Reagent for the disruption of cell material having a completely integrated internal standard

Abstract

The present invention relates to a reagent for the disruption of cell material, containing an internal standard that is completely integrated into the reagent for control and evaluation of the completeness of disruption of the cell material and subsequent steps, comprising a step selected from sample preparation, extraction, enrichment, isolation, purification, reverse transcription, amplification and detection of the cell components obtained from the disrupted cells, or a combination of a plurality or all of these steps.

Claims

1. A reagent for disrupting a sample cellular material, comprising: beads, the surface of which is at least partly coated with reference cells, wherein the reference cells are capable of being an internal standard completely integrated into the reagent for checking and assessing the completeness of disruption of a sample cellular material and subsequent steps selected from sample preparation, extraction, enrichment, isolation, purification, reverse transcription, amplification and detection of the cellular constituents obtained from the disrupted cells, and a combination of a plurality of or all of these steps, wherein: the beads consist of glass, metal, ceramic or other porous materials or tungsten carbide; the size of the beads is from 0.05 mm to 2 mm; and the beads have been created by drying out a suspension comprising the reference cells in the presence of the beads, thereby attaching the reference cells to the beads, coating the beads with the reference cells, or bonding the reference cells to the beads.

2. The reagent of claim 1, wherein the reference cells are naturally occurring microorganisms.

3. The reagent of claim 1, wherein the reference cells are genetically modified microorganisms.

4. The reagent of claim 1, wherein the beads are glass beads.

5. Beads, the surface of which is at least partly coated with dried-up reference cells, wherein: the beads consist of glass, metal, ceramic or other porous materials or tungsten carbide; the size of the beads is from 0.05 mm to 2 mm; and the beads have been created by drying out a suspension comprising the reference cells in the presence of the beads, thereby attaching the reference cells to the beads, coating the beads with the reference cells, or bonding the reference cells to the beads.

6. The beads of claim 5, wherein the size of the beads is from 0.1 to 0.8 mm or from 0.2 to 0.6 mm.

7. The beads of claim 5, wherein from 10.sup.2 to 10.sup.9 reference cells, from 10.sup.3 to 10.sup.8 reference cells, or from 10.sup.4 to 10.sup.7 reference cells are applied to the surface of 100 mg of beads.

8. The beads of claim 5, wherein the surface of the beads including the reference cells is further coated with an additional protective layer.

9. A method for preparing the beads of claim 5, comprising: (a) admixing beads with a suspension containing reference cells in an aqueous solution, wherein the beads consist of glass, metal, ceramic or other porous materials or tungsten carbide and the size of the beads is from 0.05 mm to 2 mm, (b) drying the aqueous solution on the beads, and (c) optionally coating the beads obtained from step (b) with a protective layer.

10. A method for disrupting a sample cellular material using a completely integrated internal standard, comprising: (A) mixing (a) the reagent according to claim 1, or (b) beads, the surface of which is at least partly coated with dried-up reference cells, wherein the beads consist of glass, metal, ceramic or other porous materials or tungsten carbide, the size of the beads is from 0.05 mm to 2 mm, and the beads have been created by drying out a suspension comprising the reference cells in the presence of the beads, thereby attaching the reference cells to the beads, coating the beads with the reference cells, or bonding the reference cells to the beads, with a sample cellular material to be disrupted, and (B) simultaneously disrupting the sample cellular material and the reference cells by mechanical action on the mixture of step (A).

11. The method of claim 10, wherein step (B) is performed with vortexing.

12. The method of claim 10, wherein step (B) comprises simultaneously disrupting the sample cellular material and the reference cells using a mixture of: (i) the beads the surface of which is at least partly coated with the reference cells, wherein: the beads consist of glass, metal, ceramic or other porous materials or tungsten carbide; the size of the beads is from 0.05 mm to 2 mm; and the beads have been created by drying out a suspension comprising the reference cells in the presence of the beads, thereby attaching the reference cells to the beads, coating the beads with the reference cells, or bonding the reference cells to the beads and (ii) beads the surface of which is not coated with the reference cells.

13. The method of claim 10, further comprising performing one or more additional steps selected from sample preparation, extraction, enrichment, isolation, purification, reverse transcription, amplification of the cellular constituents obtained from the disrupted cells, and detection of the cellular constituents obtained from the disrupted cells, wherein the reference cells are used as an internal standard for the one of more additional steps.

