COMPOSITIONS AND METHODS FOR NEURALGENESIS

20200121725 ยท 2020-04-23

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to novel compositions and methods to produce 3D organ equivalents of the brain (i.e. mini-brains). The invention also relates to methods of using human induced pluripotent stem cells, a combination of growth and other soluble factors and gyratory shaking. Cells from healthy or diseased donors or animals can be used to allow testing different genetic backgrounds. The model can be further enhanced by using genetically modified cells, adding micro-glia or their precursors or indicator cells (e.g. with reporter genes or tracers) as well as adding endothelial cells to form a blood-brain-barrier.

    Claims

    1. An in vitro brain microphysiological system (BMPS), comprising at least one neural cell type aggregated into a spheroid mass; and a population of microglia-like cells, wherein the in vitro BMPS is electrophysiologically active in a spontaneous manner.

    2. The BMPS of claim 1, wherein the micro-glia like cells comprise microglia, microglia precursor cells, or a combination thereof.

    3. The BMPS of claim 1, wherein the micro-glia like cells comprise monocytes, human monocytes, pro-monocyte cell lines, hematopoietic stem cells, isolated microglia, immortalized microglia, or combinations thereof.

    4. The BMPS of claim 3, where the monocytes comprise adult cell-derived monocytes, embryonic cell-derived monocytes, or a combination thereof.

    5. The BMPS of claim 4, wherein the monocytes comprise embryonic stem cell (ESC)-derived monocytes, induced pluripotent stem cell (iPSC)-derived monocytes, or a combination thereof.

    6. The BMPS of claim 3, wherein the isolated microglia comprise adult microglia, fetal microglia, or a combination thereof.

    7. The BMPS of claim 3, wherein the microglia-like cells are derived from somatic cells, neuronal cells, myeloid progenitor cells, or a combination thereof.

    8. The BMPS of claim 1, wherein the microglia-like cells express one or more of the following biomarkers: HLA-DR, Iba1, CD14, CX3CR1, F4/80, CD80, CD86, CD36, iNOS, COX2, ARG1, PPAR, SOCS-3, TMEM119, Mertk, Ax1, CD11b, CD11c, P2RY12, CD45, CD68, CD40, B7, ICAM-1, or any combination thereof.

    9. The BMPS of claim 1, wherein the BMPS expresses receptors associated with microglia function.

    10. The BMPS of claim 9, wherein the receptors associated with microglia function comprise CCL2, CX3CL, RAGE, NLRP3, SR-AI, TREM2, FPRL1/FPR2, CD36, CD33, C5a, CR1, CR3/Mac-1, FcRs, FPRs, TLRs, or a combination thereof.

    11. The BMPS of claim 1, the BMPS being configured to elicit a pro-inflammatory response, an anti-inflammatory response, or a combination thereof.

    12. The BMPS of claim 11, the BMPS being configured to elicit a pro-inflammatory response to viral infection, LPS exposure, or a combination thereof.

    13. The BMPS of claim 11, the BMPS being configured to elicit an anti-inflammatory response to IL-3, IL-4, IL-10, IL-13, IL-1, IL-6, TNF-, TGF-, or a combination thereof.

    14. The BMPS of claim 1, wherein the microglia-like cells comprise about 20% or less of the BMPS.

    15. The BMPS of claim 1, wherein the at least one neuronal cell type comprises a mature neuron, a glial cell, or a combination thereof.

    16. The BMPS of claim 15, wherein the at least one neural cell type further comprises astrocytes, polydendrocytes, oligodendrocytes, or combinations thereof.

    17. The BMPS of claim 1, wherein the in vitro BMPS has neural characteristics selected from the group consisting of synaptogenesis, neuron-neuron interactions, neuronal-glial interactions, axon myelination, cell migration, neurological development, disease phenotypes, and combinations thereof.

    18. The BMPS of claim 17, wherein disease process phenotypes comprise autophagy, integrated stress response, non-sense mediated decay, lesions, amyloid deposition, plaque formation, protein aggregation, or combinations thereof.

