PEPTIDES AND NEMATICIDAL COMPOSITIONS

20200123208 ยท 2020-04-23

    Inventors

    Cpc classification

    International classification

    Abstract

    Peptides, nematicidal compositions, transgenic microorganisms for expressing the peptides and methods of treating plant parasitic nematodes, the method comprising providing either a peptide or a nematicidal composition or a transgenic microorganism for expressing the peptide on or adjacent the plant parasitic nematodes.

    Claims

    1. A peptide comprising: AA.sub.1-AA.sub.2-AA.sub.3-F-D-AA.sub.6-AA.sub.7-AA.sub.8-AA.sub.9-AA.sub.10-AA.sub.11-AA.sub.12-AA.sub.13-AA.sub.14-AA.sub.15-AA.sub.16-AA.sub.17; wherein AA.sub.1 is selected from S, N and A; wherein AA.sub.2 is selected from S and A; wherein AA.sub.3 is selected from S, N and A; wherein AA.sub.6 is selected from S, L, D and A; wherein AA.sub.7 is selected from F, S and L; wherein AA.sub.8 is selected from V, T, M, A, F and G; wherein AA.sub.9 is selected from G, V and T; wherein AA.sub.10 is selected from R, K, P, S, G and N; wherein AA.sub.11 is selected from G and R; wherein AA.sub.12 is selected from F and G; wherein AA.sub.13 is selected from T and F; wherein AA.sub.14 is selected from G and T; wherein AA.sub.15 is selected from M, L, G and F; wherein AA.sub.16 is selected from D and M; and wherein AA.sub.17 is present or absent and, if present, is selected from T and D.

    2. The peptide of claim 1, wherein the peptide comprises: AA.sub.1-AA.sub.2-AA.sub.3-F-D-AA.sub.6-AA.sub.7-AA.sub.8-AA.sub.9-AA.sub.10-G-F-T-G-AA.sub.15-D-AA.sub.17; wherein AA.sub.1 is present or absent and, if present, is selected from S or A; wherein AA.sub.2 is present or absent and, if present, is S and A; wherein AA.sub.3 is selected from A, S and N; wherein AA.sub.6 is selected from S, L and A; wherein AA.sub.7 is selected from F and L; wherein AA.sub.8 is selected from V, T, M, A and G; wherein AA.sub.9 is selected from G and T; wherein AA.sub.10 is selected from R, K, P, S and N; wherein AA.sub.15 is selected from M, L and F; and wherein AA.sub.17 is present or absent and, if present, is selected from D and T.

    3. The peptide of claim 1, wherein the peptide comprises: AA.sub.1-AA.sub.2-AA.sub.3-F-D-AA.sub.6-AA.sub.7-AA.sub.8-AA.sub.9-AA.sub.10-G-F-T-G-AA.sub.15-D-AA.sub.17; wherein AA.sub.1 is absent; wherein AA.sub.2 is present or absent and, if present, is selected from S and A; wherein AA.sub.3 is selected from A and S; wherein AA.sub.6 is selected from S, L and A; wherein AA.sub.7 is selected from F and L; wherein AA.sub.8 is selected from V, T, M, A and G; wherein AA.sub.9 is selected from G and T; wherein AA.sub.10 is selected from R, K, P, S and N; wherein AA.sub.15 is selected from M, L and F; and wherein AA.sub.17 is present or absent and, if present, is T.

    4. The peptide of claim 1, wherein the peptide comprises: TABLE-US-00014 Gp-NLP-15a SFDSLTGPGFTGLDT Gp-NLP-15b SFDSFTGPGFTGLD Gp-NLP-15c SFDSFTGSGFTGLD Gp-NLP-15f SFDSFMGPGFTGMD Gp-NLP-15h AFDLFTGPGFTGMD Gp-NLP-15g AFDSFTGPGFTGMD Mi-NLP-15a AFDSFGTPGFTGFD Mi-NLP-15b SFDSFTGPGFTGLD Mi-NLP-15c SFDSFVGKGFTGMD Mi-NLP-15d AFDSFGTPGFTGFD Mi-NLP-15e SAFDSFVGRGFTGMD Mi-NLP-15f AFDSFAGNGFTGFD Mi-NLP-15g NFDAFMGPGFTGLD or Mi-NLP-15h AAFDSFVGRGFTGMD,

    5. The peptide of claim 1, wherein the peptide comprises: TABLE-US-00015 Mi-NLP-15b SFDSFTGPGFTGLD or Mi-NLP-15e SAFDSFVGRGFTGMD,

    6-14. (canceled)

    15. A nematicidal composition comprising a peptide as claimed in claim 1, or a mixture thereof, and a suitable carrier.

    16. An expression vector comprising a peptide as claimed in claim 1.

    17. The vector of claim 16, wherein a promoter is operably linked to the peptide.

    18. A transgenic microorganism for expression of a peptide, the microorganism comprising an expression vector comprising a peptide as claimed in claim 1.

    19. A method of treating plant parasitic nematodes, the method comprising providing a peptide as claimed in claim 1 on or adjacent the plant parasitic nematodes.

    20. The peptide of claim 1, wherein the peptide comprises: TABLE-US-00016 15b SFDSFTGPGFTGLD 15e SAFDSFVGRGFTGMD 9f GGGRYFIRPFADQ 18a FAPRQFAFA 14c ALDMMEGDDFIGL 8d AFDRLDNSFMLL or a mixture thereof.

    21. The peptide of claim 1, wherein the peptide comprises: TABLE-US-00017 15b SFDSFTGPGFTGLD.

    22. A transgenic microorganism for expression of a peptide, the microorganism comprising an expression vector comprising a peptide as claimed in claim 1, wherein a promoter is operably linked to the peptide.

    23. The peptide of claim 1, wherein the peptide consists of: AA.sub.1-AA.sub.2-AA.sub.3-F-D-AA.sub.6-AA.sub.7-AA.sub.8-AA.sub.9-AA.sub.10-AA.sub.11-AA.sub.12-AA.sub.13-AA.sub.14-AA.sub.15-AA.sub.16-AA.sub.17; wherein AA.sub.1 is selected from S, N and A; wherein AA.sub.2 is selected from S and A; wherein AA.sub.3 is selected from S, N and A; wherein AA.sub.6 is selected from S, L, D and A; wherein AA.sub.7 is selected from F, S and L; wherein AA.sub.8 is selected from V, T, M, A, F and G; wherein AA.sub.9 is selected from G, V and T; wherein AA.sub.10 is selected from R, K, P, S, G and N; wherein AA.sub.11 is selected from G and R; wherein AA.sub.12 is selected from F and G; wherein AA.sub.13 is selected from T and F; wherein AA.sub.14 is selected from G and T; wherein AA.sub.15 is selected from M, L, G and F; wherein AA.sub.16 is selected from D and M; and wherein AA.sub.17 is present or absent and, if present, is selected from T and D.

    24. The peptide of claim 1, wherein the peptide consists of: AA.sub.1-AA.sub.2-AA.sub.3-F-D-AA.sub.6-AA.sub.7-AA.sub.8-AA.sub.9-AA.sub.10-G-F-T-G-AA.sub.15-D-AA.sub.17; wherein AA.sub.1 is present or absent and, if present, is selected from S or A; wherein AA.sub.2 is present or absent and, if present, is S and A; wherein AA.sub.3 is selected from A, S and N; wherein AA.sub.6 is selected from S, L and A; wherein AA.sub.7 is selected from F and L; wherein AA.sub.8 is selected from V, T, M, A and G; wherein AA.sub.9 is selected from G and T; wherein AA.sub.10 is selected from R, K, P, S and N; wherein AA.sub.15 is selected from M, L and F; and wherein AA.sub.17 is present or absent and, if present, is selected from D and T.

    25. The peptide of claim 1, wherein the peptide consists of: AA.sub.1-AA.sub.2-AA.sub.3-F-D-AA.sub.6-AA.sub.7-AA.sub.8-AA.sub.9-AA.sub.10-G-F-T-G-AA.sub.15-D-AA.sub.17; wherein AA.sub.1 is absent; wherein AA.sub.2 is present or absent and, if present, is selected from S and A; wherein AA.sub.3 is selected from A and S; wherein AA.sub.6 is selected from S, L and A; wherein AA.sub.7 is selected from F and L; wherein AA.sub.8 is selected from V, T, M, A and G; wherein AA.sub.9 is selected from G and T; wherein AA.sub.10 is selected from R, K, P, S and N; wherein AA.sub.15 is selected from M, L and F; and wherein AA.sub.17 is present or absent and, if present, is T.

