Method For Screening Pseudomonas Protegens Mutant Strain, And Application Thereof In Biological Control
20200120939 ยท 2020-04-23
Inventors
- Youming Zhang (Jinan City, Shandong, CN)
- Qiang Tu (Jinan City, CN)
- Fangnan Yu (Yucheng City, Shandong, CN)
- Xiaoshu Jing (Jinan City, Shandong, CN)
- Xiaoying Bian (Jinan City, Shandong, CN)
- Hanna Chen (Jinan City, Shandong, CN)
Cpc classification
C12N15/90
CHEMISTRY; METALLURGY
International classification
Abstract
Provided are Pseudomonas protegens mutant strain Pf5-NiF, Pf5-retS, or Pf5-retS-NiF, and a screening method therefor and an application thereof. By means of Red/ET recombination and direct cloning technologies, the NiF nitrogen fixation gene island in the genome of Pseudomonas stutzeri DSM4166, taken as a whole, is cloned into the genome of Pseudomonas protegens Pf5, so as to heterologously express the same successfully to obtain a genetically engineered strain Pf5-NiF, thereby bringing a biological nitrogen fixation function to Pseudomonas protegens Pf5 which does not own a biological nitrogen fixation function. In addition, gene-directed markerless knockout of retS gene in the genome of Pseudomonas protegens Pf5 is performed to obtain a genetically engineered strain Pf5-retS. Thus, the expression levels of an antibiotic 2,4-diacetylphloroglucinol and red pigment are increased, and a mutant strain of Pseudomonas protegens Pf5 having a stronger bactericidal activity is obtained.
Claims
1. Pseudomonas protegens Pf5 mutant strain Pf5-NiF, Pf5-retS or Pf5-retS-NiF, having the deposit numbers CGMCC NO. 13948, CGMCC NO. 13949 and CGMCC NO. 13950 respectively.
2. (canceled)
3. (canceled)
4. A composition, for example, a microbial agent, which has any one of Pf5-NiF, Pf5-retS or Pf5-retS-NiF according to claim 1, or any combination thereof as the active ingredient.
5. A method for producing Pseudomonas protegens Pf5 mutant strain Pf5-NiF, comprising cloning the whole NiF nitrogen-fixing gene island in the genome of Pseudomonas stutzeri DSM4166 into the genome of Pseudomonas protegens Pf5, and expressing the NiF nitrogen-fixing gene island to obtain the genetically engineered strain Pf5-NiF.
6. The method according to claim 5, characterized in the following steps: (1) Using Red/ET direct cloning method, using the restriction endonucleases Afl II and Ssp I to digest the genomic DNA of Pseudomonas stutzeri DSM4166 to obtain a 69 kb NiF nitrogen-fixing gene island, which is ligated to the corresponding vector after verified to be correct by DNA fragment gel electrophoresis; constructing the expression plasmid pBeloBAC11-oriT-TnpA-genta-NiF using the primers as shown in SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3 and SEQ ID NO. 4; identifying by digesting with restriction endonuclease Kpn I; electrotransforming the correct plasmid into E. coli ET12567; (2) Introducing the plasmid pBeloBAC11-oriT-TnpA-genta-NiF from E. coli ET12567 into Pseudomonas protegens Pf5 by conjugative transfer; and then randomly inserting NiF gene into the genomic DNA of Pf5 by transposition; (3) Sequencing the correct transformant Pf5-NiF after colony PCR verification, and cryopreserving that with the correct results.
7. A method for producing Pseudomonas protegens Pf5 mutant strain Pf5-retS, comprising scarlessly knocking out retS gene from the genome of Pseudomonas protegens Pf5 to obtain the genetically engineered strain Pf5-retS.
8. The method according to claim 7, characterized in the following steps: (1) Introducing the plasmid pBBR1-Rha-TEGpsy-kan into the wild type Pseudomonas protegens Pf5 by electrotransformation, and screening the correct transformant Pf5::pBBR1-Rha-TEGpsy-kan; (2) Knocking out retS gene in the genome of Pseudomonas protegens Pf5; (3) Cryopreserving the correct transformant Pf5-retS after PCR verification and sequencing.
9. A method for producing Pseudomonas protegens Pf5 mutant strain Pf5-retS-NiF, comprising introducing NiF into mutant Pseudomonas protegens Pf5-retS, and then randomly inserting NiF into the genomic DNA of Pf5-retS by transposition.