    19. The BMPS of claim 1, wherein the at least one neural cell type express one or more biomarker selected from the group consisting of MBP, PLP, NG2, Olig1, Olig2, Olig 3, OSP, MOG, SOX10, neurofilament 200 (NF200), GRIN1, GAD1, GABA, TH, LMX1A, FOXO1, FOXA2, FOXO4, CNP, TH, TUBIII, NEUN, SLC1A6, and any combination thereof.

    20. The BMPS of claim 1, wherein the at least one neuronal cell type comprises one or more genetically modified cells.

    21. The BMPS of claim 20, wherein the one or more genetically modified cells comprise one or more reporter genes.

    22. The in vitro BMPS of claim 1, wherein the spheroid mass comprises a diameter that is about 1000 m or less.

    23. The in vitro BMPS of claim 22, wherein the spheroid mass comprises a diameter that is about 500 m or less.

    24. The BMPS of claim 1, further comprising one or more endothelial cells, pericytes, or a combination thereof capable of forming a blood-brain-barrier.

    25. A method of reproducibly producing an in vitro brain microphysiological system (BMPS), comprising: inducing one or more pluripotent stem cell (PSC) types; differentiating the one or more PSC types to form one or more neural progenitor cell (NPC) types; exposing the one or more NPC types to gyratory shaking or stirring; differentiating the one or more NPC types into one or more neural cell types aggregated into a spheroid mass; and adding microglia-like cells.

    26. The method of claim 25, wherein the micro-glia like cells comprise mature microglia, monocytes, human monocytes, pro-monocyte cell lines, PSC-derived monocytes, hematopoetic stem cells, isolated microglia, immortalized microglia, or combinations thereof.

    27. The method of claim 25, wherein the one or more pluripotent stem cells are selected from the group consisting of human or animal embryonic stem cells, iPSC, adult stem cells, fibroblasts, embryonic fibroblasts, peripheral blood mononuclear cells, neuronal precursor cells, mesenchymal stem cells, neuronal cells, glial cells, and combinations thereof.

    28. The method of claim 25, wherein the microglia-like cells are added during an early stage (before BMPS differentiation) or late stage (after BMPS differentiation).

    29. The method of claim 25. wherein microglia are generated in parallel with the BMPS.

    30. The method of claim 25, wherein gyratory shaking comprises constant or regular gyratory shaking or stirring for 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, or 8 or more weeks.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0150] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

    [0151] FIGS. 1A-1D depict characterization of BMPS during differentiation. FIG. 1A depicts a diagram of a differentiation protocol. FIG. 1B depicts size of aggregates measured during the 3D neuronal differentiation. Negative days on the x-axis represent 3D cells cultured in NPC medium while positive days represent 3D cells cultured in differentiation medium. FIG. 1C1-C5 depicts BMPS mRNA and miRNA expression of different markers during differentiation. FIG. 1D depicts flow cytometry population analysis of BMPS at different stages of differentiation.