    26. The peptide of claim 1, wherein the peptide consists of: TABLE-US-00018 Gp-NLP-15a SFDSLTGPGFTGLDT Gp-NLP-15b SFDSFTGPGFTGLD Gp-NLP-15c SFDSFTGSGFTGLD Gp-NLP-15f SFDSFMGPGFTGMD Gp-NLP-15h AFDLFTGPGFTGMD Gp-NLP-15g AFDSFTGPGFTGMD Mi-NLP-15a AFDSFGTPGFTGFD Mi-NLP-15b SFDSFTGPGFTGLD Mi-NLP-15c SFDSFVGKGFTGMD Mi-NLP-15d AFDSFGTPGFTGFD Mi-NLP-15e SAFDSFVGRGFTGMD Mi-NLP-15f AFDSFAGNGFTGFD Mi-NLP-15g NFDAFMGPGFTGLD or Mi-NLP-15h AAFDSFVGRGFTGMD,

    27. The peptide of claim 1, wherein the peptide consists of: TABLE-US-00019 Mi-NLP-15b SFDSFTGPGFTGLD or Mi-NLP-15e SAFDSFVGRGFTGMD,

    28. The peptide of claim 1, wherein the peptide consists of: TABLE-US-00020 15b SFDSFTGPGFTGLD 15e SAFDSFVGRGFTGMD 9f GGGRYFIRPFADQ 18a FAPRQFAFA 14c ALDMMEGDDFIGL 8d AFDRLDNSFMLL or a mixture thereof.

    29. The peptide of claim 1, wherein the peptide consists of: TABLE-US-00021 15b SFDSFTGPGFTGLD.

    Description

    DRAWINGS

    [0104] In the drawings,

    [0105] FIG. 1 shows that exogenous neuropeptides disrupt normal Meloidogyne incognita chemotaxis, plant invasion and stylet thrusting. (A) 100 M. incognita infective stage juveniles (J2s) were incubated in selected uNLPs, and subsequently challenged with an agar plate chemosensory assay (plant root exudate attractant/water control). Each assay of 100 nematode juveniles was repeated ten times. (B) Ten tomato seedlings were individually challenged with 500 M. incognita J2s incubated in selected uNLPs. Number of invading M. incognita J2s were normalised against the negative control group, and expressed as a relative percentage. (C) 100 M. incognita J2s were incubated in selected uNLPs and the frequency of stylet thrusting in response to 5 mM serotonin was counted. Data were normalised to control treated groups. Data shown represent the meanSEM. *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001 (One-Way ANOVA & Fisher's LSD; Graphpad Prism 6);

    [0106] FIG. 2 shows that exogenous neuropeptides disrupt normal Globodera pallida chemotaxis, plant invasion and stylet thrusting. (A) 100 G. pallida infective stage juveniles (J2s) were incubated in selected uNLPs, and subsequently challenged with an agar plate chemosensory assay (plant root exudate attractant/water control). Each assay of 100 nematode juveniles was repeated ten times. (B) Ten tomato seedlings were individually challenged with 500 G. pallida J2s incubated in selected uNLPs. Number of invading G. pallida J2s were normalised against the negative control group, and expressed as a relative percentage. (C) 100 G. pallida J2s were incubated in selected uNLPs and the frequency of stylet thrusting in response to 2 mM serotonin was counted. Data were normalised to control treated groups. Data shown represent the meanSEM. *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001 (One-Way ANOVA & Fisher's LSD; Graphpad Prism 6);

    [0107] FIG. 3 shows that Mi-NLP-15b potently inhibits the chemotaxis and infectivity of Meloidogyne incognita. (A) Serial dilutions of Mi-NLP-15b indicate that J2 chemotaxis is inhibited by low picomolar concentrations. (B) Mi-NLP-15b significantly reduced J2 invasion levels at nanomolar concentrations. Data shown represent the meanSEM. *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001 (One-Way ANOVA & Fisher's LSD; Graphpad Prism 6);

    [0108] FIG. 4 shows transgenic microbes secreting uNLPs protect tomato against Meloidogyne incognita and Globodera pallida. (A) Nine independent Chlamydomonas reinhardtii transformants secreting two distinct nematode neuropeptides (Mi-NLP-9f and Mi-NLP-15b) significantly inhibited the ability of M. incognita J2s to infect tomato plants, with up to 90% protection. (B) Bacillus subtilis cultures secreting either Mi-NLP-15b or Mi-NLP-40 also conferred significant protection against M. incognita J2 invasion. (C) C. reinhardtii transformants secreting Gp-NLP-15b (identical to Mi-NLP-15b) significantly inhibited the ability of G. pallida J2s to invade tomato plants. (D) B. subtilis cultures secreting Gp-NLP-15b also protected tomato plants from G. pallida J2 invasion. Data shown represents meanSEM. *, P<0.05; **, P<0.01; ***, P<0.001 (One-way ANOVA & Fisher's LSD; Graphpad Prism 6); and

    [0109] FIG. 5 shows Plant parasitic nematode (PPN) unamidated neuropeptide-like proteins (uNLPs) do not alter Caenorhabditis elegans chemotaxis or Steinernema carpocapsae host-finding. Chemotaxis of mixed stage C. elegans towards the attractants sodium acetate (A), pyrazine (B), benzaldehyde (C), and diacetyl (D) are unaffected by exposure to selected PPN uNLPs. (E) Chemotaxis of S. carpocapsae towards the insect host Galleria mellonella is also unaffected by exposure to selected PPN uNLPs. Data shown represent mean SEM (One-way ANOVA & Fisher's LSD; Graphpad Prism 6).

    [0110] Microorganisms in soil affect soil structure and fertility. Soil microorganisms can be classified as bacteria, actinomycetes, fungi, algae and protozoa. Up to 10 billion bacterial cells inhabit each gram of soil in and around plant roots, a region known as the rhizosphere.

    [0111] Bacteria

    [0112] Bacteria and Archaea are the smallest organisms in soil apart from viruses. Bacteria and Archaea are prokaryotic. All of the other microorganisms are eukaryotic. A prokaryote has a very simple cell structure with no internal organelles. Bacteria and archaea are the most abundant microorganisms in the soil, and serve many important purposes, including nitrogen fixation. B. subtilis is commonly found in the upper layers of the soilthe density of spores found in soil is about 10.sup.6 spores per gram.

    [0113] Fungi

    [0114] Fungi are abundant in soil, but bacteria are more abundant. Fungi are important in the soil as food sources for other, larger organisms, pathogens, beneficial symbiotic relationships with plants or other organisms and soil health. Fungi can be split into species based primarily on the size, shape and color of their reproductive spores, which are used to reproduce. Most of the environmental factors that influence the growth and distribution of bacteria and actinomycetes also influence fungi. The quality as well as quantity of organic matter in the soil has a direct correlation to the growth of fungi, because most fungi consume organic matter for nutrition. Fungi thrive in acidic environments, while bacteria and actinomycetes cannot survive in acid, which results in an abundance of fungi in acidic areas. Fungi also grows well in dry, arid soils because fungi are aerobic, or dependent on oxygen, and the higher the moisture content in the soil, the less oxygen is present for them.

    [0115] Algae

    [0116] Algae can make their own nutrients through photosynthesis. Photosynthesis converts light energy to chemical energy that can be stored as nutrients. For algae to grow, it must be exposed to light because photosynthesis requires light, so algae are typically distributed evenly wherever sunlight and moderate moisture is available. Algae, do not have to be directly exposed to the sun, but can live below the soil surface given uniform temperature and moisture conditions. Algae are also capable of performing nitrogen fixation. Algae can be split up into three main groups: the Cyanophyceae, the Chlorophyceae and the Bacillariaceae. The Cyanophyceae contain chlorophyll that absorbs sunlight and uses that energy to make carbohydrates from carbon dioxide and water and also pigments that make it blue-green to violet in colour. The Chlorophyceae usually only have chlorophyll in it which makes it green, and the Bacillariaceae contain chlorophyll as well as pigments that make the algae brown in colour. Blue-green algae, or Cyanophyceae, are responsible for nitrogen fixation. The amount of nitrogen they fix depends more on physiological and environmental factors rather than the organism's abilities. These factors include intensity of sunlight, concentration of inorganic and organic nitrogen sources and ambient temperature and stability. Chlamydomonas reinhardtii is a single-cell green alga. Chlamydomonas species are widely distributed worldwide in soil and fresh water.

    [0117] Protozoa

    [0118] Protozoa are eukaryotic organisms that were some of the first microorganisms to reproduce sexually, a significant evolutionary step from duplication of spores, like those that many other soil microorganisms depend on. Protozoa can be split up into three categories: flagellates, amoebae and ciliates. Flagellates are the smallest members of the protozoa group, and can be divided further based on whether they can participate in photosynthesis. Nonchlorophyll-containing flagellates are not capable of photosynthesis because chlorophyll is the green pigment that absorbs sunlight. These flagellates are found mostly in soil. Flagellates that contain chlorophyll typically occur in aquatic conditions. Flagellates can be distinguished by their flagella, which is their means of movement. Some have several flagella, while other species only have one that resembles a long branch or appendage. Amoebae are larger than flagellates and move in a different way. Amoebae can be distinguished from other protozoa by their slug-like properties and pseudopodia. A pseudopodia or false foot is a temporary obtrusion from the body of the amoeba that helps pull it along surfaces for movement or helps to pull in food. The amoeba does not have permanent appendages and the pseudopodium is more of a slime-like consistency than a flagellum. Ciliates are the largest of the protozoa group, and move by means of short, numerous cilia that produce beating movements. Cilia resemble small, short hairs. They can move in different directions to move the organism, giving it more mobility than flagellates or amoebae.

