Nanocomposite matertail
11713444 · 2023-08-01
Assignee
Inventors
- Mikhail Talianski (Dundee, GB)
- Andrew Love (Dundee, GB)
- Eric Whale (Burntisland, GB)
- David Hepworth (Burntisland, GB)
- Natalia Petukhova (Dundee, GB)
- Jane Shaw (Dundee, GB)
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
C07K2319/20
CHEMISTRY; METALLURGY
C12N2710/10031
CHEMISTRY; METALLURGY
B82Y40/00
PERFORMING OPERATIONS; TRANSPORTING
C07K2319/735
CHEMISTRY; METALLURGY
C12P19/04
CHEMISTRY; METALLURGY
C12N1/00
CHEMISTRY; METALLURGY
C12N2770/00031
CHEMISTRY; METALLURGY
C12N2720/00031
CHEMISTRY; METALLURGY
C04B28/02
CHEMISTRY; METALLURGY
B82Y30/00
PERFORMING OPERATIONS; TRANSPORTING
Y02W30/91
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
C12N1/00
CHEMISTRY; METALLURGY
B82Y30/00
PERFORMING OPERATIONS; TRANSPORTING
B82Y40/00
PERFORMING OPERATIONS; TRANSPORTING
C04B18/02
CHEMISTRY; METALLURGY
C04B28/02
CHEMISTRY; METALLURGY
C12N7/00
CHEMISTRY; METALLURGY
C12P19/04
CHEMISTRY; METALLURGY
Abstract
The present invention relates to nanoparticles and their use to form nanocomposite material, in particular bionanocomposite material, specifically wherein the nanoparticles are formed using plant virus attached to a scaffold of cellulosic material and/or cellulose derived materials, in particular wherein said cellulosic material further comprises plant cell components, for example hemicellulose, pectin, protein or combinations thereof.
Claims
1. A nanocomposite material comprising: a) a nanocellulose scaffold, wherein the nanocellulose scaffold is a non-virus scaffold, and wherein the nanocellulose scaffold comprises a nanocellulose material and, cellulose platelets; and b) at least one virus particle, virus-like particle, or structure formed from virus components, wherein the at least one virus particle, virus-like particle, or structure formed from virus components comprises the coat protein of the tobacco mosaic virus, wherein the at least one virus particle, virus-like particle or structure formed from virus components is modified to provide surface displayed functional peptides, whole proteins, or enzymes on the surface of the virus particle, virus-like particle, or structure, wherein the at least one virus particle or virus-like particle is bound to the nanocellulose scaffold wherein the cellulose platelets comprise at least 60% cellulose by dry weight, less than 10% pectin by dry weight, and at least 5% hemicellulose by dry weight, wherein the hemicellulose comprises xyloglucans, xylans, mannans and glucomannans.
2. The nanocomposite material of claim 1, wherein the nanocellulose material is selected from nanofibrillated cellulose, cellulose nanoparticles, and cellulose nanocrystals.
3. The nanocomposite material of claim 1, wherein the nanocellulose scaffold comprises plant cell components selected from hemicellulose, pectin, and protein.
4. The nanocomposite material of claim 1, wherein the nanocellulose scaffold is a 2-dimensional structure selected from a film-like layer, web-like layer, or cross-linked fibre matrix.
5. The nanocomposite material of claim 1, wherein the nanocellulose scaffold is formed by a first layer of a 2-dimensional scaffold and a second layer of a 2-dimensional scaffold formed over the first layer to form a multi-layer or laminate structure.
6. The nanocomposite material of claim 1, wherein the nanocellulose scaffold further comprises at least one of carbon fibre, carbon nanotubes, glass fibres, silk fibres, aramid fibres, or natural fibres comprising coir, hemp, flax, jute, wood fibre, sisal, straw, and cellulose.
7. The nanocomposite material of claim 1, wherein the nanocellulose scaffold further comprises a plurality of cellulose fragments made up of a network of cellulose nanofibres/microfibrils, at least one hydrophilic binder located within the network of cellulose nanofibres/microfibrils and at least one hydrophobic binder arranged to interact with the hydrophilic binders so as to encapsulate the plurality of cellulose fragments.