14. The method of claim 13, wherein the constituents obtained from the disrupted cells are nucleic acids.

15. The method of claim 14, wherein the nucleic acids are deoxyribonucleic acids.

16. The method of claim 13, wherein the sample cellular material is naturally occurring microorganisms.

17. The method of claim 13, wherein the sample cellular material is genetically modified microorganisms.

18. A kit for detecting nucleic acids in cellular material, containing: (i) a reagent of claim 1, or beads, the surface of which is at least partly coated with dried-up reference cells, wherein: the beads consist of glass, metal, ceramic or other porous materials or tungsten carbide; the size of the beads is from 0.05 mm to 2 mm; and the beads have been created by drying out a suspension comprising the reference cells in the presence of the beads, thereby attaching the reference cells to the beads, coating the beads with the reference cells, or bonding the reference cells to the beads; and (ii) primers for amplifying the nucleic acids from the sample cellular material or from the reference cells.

Description

DESCRIPTION OF THE FIGURES

(1) FIG. 1 shows the qRT-PCR-determined C.sub.T values for the amplification of E. coli DNA, which was disrupted by mechanical action using glass beads.

EXAMPLES

Example 1: Preparation of the Reference Cell-Coated Beads

(2) An E. coli culture was cultivated in an LB culture medium (lysogeny broth medium, G. Bertani J. Bacteriol., 1951, 62(3), 293-300). Using a counting chamber, the cell count in said medium was determined under the microscope to be 3.0310.sup.9 per ml. The culture was diluted with further LB medium to a concentration of 210.sup.7 cells per ml. 1 ml was taken from this cell suspension, and the cells were pelleted by centrifugation. The pellet obtained was suspended in 1 ml of a 0.9% NaCl solution (aqueous). 50 l of this suspension were, in each case, added to 100 mg of glass beads (600 m, Sigma G8772, Lot No. 100 K5339), and the solution was allowed to dry overnight in a laminar flow cabinet. The number of cells was thus 110.sup.6 cells per 100 mg of glass beads.

Example 2: Lysis of Whole Blood

(3) Five batches (each 100 mg) of the coated beads obtained according to example 1 were in each case stored for 1 year at 2-8 C. or 253 C. Subsequently, the stored beads were introduced into human whole blood, and the coated bacterial cells were disrupted in this biological matrix by mechanical lysis. This prelysis was followed by QIAGEN sample preparation using the below-described QIAamp DNA Blood Mini Kit (QIAGEN, Hilden, Germany) according to the QIAamp DNA Mini Kit and QIAamp DNA Blood Mini Kit handbook (November 2007) in order to isolate and purify the DNA from the disrupted bacterial cells and the human DNA originating from the leukocytes in the blood.

(4) The mechanical disruption procedure referred to as prelysis was optimized in preceding experiments to the effect that optimal disruption of bacterial and fungal cells was achieved in the blood sample material. In blood, optimal disruption was achieved by five-minute vortexing of the sample with the glass beads in a 2:1 mixture of blood and prelysis buffer (containing Tris, EDTA and Triton X-100). The subsequent experiments for analysing the reference beads were therefore carried out using the same prelysis protocol, in order to determine the disruption efficiency of the bacterial cells dried on the beads. For comparative purposes, the analyses were carried out with and without prelysis. The aim of this comparison was, in particular, to show whether prelysis is still necessary when using the coated beads which have already been stored for over a year, or whether possibly, after storage for one year, the cells dried on the beads are no longer intact and the DNA is consequently already free, making prelysis redundant and thus eliminating the checking function of the reference beads. Furthermore, controls were concomitantly carried out which contained, freshly spiked into blood, the same amount of bacteria which were dried on the coated beads.

(5) Cell disruption was carried out with the following samples: 1. three batches of the beads stored at 5 C. (100 mg in each case) and, in each case, 600 l of freshly thawed blood with prelysis (referred to as WP-5 hereinafter); 2. three batches of the beads stored at 25 C. (100 mg in each case) and, in each case, 600 l of freshly thawed blood with prelysis (WP-25); 3. two batches of the beads stored at 5 C. (100 mg in each case) and, in each case, 600 l of freshly thawed blood without prelysis (no prelysis) (NP-5); 4. two batches of the beads stored at 25 C. (100 mg in each case) and, in each case, 600 l of freshly thawed blood without prelysis (no prelysis) (NP-25); 5. three batches of a control sample composed of 200 mg of uncoated beads and, in each case, 600 l of blood admixed with 1.0710.sup.6 E. coli cells with prelysis (C-WP); 6. three batches of a control sample composed of 200 mg of uncoated beads and, in each case, 600 l of the E. coli-spiked blood described in point 5 without prelysis (no prelysis) (C-NP); 7. three control samples each composed of 600 l of unspiked blood (C-B).