    Materials and Methods

    [0119] BLAST Identification of PPN uNLPs

    [0120] The predicted NLP complement of C. elegans [16] was used in a simple BLASTp and tBLASTn analysis of available genomic/transcriptomic sequence data of G. pallida and M. incognita [46, 47]. All returned hits were curated by eye, and NLPs identified as per McVeigh et al. [17].

    [0121] PPN Maintenance

    [0122] M. incognita were maintained in tomato plants (cv. Moneymaker) under greenhouse conditions. 8 weeks post infection M. incognita eggs were harvested from the roots by washing away excess soil and by briefly treating cleaned roots in 5% sodium hypochlorite to soften the root tissue and release the eggs. Eggs were cleaned from debris by passage through nested sieves (180 micron, 150 micron and 38 micron) and washed thoroughly with water. Eggs were separated from remaining soil/silt by centrifugation (2000 rcf for 2 minutes) in 100% sucrose solution and collected in a thin layer of spring water (autoclaved and adjusted to pH 7). Eggs were treated in antibiotic/antimycotic solution (Sigma) overnight, placed in a nylon net with a 38 micron pore size, immersed in spring water and maintained in darkness at 23 C., until infective juveniles emerged. Freshly hatched juveniles were used for each assay.

    [0123] G. pallida were maintained in potato (cv. Cara) at the Agri-Food and Biosciences Institute (AFBI), Belfast. Soil was collected surrounding potato roots, dried for one week and washed through sieves to collect cysts. Cysts were incubated in potato root diffusate in the dark at 17 C. until infective juveniles emerged. Freshly hatched juveniles were used for each assay.

    [0124] PPN uNLP Screen

    [0125] Predicted uNLPs from both M. incognita and G. pallida were synthesised by EZBiolab and dissolved into pH adjusted ddH.sub.2O to make a 5 mM stock which was aliquoted and stored at 20 C. J2s of both M. incognita and G. pallida were incubated for 24 hours in 200 l of each peptide in a 24 well plate (SPL Lifesciences, South Korea) at a defined concentration.

    [0126] PPN uNLP Screen: Chemosensory Assays

    [0127] A 60 mm Petri dish was divided into two segments, a positive and a negative side, with a 0.5 cm dead zone either side of the centre point. The petri dish was filled with 15 ml of 0.25% w/v agar which was allowed to solidify. 3 ml of 0.25% w/v agar slurry in spring water (pH 7, agitated with a magnetic stirrer for several hours to give a smooth consistency) was added to the petri dish and spread evenly over the surface. Root diffusate (attractant) and water only (control) 0.25% agar plugs were embedded in the agar slurry, either side of the assay arena. Root diffusate was collected from 10 tomato plants, aged 3-6 weeks in 1 litre pots, by pouring 500 ml of ddH.sub.2O through the soil three times. Diffusate from each plant was combined, filter sterilised and stored at 4 C. for a maximum of 1 month. Root diffusate agar plugs were made by melting 1.25% agar in ddH.sub.2O, cooling to 50 C. before mixing with 4 parts of root diffusate. The agar was then allowed to solidify at room temperature. 100 uNLP pre-treated M. incognita or G. pallida J2s were added by pipette to the centre of the plate. J2s which moved out of the dead zone after 3 hours were counted and their location (+/) scored. The distribution of J2s were used to create a chemotaxis index [68] for each plate, which formed one replicate, a total of 10 replicates where completed for each uNLP treatment.

    [0128] PPN uNLP Screen: Tomato Invasion Assays

    [0129] Tomato seeds were sterilised with 2.5% NaOCl for 15 minutes, washed 5 times in ddH.sub.2O and germinated on 0.5% Murashige and Skoog plates at 23 C. An agar slurry was prepared by autoclaving 0.55% (w/v) agar (using autoclaved spring water adjusted to pH 7) which was mechanically agitated overnight until it had a smooth consistency. Invasion assays were performed by mixing 500 pre-treated M. incognita or G. pallida J2s with agar slurry and a single tomato seedling (2 days post germination) in a 6 well plate. Assays were left at 23 C. for 24 hours in the case of M. incognita and at 18 C. for 24 hours in the case of G. pallida under a 16 hour light and 8 hour darkness cycle. Seedlings were stained using acid fuschin [69] and the number of nematodes within the roots counted.

    [0130] PPN uNLP Screen: Stylet Thrusting Assays

    [0131] Stylet thrusting assays where performed by incubating 100 M. incognita or G. pallida J2s for 15 minute in 5 mM or 2 mM serotonin (Sigma Aldrich, USA), respectively. J2s were placed on a glass slide and stylet thrusts were counted for randomly selected J2s, for 1 minute each. Counting took place for a maximum of 15 minutes. Longer incubations yielded inconsistent results. At least 30 J2s were counted for each neuropeptide treatment.

    [0132] B. subtilis and C. reinhardtii Plant Protection Assays

    [0133] B. subtilis were grown overnight in LB media containing ampicillin (100 g/ml) at 37 C. with shaking, and harvested in the log phase of growth determined by measuring OD.sub.600nm. Five ml of culture at 0.5 OD was spun down and the pellet mixed with 3 ml of agar slurry and 500 J2s from either G. pallida or M. incognita. C. reinhardtii clones were grown at 23 C. with shaking, cultures in the log phase were measured at OD.sub.750 and 5 ml of culture at 0.5 OD was pelleted by centrifugation. C. reinhardtii pellets were mixed with 3 ml of agar slurry and 500 J2s from either G. pallida or M. incognita. Plant invasion assays were performed as described above.

    [0134] C. elegans Culture and Assays

    [0135] C. elegans wild-type N2 Bristol strain were obtained from the C. elegans Genomics Center and maintained on a Escherichia coli (strain OP50) lawn on nematode growth medium (NGM) agar plates (3 g/l NaCl, 17 g/l agar, 2.5 g/l peptone, 5 mg/l cholesterol, 25 mM KH.sub.2PO.sub.4 (pH 6.0), 1 mM CaCl.sub.2, 1 mM MgSO.sub.4) at 20 C. [70]. Chemotaxis assays were performed in a 9 cm diameter Petri dish on NGM agar which was split into a positive and negative side with a central dead zone of 1.5 cm diameter. 100 mixed-staged C. elegans were washed three times in M9 buffer and soaked in 100 M PPN uNLP, or M9 vehicle control for 24 hours. 2 l of 50 mM sodium acetate, 0.5% pyrazine, 0.5% benzaldehyde or 0.5% diacetyl was spotted onto the positive side, 2 l of ddH.sub.2O was spotted onto the negative side. Pyrazine, benzaldehyde and diacetyl volatile attractants were assayed immediately whereas the water soluble sodium acetate was assayed 18 hours following addition to the plate. Assays were maintained in the dark at 20 C., and counted after 1 hour.

    [0136] S. carpocapsae Culture and Host-Finding Assay

    [0137] S. carpocapsae were cultured in Galleria mellonella at 23 C. Infective juveniles (IJs) were collected using a White trap [71] in PBS. Freshly emerged IJs were used for each assay. 100 IJs were incubated for 24 hours in 100 M of selected uNLPs, and host-finding assays performed as in Morris et al. [45].

    [0138] Construction of uNLP Expression/Secretion Plasmids

    [0139] Codon optimised DNA sequences coding for the desired neuropeptide flanked by restriction sites necessary to clone into the C. reinhardtii expression vector pChlamy_3 (Life Technologies, USA) or the B. subtilits expression vector pBE-S (Clontech, USA) were synthesised by GeneArt Gene Synthesis (Life Technologies, USA).

    [0140] Transformation of C. reinhardtii

    [0141] uNLP secretion inserts, and vector pChlamy_3 were digested using Kpnl/Xbal (New England Biolabs, USA), ligated using T4 ligase (New England Biolabs, USA), and cloned into Escherichia coli One Shot TOP10 chemically competent cells (Life Technologies, USA) following manufacturer's instructions. Ampicillin (Sigma Aldrich, USA) was used to select E. coli containing the pChlamy_3 plasmid, which was subsequently extracted using the High Pure Plasmid Isolation Kit (Roche) and sequenced (Eurofins Genomics, UK) to identify correct clones. C. reinhardtii was transformed by electroporation following manufacturer's instructions (GeneArt Chlamydomonas Engineering Kit, Life Technologies) and individual colonies grown on TAP-Agar-Hygromycin plates (10 g/mL) (Sigma Aldrich, USA) at 23 C. Colonies were picked and grown at 23 C. in 100 ml TAP growth media (Invitrogen, USA) with constant orbital agitation. qRT-PCR was performed to identify clones with the highest level of uNLP expression, which were then selected for downstream assays (pChlamy universal FWD: CACTTTCAGCGACAAACGAG, nlp-15b REV: CTACTAGTCGAGGCCGGTA; Mi-nlp-9f REV: GAACGGGCGGATGAAGTAG).