8. The nanocomposite material of claim 1, wherein the nanocellulose scaffold further comprises a biocomposite material reinforced with a plurality of fibres wherein the biocomposite material comprises at least one cellulose fragment made up of a network of cellulose microfibrils, at least one hydrophilic binder located within the network of cellulose microfibrils/nanofibers and at least one hydrophobic binder arranged to interact with the at least one hydrophilic binder so as to encapsulate the at least one cellulose fragment.
9. The nanocomposite material of claim 1, wherein the virus particle or virus-like particle or structure formed from virus protein components is a nanoparticle formed from reduction of metal by the functional peptides on the surface of the virus particle or virus-like particle or structures formed from virus protein components.
10. The nanocomposite material of claim 1, wherein the virus particle, virus-like particle or structure formed from virus protein components or nanoparticle formed therefrom is a plant virus, non-enveloped animal virus or bacteriophage.
11. The nanocomposite material of claim 1, wherein the virus particle, virus-like particle or structure formed from virus protein components or nanoparticle formed therefrom is a plant virus.
12. The nanocomposite material of claim 1, wherein the surface displayed peptides are metal binding or reducing peptides capable of binding or reducing metal ions to provide a metallic nanoparticle.
Description
(1) Embodiments of the present invention will now be provided by way of example only, with reference to the accompanying figures in which
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
EXAMPLE 1
(13) Genetic Modification of Tobacco Mosaic Virus Tobacco mosaic virus (TMV) was modified genetically such that small peptides like the metal binding and reducing peptide (MBP), (MBP; Tan, Y. N., Lee, J. Y., and Wang, D. I. C. 2010. Uncovering the design rules for peptide synthesis of metal nanoparticles. J. Am. Chem. Soc. 132, 5677-5686.) SEKLWWGASL (SEQ ID NO: 1), or a hydroxyapatite deposition peptide (MIP3), (MIP3; Choi, Y. S., Lee J. Y., Suh, J. S., Lee, G., Chung, C. P., Park, Y. J. 2013. The mineralization inducing peptide derived from dentin sialophosphoprotein for bone regeneration. J Biomed Mater Res A, 101(2), 590-8.) SESDSSDSDSKS (SEQ ID NO: 2), was inserted into the surface exposed regions of the coat protein. (Turpen, T. H., Reinl, S. J., Charoenvit, Y., Hoffman, S. L., Fallarme, V., Grill, L. K. 1995. Malarial epitopes expressed on the surface of recombinant tobacco mosaic virus. Nature Biotechnology, 13(1), 53-57.) and (Bendahmane, Karrer, E., Beachy, R. N. 1999. Display of epitopes on the surface of tobacco mosaic virus: impact of charge and isoelectric point of the epitope on virus-host interactions. J Mol Biol. 290(1), 9-20.). Peptide insertion did not compromise virion formation. Moreover, these viruses could be obtained to a high yield using plants (>1 g/kg fresh tissue weight).
(14) The method can utilize restriction sites which are either already present or engineered into the nucleic acid sequence of the surface exposed regions of TMV, for example a PpuMI restriction site permits insertion of sequences into the surface exposed C-terminal end of the coat protein; or alternatively NgoMIV/BstZ17I restriction sites may be used to introduce sequences into a surface exposed loop of the coat protein which lies between 195-210 base pairs of the coat protein.
(15) Suitable restriction enzyme digestion of the TMV vector at the region for surface display, prior to insertion of sequences of interest into this region may be carried out as below. For example, 200 ng of TMV vector was combined with 2.5 units of NgoMIV and BstZ17I and a propriety brand of 1× cut smart buffering solution (New England Biolabs; 240 County Road Ipswich, Mass.) prior to incubation at 37° C. for 4 hours. Subsequently, 20 units of New England Biolabs CIP was then added to the reaction and incubation was continued for another 3 hours at 37° C. in order to remove phosphates at the excision site. The reactions were gel electrophoresed on 1% agarose 1×TBE gels which were run at 100 v for 4 hours. After the bands on the gel were resolved the linearized plasmid was excised from the gel and the DNA was extracted using a Qiagen gel extraction kit (QIAGEN GmbH QIAGEN Strasse 1 40724 Hilden; Germany). The purified digested and dephosphorylated plasmids were then ligated to phosphorylated annealed oligonucleotide primers (see sequences below) using DNA ligase and ligase buffer as per the protocols of New England Biolabs. The annealed oligonucleotides contain complementary overhangs which permit the in-frame ligation of the sequences that correspond to the peptides of interest. This procedure generates for example a DNA sequence which when expressed in an organism or in vitro system, produces a virus coat protein that displays a functional peptide sequence of interest, with the peptide still retaining its functionality and accessibility even after self-assembly into a larger virus or virus-like structure.