10. The method according to claim 9, characterized in the following steps: (1) Introducing the plasmid pBBR1-Rha-TEGpsy-kan into the wild type Pseudomonas protegens Pf5 by electrotransformation, and screening the correct transformant Pf5::pBBR1-Rha-TEGpsy-kan; (2) Knocking out retS gene in the genome of Pseudomonas protegens Pf5 to obtain the mutant Pseudomonas protegens Pf5-retS; (3) Using Red/ET direct cloning method, using the restriction endonucleases Afl II and Ssp I to digest the genomic DNA of Pseudomonas stutzeri DSM4166 to obtain a 69 kb NiF nitrogen-fixing gene island, which is ligated to the corresponding vector after verified to be correct by DNA fragment gel electrophoresis; constructing the expression plasmid pBeloBAC11-oriT-TnpA-genta-NiF using the primers as shown in SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3 and SEQ ID NO. 4; identifying by digesting with restriction endonuclease Kpn I; electrotransforming the correct plasmid into E. coli ET12567; (4) Introducing the plasmid pBeloBAC11-oriT-TnpA-genta-NiF from E. coli ET12567 into the mutant Pseudomonas protegens Pf5-retS by conjugative transfer; and then randomly inserting NiF gene into the genomic DNA of Pf5 by transposition.
11. A method for promoting plant growth, killing bacteria and/or fixing nitrogen, comprising administering to a plant or a seed thereof the Pseudomonas protegens mutant strain Pf5-NiF or Pf5-retS-NiF according to claim 1 or a combination thereof, or a composition, for example, a microbial agent, comprising Pseudomonas protegens mutant strain Pf5-NiF or Pf5-retS-NiF according to claim 1 or a combination thereof.
12. A method for promoting plant growth and/or killing bacteria, comprising administering to a plant or a seed thereof the Pseudomonas protegens mutant strain Pf5-retS according to claim 1, or a composition, for example, a microbial agent, comprising the Pseudomonas protegens mutant strain Pf5-retS according to claim 1.
Description
DESCRIPTION OF THE DRAWINGS
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064] 8A to 8C are schematic diagrams showing the effects of the nitrogen-fixing Pseudomonas syringae Pf5-NiF treatment and the application of the control nitrogen fertilizers NO.sub.3.sup. and Pf5 on Arabidopsis thaliana 4 weeks after transplanted into a pot.
DEPOSIT INFORMATION
[0065] Classification designation: Pseudomonas protegens mutant strain Pf5-NiF
[0066] Name of the depository: China General Microbiological Culture Collection Center Institute of Microbiology
[0067] Address of the depository: NO. 1 West Beichen Road, Chaoyang District, Beijing 100101, China
[0068] Deposit date: Mar. 28, 2017
[0069] Deposit number: CGMCC NO. 13948
[0070] Classification designation: Pseudomonas protegens mutant strain Pf5-retS
[0071] Name of the depository: China General Microbiological Culture Collection Center Institute of Microbiology
[0072] Address of the depository: NO. 1 West Beichen Road, Chaoyang District, Beijing 100101, China
[0073] Deposit date: Mar. 28, 2017
[0074] Deposit number: CGMCC NO. 13949
[0075] Classification designation: Pseudomonas protegens mutant strain Pf5-retS-NiF
[0076] Name of the depository: China General Microbiological Culture Collection Center Institute of Microbiology
[0077] Address of the depository: NO. 1 West Beichen Road, Chaoyang District, Beijing 100101, China
[0078] Deposit date: Mar. 28, 2017
[0079] Deposit number: CGMCC NO. 13950
DETAILED DESCRIPTION
[0080] The present invention will be further described in conjunction with the drawings and the Examples. The following description is to explain the present invention and will not limit its contents.
Example 1
[0081] A method for screening Pseudomonas protegens Pf5 mutant strain Pf5-retS, comprising the specific steps as follows:
[0082] (1) The plasmid pBBR1-Rha-TEGpsy-kan (which can express recombinases in Pseudomonas) was introduced into the wild type Pseudomonas protegens Pf5 by electrotransformation. The electrotransformed bacteria were coated on a plate of LB medium+kanamycin (kin, 30 g/mL), and 12 single colonies were selected randomly to extract the plasmids to be enzymatically identified, and the correct transformant Pf5::pBBR1-Rha-TEGpsy-kan was screened;
[0083] (2) retS gene in the genome of Pseudomonas protegens Pf5 was knocked out. The linear DNA fragment loxM-genta (which was obtained by PCR method using a pair of primers, RetS-Genta-loxM-5 GCACACGCCCTTGCCGTGCGGTCATTACGCCGCGCATAGTTATAA TCAGGCATCAACCAACGAAGGGATTTCGCCAGCTGAATTACATTC CCAACCG/RetS-Genta-loxM-3 TGGAGCATGGTGGGAGCTCACGAC TAAAGGAGGGCGAGCGAGAGTTTAACAGGCGCCGCAGAGCCTGT CGGCTCACAACTTAAATGTGAAAGTGGGTC, shown in SEQ ID NO. 15 and SEQ ID NO. 16 respectively) was electrotransformed into Pf5::pBBR1-Rha-TEGpsy-kan obtained in step (1). Using the method of Red/ET homologous recombination, under the action of the recombinase, retS gene in the genome of Pseudomonas protegens Pf5 was replaced by gentamicin resistance gene (genta). Multiple single colonies were selected randomly to be subject to PCR verification (the pair of primers used for verification are check-5 TGCTTCTACCGCAAGGACATC/check-3 GCTGATGAAGCAC GAGAGCAC, shown in SEQ ID NO. 13 and SEQ ID NO. 14 respectively). The correct transformant Pf5::retS-genta-loxM was screened.