    [0152] FIGS. 2A-2C depict morphological characterization of BMPS. FIG. 2A depicts co-immunostaining of neurons with markers. MAP2+ neurons were co-immunostained with the maturation marker Nestin at 2, 4, and 8 weeks of differentiation, which showed progressive increase of MAP2+ neurons and decrease of Nestin+ cells over time (panels a, b, c), demonstrating neuronal maturation. Co-immunostaining of neurons (NF-H) with the myelin marker MBP at 2, 4, and 8 weeks of differentiation (d,e,f, respectively) showed progressive increase of MBP+ cells in association with axonal processes. An increasing number of MBP+ cells (oligodendrocytes) was observed in association with axons (panels d, e, f). FIG. 2B depicts neuronal and glial cell diversity was evaluated at 8 weeks. Neurons (MAP2, NF, SYP and SMI32) were visualized interacting with glia (GFAP and NOGOA). Neurons disclosed characteristic perykaria, dendrites (MAP2, panels a, b) and axons (NF, SMI32, panels c-f) associated with glia. Neurons exhibited diverse neurotransmitter identities shown by identification of glutamatergic VGLUT1+(panels g, h), GABAergic CALB+(panels i, j) and dopaminergic TH (panels k, 1) neurons. FIG. 2C depicts that GFAP+ astroglia and CNPase+, 01+ and MBP+ oligodendroglia were identified. Oligodendroglia appeared mixed among astrocytes (panels a, b). 01+(panels c, d) and MBP+(panels e, f) oligodendrocytes were associated with axonal processes. Astrocytes established relationships with oligodendrocytes and exhibited characteristic multipolar processes (panels g, h). MBP+ oligodendrocytes issued processes in association with axons (panel i) 3D-reconstruction demonstrated myelinating processes resembling human myelination (panels j, k). Electron microscopy analysis of BMPS at 4 and 8 weeks of differentiation identified morphology of axonal structures and cells (e.g., oligodendrocytes) (panel 1). Myelinating-like processes, which closely resembled cross-sections of myelinated axons of the CNS were identified at 8 weeks of differentiation (panel m). FIG. 2D depicts MBP+ oligodendrocytes issued processes in close association with axons and seemed to enwrap them at 8 weeks (a,b,c). Myelination calculated as the mean percentage MBP positive oligodendrocyte processes coverage of NF-H-positive axons (a,b,c) at 2, 4 and 8 weeks in at least 2 independent experiments showed significant increase of myelination observed with time of differentiation (p<0.001) (d). FIG. 2E depicts 3D-reconstruction based on confocal z-stacks at 8 weeks demonstrating a wrapping myelinating process, which resembled the myelination of axons in human CNS. FIG. 2F depicts a comparison of expression of neuronal and glial markers at 2 and 8 weeks. At 2 weeks, oligodendrocytes (01, CNPase, NOGOA) were identified without a preferential localization (a,b,e,f,i,j), later they resemble human oligodendrocytes and localize in close proximity with axons (c,d, g,h, k,l). At 2 weeks there are few MAP2-positive cells without identifiable neuronal shape (l,j) whereas at 8 weeks, the MAP2+ cells acquire a well-defined dendritic network (k,l). The amount of astrocytes and density of the astroglial network increases with time of differentiation (GFAP, g,h). FIG. 2G depicts variation in the nuclear morphology. Co-immunostaining of neurons (MAP2) with cell-division marker K167 showed that some cells are dividing (a,b), there was also a small degree of apoptosis demonstrated by positive staining with CASP3 (c). CASP 3-positive nuclei did not co-localize with mature neurons (d). FIG. 2H depicts ultrastructure analysis by electron microscopy of 4 week BMPS showed evidence of cell to cell junctions demonstrating functional interactions between the cells (arrows, a,b). Nuclear variation was confirmed by the presence of a few apoptotic nuclei (c) and normal healthy nuclei (d). NF: Neurofilament-heavy-chain, MAP2: Microtubule-associated-protein 2, MBP: myelin-basic-protein, VGLUT1: Vesicular-glutamate-transporter 1, GFAP: Glial-fibrillary-acidic-protein, CALB: Calbindin, NOGOA: Neurite-outgrowth-inhibitor, SYP: Synaptophysin, SMI32: Nonphosphorylated-neurofilament, TH: Tyrosine-hydroxylase, 01: Olig1, CNPase: 2,3-Cyclic-nucleotide-3-phosphodiesterase. Scale Bar: 10 m.

    [0153] FIGS. 3A-3F depict electrical activity of BMPS. Cells were cultured in 3D for 8 weeks and then cultured in 12-well and 48-well MEA plates for 4 more weeks. FIG. 3A depicts heat map recordings from a 48-well plate. FIG. 3B depicts illustration of an active well showing spike morphology and FIG. 3C depicts spike activity. FIGS. 3D and 3E depicts phase-contrast imaging of the mini-brains on MEAs, electrode diameter is 40-50 m and inter-electrode space is 350 m. FIG. 3F depicts activity pattern recordings over 0.05 spikes/sec of the electrode over 10 min.