(16) TABLE-US-00001 MIP3 primers- (SEQ ID NO: 3) F: 5′ CCGGC TCT GAA TCT GAT TCT TCT GAT TCT GAT TCT AAG TCT GTA (SEQ ID NO: 4) R: 5′ TAC AGA CTT AGA ATC AGA ATC AGA AGA ATC AGA TTC AGA G MBP primers- (SEQ ID NO: 5) F: 5′ CCGGC TCTGAAAAGCTTTGGTGGGGAGCTTCTCTTGTA (SEQ ID NO: 6) R: 5′ TAC AAAGAGAAGCTCCCCACCAAAGCTTTTCAGAG
(17) Suitably a TMV vector used in such manipulations may contain a T7 transcriptional promoter to allow in vitro transcription, which leads to the formation of infectious RNA transcripts which can subsequently be rubbed on plants such as Nicotiana benthamiana to propagate the virus. Virus can be easily extracted to a high yield by finely grinding infected leaf material in the presence of aqueous buffers, which then undergoes various stages of low speed centrifugation in the presence of polyethylene glycol and salts, with the resulting pure pellet being resuspended in an appropriate phosphate buffer according to Gooding and Herbert (Gooding, G V and Herbert, T T. 1967. A simple technique for purification of tobacco mosaic virus in large quantities. Phytopathology Volume: 57 Issue: 11 Pages: 1285).
EXAMPLE 2
(18) Preparation of Functionalized Nanocellulose Films Using Viruses
(19) TMV modified with the MBP and MIP3 peptides were used to functionalize nanocellulose scaffold. Viscous purified nanocellulose dispersions and dispersions of cell wall particles containing nanocellulose fibres were produced from waste plant material, by different extraction techniques, wherein the plant material was treated with either NaOH treatment (as specified in WO2013/128196 for example wherein, for example root vegetable waste, such as carrot or sugar beet from existing industrial processes, can be processed to form a mixture having a concentration of between 0.1% and 10% solids content by weight in water. 0.5M sodium hydroxide (NaOH) can be added to the solution, raising and maintaining the pH of the solution at pH 14 such that the addition of the NaOH extracts a significant proportion of hemicellulose and the majority of pectin from the cellulose of the cells within the mixture. The mixture can then be heated to 90° C. for five hours and homogenised periodically during the heating period for a total of one hour with a mixer blade rotating at a rate of 11 m/s (6), followed by homogenisation for a period of five minutes, at the end of the heating period, with a mixer blade rotating at a rate of 30 m/s (8). Homogenisation separates the cells along the line of the middle lamella, then breaks the separated cells into platelets. The resultant cellulose platelets are approximately 10 times smaller than the original separated cells and the resultant mixture can then be filtered to remove the dissolved materials to a solids content of less than 8% by weight, peroxide treatment (as specified in WO2014/147392 or WO2014/147393), for example wherein 35% aqueous peroxide solution may be added in an amount of 0.5% by weight or less of the weight of herbaceous plant material (dry content) and a peroxide treatment step carried out until substantially all of the peroxide has been consumed and then terminated such that a particulate cellulose material with a viscosity of at least 2500 cps (at a 1 wt % solids concentration) is obtained) or enzyme treatment.
(20) TMV virus stock solutions (wild type and modified) were prepared in 10 mM sodium phosphate pH7 buffer. 1. 250 μl Cellulose dispersion was mixed with 10 μl of wild type or modified TMV (22 mg/ml; total virus per reaction is 220 μg) to provide a cellulose mixture. 2. After incubation at room temperature (between 20°-25° C.) for 2 hours the cellulose dispersion was pipetted and spread onto a 1 cm.sup.2 area on a flexible plastic sheet. 3. The cellulose dispersion was left to dry overnight at room temperature in a dust free location to form a dried sample. 4. The dried sample was peeled from the plastic sheet and washed several times in distilled water, prior to re-drying for analysis using electron microscopy, or for inclusion in metal or hydroxyapatite catalytic experiments.