(6) To prepare the E. coli-spiked blood samples, 10 ml of blood were admixed with 143 l of an E. coli-glycerol stock culture which contained 1.2510.sup.8 cells per ml.

(7) For the disruption of the cells, 600 l of freshly thawed blood (for samples WP-5, NP-5, WP-25, NP-25, C-B) or 600 l of E. coli-spiked blood (for samples C-NP, C-WP) in 300 l of SPL1 buffer were added to 200 mg of the untreated beads (C-NP, C-WP, C-B) or 100 mg of the coated beads (WP-5, NP-5, WP-25, NP-25) in a 1.5 ml sample vessel from Eppendorf. Subsequently, the samples with prelysis (WP-5, WP-25, C-WP) were vortexed for five minutes at the highest setting. Alternatively, incubation was carried out for five minutes at room temperature (samples without prelysis). After the glass beads had sunk, 600 l of the supernatant were transferred to a new sample vessel and, after addition of 60 l of proteinase K, briefly mixed by vortexing. After addition of 450 l of Buffer AL from QIAGEN, the sample was vortexed for a further 15 seconds. The above-described steps were carried out in a laminar flow cabinet. The samples were then, in each case, incubated for ten minutes at 56 C. and thereafter briefly centrifuged, admixed with 750 l of a mixture of 80% ethanol and 20% Buffer AL from QIAGEN (Hilden, Germany) and vortexed for 15 seconds. The entire reaction mixes were, in each case, transferred to Extender Tubes from QIAGEN (Hilden, Germany) which were fitted onto QIAamp Mini Columns from QIAGEN (Hilden, Germany). The lysate was then drawn under vacuum through the QIAamp Mini Columns, with the released nucleic acid binding to the silica matrix of the column. Subsequently, the column was washed twice with, in each case, 700 l of Buffer AW1 from QIAGEN (Hilden, Germany). The wash solution was removed under reduced pressure. Thereafter, the column was washed twice with, in each case, 750 l of Buffer AW2 from QIAGEN (Hilden, Germany), and the wash solution was removed under reduced pressure. Subsequently, the QIAamp Mini Column was removed from the vacuum device, transferred to a new sample vessel and dried by three-minute centrifugation at 15 000 g. The column was transferred to a new vessel and dried in a heating block for an additional five minutes at 56 C. The DNA was subsequently eluted with 100 l of ultrapure water, with incubation at room temperature for one minute on the membrane of the spin column before the eluate was obtained by centrifugation at 15 000 g for 1 minute. The eluates obtained were analysed photometrically in order to determine the total DNA yield, i.e. the human DNA, including E. coli DNA, obtained from the blood, with the proportion of the DNA obtained from the reference cellular material with respect to the DNA obtained from the sample being low. The results are shown in table 1. In addition, qRT-PCR analysis was carried out for the quantitative specific detection of the E. coli DNA.

(8) TABLE-US-00001 TABLE 1 Yield g/elution A260/ CV.sup.2 Sample Batch A260 A280 [g] Mean SD.sup.1 % Coated beads with 1 0.30 1.95 8.49 7.7 0.8 9.9 prelysis, stored 2 0.27 1.93 7.80 at 5 C. (WP-5) 3 0.24 1.93 6.66 Coated beads with 1 0.26 1.92 7.26 7.5 1.2 15.9 prelysis, stored 2 0.33 1.94 9.03 at 25 C. (WP-25) 3 0.23 1.90 6.15 Coated beads 1 0.23 1.95 6.78 5.9 0.9 15.0 without prelysis, 2 0.17 1.88 5.01 stored at 5 C. (NP-5) Coated beads 1 0.19 1.91 5.40 5.6 0.2 4.3 without prelysis, 2 0.21 1.88 5.88 stored at 25 C. (NP-25) Control E. coli with 1 0.18 2.68 3.78 4.3 0.5 11.8 prelysis (C-WP) 2 0.17 1.93 4.98 3 0.14 1.93 4.11 Control E. coli 1 0.20 1.91 5.85 5.6 0.2 4.1 without prelysis 2 0.20 1.92 5.70 (C-NP) 3 0.18 1.82 5.31 Control blood 1 0.20 1.90 5.58 4.9 0.7 14.5 (C-B) 2 0.17 1.88 5.07 3 0.13 1.86 3.90 .sup.1SD: standard deviation; .sup.2CV: coefficient of variation

(9) The amount of total DNA was determined by photometric measurements of light absorption at a wavelength of 260 nm. It can be clearly seen that the use of the coated beads and also the prelysis procedure, i.e. the vortexing of the sample mixed with the beads, do not have an adverse effect on the total yield of DNA.