    [0142] Transformation of B. subtilis

    [0143] uNLP secretion inserts, and vector pBE-S were digested using Xbal/Mlul (New England Biolabs, USA), ligated using T4 ligase (New England Biolabs, USA), and cloned into E. coli One Shot TOP10 chemically competent cells (Life Technologies, USA) following manufacturer's instructions. Ampicillin (Sigma Aldrich, USA) was used to select E. coli containing the pBE-S plasmids, which were subsequently extracted using the High Pure Plasmid Isolation Kit (Roche) and sequenced (Eurofins Genomics, UK) to identify correct clones. B. subtilis RIK1285 competent cells (Takara, USA) were transformed according to manufacturer's instructions and grown overnight at 37 C. on kanamycin selective plates (10 g/mL) (Sigma Aldrich, USA). Individual colonies were picked and grown in LB broth overnight at 37 C. qRT-PCR (pBE-S universal FWD: GGATCAGCTTGTTGTTTGCGT, nlp-15b REV: CCTGGCCCAGTGAAAGAGTC, Mi-nlp-40 REV: TACCGGCTGCCAAGATACCA) was performed to confirm the expression of uNLP secretion cassettes.

    [0144] Statistical Analysis

    [0145] Data pertaining to behavioural and invasion assays were assessed by Brown-Forsythe and Bartlett's tests to examine homogeneity of variance between groups. One-way ANOVA was followed by Fisher's Least Significant Difference (LSD) test. All statistical tests were performed using GraphPad Prism 6.

    Results

    [0146] BLASTp Identification of Predicted NLPs

    [0147] Pro-peptide sequences of C. elegans NLPs predicted to be unamidated (no C-terminal glycine; uNLPs) were used as queries to conduct a BLASTp analysis of the predicted protein complements of both M. incognita and G. pallida [46, 47]. A total of four nlp genes encoding 25 predicted uNLPs were found within the G. pallida genome, and seven nlp genes encoding 28 predicted uNLPs within the M. incognita genome (Table 1).

    TABLE-US-00012 TABLE1 ThepredictedunamidatedNLPcomplementsofGloboderapallidaand Meloidogyneincognita. GloboderapallidaNLPs* MeloidogyneincognitaNLPs* Gp-NLP-8a FSDDELAAMPLNDLYLSSPYAFGPF Mi-NLP-2 SSLASGRIGFRPA Gp-NLP-8b SFDRLEESAFFGQ Mi-NLP-8a AFDRLDVSPFDFDAMT Gp-NLP-14a ALDILESDDFGGF Mi-NLP-8b FNDDELSSLPFNFEYFPSLDTH Gp-NLP-14b ALDVMDGDGFGSFE Mi-NLP-8c AFDRLEDSGFFGL Gp-NLP-14c ALDTLEGDDFMGL Mi-NLP-8d AFDRLDNSFMLL Gp-NLP-14d LNELEGDGFMGLD Mi-NLP-9a AGARAFQRPDFDDASYEL Gp-NLP-14e ALDILDGDDFTGFS Mi-NLP-9b GGARTFLVGE Gp-NLP-14f ALDALEGNSFGF Mi-NLP-9c GGARAFAKLEE Gp-NLP-15a SFDSLTGPGFTGLDT Mi-NLP-9d GGARPFYEE Gp-NLP-15b SFDSFTGPGFTGLD Mi-NLP-9e GGARPFYGFFGGGEGTW Gp-NLP-15c SFDSFTGSGFTGLD Mi-NLP-9f GGGRYFIRPFADQ Gp-NLP-15d AAFDTDFTNYD Mi-NLP-14a ALDMLEGDDFIGMQ Gp-NLP-15e FEPFDGYGFNGFE Mi-NLP-14b ALDLMEGDGFGGGFD Gp-NLP-15f SFDSFMGPGFTGMD Mi-NLP-14c ALDMMEGDDFIGL Gp-NLP-15g AFDSFTGPGFTGMD Mi-NLP-15a AFDSFGTPGFTGFD Gp-NLP-15h AFDLFTGPGFTGMD Mi-NLP-15b SFDSFTGPGFTGLD Gp-NLP-21a GGARAFNFFAPPDE Mi-NLP-15c SFDSFVGKGFTGMD Gp-NLP-21b GGARAFNFFAPDE Mi-NLP-15d AFDSFGTPGFTGFD Gp-NLP-21c GGTRAFNFFVSDALPSSYE Mi-NLP-15e SAFDSFVGRGFTGMD Gp-NLP-21d SGIQTFRDDYDEKQAGEL Mi-NLP-15f AFDSFAGNGFTGFD Gp-NLP-21e AGGRLFRMVDLPDGDDFVPEG Mi-NLP-15g NFDAFMGPGFTGLD Gp-NLP-21f GGARPFYGGGYMDGTW Mi-NLP-15h AAFDSFVGRGFTGMD Gp-NLP-21g AGGRYFMRHFDDSPFAGWMA Mi-NLP-18a FAPRQFAFA Gp-NLP-21h GGARAFFGDADGPFNSASYWAP Mi-NLP-18b GMRNFAFA Gp-NLP-21i GGARAFNGAEETLLNVANLA Mi-NLP-18c SFGDYPFGSRTFAFA Mi-NLP-18d AAENFDENNDIN Mi-NLP-18e SSQFGGENSFARFAFA Mi-NLP-40 MVSWQPV *, single letter annotation of amino acids.

    [0148] uNLPs Dysregulate Key Behaviours of M. incognita J2s

    [0149] Predicted uNLPs were synthesised and screened against M. incognita and G. pallida J2s for plant protective qualities. Chemotaxis, host-invasion, and stylet thrusting behaviours were assayed following J2 exposure to 100 M of each uNLP for 24 h. Eleven of 27 tested uNLPs were found to disrupt normal chemotaxis towards root exudate: Mi-NLP-8a (Cl: 0.018+/0.3438, p=0.0416), Mi-NLP-15a (Cl: 0.01067+/0.06497, p=0.0299), Mi-NLP-15e (Cl: 0.01767+/0.09428, p=0.0275), Mi-NLP-40 (Cl: 0.04+/0.04726, p=0.021), Mi-NLP-15f (Cl: 0.05+/0.3547, p=0.0185), Mi-NLP-9b (Cl: 0.07417+/0.154, p=0.001), Mi-NLP-14b (Cl: 0.1155+/0.1472, p=0.0004), Mi-NLP-18a (Cl: 0.1353+/0.1129, p=0.006), Mi-NLP-9f (Cl: 0.26+/0.224, p<0.0001), Mi-NLP-15b (Cl: 0.3408+/0.2207, p<0.0001), Mi-NLP-15c (Cl: 0.359+/0.277, p=0.0002) (FIG. 1A).

    [0150] Likewise, 13 uNLPs were also found to disrupt M. incognita host invasion compared to controls: Mi-NLP-8b (61.38%+/11.56, p=0.0113), Mi-NLP-9e (48.68%+/10.87, p=0.0022), Mi-NLP-18b (47.81%+/6.008, p=0.0019), Mi-NLP-18e (46.49%+/7.391, p=0.0014), Mi-NLP-9a (45.59%+/22.97, p=0.0039), Mi-NLP-14a (44.61%+/12.25, p=0.0033), Mi-NLP-15e (38.71%+/5.963, p=0.0003), Mi-NLP-18d (34.21%+/12, p=0.0001), Mi-NLP-15b (32.22%+/8.122, p<0.0001), Mi-NLP-8d (29.31%+/12.57, p<0.0001), Mi-NLP-9f (28.22%+/5.253, p<0.0001), Mi-NLP-18a (25.88%+/8.695, p<0.0001), Mi-NLP-14c (20.96%+/11.12, p<0.0001) (FIG. 1B).

    [0151] Eleven uNLPs were also found to disrupt the rate of serotonergic-induced M. incognita stylet thrusting (positively or negatively) compared with controls: Mi-NLP-40 (210%+/21.35, p<0.0001), Mi-NLP-18c (175.5%+/20.72, p<0.0001), Mi-NLP-2 (164.4%+/20.3, p<0.0001), Mi-NLP-18d (147.7%+/16.05, p<0.0001), Mi-NLP-18b (146.6%+/7.609, p=0.0002), Mi-NLP-9c (143.2%+/9.878, p=0.0005), Mi-NLP-14c (134.7%+/19.51, p=0.0053), Mi-NLP-15b (129.9%+/10.59, p=0.0159), Mi-NLP-8a (126.1%+/9.278, p=0.0359), Mi-NLP-15f (75.18%+/9.199, p=0.0456), Mi-NLP-14a (61.6%+/7.86, p=0.002) (FIG. 1C).