(21) Using scanning electron microscopy (SEM) it was found that nanocellulose and nanocellulose containing particles only, formed a network of nanocellulose fibres, or a nanocellulose film or membrane (
EXAMPLE 3
(22) Testing the Preserved Immunoreactivity of TMV in the Nanocellulose Film
(23) Tobacco mosaic virus integrated into the nanocellulose structure was cross-reactive to antibodies specific for the virus, as indicated by the localization of gold particle-antibody conjugates to the virus (
(24) After confirmation of incorporation of the virus, the utility of the virus functionalized membranes were tested in several different catalytic reactions depending on the functionalities of the virus.
EXAMPLE 4
(25) Testing Metal Nanoparticle Formation.
(26) A TMV-MBP functionalized, washed nanocellulose film was placed in an eppendorf tube and 500 μl AgNO.sub.3 (2.9×10.sup.−3 M) metal salts were added. TEM analysis found that significant amounts of silver nanoparticles formed in the supernatant within an hour in the TMV-MBP functionalized sample (
EXAMPLE 5
(27) Testing Hydroxyapatite Deposition
(28) Nanocellulose films were produced with TMV-MIP3 or TMV as above except that double the amount of virus was used (440 μg per 250 μl of nanocellulose).
(29) The washed membranes were incubated for 17 hours in 100 mM CaCl.sub.2 (pH 4.83). Subsequently the membranes were washed in distilled water and incubated in 60 mM Na.sub.2HPO.sub.4 (pH 8.36) with slight agitation. The process of washing and sequentially incubating with the HA precursors (CaCl.sub.2 and Na.sub.2HPO.sub.4) was repeated once more, with a final wash step prior to a final drying. SEM analysis was carried out, and it was found that the nanocellulose only (
(30) Production of Structures Formed from Viral Protein Components for Display of Whole Proteins/Enzymes
(31) A new platform for the surface presentation of peptides or whole proteins/enzymes was determined to be generated by thermal remodelling of plant viruses, such as TMV. Heating of TMV rod-shaped viruses at 94° C. for 5 minutes leads to formation of nanoscale spherical particles (SPs) (patent WO 2012078069 A1), which are RNA-free and can bind any peptide or whole protein/enzyme for formation of functional complexes. TMV (concentration 1 mg/ml) was used to prepare SPs about 200-500 nm in diameter. SPs in solution (0.1 mg in 100 μl) were mixed with Calf-Intestinal Alkaline Phosphatase (CIP) (0.02 mg in 6 μl); the mixture was incubated for 1 hour at room temperature and then centrifuged (2300 g, 5 min) to separate the unbound protein. The obtained pellet was resuspended in 100 μl of milli-Q water. The SPs decorated with CIP (SP-CIP) were mixed with 100 μl of nanocellulose suspension and left to dry at room temperature into thin films. Thin films comprising cellulose alone or cellulose containing the same amount of SPs were used as negative controls.
(32) The dried cellulose films were washed with water several times. The CIP substrate (BCIP (5-bromo-4-chloro-3-indonyl-phospate) in conjunction with NBT (nitro blue tetrazolium)) was added to the washed cellulose membranes and colour changes were observed. Films composed of cellulose only or cellulose with SPs did not show any reactivity as indicated by no colour change from white to dark blue (FIG. a, b). In contrast, a strong colour change to dark blue was detected in nanocellulose films containing the SP-CIP enzyme (FIG. c), demonstrating that enzymatic activity in the nanocellulose films was preserved even after drying and washing. Thus, incorporation of platforms decorated with enzymes, confers functionality to the nanocellulose matrix which is stable.
EXAMPLE 6
(33) Paint Study, Using Nanocellulose Containing Particles to Make Paint Formulations
(34) Two sets of paint formulations were made up (see Tables 1 and 2 below). One was made using an epoxy resin system and the other using an acrylic resin system. For each set a number of batches were made containing different amounts of Curran (nanocellulose containing particles) produced by the method outlined in the rheological formulation paragraphs below. The weight of all additives in both the epoxy and acrylic formulations was kept constant from one batch to the next, except for water and viscosity modifier. The weight of viscosity modifier was varied from one batch to another, to test the effects of different addition levels on the formulation viscosity. In order to keep total formulation weight constant the weight of water added to a batch was also adjusted depending upon the addition level of the viscosity modifier, so that weight of water plus the viscosity modifier was constant from one batch to another.