    [0154] FIGS. 4A-4G depict Parkinson's disease (PD) application of BMPS. BMPS were differentiated for 4 weeks and exposed to rotenone and MPP+ for 12 and 24 hours. FIG. 4A depicts viability (resazurin assay) of BMPS after 24 hours rotenone exposure. FIG. 4B depicts ROS (OxiSelect In Vitro ROS/RNS Assay Kit) production of BMPS after 12 and 24 hours rotenone exposure. FIG. 4C depicts viability (resazurin assay) of BMPS after 24 hours MPP+ exposure. FIG. 4D depicts ROS (OxiSelect In Vitro ROS/RNS Assay Kit) production of BMPS after 12 and 24 hours MPP+ exposure. FIGS. 4E and 4F depict confocal images of BMPS exposed to different concentrations of rotenone and MPP+ for NF200 (Red), TH (Green) and Hoechst nucleus staining (Blue). FIG. 4G depicts expression of genes associated with oxidative stress and PD by real time RT-PCR. Graphs represent the relative expression of different markers compared to control (cells not treated) after 24 hours exposure to 5 M rotenone and 1 mM MPP+. Genes of interest: mitochondrial complex 5 (ATP50, ATP5C1), mitochondrial complex 1 (NDUFB1), oxidative stress (KEAP1) and genes related to PD (TH, SNCA, TBR1, CASP1). Data are presented as meanSD, of 3 independent experiments performed in 3 replicates. *P<0.05 comparing to control (untreated).

    [0155] FIGS. 5A-5D depict Down's Syndrome application of BMPS. BMPS were produced with iPSCs derived from a patient with Down's Syndrome. FIG. 5A depicts morphological characterization with immunostaining of neurons (MAP2, Synl, TH, SYP), neural precursor cells (nestin) and glial cells (GFAP) at 8 weeks of differentiation. FIG. 5B depicts expression of genes in healthy BMPS vs. Down's Syndrome BMPS before and after treatment with 5 M rotenone, after 24 hours exposure. Genes of interest include CNS markers (TH, OLIG2, NEFH), mitochondrial markers (ATP5C1, ATPSJ, ATP50) and ROS markers (NFE2L2, SOD1) which were measured by comparing control with exposed cells to rotenone on both healthy and Down syndrome derived mini-brains. FIGS. 5C and 5D depict karyotyping of iPSCs derived from the patient with Down's Syndrome. aCGH+SNP results for Down syndrome iPSC line are shown.

    [0156] FIG. 6 depicts viability of pre-frozen NT2 human teratocarcinoma cell line and iPSC derived mini-brains. Fmedium corresponds to 95% FBS and 5% DMSO. NPC fmedium corresponds to STEMdiff Neural Progenitor Freezing Medium. Viability was measured by resazurin cell viability assay. Non-frozen cells at the same stage of differentiation were used as control aggregates.

    [0157] FIG. 7 depicts an example of a BMPS covered with other cell types. LUHMES fluorescent cells (red) were incorporated to a BMP using gravity systems to cover the surface of the aggregate.

    [0158] FIGS. 8A-8E depict morphologic characterization of mature human BMPS. FIG. 8A shows at 8 weeks, neuronal populations exhibited a diversity of neurotransmitter identities as shown by identification of dopaminergic TH+(a,b), glutamatergic VGLUT1+(c,d) and gabaergic calbindin+(e,f) neurons. Neurons disclosed characteristic axons (NF) and synaptic proteins (SYN) (g,h). FIG. 8B depicts two distinctive glial populations were identified in close interaction with neuronal populations, GFAP+ astroglia and CNPase+, 01+, NOGOA+ oligodendroglia. O1+oligodendrocytes were closely associated with axonal processes (NF) (a,b), CNPase+ oligodendroglia appeared mixed among GFAP+ astroglia (c,d) and exhibited the characteristic multipolar glial processes, which extended from the perykaria (e,f). NOGOA+ cells were associated with MAP+ neurons (g,h). FIG. 8C depicts example of custom algorithm created using the Cellomics Target Activation image-analysis software package to study astrocytes and oligodendrocytes (a,b,c,d). Quantification of cell populations as a percentage of the total nuclei count showed 3% NOGOA+ positive cells, 9% CNPase+ cells and 19% GFAP+ cells at 8 weeks (e). FIG. 8D shows Co-expression of mature oligodendroglia markers (MBP and 02). FIG. 8E shows expression of neuronal markers (VGLUT, TUJ1, SYN). Scale Bar: 10 m.