    [0152] uNLPs Dysregulate Key Behaviours of G. pallida J2s

    [0153] 12 of 25 tested uNLPs were found to disrupt chemotaxis of G. pallida J2s towards root exudate: Gp-NLP-21f (Cl: 0.1456+/0.1232, p=0.0317), Gp-NLP-21g (Cl: 0.01357+/0.1854, p=0.0248), Gp-NLP-21h (Cl: 0.01564+/0.08072, p=0.0488), Gp-NLP-15b (Cl: 0.04762+/0.1983, p=0.0345), Gp-NLP-14e (Cl: 0.0641+/0.2329, p=0.0026), Gp-NLP-15h (Cl: 0.06784+/0.1415, p=0.0052), Gp-NLP-21b (Cl: 0.117 +/0.1936, p=0.0008), Gp-NLP-15a (Cl: 0.1451 +/0.221, p=0.0035), Gp-NLP-21i (Cl: 0.1733 +/0.02667, p=0.0074), Gp-NLP-15g (Cl: 0.2208 +/0.1568, p=0.001), Gp-NLP-15c (Cl: 0.227+/0.0776, p=0.0002), Gp-NLP-14a (Cl: 0.3765+/0.1039, p<0.0001), Gp-NLP-21e (Cl: 0.3804+/0.2762, p<0.0001) (FIG. 2A).

    [0154] Five uNLPs disrupt G. pallida host invasion relative to controls: Gp-NLP-21d (2.01%+/1.545, p=0.004), Gp-NLP-21c (14.07%+/4.655, p=0.0115), Gp-NLP-21a (178.9%+/48.52, p=0.0201), Gp-NLP-21b (6.897%+/3.855, p=0.0086), Gp-NLP-21g (214.8%+/30.31, p=0.0012) (FIG. 2B).

    [0155] Three uNLPs were also found to modulate serotonergic-induced stylet thrusting of G. pallida J2s relative to controls groups: Gp-NLP-21 i (117.7%+/4.497, p=0.0302), Gp-NLP-21 h (116.8%+/4.876, p=0.0046), Gp-NLP-15c (56.07%+/9.441, p<0.0001) (FIG. 2C).

    [0156] Mi-NLP-15b Inhibits M. incognita Chemotaxis and Host Invasion with High Potency

    [0157] The potency of Mi-NLP-15b-induced disruption of chemotaxis and host invasion was assessed by exposing M. incognita J2s to various concentrations of synthetic Mi-NLP-15b for 24 h. Normal chemotaxis of M. incognita towards root exudate was inhibited across a range of dilutions, indicating high potency: 100 M, (Cl: 0.3782+/0.07224, p=0.0031), 10 M, (Cl: 0.03579+/0.1504, p=0.0025), 1 M, (Cl: 0.1344+/0.1733, p=0.001), 100 nM, (Cl: 0.1195+/0.1968, p=0.0014), 10 nM, (Cl: 0.1741+/0.1724, p=0.0055), 1 nM, (Cl: 0.07105+/0.1534, p=0.0035), 100 pM, (Cl: 0.03117+/0.1594, p=0.0202), 10 M, (Cl: 0.1553+/0.2642, p=0.0037) (FIG. 3A). We found that M. incongita J2 invasion was also inhibited across a range of Mi-NLP-15b concentrations: 100 M, (35.06%+/6.407, p<0.0001), 10 M, (54.62%+/8.362, p=0.0002), 1 M, (59.05%+/8.545, p=0.0036), 100 nM, (69.9%+/10.66, p=0.0295) (FIG. 3B).

    [0158] Transgenic Microbes Secreting uNLPs Protect Plants from PPN Invasion

    [0159] Innoculation of C. reinhardtii cultures secreting selected uNLPs into the tomato invasion assay arena inhibited M. incognita invasion relative to untransformed C. rehinhardtii: Mi-NLP-9f (10.32%+/10.32, p<0.0001), Mi-NLP-15b (10.82%+/6.574, p<0.0001) (FIG. 4A). Likewise, innoculation of B. subtilis cultures secreting selected uNLPs, significantly inhibited M. incognita invasion: Mi-NLP-15b (26.63%+/8.12, p=0.0003), Mi-NLP-40 (23.72%+/5.448, p=0.0002) (FIG. 4B). C. reinhardtii expressing Gp-NLP-15b also inhibited G. pallida invasion relative to controls (30.95%+/9.021, p=0.0042) (FIG. 4C). Similarly, innoculation with B. subtilis secreting Gp-NLP-15b inhibited G. pallida invasion relative to control groups (51.98%+/13.29), p=0.0203 (FIG. 4D).

    [0160] PPN uNLPs do not Alter Behaviours of Non-Target Nematodes

    [0161] BLAST was used to identify NLP-15b homologues across available expressed sequence tags (ESTs) or genomes of PPNs and non-target nematode species. PPNs with diverse life history traits share high levels of NLP-15b sequence similarity, however sequence similarity is reduced in non-target nematode species (Table 2).

    TABLE-US-00013 TABLE2 SequencealignmentofNLP-15binselected parasiticnematodespeciesandthefree livingnematodeC.elegans. NematodeSpecies NLP-15bsequence* Meloidogyneincognita SFDSFTGPGFTGLD Meloidogynejavanica SFDSFTGPGFTGLD Meloidogynehapla SFDSFTGPGFTGLD Meloidogynechitwoodi SFDSFMGPGFTGLD Globoderapaffida SFDSFTGPGFTGLD Globoderarostochiensis SFDSFTGPGFTGLD Heteroderaglycines SFDSFTGPGFTGLD Pratylenchuspenetrans SFDSFMGPGFTGLD Radopholussimilis SFDSFMGPGLTGLD Steinememacarpocapsae AFDSFMGSGFTGMD Pristionchuspacifius SFDTFGGVRFSPLE Caenorhabditiselegans AFDSLAGSGFGAFN *, single letter annotation of amino acids.

    [0162] Incubation of mixed-stage C. elegans in selected PPN uNLPs (100 M, 24 h) had no statistically significant impact on chemotaxis towards: (i) sodium acetate. Mi-NLP-9f (Cl: 0.5261+/0.064, p=0.4164), Mi/Gp-NLP-15b (Cl: 0.3142+/0.039, p=0.3578) or Mi-NLP-40 (Cl: 0.4820+/0.115, p=0.6485) relative to control groups (Cl: 0.4269+/0.094), (FIG. 5A); (ii) pyrazine. Mi-NLP-9f (Cl: 0.4599+/0.087, p=0.8094), Mi/Gp-NLP-15b (Cl: 0.4959+/0.089, p=0.9648) or Mi-NLP-40 (Cl: 0.5018+/0.039, p=0.9282) relative to controls (Cl: 0.4904+/0.116) (FIG. 5B); (iii) benzaldehyde. Mi-NLP-9f (Cl: 0.7463+/0.047, p=0.6416), Mi/Gp-NLP-15b (Cl: 0.7032+/0.075, p=0.9952) or Mi-NLP-40 (Cl: 0.6686+/0.065, p=0.7172) relative to controls (Cl: 0.7026+/0.072) (FIG. 5C); (iv) diacetyl. Mi-NLP-9f (Cl: 0.6+/0.092, p=0.5739), Mi/Gp-NLP-15b (Cl: 0.6640+/0.126, p=0.9987) or Mi-NLP-40 (Cl: 0.5858+/0.097, p=0.6454) relative to controls (Cl: 0.6638+/0.064) (FIG. 5D). Exposure of S. carpocapsae infective juveniles (IJs) to selected PPN uNLPs also had no statistically significant impact on insect host-finding: control (Cl: 0.2315+/0.068); Mi-NLP-9f (Cl: 0.2462+/0.070, p=0.8784); Mi/Gp-NLP-15b (Cl: 0.2225+/0.043, p=0.9249); or, Mi-NLP-40 (Cl: 0.3057+/0.082, p=0.4422) (FIG. 5E).

    [0163] Discussion

    [0164] We have identified seven nlp genes which putatively encode 27 mature unamidated peptides in the root knot nematode, M. incognita. Likewise, four nlp genes predicted to encode 24 mature unamidated peptides were identified in the potato cyst nematode, G. pallida (Table 1). Several predicted unamidated NLPs share high levels of amino acid sequence similarity between M. incognita and G. pallida, with one predicted peptide, designated NLP-15b, perfectly conserved between the two. Indeed, NLP-15b is highly conserved at the sequence level across PPN species with diverse life history traits; less sequence similarity is observed between NLP-15b from PPNs and non-target species such as S. carpocapsae, C. elegans or P. pacificus for example (see Table 2).