(35) The cellulose-containing particles had been pressed to reduce water content to 25% solids then grated using a parmesan cheese grater into a coarse powder. The ingredients of each formulation were mixed together at room temperature using a Dispermat paint mixer, with saw tooth blade of 4 cm diameter rotated at 3000 rpm. Mixing was carried out for 1 hr to ensure that all ingredients were fully dispersed. The mixed formulations were allowed to stand for 1 day. Then the viscosity of each sample was scanned over a range of shear rates using a rheometer.
(36) For the epoxy formulation a bench mark, which was a well known Bentonite clay rheology modifier, was used to allow comparison with the cell wall material. This was mixed into the formulation at a concentration of 0.25% by total formulation weight.
(37) Similarly for the acrylic formulation a suitable bench mark was used for comparison, which was an Acrysol associative thickener. This was mixed into the formulation at 0.6% of total formulation weight.
(38) TABLE-US-00002 TABLE 1 Material Epoxy Resin Component % g Beckopox EP 2384w/57WA 20.30 101.50 Water 8.71 43.53 Cell wall material: powder 0.09 0.47 Additol VXW-6393 Defoamer 0.40 2.00 Additol VXW-6208/60 1.00 5.00 RO-4097 Red Iron Oxide 7.00 35.00 Halox SZP-391 Anti-Corrosive Pigment 4.60 23.00 Barium Sulphate 9.20 46.00 Minelco Wollastonite Powder MW50 13.90 69.50 Zeeosphere 400 Ceramic Microspheres 9.30 46.50 325 mesh Water Ground Mica 0.70 3.50 Beckopox EP 2384w/57WA 20.30 101.50 Additol VXW-6393 Defoamer 0.40 2.00 BYK 348 0.40 2.00 Cotrol AMB ammonium Benzoate (10% in Water) 3.70 18.50 100.00 500.00
(39) A graph showing viscosity as a function of shear rate for an epoxy paint formulation with varying amounts of cellulose-containing particles added as a viscosity modifier (here labelled A) and compared to a Bentonite clay viscosity modifier (labelled Bentone E W) is shown in
(40) TABLE-US-00003 TABLE 2 Acrylic/low PVC formulation Material % g Water 15.57 93.42 Cell wall material: 2.3% Powder 2.33 13.98 Propylene Glycol 2.00 12.00 Pat-Add AF16 0.20 1.20 Pat-Add DA 420 0.60 3.60 Pat-Add DA 202 0.40 2.40 Kemira RDI-S 22.20 133.20 Neocryl XK 98 55.30 331.80 Pat Add AF 16 0.10 0.60 Parrmetol A 23 0.30 1.80 Pat-Add COAL 77 1.00 6.00 Total 100.00 600.00
(41) A graph showing viscosity as a function of shear rate for an acrylic paint formulation with varying amounts of cellulose-containing particles added as a viscosity modifier (here labelled A) and compared to an associative thickener acting as a viscosity modifier (Acrysol) is shown in
EXAMPLE 7
(42) Cementious Materials/Concrete—Using Nanocellulose Containing Particles as an Additive in Concrete
(43) The cellulose particulate material produced by the process described in the Rheological formulation section herein, was tested for its suitability in composite materials, particularly cementitious materials such as concrete and mortar.
(44) The cellulose particulate material was incorporated into a mortar mix in amounts of 1 wt %, 5 wt % and 10 wt % as set out below. The mortar used was a decorative mortar called Enduit Béton Coloré available from Mercardier.