[0084] The genta resistance gene in Pf5::retS-genta-loxM was eliminated. PCM157 plasmid capable of expressing Cre recombinase was electrotransformed into Pf5::retS-genta-loxM, and was coated on a plate of LB medium+tetracycline (tet 25 g/mL) for screening. The resultant recombinants were inoculated into 1 mL LB+tet 25 g/mL liquid medium, and cultured at 900 rpm, 30 C. overnight. 50 L of the overnight cultured bacterial solution was transferred to 1 mL of fresh LB+tet 25 g/mL liquid medium. After culturing at 900 rpm for 3 hours at 30 C., 1 mM of isopropyl--D-thiogalactoside (IPTG) was added for induction. After continuing the culture for 2 hours, the bacterial solution was streaked in a Z-shaped line on a LB plate with a blue inoculation loop. After single colonies grew, they were double-streaked on a LB plate and a LB+genta 15 g/mL plate respectively and cultured at 30 C. overnight. If single colonies grew on both plates, it indicated that the genta resistance gene in the recombinant had not been eliminated; If the colonies grew on LB plate while did not grow on the LB+genta 15 g/m plate, it indicated that the genta resistance gene in the recombinant had been eliminated. Such recombinants whose genta resistance gene had been eliminated were picked up and subjected to colony PCR verification and sequencing, using the following primers:
[0085] check-5 TGCTTCTACCGCAAGGACATC/
[0086] check-3 GCTGATGAAGCACGAGAGCAC; as shown in SEQ ID NO. 13 and SEQ ID NO. 14 respectively.
[0087] (3) The correct transformant Pf5-retS was cryopreserved after PCR verification and sequencing for subsequent bacteriostatic, room temperature potting and field trials.
[0088]
Example 2
[0089] A method for screening Pseudomonas protegens mutant strain Pf5-NiF, comprising the specific steps as follows:
[0090] (1) Using Red/ET direct cloning method, the restriction endonucleases Afl II and Ssp I were used to digest the genomic DNA of Pseudomonas stutzeri DSM4166 to obtain a 69 kb NiF nitrogen-fixing gene island (
[0091] Primer 1: AGTGAATTGTAATACGACTCACTATAGGGCGAATT CGAGCTCGGTACCCGCTTAAGTACGGCTACCTGGAGCTCGCGCCA GTG, as shown in SEQ ID NO.
[0092] Primer 2: TACGGCTACCTGGAGCTCGCGCCAGTGCTTGCCGAC ATCGAATCACGGCCGCTGCTGCAGCACGTGGTGGTCACCGGCCG GGATCCGTTTAAACACAAATGGCAAGGGCTAATG, as shown in SEQ ID NO. 2;
[0093] Primer 3: ATTGATGTTTTCCTTGGCCAGCGCCTCGAACATCCG GCTGGCGACGCCTGCGTGCGAACGCATACCGACACCGACGATAG GGATCCGTTTAAACGGTGTGGTAGCTCGCGTATT, as shown in SEQ ID NO. 3;
[0094] Primer 4: GCGACACTATAGAATACTCAAGCTTGGCATGAAT GCAGGTCGACTCTAGAGAATATTGATGTTTTCCTTGGCCAGCGCC TCGAAC, as shown in SEQ ID NO. 4.