    [0165] Selected M. incognita and G. pallida peptides had a negative impact on PPN chemosensation and host-finding behaviours, but not on chemosensory or host-finding behaviours of mixed stage C. elegans or S. carpocapsae infective juveniles (FIG. 1, 2, 5). This may be due to NLP sequence dissimilarity, or to different peptide uptake efficiencies between species. The attractants used to assay C. elegans chemotaxis operate via distinct neuroanatomical and biochemical pathways; sodium acetate is detected by the ASE neurons, benzaldehyde by the AWC neurons and prazine and diacetyl are both detected by the AWA neuron [48, 49]. Off-target NLP impacts were also assessed as a factor of host-finding ability in S. carpocapsae which will involve numerous neuroanatomical and biochemical pathways. Whilst these data on C. elegans and S. carpocapsae are far from exhaustive, they suggest that neuropeptide treatments which produce strong disruptive effects on the behaviours of M. incognita and G. pallida may be specific to PPNs.

    [0166] Whilst it is tempting to extrapolate something on native NLP functionality from these data, we do not know if the aberrant phenotypes observed are due to interactions between tested NLPs and their cognate receptors. However, we do observe that exogenous NLPs can interact with endogenous neurophysiological circuits, interfering with host-finding, invasion and serotonergic stylet-thrusting behaviours of both M. incognita and G. pallida juveniles (FIG. 1, 2). This supports our initial hypothesis that nematode neuropeptides represent a valuable repository of nematicide candidates, which may elicit broad-spectrum activities against PPN species, but not off-target nematode species. Serial dilution of Mi-NLP-15b inhibited M. incognita chemosensation at concentrations as low as 10 pM, demonstrating high uNLP potency, which is a known characteristic of interactions between nematode neuropeptides and their cognate receptors [13, 25-30, 50, 51] (FIG. 3). While the potency of this peptide would support the specificty of the associated phenotypic impact, we advise some caution when interpreting these data as indicative of NLP function within either M. incognita or G. pallida J2s due to the potential for peptide interaction with other, non-cognate receptors.

    [0167] In order to further assess the efficacy of exogenous NLPs as nematicides, we developed two transgenic synthesis and delivery systems which could be deployed in field, potentially through seed treatments or soil amendments. Gram positive Bacillus spp. are a major component of rhizosphere microbial communities [52, 53], and are frequently categorised as Plant Growth Promoting Rhizobacteria (PRPR) [54, 55]; B. subtilis has also been shown effective in controlling Meloidogyne species [56]. More generally, B. subtilis represents an important organism for many biotechnology applications, and is classified as GRAS (generally regarded as safe) by the FDA [57, 58]. It is increasingly well served by the development of synthetic biology tools [59], and can persist in soil for long periods through the production of spores [60]. We modified B. subtilis to secrete a number of PPN NLPs, and found that transformed B. subtilis cultures confer significant levels of protection on tomato cv. Moneymaker against both M. incognita and G. pallida infective juveniles (FIG. 4). This proof of concept demonstration employed a commercial B. subtilis strain and signal peptide sequence. It has however been reported that signal peptide identity can have a significant influence on the level of protein/peptide secreted by B. subtilis [61, 62]. We anticipate that signal peptide optimisation efforts could increase plant protection levels. Likewise, assessing other rhizobacteria strains may enhance efficacy. The secretion of uNLP nematicides could also be more targeted if driven by a plant root exudate-responsive promoter [63, 64, 65, 66].

    [0168] We also utilised the soil-dwelling microalgae, C. reinhardtii as a novel synthesis and delivery platform. Like B. subtilis, C. reinhardtii benefits from an improving suite of synthetic biology tools [67]. C. reinhardtii cultures secreting selected PPN NLPs also provided significant levels of protection to tomato cv. Moneymaker when challenged by either M. incognita or G. pallida infective juveniles (FIG. 4).

    [0169] The NLP screening approach employed here may underestimate the efficacy achievable through a continuous transgenic delivery (FIGS. 1, 2). For example, exogenous NLP-15b exposure inhibits G. pallida chemotaxis, but does not inhibit host invasion (FIG. 2). However, when NLP-15b is delivered continuously to G. pallida infective juveniles via microbial secretion, we observe a significant inhibition of tomato invasion relative to J2s exposed to unmodified B. subtilis (FIG. 4). This discrepency may be due to the recovery of G. pallida infective juveniles over the 24 hour timecourse of the tomato invasion assay. We expect that this may result in some false negative determinations in our NLP pre-screening approach.

    [0170] Our data demonstrate that unamidated NLPs represent a new class of potent and specific plant protective nematicide which could be deployed as a transgenic trait in crop plants, or through soil microorganisms such as the B. subtilis and C. reinhardtii systems developed here. In particular, these non-crop delivery approaches could facilitate rapid deployment to many different crop plant species and cultivars. A key consideration in the development of PPN resistance traits must be the maintenance of genetic diversity across crop cultivars and isolates. This reduces the chance of widespread pathology from other pests as a result of genetic bottlenecks introduced by a single preferred transgenic cultivars.

    REFERENCES

    [0171] 1. Jones J T, Haegeman A, Danchin E G J, Gaur H S, Helder J, Jones M G K, Kikuchi T, Manzanilla-Lopez R, Palomares-Ruis J E, Wesemael W M L, Perry R N. Top 10 plant-parasitic nematodes in molecular plant pathology. Molecular Plant Pathology. 2013; 14(9): 946-961.

    [0172] 2. Nicol J M, Stirling G R, Turner S J, Coyne D L, de Nijs L, Hockland S, Maafi Z T. Current nematode threats to world agriculture. Genomics and Molecular Genetics of Plant-Nematode Interactions (Jones J T, Gheysen G, Fenoll C., eds). Heidelberg: Springer. 2011; pp. 21-44

    [0173] 3. Council of the European Union. 1991. Council Directive 91/414/EEC of 15 Jul. 1991 concerning the placing of plant protection products on the market. Official Journal. 2005; L 230: 1-32.

    [0174] 4. UNEP. Montreal protocol on substances that deplete the ozone layer. 2014 report of the methyl bromide technical options committee. 2015; p 13. ISBN: 978-9966-076-08-3.

    [0175] 5. Babich H, Davis D L, Stotzky G. Dibromochloropropane (DBCP): a review. The Science of Total Environment. 1981; 17: 207-221.

    [0176] 6. Lilley C J, Urwin P E, Johnston K A, and Atkinson H J. Preferential expression of a plant cystatin at nematode feeding sites confers resistance to Meloidogyne incognita and Globodera pallida. Plant Biotechnology Journal. 2004; 2(1): 3-12

    [0177] 7. Liu B, Hibbard J K, Urwin P E, Atkinson H J. The production of synthetic chemodisruptive peptides in planta disrupts the establishment of cyst nematodes. Plant Biotechnology Journal. 2005; 3(5): 487-96.

    [0178] 8. Green J, Wang D, Lilley C J, Urwin P E, Atkinson H J. Transgenic Potatoes for Potato Cyst Nematode Control Can Replace Pesticide Use without Impact on Soil Quality. Plos One. 2012; 7(2): e30973

    [0179] 9. Tripathi L, Babirye A, Roderick H, Tripathi J N, Changa C, Urwin P E, Tushemereirwe W K, Coyne D, Atkinson H J. Field resistance of transgenic plantain to nematodes has potential for future African food security. Nature, Scientific Reports 5, Article number: 8127. 2014.

    [0180] 10. Kyndt T, Ji H, Vanholme B, Gheysen G. Transcriptional silencing of RNAi constructs against nematode genes in Arabidopsis. NEMATOLOGY. 2013; 15(5):519-28.

    [0181] 11. Wang D, Jones L M, Urwin P E and Atkinson H J. A Synthetic Peptide Shows Retro- and Anterograde Neuronal Transport before Disrupting the Chemosensation of Plant-Pathogenic Nematodes. PLoS ONE. 2011; 6 (3): e17475

    [0182] 12. Maule A G, Geary T G, Bowman J W, Marks N J, Blair K L, Halton D W, Shaw C, Thompson D P. Inhibitory effects of nematode FMRFamide-related peptides (FaRPs) on muscle strips from Ascaris suum. Invertebrate Neuroscience. 1995; 1(3): 255-265.

    [0183] 13. Moffett C L, Beckett A M, Mousley A, Geary T G, Marks N J, Halton D W, Thompson D P, Maule A G. The ovijector of Ascaris suum: Multiple response types revealed by Caenorhabditis elegans FMRFamide-related peptides. International Journal of Parasitology. 2003; 33(8): 859-876.

