9024 MOPS sodium salt BioPerformance 6.5-7.9 71119-22-7 7.20 Certified, suitable for cell culture, 99.5% 16 M1442 MOPS solution BioReagent, 1M, for 6.5-7.9 molecular biology, suitable for cell culture 17 P1851 PIPES BioPerformance Certified, suitable 6.1-7.5 5625-37-6 6.80 for cell culture, 99% 18 P5493 Phosphate buffered saline 10 concentrate, BioPerformance Certified, suitable for cell culture 19 P5368 Phosphate buffered saline BioPerformance Certified, pH 7.4 20 S6191 Sodium chloride BioPerformance Certified, 99.5% 7647-14-5 (titration), Cell Culture Tested 21 S6566 Sodium phosphate monobasic 7558-80-7 Biotechnology Performance Certified, Cell Culture Tested 22 T5316 TAPS BioPerformance Certified, cell 7.7-9.1 29915-38-6 8.40 culture tested, 99.5% (titration) 23 T5441 TAPS sodium salt BioPerformance 7.7-9.1 91000-53-2 8.40 Certified, suitable for cell culture, 99% 24 T5691 TES BioPerformance Certified, cell culture 6.8-8.2 7365-44-8 7.50 tested, 99% (titration) 25 T5816 Tricine BioPerformance Certified, cell 7.4-8.8 1389475.00 8.10 culture tested, 99% (titration) 26 T7193 Trizma Pre-set crystals BioPerformance 7.0-9.0 Certified, pH 7.0, average Mw 154.8 27 T9943 Trizma Pre-set crystals BioPerformance 7.0-9.0 Certified, pH 7.0, average Mw 154.8 28 T7443 Trizma Pre-set crystals BioPerformance 7.0-9.0 Certified, pH 7.2, average Mw 153.8 29 T7693 Trizma Pre-set crystals BioPerformance 7.0-9.0 Certified, pH 7.4, average Mw 151.6 30 T0319 Trizma Pre-set crystals BioPerformance 7.0-9.0 Certified, pH 7.4, average Mw 151.6 31 T7818 Trizma Pre-set crystals BioPerformance 7.0-9.0 Certified, pH 7.5, average Mw 150.6 32 T7943 Trizma Pre-set crystals BioPerformance 7.0-9.0 Certified, pH 7.6, average Mw 149.0 33 T8068 Trizma Pre-set crystals BioPerformance 7.0-9.0 Certified, pH 7.7, average Mw 147.6 34 T8193 Trizma Pre-set crystals BioPerformance 7.0-9.0 Certified, pH 7.8, average Mw 145.8 35 T8443 Trizma Pre-set crystals BioPerformance 7.0-9.0 Certified, pH 8.0, average Mw 141.8 36 T0819 Trizma Pre-set crystals BioPerformance 7.0-9.0 Certified, pH 8.0, average Mw 141.8 37 T8568 Trizma Pre-set crystals BioPerformance 7.0-9.0 Certified, pH 8.1, average Mw 139.8 38 T8943 Trizma Pre-set crystals BioPerformance 7.0-9.0 Certified, pH 8.3, average Mw 135.4 39 T8818 Trizma Pre-set crystals BioPerformance 7.0-9.0 Certified, pH 8.5, average Mw 131.4 40 T1194 Trizma Pre-set crystals BioPerformance 7.0-9.0 Certified, pH 8.5, average Mw 131.4 41 T9443 Trizma Pre-set crystals BioPerformance 7.0-9.0 Certified, pH 8.8, average Mw 127.2 42 T9568 Trizma Pre-set crystals BioPerformance 7.0-9.0 Certified, pH 8.9, average Mw 125.6 43 T9693 Trizma Pre-set crystals BioPerformance 7.0-9.0 Certified, pH 9.0, average Mw 124.6 44 T1444 Trizma Pre-set crystals BioPerformance 7.0-9.0 Certified, pH 9.0, average Mw 124.6 45 T9818 Trizma Pre-set crystals BioPerformance 7.0-9.0 Certified, pH 9.1, average Mw 123.0 46 T0194 Trizma Pre-set crystals pH 7.2, average 7.0-9.0 Mw 153.8 47 T0444 Trizma Pre-set crystals pH 7.5, average 7.0-9.0 Mw 150.6 48 T0569 Trizma Pre-set crystals pH 7.6, average 7.0-9.0 Mw 149.0 49 T0694 Trizma Pre-set crystals pH 7.7, average 7.0-9.0 Mw 147.6 50 T0944 Trizma Pre-set crystals pH 8.1, average 7.0-9.0 Mw 139.8 51 T1069 Trizma Pre-set crystals pH 8.3, average 7.0-9.0 Mw 135.4 52 T1319 Trizma Pre-set crystals pH 8.8, average 7.0-9.0 Mw 127.2 53 T6066 Trizma base BioPerformance Certified, 41524.00 77-86-1 8.10 meets EP, USP testing specifications, cell culture tested, 99.9% (titration) 54 T5941 Trizma hydrochloride BioPerformance 7.0-9.0 1185-53-1 8.10 Certified, cell