[0095] The expression plasmid pBeloBAC11-oriT-TnpA-genta-NiF (
[0096] (2) The plasmid pBeloBAC11-oriT-TnpA-genta-NiF from E. coli ET12567 was introduced into Pseudomonas protegens Pf5 by conjugative transfer, and then NiF gene was randomly inserted into the genomic DNA of Pf5 by transposition. The detailed operation of the conjugation transfer was as follows: A single colony of Pseudomonas protegens Pf5 was picked up and was cultured (LB medium, 30 C.) separately with E. coli ET12567 (LB+genta 2 g/mL+cm 10 g/mL+kin 1 g/mL medium, 37 C.) overnight; The two overnight bacterial solutions were centrifuged at 7000 rpm for 1 minute. Pseudomonas protegens Pf5 and E. coli ET12567 were washed twice with fresh LB medium, resuspended in 300 L of LB medium. 50 L of each suspension was mixed and coated on a small area in the middle of the LB plate and air dried. After incubating for 4 hours at 37 C., the plate was invertedly incubated in an incubator at 30 C. overnight; The bacteria on the plate were scraped with an inoculating loop, mixed thoroughly with 1 mL sterilized solution. 100 L of bacterial solution was streaked in a Z-shaped line on a plate of PMM medium+genta 25 g/mL, and cultured invertedly at 30 C. for 2 days until single colonies appeared; Two days later, colonies grew. A single colony was picked up to be inoculated in 1 mL of LB+genta 25 g/mL and to be cultured overnight, followed by colony PCR verification using the following 5 pairs of primers:
[0097] NiF-check-1 GGTCTACCAGCTCGACCT/
[0098] NiF-check-2 CGATTCCAGCGTCGAATGAT;
[0099] NiF-check-3 GCTGACCTCCTTGAGGTGCT/
[0100] NiF-check-4 CAGCGGCACCTCGAGGAGT;
[0101] NiF-check-5 GATAGAGCAGGTCCTCGAT/
[0102] NiF-check-6 GGTGCTCTACGTCAGCCATT;
[0103] NiF-check-7 CGACAGATCCTGATTACCGT/
[0104] NiF-check-8 TACCCTCGACCAGCTTGAGCA;
[0105] check-5 TGCTTCTACCGCAAGGACATC/
[0106] check-3 GCTGATGAAGCACGAGAGCAC; as shown in SEQ ID NO. 5 to SEQ ID NO. 14, respectively.
[0107] The first four pairs of primers were used to verify whether the NiF nitrogen-fixing gene had been integrated as a whole into the genome of Pseudomonas protegens Pf5. The amplified PCR fragments were 1000 bp, 970 bp, 830 bp, and 1080 bp, respectively. The fifth pair of primers was used to verify that the strain to which the NiF nitrogen-fixing gene was introduced was Pseudomonas protegens Pf5 instead of Escherichia coli ET12567, and the PCR amplification result was retS gene with a DNA fragment size of 3200 bp.
[0108] The correct transformant Pf5-NiF was sent to the sequencing after colony PCR verification, and that with the correct results was cryopreserved and used for subsequent bacteriostatic, room temperature potting and field trials.
[0109]
Example 3
[0110] A method for screening Pseudomonas protegens mutant strain Pf5-retS-NiF, comprising the specific steps as follows:
[0111] The plasmid pBeloBAC11-oriT-TnpA-genta-NiF from E. coli ET12567 was introduced into mutant Pseudomonas protegens Pf5-retS by conjugative transfer, and then NiF gene was randomly inserted into the genomic DNA of Pf5-retS by transposition. The detailed operation of the conjugation transfer was as follows: The mutant Pseudomonas protegens Pf5-retS (LB medium, 30 C.) and E. coli ET12567 (LB+genta 2 g/mL medium, 37 C.) were cultured overnight respectively; The next day, the mutant Pseudomonas protegens Pf5-retS and E. coli ET12567 were washed twice with fresh LB medium respectively, and dissolved in 500 L of LB in the same amounts respectively, and then mixed together to 1 mL. After centrifuged at 9000 rpm for 1 minute, most of the supernatant was discarded. 100 L of the bacterial solution was retained to be resuspended with the mixed bacteria, and uniformly coated on a LB plate in a small range. After incubated at 37 C. for 4 hours, the plate was placed in an incubator at 30 C. to be cultured overnight; On the third day, the co-cultured bacteria were transferred with a yellow inoculating loop from the LB plate to 1 mL of LB to be mixed thoroughly. 30 L of the bacterial solution was streaked in a Z-shaped line on PMM medium+genta 25 g/mL. Two days later, colonies were grown. Single colonies were picked up and inoculated in 1 mL LB+genta 25 g/mL to be cultured overnight, and then subjected to colony PCR verification using the 5 pairs of primers shown in Example 2. The first four pairs of primers were used to verify whether the NiF nitrogen-fixing gene had been integrated as a whole into the genome of Pseudomonas protegens Pf5. The amplified PCR fragments were 1000 bp, 970 bp, 830 bp, and 1080 bp, respectively. The fifth pair of primers was used to verify that the strain to which the NiF nitrogen-fixing gene was introduced was Pseudomonas protegens Pf5 instead of Escherichia coli ET12567. Because this time the NiF nitrogen-fixing gene was transferred into the mutant Pseudomonas syringae Pf5-retS whose retS gene had been knocked out, the PCR amplification result was a DNA fragment of 400 bp in size. The correct transformant Pf5-retS-NiF was sent to the sequencing after PCR verification, and that with the correct results was cryopreserved and used for subsequent bacteriostatic, room temperature potting and field trials
[0112]
[0113] The information about Pseudomonas protegees Pf5 and its mutant strains Pf5-NiF, Pf5-retS and Pf5-retS-NiF obtained by the present invention is shown in Table 1.