(10) The purity of the DNA obtained was determined by means of photometric measurement of the ratio of light absorption at 260 nm to that at 280 nm (A260/A280). The A260/A280 ratio was within the range of between 1.8 and 2.0 for all samples which were disrupted using the coated beads. Consequently, storage of the coated samples for more than one year has no effect on the purity of the DNA obtained.

Example 3: qRT-PCR Analysis for the Specific Detection of E. coli DNA

(11) To demonstrate that the E. coli DNA from the coated beads is still intact and detectable even after storage for one year, a real-time polymerase chain reaction (qRT-PCR) was carried out for the detection of the E. coli DNA in samples WP-5, NP-5, WP-25, NP-25, C-WP and C-NP, which are described in example 2. The reactions were carried out using the FRET probe 5 [6FAM]CACTACGGTGCTGAAGCGACAA A[BHQ1a6FAM] (SEQ ID NO: 1) and the primers 5CCAGGCAAATCCGGAAAAC3 (SEQ ID NO: 2) and 5GTACGATTTGATGTTACCTGAT3 (SEQ ID NO: 3) on an ABI Taqman 7900 (Applied Biosystems Inc., Foster City, Calif., USA) in reaction volumes of, in each case, 25 l (10 l of template, 0.6 l of a 10 M solution of the FAM-BHQ-functionalized FRET probe, 12.5 l of QIAGEN 2 QuantiTect Multiplex PCR, 0.6 l of a mixture of the two primers, each as a 10 M solution, and 1.3 l of ultrapure water). A total of 40 cycles was carried out, with each cycle comprising the following steps: denaturation (15 min at 95 C.), annealing (45 s at 94 C.) and elongation (75 s at 60 C.).

(12) The C.sub.T (threshold cycle) values thus determined are shown in table 2.

(13) TABLE-US-00002 TABLE 2 C.sub.T values Sample C.sub.T Mean SD.sup.1 CV.sup.2 [%] Coated beads with prelysis, 19.49 19.31 0.20 1.04 stored at 5 C. (WP-5) 19.35 19.09 Coated beads with prelysis, 20.85 20.67 0.20 0.95 stored at 25 C. (WP-25) 20.46 20.70 Coated beads without prelysis, 20.87 20.36 0.72 3.54 stored at 5 C. (NP-5) 19.85 Coated beads without prelysis, 22.85 22.75 0.14 0.60 stored at 25 C. (NP-25) 22.65 Control E. coli 21.65 22.08 0.37 1.67 with prelysis (C-WP) 22.29 22.29 Control E. coli without prelysis 24.99 25.02 0.40 1.58 (C-NP) 24.64 25.43 .sup.1SD: standard deviation; .sup.2CV: coefficient of variation

(14) Although a direct comparison between the samples which were treated with the coated beads and those which were spiked with E. coli cells is difficult owing to the different starting cultures of E. coli bacteria, it can nevertheless be clearly seen that the E. coli DNA on the coated beads was still very highly amplifiable and detectable by qRT-PCR even after storage for one year. Furthermore, it can be seen that the prelysis has a significantly positive effect on the C.sub.T value determined in subsequent amplification, indicating that the majority of the cells was still intact and required disruption. This is also illustrated in FIG. 1, which shows the qRT-PCR-determined C.sub.T values according to disruption method. The C.sub.T values of those blood samples which were disrupted using the coated beads (WP-5, WP-25 and NP-5, NP-25) are below the C.sub.T value which was determined for the DNA obtained from just the blood sample (C-WP and C-NP), and this was the case for both the beads stored at 5 C. and the beads stored at 25 C. In this connection, a comparison should be made between the two sets of samples treated according to the same method, i.e. those with prelysis (WP) and those without prelysis (NP). A comparison of the samples which were subjected to prelysis with those which were disrupted without prelysis further shows that the use of the prelysis step has a significantly positive effect on the C.sub.T value obtained when the coated beads are used for the cell disruption, indicating that the majority of the E. coli cells in the coating was still intact and allowed disruption even after storage for more than one year.

(15) This applied to both the coated beads stored at 25 C. and those stored at 5 C. In summary, examples 2 and 3 show that the cells applied to glass beads are stable over a long period (t>1 year) and can, even after storage for one year, be used for checking the completeness of disruption and for assessing subsequent analyses such as, for example, qRT-PCR.