    [0159] FIGS. 9A-9D depict the generation of microglia-containing BS (OS) Immortalized Human MicrogliaSV40 were incorporated to 7 week-differentiated BS by gravity. FIG. 9A shows a diagram of BS generation procedure under one embodiment. FIG. 8B provides a comparison between BS and BS using different microglia markers (TMEM119, Mertk, Ax1) and hematoxylin/eosin (HE). FIG. 9C provides confocal images of immunohistochemistry for the microglia marker IBA1 (green), the neuronal marker NF200 (red), and nuclear staining (Hoechst 33342, blue) in BS, 48 h after microglia incorporation. FIG. 9D shows details of microglia aggregations in BS. Green arrow indicates microglia cluster and red arrow indicates the BS. Bars represent 100 m (FIG. 9B), 50 m (FIG. 9C, upper panel), 20 m (FIG. 9C, all other panels), and 50 m (FIG. 9D).

    [0160] FIGS. 10A-10C depicts differences between BS, BS, and microglia after LPS treatment. The microglia, BS, BS, were exposed to 20 ng/mL LPS up to 24 h. FIG. 10A shows gene expression of IL6, IL10, ILlb, CCL2, and TNFa after LPS treatment on the different models (BS, BS, and microglia cells). Data are shown as fold change of treated versus untreated up to an hour post treatment (3, 6, 12, and 24 h after treatment). FIG. 10B shows changes in cell cycle in percentage of the cells in G2 plus S phase in microglia cells, BS and BS treated or non-treated with LPS. Each dot symbol represent a replicate sample (n+3). FIG. 10C shows Annexin V Apoptosis Muse assay. Results show % live cells microglia, BS, ad BS cells treated (+) or not treated () with LPS. Each symbol represent a replicate (n=3). Statistical analysis in FIG. 10A was performed using Dunnett test on Ct. The asterisks symbols represents *P<0.05 and **P<0.01 (two independent experiments and three biological replicates on each experiment).

    [0161] FIG. 11 shows virus infection by immunohistochemistry in BrainSpheres with (OS) and without microglia (BS). Green represents the Flavivirus marker for ZIKV (NS1) and DENV-1, red represents microglia markers IBA1 and NF200. Bars represent 50 m (lower magnification) and 10 m (higher magnification).

    [0162] FIGS. 12A-12D depict the effects of Flavivirus infection on 3D human iPSC-derived brain spheres (BrainSpheres, BS) without or with microglia cells (OS). The microglia cells, BS, and BS were infected with Dengue, ZIKV-BR, and ZIKV-UG using MOI equal 0.1. FIG. 12A shows the growth kinetics of flaviviruses over time for the three models.

    [0163] The viral load (RNA copies/mL) are shown with standard deviation. FIG. 12B depicts changes in cell cycle shown as percentage of cells in G2/S phase in BS, BS, and microglia treated or non-treated with the different viruses. FIG. 12C shows Annexin V Apoptosis Muse assay results. Results represent % live cells in BS, BS, and microglia samples after the different flavivirus treatments. FIG. 12D shows gene expression relative quantification for TNF, CCL2, IL-1b, and IL-6 over the time. Statistical analysis was performed using the Dunnett's Test (*mean equal p<0.05 and **p<0.01) for two independent experiments, three biological replicates on each experiment.

    [0164] FIGS. 13A-13C show an alternative protocol performed to incorporate microglia into BS 3D cultures. When NPCs reached 95% confluence, 110.sup.6 microglia were added to the flask. After 24 h, the co-culture was detached mechanically with a cell scraper (Sarstedt, Newton, N.C., United States, 2-position, Blade 25, 83.1830), re-pipetted for disaggregation, and counted using the Countess Automated Cell Counter (Invitrogen, Carlsbad, Calif., United States). 210.sup.6 cells per well were then plated in non-treated 6-well plates and cultured as BS for 8 weeks. The density was chosen to have approximately 10% microglia cells. FIG. 13A shows a diagrammatic representation for the alternative protocol. FIG. 13B is immunohistochemistry showing microglia marker (IBA1) and neuronal marker (NF200). FIG. 13C shows immunohistopathology characterization of the microglia incorporation for this method of BS generation, markers are mentioned in Example