TABLE-US-00001 TABLE 1 Information about each strain Strains of Pseudomonas protegens Relevant properties origins Pf5 Wild type German Collection of Microorganisms, DSMZ Pf5-NiF Pf5 genetically engineered strain having integrated NiF The present nitrogen-fixing gene, having genta resistance during invention culture, and capable of biologically nitrogen-fixing and reducing the usage of nitrogen fertilizer during the growth of plants Pf5-retS Pf5 mutant strain whose retS gene has been knocked The present out, having no genta resistance gene, having no invention resistance during culture, and having increased bacteria killing activity Pf5-retS-NiF Pf5 genetically engineered strain whose retS gene has The present been knocked out and having integrated NiF invention nitrogen-fixing gene, having genta resistance during culture, having increased bacteria killing activity, and capable of biologically nitrogen-fixing and reducing the usage of nitrogen fertilizer during the growth of plants
Example 4
[0114] The filter paper method was used to detect the inhibitory effects of Pseudomonas protegens Pf5 and its mutant strains Pf5-NiF, Pf5-retS and Pf5-retS-NiF on Bacillus subtilis. The specific steps were as follows:
[0115] (1) Bacillus subtilis and the experimental strain Pseudomonas protegens Pf5 and its mutant strains Pf5-NiF, Pf5-retS and Pf5-retS-NiF were inoculated into 1 mL LB liquid medium respectively, and were cultured at 900 rpm, overnight at 30 C.;
[0116] (2) The next day, Bacillus subtilis was centrifuged at 9000 rpm for 1 minute, and 100 L of the bacterial solution was uniformly coated on a LB solid plate. After dried, several double-layer filter paper sheets having a diameter of 6 mm were placed on the plate. 5 L overnight cultured experimental strain Pseudomonas protegens Pf5 and its mutant strains Pf5-NiF, Pf5-retS and Pf5-retS-NiF were added dropwise to the filter paper sheets. The plate was cultured at 30 C. overnight.
[0117] (3) On the third day, the size of the inhibition zone around each small filter paper sheet on the plate was observed.
[0118]
Example 5
[0119] The room temperature pot experiment of Pseudomonas protegens strain Pf5-NiF was carried out with Arabidopsis thaliana as the test subject. The test protocol was as follows:
[0120] 1) Wild type Arabidopsis thaliana Col-0 was used as the test subject. The test conditions were: temperature 20 C., light intensity 80 mol.Math.m.sup.2.Math.s.sup.1, light cycle: 16 hours light, 8 hours dark; the test was divided into 3 groups:
[0121] i) Normal application of nitrogen fertilizer 1 mM (NO.sub.3.sup.), as the control
[0122] ii) No nitrogen fertilizer was applied, but the normal Pseudomonas protegens strain Pf5 was applied.
[0123] iii) No nitrogen fertilizer was applied, but the nitrogen-fixing Pseudomonas protegees strain Pf5-NiF was applied.
[0124] 2) pre-treatment of the seeds of Arabidopsis thaliana: Seeds were placed in a refrigerator at 4 C. for 2-4 days (the seeds were vernalized to keep the germination rate of the batch of seeds tested consistent); Disinfection of the seeds: After detoxification in 2 w.t. % sodium hypochlorite (NaClO) (continuous shaking during detoxification to allow the seeds to be fully contacted) for 15 minutes, the seeds were then rinsed 5-10 times with sterile water;
[0125] 3) The seeds of Arabidopsis thaliana were sown on MS solid medium (the seeds at the same location should not be excessive). Specific operation: the supernatant in the Ep tube was sucked up with a pipette tip. 200 L of the medium was aspirated, and the liquid was slowly flowed to the tip of the pipette, and then gently spotted on the MS medium. The plate was then incubated vertically.
[0126] 4) Transplant of the seedlings: When the seedlings grew on the MS medium (took about 10 days), they were transplanted into the soil medium (roseite: black soil (mass ratio)=1:1), three seedlings per pot. The roots of the seedlings were not broke during the transplant process.
[0127] 5) Inoculation: Pf5-NiF single colonies on the plate were cultured overnight on KB medium, and inoculated in LB medium at a ratio of overnight bacterial solution:fresh medium (volume ratio)=1:50 on the next day, and cultured to 220 rpm, 30 C. until OD.sub.600=0.6 (the number of Pf5-NiF can reach 110.sup.9 cfu/mL). 1 mL of bacterial solution was inoculated in the range of 0.5 mm around the rhizosphere of the seedlings of Arabidopsis thaliana for 3 days.