(45) Composition:
(46) 4.3 kg cement powder
(47) 1 kg acrylic resin binder
(48) 1 wt % or 5 wt % cellulose particulate material (CPM)
(49) The indentation strength of the composite material was tested using a 2 mm thick sample of material. The test used a 62.5 MPa punch with a 1 cm diameter punch die. The results are shown in Table 3 below:
(50) TABLE-US-00004 TABLE 3 Results in MPa Composition Sample 1 Sample 2 Sample 3 Average EBC 29.5 26.5 29.5 28.5 EBC + 1% CPM 36.5 37.5 34.5 36.17 EBC + 5% CPM 30.5 35 31.5 32.33 EBC + 10% CPM 29 30 26.5 28.5
(51) This data shows that inclusion of up to 5 wt % of the cellulose particulate material described herein led to an improvement in the strength of the material, demonstrating that the cellulose particulate material is able to strengthen or reinforce inorganic composite materials such as concrete.
EXAMPLE 8
(52) Paper Compositions—Using Nanocellulose Containing Particles as Additives to Paper
(53) A paper composition comprising differing amounts of the cellulose particulate material (CPM) produced by the process described in the rheological material formulation section below, was tested for opacity and porosity.
(54) Inclusion of the cellulose particulate material described herein decreased porosity relative to a base paper formed from a standard cellulose. Decreasing porosity of a paper composition provides advantages for food, cosmetic and fragrance-type packaging where permeation of gases, microbes and other substances is undesirable.
(55) From the above examples, it can be seen that the cellulose particulate materials described herein, and the processes for producing such cellulose particulate materials find utility in many different applications.
(56) Examples of forming and analysing cellulosic scaffold compositions of the invention are now described.
EXAMPLE 9
(57) Composite Formulation—Using Nanocellulose Containing Particles to Make Composites
(58) 30 kg of Carrots were peeled, chopped into pieces and then added into a cooking pot with an equal weight of tap water and cooked for 3 hrs at 95° C. until soft. The material was then homogenised using a silverson FX in-tank homogenisaser. Coarse medium and fine heads were used on the homogeniser to gradually reduce particle size until an average particle size of around 100 microns was achieved. Sodium hydroxide was then added in a ratio of 2 parts NaOH to 1 part of plant material solids. The material was then re-heated to 90° C. while stirring continually. The stirred material was held at 90° C. for 8 hrs. The material was then cooled and filtered using a gravity filter. Several washes of clean water were put through the material until the pH had reached 7. The material was then mixed with Polyvenyl alcohol/acetate and water based epoxy resin+hardener in a ratio of 85% plant material, 10% epoxy+hardener and 5% PVA (on a solids basis). The PVA was mixed in first by adding the liquid PVA (containing around 70% water) to the plant material, mixing thoroughly for 30 minutes and then pressing the material to 7.7% solids (most of the PVA remains trapped in the plant mix during this pressing). The pressing was carried out by placing the material in a porous bag of filter material and pressing it in a hydraulic filter press between 2 metal plates until the solids in the bag reached 7.7%. Water based epoxy resin (either a dispersion or an emulsion) was then mixed into the plant material+PVA using a dough mixer. Additional water can be added depending upon the application. The resulting material when dried shrinks and forms a hard biocomposite material. Sheets can be formed if the plant material+PVA+Epoxy and hardener+water is liquid and this liquid is poured into plastic trays and the material dried.
(59) As would be understood by those of skill in the art, the plant material to be mixed with the PVA epoxy and hardener can be produced by alternative treatments. Other examples include but are not limited to, treatment of the plant material with hydrogen peroxide at 90° C. or by treatment of the plant material with enzymes.
EXAMPLE 10
(60) Rheological Material Formulation—Using Nanocellulose Containing Particles to Make a Rheological Modifier
(61) 900 g of sugar beet pellets were washed and hydrated by adding them to warm water, with dirty water being drained through a sieve. This sugar beet hydrate was placed in a large bucket in excess water and agitated before being scooped out with a colander and washed with water, to ensure that no stones/grit enter the next stage of processing.
(62) The washed sugar beet was cooked for 3 hours at 100° C., before being homogenised using a Silverson FX homogeniser fitted with initially coarse stator screens and moving down to the small holed emulsifier screen (15 min process time for each screen). The solids were measured using an Oxford solids meter and the mixture adjusted to 2% solids by addition of clean water.
(63) The mix was then placed in a 25 litre glass reaction vessel and the dry solids content in the vessel calculated. Peroxide based on ratio of aqueous peroxide solution (at 35%) to the dry solids of 0.25:1 was added when the mix was heating. The temperature was maintained for 2 hours at 90° C. (once it reaches 90° C.), by which time the pH dropped from around 5 to 3.5.