culture tested, 99.0% (titration) 55 T1819 Trizma hydrochloride solution pH 7.0, 7.0-9.0 1M, BioReagent, for molecular biology, suitable for cell culture 56 T2069 Trizma hydrochloride solution pH 7.2, 7.0-9.0 1M, BioReagent, for molecular biology, suitable for cell culture 57 T1944 Trizma hydrochloride solution pH 7.4, 7.0-9.0 0.1M 58 T2194 Trizma hydrochloride solution pH 7.4, 7.0-9.0 1M, BioReagent, for molecular biology, suitable for cell culture 59 T2319 Trizma hydrochloride solution pH 7.5, 7.0-9.0 1M, BioReagent, for molecular biology, suitable for cell culture 60 T2944 Trizma hydrochloride solution pH 7.5, 7.0-9.0 2M, BioReagent, for molecular biology, suitable for cell culture 61 T2444 Trizma hydrochloride solution pH 7.6, 7.0-9.0 1M, BioReagent, for molecular biology, suitable for cell culture 62 T2569 Trizma hydrochloride solution pH 7.8, 7.0-9.0 1M, BioReagent, for molecular biology, suitable for cell culture 63 T2694 Trizma hydrochloride solution pH 8.0, 7.0-9.0 1M, BioReagent, for molecular biology, suitable for cell culture 64 T3069 Trizma hydrochloride solution pH 8.0, 7.0-9.0 2M, BioReagent, for molecular biology, suitable for cell culture 65 T2819 Trizma hydrochloride solution pH 9.0, 7.0-9.0 1M, BioReagent, for molecular biology, suitable for cell culture
(37) Modulation of Residual Activity of Chemically Inactivated Taq DNA Polymerase Using EGTA/EDTA
(38) The following experiments employed a system to detect the formation of primer dimers in a PCR reaction mixture using residual active Taq polymerase molecules. Herein, bisulphite-treated DNA is used as a template. As a consequence of the bisulphite treatment, which entails the chemical modification of non-methylated cytosines to uracil), said template only consists of three bases. Since bisulphite treatment only works when using single stranded DNA, the majority of DNA after completion of said bisulphite treatment is single stranded. Primers that are used for amplification of such DNA sequences are characterized by reduced complexity since they only consist of three bases. Hence these primers are prone to dimer formation and are very likely to be able to bind >100.000 times to said bisulphite-treated DNA.
(39) Genomic DNA was propagated using the Qiagen REPLI g Midi Kit according to the manufacturer's protocol. Subsequently, 1 g of said genomic DNA was used in 10 independent reactions wherein the DNA was subjected to bisulphite treatment using the EpiTect Bisulfite Kit followed by purification. The resulting DNA of each reaction was pooled and used in the subsequent amplification reactions. Primer sequences are shown in Table 5.
(40) TABLE-US-00005 TABLE5 Primersusedinamplificationof bisulphite-treatedDNA. SEQ Primer IDNO NO Sequence 3 1 ACCCCCACTAAACATACCCTTATTCT 4 2 GGGAGGGTAATGAAGTTGAGTTTAGG
(41) TABLE-US-00006 TABLE 6 Amplification reaction mixture. Reagent Concentration Volume (l) EpiTect HRM PCR Kit 2x 12.5 Primer 1 10 M 1.875 Primer 2 10 M 1.875 Bisulphite-treated DNA 10 ng/l 1 Water or EGTA 1-x mM 5 Water 2.75
(42) The final EGTA concentration was between 0.25 and 10 mM.
(43) One set of samples consisting of two reactions was incubated on ice for 120 min, whereas the other set of samples also consisting of two reactions was incubated at room temperature for 120 min. Subsequently both sets of samples were analyzed using the Rotor-Gene Q 5plex HRM System. The cycling program is shown in Table 7.
(44) TABLE-US-00007 TABLE 7 Cycling program used in the amplification of bisulphite-treated DNA. 95 C. - 5 95 C. - 10 55 C. - 30 {close oversize bracket} x 40 72 C. - 10 HRM 68 C.-82 C.