[0128] 6) Cultivation in the pots in the greenhouse according to the set test conditions,
[0129] The composition of each medium used in the potting test at room temperature was as follows:
[0130] MS medium: NH.sub.4NO.sub.3 1.65 g/L, KNO.sub.3 1.9 g/L, CaCl.sub.2.2H.sub.2O 0.44 g/L, MgSO.sub.4.7H.sub.2O 0.37 g/L, KH.sub.2PO.sub.4 0.17 g/L, KI 0.83 mg/L, H.sub.3BO.sub.3 6.2 mg/L, MnSO.sub.4.4H.sub.2O 22.3 mg/L, ZnSO.sub.4.7H.sub.2O 8.6 mg/L, Na.sub.2MoO.sub.4.2H.sub.2O 0.25 mg/L, CuSO.sub.4.5H.sub.2O 0.025 mg/L, CoCl.sub.2.6H.sub.2O 0.025 mg/L, FeSO.sub.4.7H.sub.2O 27.8 mg/L, Na.sub.2-EDTA.2H.sub.2O 37.3 mg/L, inositol 100 mg/L, nicotinic acid acid 0.5 mg/L, vitamin B.sub.6 0.5 mg/L, vitamin B.sub.1 0.1 mg/L, glycine 2 mg/L.
[0131] KB medium: K.sub.2HPO.sub.4 0.1 g/L, KH.sub.2PO.sub.4 0.4 g/L, NaCl 0.1 g/L, MgSO.sub.4.7H.sub.2O 0.01 g/L, Fee (SO.sub.4).sub.3.H.sub.2O 0.01 g/L, ZnSO.sub.4.7H.sub.2O 0.01 g/L, MnCl.sub.2H.sub.2O 0.01 g/L, NaMoO.sub.4 0.01 g/L, CaCl.sub.2 2H.sub.2O 0.1 g/L, sodium citrate 1 g/L, glucose 5.5 g/L, yeast extract 0.2 g/L, pH adjusted to 7.0.
[0132]
[0133] The green quality of potted Arabidopsis thaliana treated with the Pseudomonas protegens strain Pf5-NiF obtained by the present invention was increased by about 8% on average (
Example 6
[0134] Effects of Pf5 Engineered Strain on Wheat Growth and Soil-Borne Disease Control
[0135] 1. Test time: October 2016-May 2017
[0136] 2. Test location: Xinzhai Town, Yucheng City, Dezhou City, Shandong Province
[0137] 3. Test crop: wheat
[0138] 4. Test treatment:
[0139] During the wheat planting period, the fertilizer management and the addition of microbial agents were according to the conventional method, that is, the base fertilizer was equivalent to pure N 225 kg/hm.sup.2, P.sub.2O.sub.5 180 kg/hm.sup.2, K.sub.2O 180 kg/hm.sup.2, and pure N 80 kg/hm.sup.2 was applied during the shooting period. Frozen water (December 4th) and shooting water (April 10th) was normally irrigated during the whole growth period at the amount of 750 m.sup.3/hm.sup.2. The dosage form of the microbial agents is liquid, and the effective viable bacterial count was 5 billion/ml. The application amount was 2 kg/mu, and the application method was seed dressing and root irrigation.
[0140] Treatment 1: blank control (CK) without applying any microbial agent
[0141] Treatment 2: application of the control microbial agent, which was a commercially available conventional Pseudomonas protegees Pf5 agent (purchased from Lanling Pharmaceutical Co., Ltd., Changzhou, Jiangsu);
[0142] Treatment 3: application of the test microbial agent having the active ingredient Pf5-NiF;
[0143] Treatment 4: application of the test microbial agent having the active ingredient Pf5-retS;
[0144] Treatment 5: application of the test microbial agent having the active ingredient Pf5-retS-NiF;
[0145] Treatment 6: application of the test microbial agent having the active ingredient Pf5-retS-NiF; wherein the application amount of nitrogen fertilizer was of the standard fertilization, and the phosphorus and potassium were consistent.
[0146] The field plot test results are shown in Tables 2 and 3.