(64) The reaction liquid was then removed from the vessel and washed prior to bleaching
(65) Bleaching was then carried out by re-suspending the washed material in clean water and placing it back in the vessel. Bleaching was performed at 60° C., with a 2:1 bleach (2 parts of bleach solution with 10% active chlorine to 1 part solids, for 30 minutes).
(66) The material was then washed and homogenised for 30 minutes on the fine slotted stator screen of the Silverson FX homogeniser
(67) The material is then drained through a filter and pressed between absorbent cloths to a desired final solids content. Resuspension of the solids in water at 1 wt % solids resulted in a viscosity (measured as previously described) of 4600 cps.
EXAMPLE 11
(68) Analysis of the Cellulose Containing Particles (Produced by Peroxide Extraction as Described in Example 10 and WO2014/147392 or WO2014/147393) Using Acid Hydrolysis Extraction
(69) Dry material from three stages of the process (start; after peroxide treatment; after sodium hypochlorite treatment) was analysed for extractable monosaccharide/polysaccharide content. The starting plant materials tested were sugar beet and carrot.
(70) The test procedure was carried out according to the standard two-step protocol below, which is based on separation of monosaccharides and oligosaccharides from polysaccharides by boiling the sample in an 80% alcohol solution. Monosaccharides and oligosaccharides are soluble in alcoholic solutions, whereas polysaccharides and fibre are insoluble. The soluble components can be separated from the insoluble components by filtration or centrifugation. The two fractions (soluble and insoluble) can then be dried and weighed to determine their concentrations.
(71) The dried materials can then be used for analysis by HPLC, following acid hydrolysis.
(72) (i) Separation of Alcohol Soluble and Insoluble Components
(73) Materials
(74) Dry samples 80% Ethanol Compressed Nitrogen
Method
(75) For each material sample, 50 mg was extracted three times with 5 ml of 80% ethanol, by boiling the samples in capped glass tubes in 95° C. water bath for 10 min each. After each extraction, the tubes were centrifuged at 5000×g for 5 min, and the supernatants of the three extractions combined for sugar analysis.
(76) The residue and supernatant are oven dried prior to acid hydrolysis. Acid hydrolysis using trifluoroacetic acid degrades pectins, hemicelluloses and highly amorphous regions of cellulose, while acid hydrolysis using 72% (w/v) sulphuric acid degrades all polysaccharides with the exception of highly crystalline regions of cellulose.
(77) (ii)(a) Analysis of Matrix Polysaccharides—Trifluoroacetic Acid Hydrolysis
(78) Materials
(79) Dry samples Screw cap tubes 2M Trifluororoacetic acid=11.4 g in 50 ml (or 3 ml 99.5% TFA and 17 ml dH.sub.2O) Compressed Nitrogen Monosaccharide standards Standard sugar mixture of three monosaccharides (glucose, fructose, xylose). Each sugar is in a 10 mM stock solution (100×). The preparation of the standards is done by pipetting 250, 500, and 750 μl in screw cap vials and evaporating to dryness. Proceed to hydrolysis in the same way as with the samples.
Method
Day 1 Weigh 5 mg of the alcohol insoluble fraction from step (i) in screw cap tubes Dry all the samples and monosaccharide standards (250 μl, 500 μl, 750 μl)
Day 2 In the fume hood, hydrolyse by adding 0.5 ml 2 M TFA. Flush the vials with dry nitrogen, place the cap, and mix well. Wipe nitrogen nozzle with ethanol tissue between samples to prevent contamination. Heat the vials at 100° C. for 4 h and mix several times during hydrolysis. Evaporate completely in centrifugal evaporator or under a nitrogen flush with fume extraction overnight.
Day 3 Add 500 μl of propan-2-ol, mix, and evaporate. Repeat Resuspend the samples and standards in 200 μl of dH.sub.2O. Mix well. Centrifuge and transfer the supernatant into a new tube. Filter supernatant through 0.45 μm PTFE filters prior to HPLC analysis.