(45) Ct values are summarized in Table 8 and
(46) TABLE-US-00008 TABLE 8 Summary of results obtained from the amplification experiment of bisulphite-treated DNA in the presence of different EGTA concentrations. Room temperature On ice EGTA [mM] Ct Average Standard deviaton Ct Average Standard deviation 25.01 24.92 0.1 25.29 25.28 0.01 24.82 25.26 0.25 25.2 25.31 0.11 25.34 25.43 0.09 25.42 25.51 0.5 25.55 25.51 0.04 25.53 25.58 0.04 25.47 25.62 0.75 25.91 25.86 0.05 25.78 25.83 0.05 25.8 25.88 1 26.47 26.49 0.02 26.59 26.55 0.04 26.5 26.61 1.5 27.76 27.82 0.06 28.17 28.19 0.02 27.88 28.21 2 29.9 29.81 0.09 30.16 29.35 0.82 29.71 28.53 4 37.32 37.13 0.1 38.37 38.26 0.11 37.02 38.14 8 10 35.18 34.59 0.59 34
(47) Samples that had been incubated on ice without the addition of EGTA showed a Ct value of 25.28 and a specific melting curve (
(48) In the follow-up experiment said primers and said bisulphite-treated DNA were used in amplification reactions wherein the magnesium dependency was analyzed. The composition of the reaction mixtures is shown in Table 9.
(49) TABLE-US-00009 TABLE 9 Amplification reaction mixture. Reagent Concentration Volume (l) EpiTect HRM PCR Kit 2x 12.5 Primer 1 10 M 1.875 Primer 2 10 M 1.875 Bisulphite-treated DNA 10 ng/l 1 Water or EGTA 5 mM 2.5 Magnesium 0.1 mM-0.6 mM 2.5 Water 2.75
(50) The final concentration of EGTA was 5 mM. The HRM master mix was supplemented with 0.1 0.6 mM magnesium.
(51) Two sets of reactions consisting of duplicates were used in the amplification experiment. One set of samples was incubated on ice for 120 min, whereas the other set of samples was incubated at room temperature for 120 min. Subsequently the samples were analyzed using the Rotor-Gene Q 5plex HRM System. The cycling program was the same as shown in Table 6. The results are shown in Table 9 and
(52) TABLE-US-00010 TABLE 10 Summary of results obtained from the amplification experiment of bisulphite-treated DNA in the presence of EGTA and different magnesium concentrations. MgCl.sub.2 Room temperature On ice DNA EGTA [mM] Ct Average Standard deviation Ct Average Standard deviation 10 ng 22.41 22.62 0.21 25.32 25.46 0.14 22.82 25.59 5 mM 0 mM 28.86 28.77 0.09 28.74 28.82 0.08 28.67 28.89 0.1 27.53 27.62 0.09 27.82 27.81 0.02 27.71 27.79 0.2 26.69 26.98 0.29 26.85 27.12 0.27 27.27 27.39 0.3 26.14 26.39 0.25 26.25 26.38 0.13 26.64 26.51 0.4 26.06 26.15 0.09 26.01 26.08 0.06 26.24 26.14 0.5 25.82 25.84 0.02 25.81 25.85 0.04 25.86 25.89 0.6 25.55 25.52 0.03 25.61 25.59 0.03 25.49 25.56
(53) The experiment showed that in the case of the samples incubated on ice without the addition of EGTA a Ct value of 25.46 and a specific melting curve was obtained, whereas incubation at room temperature resulted in a shift of the Ct value (22.62) and no specific amplification product was observed. Addition of EGTA up to a final concentration of 5 mM led to increased specificity. The Ct value when using 5 mM EGTA was 28.77 and 28.82 respectively. Increasing the magnesium concentration resulted in lower Ct values whilst maintaining specificity.
(54) Modulation of DNase Activity
(55) In this set of experiments means of modulating activity of DNase, a nuclease isolated from bovine pancreas, were investigated.