TABLE-US-00002 TABLE 2 Prevention effects of different treatments in field plots on take-all disease of wheat 120 d after sowing Late Height of the Ration of Index of emergence Emergence seedlings 30 d diseased the Control time rate after sowing plants disease of effects treatments (d) (%) (cm) (%) the root (%) Treatment 1 2 94 30.6 96 78.2 Treatment 2 0 99 33.5 46 24.2 52.1 Treatment 3 0 100 34.0 44 23.9 54.3 Treatment 4 0 100 41.9 18 13.4 77.8 Treatment 5 0 100 42.6 16 12.7 79.1 Treatment 6 0 100 42.3 17 13.2 78.2
[0147] As can be seen from the results in Table 2, the three Pf5 engineered bacteria (treatments 4, 5, 6), whose retS gene had been knocked out, had 77.8%, 79.1%, and 78.2% control effects on take-all disease of wheat. The control effects of the three were all significantly higher than that of the two Pf5 bacteria (treatment 2, 3) whose retS gene had not been knocked out (52.1% and 54.3%). After the application of Pf5 microbial agent, there was effect on the height of the seedlings of the wheat within 30d after sowing. Moreover, the effects of applying Pf5 engineered bacteria whose retS gene had been knocked out were more significant, which were generally 20% higher than that of the non-knocked out Pf5 treatment group. Moreover, due to the presence of nitrogen-fixing gene, after the application of nitrogen fertilizer decreased by , treatment 6 still maintained the effect same as that without the decrease of the application, indicating that the nitrogen-fixing gene played an important role in the growth of wheat.
TABLE-US-00003 TABLE 3 Effects of different treatments in field plots on the yield and constitutive factors of wheat Constitution of yield Weight of The increase Number of Number of ears thousand grains yield of yield treatments ear kernels (ten thousand/hm.sup.2) (g) (kg/hm.sup.2) (%) Treatment 1 26.8 490 25.6 6142.2 Treatment 2 34.1 530 33.1 6744.1 9.79 Treatment 3 34.5 535 33.3 6742.8 9.83 Treatment 4 41.6 665 40.7 7780.2 26.67 Treatment 5 42.3 667 41.2 7826.1 27.42 Treatment 6 42.2 665 40.9 7810.3 27.16
[0148] As shown in table 3, after applying the Pf5 microbial agent, the number of the ears of wheat was significantly increased. The three Pf5 engineered bacteria (treatments 4, 5, 6), whose retS gene had been knocked out, had larger increase, generally around 35%. In the treatment group to which Pf5 microbial agent was applied, the yield of wheat was also significantly higher than that of the control (treatment 1), which increased by about 26%. Under the action of nitrogen-fixing gene NiF, treatment 6 which had decrease of nitrogen fertilizer, also obviously increased the yield of wheat, indicating that it was feasible to apply nitrogen-fixing engineered bacteria to reduce the application of nitrogen fertilizer during the growth of wheat.
Example 7
[0149] Report of Field Test on Garlic with Pf5 Engineered Strains
[0150] 1. Test time: October 2016-June 2017
[0151] 2. Test location: Qianjiang Village, Yucheng Town, Yutai County, Jining City, Shandong Province
[0152] 3. Test crop: hybrid garlic (white garlic)
[0153] 4. Test treatments: The test was divided into 6 treatments as follows:
[0154] Treatment 1: Fertilizer was applied according to the farmers' convention (N 45 kg/hm.sup.2, P.sub.2O.sub.5 22.5 kg/hm.sup.2, K.sub.2O 22.5 kg/hm.sup.2, organic fertilizer 40 kg/mu, high-nitrogen and high-potassium compound fertilizer for topdressing);
[0155] Treatment 2: Optimized fertilization, N 30 kg/hm.sup.2, P.sub.2O.sub.5 16 kg/hm.sup.2, K.sub.2O 24 kg/hm.sup.2, N 30 kg/hm.sup.2, P.sub.2O.sub.5 16 kg/hm.sup.2, K.sub.2O 24 kg/hm.sup.2, bio-organic fertilizer 200 kg/hm.sup.2, formula fertilizer used for topdressing (18-5-17 humic acid type) 20 kg/mu; Dodine was used for seed dressing; hymexazol, methyl thiophanate and dodine were applied according to the actual situation in the spring when topdressing;
[0156] Chemical control measures (according to actual re-selection): mepiquat and brassinolide
[0157] Treatment 3: Microbial agentPseudomonas protegens Pf5-NiF
[0158] Fertilization was consistent with optimized fertilization. Pseudomonas protegens was used for seed dressing. Solution of Pseudomonas protegens was flushed by water to be applied in the spring. Bacterial solution was flushed by water to be applied during topdressing.
[0159] Treatment 4: Microbial agentPseudomonas protegens Pf5-retS
[0160] Fertilization was consistent with optimized fertilization. Pseudomonas protegens was used for seed dressing. Solution of Pseudomonas protegens was flushed by water to be applied in the spring. Bacterial solution was flushed by water to be applied during topdressing.