    [0184] 14. McVeigh P, Geary T G, Marks N J, Maule A G. The FLP-side of nematodes. Trends in Parasitology. 2006; 22(8): 385-96.

    [0185] 15. Kimber M J, McKinney S, McMaster S, Day T A, Fleming C C, Maule A G. flp gene disruption in a parasitic nematode reveals motor dysfunction and unusual neuronal sensitivity to RNA interference. The Federation of American Societies for Experimental Biology Journal. 2007; 21(4):1233-43.

    [0186] 16. Li C, and Kim K. 2008. Neuropeptides. The C. elegans Research Community, WormBook.

    [0187] 17. McVeigh P, Alexander-Bowman S, Veal E, Mousley A, Marks N J, Maule A G. Neuropeptide-like protein diversity in phylum Nematoda. International Journal for Parasitology. 2008; 38(13): 1493-1503.

    [0188] 18. Marks N J, Maule A G. Neuropeptides in helminths: Occurrence and distribution. Advances in Experimental Medicine and Biology. 2010; 692: 49-77.

    [0189] 19. McVeigh P, Atkinson L, Marks N J, Mousley A, Dalzell J J, Sluder A, Hammerland L, Maule A G. Parasite neuropeptide biology: Seeding rational drug target selection? International Journal for Parasitology: Drugs and Drug Resistance. 2012; (2): 76-91.

    [0190] 20. Atkinson L E, Stevenson M, McCoy C J, Marks N J, Fleming C, Zamanian M, Day T A, Kimber M J, Maule A G, Mousley A. flp-32 Ligand/receptor silencing phenocopy faster plant pathogenic nematodes. PLoS Pathogens. 2013; 9(2):e1003169.

    [0191] 21. Peymen K, Watteyne J, Frooninckx L, Schoofs L, Beets I. The FMRFamide-Like Peptide Family in Nematodes. Frontiers in Endocrinology. 2014; 16; 5: 90.

    [0192] 22. Geary T G and Maule A G. Neuropeptide Systems as Targets for Parasite and Pest Control. Advances in Experimental Medicine and Biology. 2011; 692: v-vi.

    [0193] 23. Lee D J. The Biology of Nematodes. 2002.

    [0194] 24. Kimber M J, Fleming C C, Priord A, Jones J T, Halton D W, Maule A G. Localisation of Globodera pallida FMRFamide-related peptide encoding genes using in situ hybridisation. International Journal for Parasitology. 2002; 32(9): 1095-1105.

    [0195] 25. Fellowes R A, Maule A G, Marks N J, Geary T G, Thompson D P, Shaw C, Halton D W. Modulation of the motility of the vagina vera of Ascaris suum in vitro by FMRF amide-related peptides. Parasitology. 1998; 116: 277-287.

    [0196] 26. Bowman J W, Friedman A R, Thompson D P, Maule A G, Alexander-Bowman S J, and Geary T G. Structure-activity relationships of an inhibitory nematode FMRFamide-related peptide, SDPNFLRFamide (PF1), on Ascaris suum muscle. International Journal of Parasitology. 2002; 32: 1765-1771.

    [0197] 27. Kubiak T M, Larsen M J, Nulf S C, Zantello M R, Burton K J, Bowman J W, Modric T, and Lowery, D E. Differential activation of social and solitary variants of the Caenorhabditis elegans G protein-coupled receptor NPR-1 by its cognate ligand AF9. The Journal of Biological Chemistry. 2003; 278: 33724-33729.

    [0198] 28. Kubiak T M, Larsen M J, Zantello M R, Bowman J W, Nulf S C, and Lowery D E. Functional annotation of the putative orphan Caenorhabditis elegans G-protein-coupled receptor C1006.2 as a FLP15 peptide receptor. The Journal of Biological Chemistry. 2003; 278: 42115-42120.

    [0199] 29. Trailovic S M, Clark C L, Robertson A P, and Martin R J. Brief application of AF2 produces long lasting potentiation of nAChR responses in Ascaris suum. Molecular and Biochemical Parasitology. 2005; 139: 51-64.

    [0200] 30. Mertens I, Clinckspoor I, Janssen T, Nachman R, and Schoofs L. FMRFamide-related peptide ligands activate the Caenorhabditis elegans orphan GPCR Y59H11AL.1. Peptides. 2006; 27: 1291-1296

    [0201] 31. Mousley A, Maule A G, Halton D W, Marks N J. Inter-phyla studies on neuropeptides: the potential for broad-spectrum anthelmintic and/or endectocide discovery. Parasitology. 2005; 131: 143-67.

    [0202] 32. McVeigh P, Leech S, Mair G R, Marks N J, Geary T G, and Maule A G. Analysis of FMRFamide-like peptide (FLP) diversity in phylum Nematoda. International Journal of Parasitology. 2005; 35: 1043-1060.

    [0203] 33. Holden-Dye L, and Walker R J. Anthelmintic drugs. The C. elegans Research Community, WormBook. 2007.

    [0204] 34. James C E, Hudson A L, Daveyemail M W. Drug resistance mechanisms in helminths: is it survival of the fittest? Trends in Parasitology. 2009; 25(7), 328-335.

    [0205] 35. Kodama E, Kuhara A, Mohri-Shiomi A, Kimura K D, Okumura M, Tomioka M, lino Y, and Mori I. Insulin-like signaling and the neural circuit for integrative behavior in C. elegans. Genes and Development. 2006; 20: 2955-2960.

    [0206] 36. Duret L, Guex N, Peitsch M C, Bairoch A. New insulin-like proteins with atypical disulfide bond pattern characterized in Caenorhabditis elegans by comparative sequence analysis and homology modeling. Genome Research. 1998; 8: 348-353.

    [0207] 37. Gregoire F M, Chomiki N, Kachinskas D, Warden C H. Cloning and developmental regulation of a novel member of the insulin-like gene family in Caenorhabditis elegans. Biochemical and Biophysical Research Communications. 1998; 249(2): 385-390.

    [0208] 38. Smit A B, van Kesteren R E, Li KW, Van Minnen J, Spijker S, Van Heerikhuizen H, Geraerts W P. Towards understanding the role of insulin in the brain: Lessons from insulin-related signaling systems in the invertebrate brain. Progress in Neurobiology. 1998; 54:35-54.

    [0209] 39. Kawano T, Ito Y, Ishiguro M, Takuwa K, Nakajima T, Kimura Y. Molecular cloning and characterization of a new insulin/IGF-like peptide of the nematode Caenorhabditis elegans. Biochemical and Biophysical Research Communications. 2000; 273: 431-436.

    [0210] 40. Pierce, S B, Costa M, Wisotzkey R, Devadhar S, Homburger S A, Buchman A R, Ferguson K C, Heller J, Platt D M, Pasquinelli A A, Liu L X, Doberstein S K and Ruvkun G. Regulation of DAF-2 receptor signaling by human insulin and ins-1, a member of the unusually large and diverse C. elegans insulin gene family. Genes and Development. 2001; 15: 672-678.

    [0211] 41. Nathoo A N, Moeller R A, Westlund B A, and Hart A C. Identification of neuropeptide-like protein gene families in Caenorhabditis elegans and other species. Proceedings of the National Academy of Sciences. 2001; 98: 14000-14005.

    [0212] 42. Li W, Kennedy S G, and Ruvkun G. daf-28 encodes a C. elegans insulin superfamily member that is regulated by environmental cues and acts in the DAF-2 signaling pathway. Genes and Development. 2003; 17: 844-858.

    [0213] 43. Kim K, and Li C. Expression and regulation of an FMRFamide-related neuropeptide gene family in Caenorhabditis elegans. The Journal of Comparative Neurobiology. 2004; 475: 40-550.

    [0214] 44. Atkinson L E, Miskelly I R, Moffett C L, McCoy C J, Maule A G, Marks N J, Mousley A. Unraveling flp-11/flp-32 dichotomy in nematodes. International Journal of Parasitology. 2016; 46(11): 723-36.

    [0215] 45. Morris R, Wilson L, Warnock N D, Carrizo D, Cox D, Sturrock M, McGrath K, Maule A G, Dalzell J. A neuropeptide modulates sensory perception in the entomopathogenic nematode Steinernema carpocapsae. 2016; bioRxiv doi: http://dx.doi.orq/10.1101/061101

    [0216] 46. Abad P, Gouzy J, Aury J M, Castagnone-Sereno P, Danchin E G, Deleury E, Perfus-Barbeoch L, Anthouard V, Artiguenave F, Blok V C, Caillaud M C, Coutinho P M, Dasilva C, De Luca F, Deau F, Esquibet M, Flutre T, Goldstone J V, Hamamouch N, Hewezi T, Jaillon O, Jubin C, Leonetti P, Magliano M, Maier T R, Markov G V, McVeigh P, Pesole G, Poulain J, Robinson-Rechavi M, Sallet E, Sgurens B, Steinbach D, Tytgat T, Ugarte E, van Ghelder C, Veronico P, Baum T J, Blaxter M, Bleve-Zacheo T, Davis E L, Ewbank J J, Favery B, Grenier E, Henrissat B, Jones J T, Laudet V, Maule A G, Quesneville H, Rosso M N, Schiex T, Smant G, Weissenbach J, Wincker P. Genome sequence of the metazoan plant-parasitic nematode Meloidogyne incognita. Nature Biotechnology. 2008; 26(8): 909-15.