(56) Human genomic DNA was propagated using the REPLI g Midi Kit (Qiagen) according to the manufacturer's instructions. DNase activity was analyzed in 10 l reactions. Each reaction contained 50 mM Tris pH 8.2 as the reaction buffer, 1 g genomic DNA, 1 mM MgCl.sub.2, and 50 M CaCl.sub.2. Three different amounts of DNase (0.01, 0.1 and 1 U) were used. The samples were incubated at two different temperatures, 42 C. and on ice, for 5 and 15 min respectively. DNA degradation was terminated by adding EDTA to a final concentration of 8.33 mM and samples were incubated on ice prior to analysis of the reaction products using a 0.5% agarose gel. The results are shown in
(57) Addition of EGTA to a final concentration of 100 M led to almost complete inhibition of degradation for any of the amounts of DNase that were used (lanes 2-7, on ice 100 M EGTA). Exempt from this is the reaction using 1 U DNase for 15 min (lane 3 on ice 100 M EGTA). However, in this case degradation is significantly reduced compared to the sample without EGTA. Increasing the temperature to 42 C. largely restored DNase activity (lanes 8-13 42 C. 100 M EGTA).
(58) In the follow-up experiment EDTA was used as a chelating agent. The procedure of genomic DNA propagation as well the buffer and reaction conditions were equivalent to the experiment as described above.
(59) The reaction products were analyzed using a 0.5% agarose gel (
(60) In summary, both examples show that chelating agents can be used to inhibit DNase activity and that shifting the reaction temperature restores enzymatic activity, thereby validating said system of activity regulation.
FIGURE CAPTIONS
(61)
(62)
(63) An increase in Mg concentration leads to successful amplification of the target product specific PCR product, although much unspecific product is visible (lane 10-lane 12). A further increase of Mg concentration leads to generation of unspecific PCR products (lane 14, 4 mM Mg Cl.sub.2). In contrast, addition of 5 mM EGTA in presence of 5-10 mM MgCl.sub.2 results in specific PCR product (lane 2-lane 7), although the amount of unspecific by product increase while Mg concentration is increased.
(64)
(65) Melting curves (EGTA titration experiment).
(66) The curves are annotated as follows: A: no additive, B: 0.25 mM EGTA, C: 0.5 mM EGTA, D: 0.75 mM EGTA, E: 1 mM EGTA, F: 1.5 mM, G: 2 mM EGTA, H: 4-10 mM.
(67)
(68) Melting curves (Mg titration experiment).
(69) The curves are annotated as follows: A: no additives, B: 5 mM EGTA, C: 5 mM EGTA+0, 1 mM Mg, D: 5 mM EGTA+0.2 mM Mg, E: 5 mM EGTA+0.3 mM Mg, F: 5 mM EGTA+0.4 mM Mg, G: 5 mM EGTA+0.5 mM Mg, H: 5 mM EGTA +0.6 mM Mg.
(70)
(71) Agarose gel analysis of DNase assay at different temperatures and influence of EGTA.
(72) Lanes are annotated as follows: Note that reactions corresponding to samples in lane 2-7 were performed on ice and are hence labelled on ice. Similarly, reactions corresponding to samples in lanes 8-13 were performed at 42 C. and are labelled 42 C. accordingly. Reactions at both temperatures were performed in the absence and presence of 100 M EGTA CO M EGTA and 100 M EGTA respectively).
(73) Lane M: GelPilot High Range Ladder (60), lane 1: 1 g WGA gDNA (no DNase added), lanes 2 and 3: 1 l DNase (1 U) 5 and 15 min, lanes 4 and 5: 0.1 l DNase (0.1 U) 5 and 15 min, lanes 6 and 7: 0.01 l DNase (0.01 U), 5 and 15 min, lanes 8 and 9: 1 l DNase (1 U) 5 and 15 min, lanes 10 and 11: 0.1 l DNase (0.1 U) 5 and 15 min, lanes 12 and 13: 0.01 l DNase (0.01 U) 5 and 15 min.
(74)
(75) Agarose gel analysis of DNase assay at different temperatures and influence of EDTA.
(76) Reactions corresponding to samples in lanes 1-6 were performed on ice and are hence labeled on ice Reactions corresponding to samples in lane 7-12 were performed at 42 C. and are labeled 42 C. accordingly. Lanes are annotated as follows: Lane K: 1 g WGA gDNA.
(77) Lane 1: 1 U DNase, lane 2: 0.5 U DNase, lane 3: 0.1 U DNase, Lane 4: 1 U DNase +100 M EDTA, lane 5: 0.5 U DNase +100 M EDTA, lane 6: 0.1 U DNase +100 M EDTA.
(78) Lane 7: 1 U DNase, lane 8: 0.5 U DNase, lane 9: 0.1 U DNase, lane 10: 1 U DNase +100 M EDTA, lane 11: 0.5 U DNase +100 M EDTA, lane 12: 0.1 U DNase +100 M EDTA, lane M: GelPilot 1 kb Ladder (3 l).