(ii)(b) Analysis of Matrix Polysaccharides—Sulphuric Acid Hydrolysis
Materials
Sulphuric acid 72% (w/v) (AR)
Barium hydroxide (150 mM)
Bromophenol blue (1% solution in water)
0.45 μm filters
SPE reverse phase (styrene divinylbenzene); e.g. Strata-X 30 mg, 1 ml volume.
Method Weight accurately 4 mg of the alcohol insoluble fraction from step (i) into a 2.0 ml screw-top microcentrifuge tube. Alternatively use the dried residue from the matrix sugar digestion. Add 70 μl of 72% (w/v) sulphuric acid to the screw-top vial. Mix, until solids are dispersed/dissolved. Incubate in a water bath at 30° C. for 2 hours. Mix samples every 15 minutes. Add water to reduce the sulphuric acid concentration to 4.6% (w/w)—add 1530 μl water. Mix well and heat in a block heater at 121° C. for 4 hours. Vortex every 30 minutes. Cool to room temperature. (Samples may be stored in fridge for up to 2 weeks at this point). Take 300 μl into a new tube, add 1 μl of 1% bromophenol blue. Partially neutralise by the addition of 0.8 ml 150 mM barium hydroxide. Finish by adding barium carbonate powder. The indicator goes blue. Centrifuge to eliminate the precipitated barium sulphate (10 min at 10000×g). Transfer supernatant to a new tube. Freeze thaw to finish precipitation and repeat centrifugation (total volume 1050 μl). Prior to HPLC, the samples (700 μl aliquot) are passed on a reverse phase column (e.g. strata X 30 mg) and filtered through a 0.45 μm filter.
(80) The results of these analyses, with respect to xylose content and glucose content are shown in Table 4. Quantitative data can be obtained by injection of a known amount of a reference monosaccharide, for example glucose or xylose, as is routine in the art, as well as comparative materials such as those disclosed in WO2014017911 (Examples CelluComp 8 to 10).
(81) Although the invention has been particularly shown and described with reference to particular examples, it will be understood by those skilled in the art that various changes in the form and details may be made therein without departing from the scope of the present invention.
(82) TABLE-US-00005 TABLE 4 Sample taken for TFA Sample Material Process hydrolysis (mg) Peak area xylose (mg) % xylose release Cellucomp 1 Sugar Beet Start Material 4.8 30274 0.955 19.90 Cellucomp 2 Sugar Beet Peroxide Process 5.7 2880 0.089 1.56 Cellucomp 3 Sugar Beet Full Process 5.1 3281 0.102 2.00 Cellucomp 4 Sugar Beet Full Process with extra wash 5.4 3161 0.098 1.82 Cellucomp 5 Carrot Start Material 5.4 3230 0.100 1.86 Cellucomp 6 Carrot Peroxide Process 4.9 1334 0.040 0.82 Cellucomp 7 Carrot Full Process 4.7 1530 0.046 0.99 Cellucomp 8 Comparative NaOH + heat 5.6 1021 0.030 0.54 Example (Carrot) Cellucomp 9 Comparative Cellucomp 8 followed by 4.6 1302 0.039 0.85 Example (Carrot) bleach Cellucomp 10 Sugar Beet (low Full process 4.9 1119.3 0.033 0.68 viscosity) Sample taken for Sample Material Process H2SO4 hydrolysis (mg) Peak area glucose (mg) % glucose release Cellucomp 1 Sugar Beet Start Material 4.8 351 0.353 7.31 Cellucomp 2 Sugar Beet Peroxide Process 5.7 1121 0.739 12.99 Cellucomp 3 Sugar Beet Full Process 5.1 1830 1.098 21.57 Cellucomp 4 Sugar Beet Full Process with extra wash 5.4 1654 1.012 18.71 Cellucomp 5 Carrot Start Material 5.4 858 0.605 11.26 Cellucomp 6 Carrot Peroxide Process 4.9 1525 0.948 19.29 Cellucomp 7 Carrot Full Process 4.7 1724 1.044 22.26 Cellucomp 8 Comparative NaOH + heat 5.6 3578 1.987 35.43 Example (Carrot) Cellucomp 9 Comparative Cellucomp 8 followed by 4.6 2595 1.489 32.33 Example (Carrot) bleach Cellucomp 10 Sugar Beet (low Full process 4.9 2247 1.311 26.76 viscosity)