    [0217] 47. Cotton J A, Lilley C J, Jones L M, Kikuchi T, Reid A J, Thorpe P, Tsai I J, Beasley H, Blok V, Cock P J A, Akker S E, Holroyd N, Hunt M, Mantelin S, Naghra H, Pain A, Palomares-Rius J E, Zarowiecki M, Berriman M, Jones J T, and Urwin P E. The genome and life-stage specific transcriptomes of Globodera pallida elucidate key aspects of plant parasitism by a cyst nematode. Genome Biology. 2014; 15(3): R43.

    [0218] 48. Bargmann C I, Hartwieg E, and Horvitz H R. Odorant-selective genes and neurons mediate olfaction in C. elegans. Cell. 1993; 74: 515-527.

    [0219] 49. Bargmann C I. Chemosensation in C. elegans. The C. elegans Research Community, WormBook. 2006.

    [0220] 50. Maule A G, Shaw C, Bowman J W, Halton D W, Thompson D P, Thim L, Kubiak T M, Martin R A, Geary T G. Isolation and preliminary biological characterization of KPNFIRFamide, a novel FMRFamide-related peptide from the free-living nematode, Panagrellus redivivus. Peptides. 1995; 16(1): 87-93.

    [0221] 51. Davis R E, Stretton A O. Structure-activity relationships of 18 endogenous neuropeptides on the motor nervous system of the nematode Ascaris suum. Peptides. 2001 ; 22(1):7-23.

    [0222] 52. Hirooka K. Transcriptional response machineries of Bacillus subtilis conducive to plant growth promotion. Bioscience, Biotechnology, and Biochemistry. 2014; 78(9): 1471-1484.

    [0223] 53. Fall R, Kinsinger R F, Wheeler K A. A simple method to isolate biofilm-forming Bacillus subtilis and related species from plant roots. Systematic and Applied Microbiology. 2004; 27(3): 372-379.

    [0224] 54. Compant S, Duffy B, Nowak J, Clement C, Barka E A. Use of plant growth-promoting bacteria for biocontrol of plant diseases: principles, mechanisms of action, and future prospects. Applied and Environmental Microbiology 71(9): 4951-4959.

    [0225] 55. Vessey J K. Plant growth promoting rhizobacteria as biofertilizers. Plant and Soil. 2003; 255(2): 571-586.

    [0226] 56. Wepuhkhulu M, Kimenju J, Anyango B, Wachira P and Kyallo G. Effect of soil fertility management practices and Bacillus subtilis on plant parasitic nematodes associated with common bean, Phaseolus vulgaris. Tropical and Subtropical Agroecosystems. 2011; 13: 27-34.

    [0227] 57. Van Dijl J M, Hecker M. Bacillus subtilis: from soil bacterium to super-secreting cell factory. Microbial Cell Factories. 2013; 12:3.

    [0228] 58. Das K, Mukherjee A K. Crude petroleum-oil biodegradation efficiency of Bacillus subtilis and Pseudomonas aeruginosa strains isolated from a petroleum-oil contaminated soil from North-East India. Bioresource Technology. 2004; 98(7): 1339-1345.

    [0229] 59. Guiziou S, Sauveplane V, Chang H J, Clert C, Declerck N, Jules M, Bonnet J. A part toolbox to tune genetic expression in Bacillus subtilis. Nucleic Acids Research. 2016; 44(15): 7495-508.

    [0230] 60. Wood J P, Meyer K M, Kelly T J, Choi Y W, Rogers J V, Riggs K B, and Willenberg Z J. Environmental Persistence of Bacillus anthracis and Bacillus subtilis Spores. PLoS One 2015; 10(9): e0138083.

    [0231] 61. Brockmeier U, Caspers M, Freudl R, Jockwer A, Noll T, Eggert T. Systematic screening of all signal peptides from Bacillus subtilis: a powerful strategy in optimizing heterologous protein secretion in Gram-positive bacteria. Journal of Molecular Biology. 2006; 362: 393-402.

    [0232] 62. Degering C, Eggert T, Puls M, Bongaerts J, Evers S, Maurer K H, Jaeger K H. Optimization of protease secretion in Bacillus subtilis and Bacillus licheniformis by screening of homologous and heterologous signal peptides. Applied and Environmental Microbiology. 2010; 76(19): 6370-6376.

    [0233] 63. Dunn A K, Klimowicz A K, and Handelsman J. Use of a Promoter Trap To Identify Bacillus cereus Genes Regulated by Tomato Seed Exudate and a Rhizosphere Resident, Pseudomonas aureofaciens. Applied and Environmental Microbiology. 2003; 69(2): 1197-1205.

    [0234] 64. Xie S, Wu H, Chen L, Zang H, Xie Y, and Gao X. Transcriptome profiling of Bacillus subtilis OKB105 in response to rice seedlings. BMC Microbiology. 2015; 15(1): 21.

    [0235] 65. Zhang N, Yang D, Wang D, Miao Y, Shao J, Zhou X, Xu Z, Li Q, Feng H, Li S, Shen Q, and Zhang R. Whole transcriptomic analysis of the plant-beneficial rhizobacteriurn Bacillus amyloliquefaciens SQR9 during enhanced biofilm formation regulated by maize root exudates. BMC Genomics. 2015; 16(1): 685.

    [0236] 66. Xie S, Wu H, Chen L, Zang H, Xie y, and Gao X. Transcriptome profiling of Bacillus subtilis OKB105 in response to rice seedlings. BMC Microbiology. 2015; 15(1): 21.

    [0237] 67. Merchant S S, Prochnik S E, Vallon O, Harris E H, Karpowicz S J, Witman G B, Terry A, Salamov A, Fritz-Laylin L K, Marchal-Drouard L, Marshall W F, Qu L H, Nelson D R, Sanderfoot A A, Spalding M H, Kapitonov V V, Ren Q, Ferris P, Lindquist E, Shapiro H, Lucas S M, Grimwood J, Schmutz J, Cardol P, Cerutti H, Chanfreau G, Chen C L, Cognat V, Croft M T, Dent R, Dutcher S, Fernndez E, Fukuzawa H, Gonzlez-Ballester D, Gonzlez-Halphen D, Hallmann A, Hanikenne M, Hippler M, Inwood W, Jabbari K, Kalanon M, Kuras R, Lefebvre P A, Lemaire S D, Lobanov A V, Lohr M, Manuell A, Meier I, Mets L, Mittag M, Mittelmeier T, Moroney J V, Moseley J, Napoli C, Nedelcu A M, Niyogi K, Novoselov S V, Paulsen I T, Pazour G, Purton S, Ral J P, Riao-Pachn D M, Riekhof W, Rymarquis L, Schroda M, Stern D, Umen J, Willows R, Wilson N, Zimmer S L, Allmer J, Balk J, Bisova K, Chen C J, Elias M, Gendler K, Hauser C, Lamb M R, Ledford H, Long J C, Minagawa J, Page M D, Pan J, Pootakham W, Roje S, Rose A, Stahlberg E, Terauchi A M, Yang P, Ball S, Bowler C, Dieckmann C L, Gladyshev V N, Green P, Jorgensen R, Mayfield S, Mueller-Roeber B, Rajamani S, Sayre R T, Brokstein P, Dubchak I, Goodstein D, Hornick L, Huang Y W, Jhaveri J, Luo Y, Martinez D, Ngau W C, Otillar B, Poliakov A, Porter A, Szajkowski L, Werner G, Zhou K, Grigoriev I V, Rokhsar D S, Grossman A R. The Chlamydomonas genome reveals the evolution of key animal and plant functions. Science. 2007; 318(5848): 245-50.

    [0238] 68. Hart A C. Behavior. The C. elegans Research Community, WormBook. 2006.

    [0239] 69. Bybd, D. W, J R., T. Kirkpatrick, T. J R, and K. R. Barker, K.R. An Improved Technique for Clearing and Staining Plant Tissues for Detection of Nematodes. Journal of Nematology. 1983; 15(1): 142-143.

    [0240] 70. Stiernagle, T. Maintenance of C. elegans. The C. elegans Research Community, WormBook. 2006.

    [0241] 71. White G. A method for obtaining infective nematode larvae from cultures. American Association for the Advancement of Science. 1927; 66 (1709): 302-3.

    [0242] The invention is not limited to the embodiments described herein but can be amended or modified without departing from the scope of the present invention.