[0161] Treatment 5: Microbial agentPf5-retS-NiF
[0162] Fertilization was consistent with optimized fertilization. Pseudomonas protegens was used for seed dressing. Solution of Pseudomonas protegens was flushed by water to be applied in the spring. Bacterial solution was flushed by water to be applied during topdressing.
[0163] Treatment 6: Microbial agentPf5-retS-NiF
[0164] The application amount of nitrogen fertilizer was of optimized fertilization, and phosphorus and potassium were same as optimized fertilization. Others were consistent with optimized fertilization. Pseudomonas protegens was used for seed dressing. Solution of Pseudomonas protegens was flushed by water to be applied in the spring. Bacterial solution was flushed by water to be applied during topdressing.
[0165] The dosage form of the microbial agents was liquid, and the effective viable bacterial count was 5 billion/ml. The application amount was 2 kg/mu.
[0166] On Jan. 26, 2017, the length and width of the garlic leaves, the diameter of the stein, and the enzymatic activity of the root were measured before wintering (Table 4).
TABLE-US-00004 TABLE 4 Statistical table of biological traits of the test treatments Enzymatic activity of root Diameter Weight of Weight of mg/g Length of of stem Width of seedling root (fresh weight of treatment leaf (cm) (cm) leaf (g) (g) root)/h Treatment 1 21.4 11.82 1.008 105.33 14.21 0.367 Treatment 2 22.3 12.62 0.992 131.12 18.75 0.384 Treatment 3 23.1 12.89 1.047 134.46 19.68 0.409 Treatment 4 24.8 13.75 1.179 139.81 21.05 0.422 Treatment 5 25.5 14.58 1.124 144.73 21.96 0.436 Treatment 6 25.1 14.10 1.121 143.65 21.32 0.423
[0167] The measured data were consistent with the results of field test observations. Four treatments of Pseudomonas protegens showed that the leaves were significantly longer and wider in the early growth stage of the garlic. The leaf lengths of treatments 5 and 6 were increased by 19.16 and 17.29%, respectively, and the leaf lengths of treatments 5 and 6 observed in the field were more prolonged than the control treatment. By measuring the enzymatic activity of the root of the garlic before wintering, the enzymatic activity of the root of the four treatments using Pseudomonas protegens was significantly higher than that of the control treatment. Donine inhibited the growth of pathogens and also harmed the beneficial bacteria around the garlic so that indirectly hindered the growth of garlic in the early stage of growth. The Pseudomonas protegens agents replaced the seed dressing with donine. Therefore, the Pseudomonas protegens treated garlic seedlings grew vigorously.
[0168] From the planting of garlic in October to the harvest in May of the following year, the production was calculated and converted into the yield of garlic, and the results were statistically analyzed.
[0169] The garlic yield results of test treatments 1-6 are shown in Table 5.
TABLE-US-00005 TABLE 5 Effects of different treatments on garlic yield and garlic quality Increase in Vc in the Soluble yield yield garlic Soluble sugar protein Allicin treatment (kg/667 m.sup.2) (%) (%) (mg//Gfw) (mg/gFW) (g/gFW) Treatment 1 18345 16 20 27 20 Treatment 2 24130 31.5 18 27 44 26 Treatment 3 25084 36.7 19 29 47 29 Treatment 4 29268 59.6 23 38 67 47 Treatment 5 29846 62.7 25 43 74 49 Treatment 6 29653 61.6 24 41 72 47
[0170] It can be seen from Table 5, the four treatments of Pseudomonas protegens had a very positive effect on the yield increase of garlic. Treatments 5 and 6 were increased by 62.7% and 61.6%, respectively, compared with the control treatment, indicating that the effect of Pf5 microbial agents was very obvious in the case of reduced nitrogen fertilizer application. For the determination of garlic quality, there were four indicators: Vc in the garlic, soluble sugar content, soluble protein and allicin. Each of the four treatments of Pseudomonas protegens had a very significant improvement. After reducing the application of nitrogen fertilizer, compared with the control treatment, the content of Vc in the garlic of treatments 5 and 6 were increased by 25% and 24%, the soluble sugar content increased by 115% and 105%, the soluble protein content increased by 174% and 167%, and the dry content of allicin increased by 145% and 135%. It can be seen that the application of Pf5 microbial agents had a great impact on the quality of garlic. It can bring huge economic benefits to customers, and reduce of the usage of nitrogen fertilizer. Under the premise of not affecting the quality of the product, the production cost of the customer can be reduced, and the effect is immediate.
[0171] The above description of the specific embodiments of the present invention has been described with reference to the accompanying drawings, but is not intended to limit the scope of the present invention. On the basis of the technical solutions of the present invention, various modifications or variations that can be made by the skilled in the art without any creative work are still within the scope of protection of the present invention.