    DETAILED DESCRIPTION

    [0165] The present invention is based, at least in part, upon the discovery that brain microphysiological systems (BMPS) can be produced from induced pluripotent stem cells (iPSCs). Furthermore, the invention provides for reproducible BMPS that differentiate into mature neurons and glial cells (astrocytes and oligodendrocytes) in the central nervous system. This model is spontaneously electrophysiological active and may be reproduced with patient or genetically modified cells. The derivation of 3D BMPS from iPSCs has applications in the study and treatment of neurological and neurodevelopmental diseases. In some embodiments, the present disclosure provides for compositions and methods to study and/or treat neurodevelopmental and neurodegenerative disorders. In some cases, the neurodevelopmental and neurodegenerative disorders treated and/or studied by the present disclosure include, but are not limited to, autism, encephalitis, trauma, brain cancer, stroke, Amyotrophic lateral sclerosis, Huntington's Disease, muscular dystrophy, neurodegenerative disorder, neurodevelopmental disorder, Multiple Sclerosis, infection, Parkinson's Disease and Alzheimer's Disease.

    [0166] As described herein, the present disclosure provides for the derivation of a multitude of identical brain microphysiological systems (BMPS) from stem cells, preferably of human origin, but including stem cells from animal origin. The preferred starting material are human induced pluripotent stem cells or embryonic stem cells, although other pluripotent stem cells such as, for example, neuronal precursor cells and mesenchymal stem cells may also be employed. Human in-vitro models of brain neurophysiology are needed to investigate molecular and cellular mechanisms associated with neurological disorders and neurotoxicity. The techniques herein provide a reproducible iPSC-derived human 3D BMPS that includes differentiated mature neurons and glial cells (astrocytes and oligodendrocytes) that reproduce neuronal-glial interactions and connectivity. BMPS mature over about eight weeks and show the critical elements of neuronal function including, but not limited to, synaptogenesis and neuron-to-neuron (e.g. spontaneous electric field potentials) and neuronal-glial interactions (e.g. myelination). Advantageously, the BMPS described herein include mature neurons (e.g., glutamatergic, dopaminergic and GABAergic neurons) and glial cells (e.g., astrocytes and oligodendrocytes). Quantification of the different cell types exhibited high reproducibility between experiments. Moreover, the BMPS disclosed herein present neuron and glial functions such as spontaneous electrical activity and axon myelination. The BMPS described herein are able to mimic the microenvironment of the central nervous system, which is a significant advance in the field of neurobiology as this ability has not been achieved at this level of functionality, reproducibility, and consistency in prior art in vitro systems.

    [0167] In particular, the high amount of myelination of axons (up to 40%) in the disclosed BMPS represents a significant improvement over the prior art. Myelin pathology is a rather frequent condition in demyelinating and inflammatory disorders such as multiple sclerosis and post-infection diseases as well as other neurological diseases such as acute and post-traumatic brain injury, stroke and neurodegenerative disorders (see e.g., Fumagalli et al., 2016; Tse and Herrup, 2016). Moreover, the myelination process can be perturbed by exposure to chemicals and drugs (see e.g., Garcia et al., 2005; Brubaker et al., 2009; Creeley et al., 2013) during brain development and adulthood. For example, the BMPS disclosed herein show 40% overall myelination after 8 weeks of differentiation. Myelin was observed by immunohistochemistry and confirmed by confocal microscopy 3D reconstruction and electron microscopy. These findings are of particular relevance since myelin is crucial for proper neuronal function and development. The ability to assess oligodendroglia function and mechanisms associated with myelination in this BMPS model provide an excellent tool for future studies of neurological disorders such as multiple sclerosis and other demyelinating diseases. Thus, the BMPS provides a suitable and reliable model to investigate neuron-neuroglia function in neurotoxicology or other pathogenic mechanisms that has heretofore not been available in the prior art.

    [0168] The method disclosed combines gyratory shaking or regular stirring and the addition of growth factors to obtain the basic model. Suitable conditions as to how to achieve reproducible brain composition are disclosed herein. In contrast to earlier models, identical units of BMPS are produced, which allow comparative testing for the purpose of product development or safety assessments.

    [0169] According to the techniques herein, a number of additional measures complement the basic BMPS to increase their completeness in modeling the human brain and improve its usefulness for such testing, for example:

    [0170] 1. The addition of microglia: All stem-cell-derived brain models described so far lack micro-glia. The techniques herein provide that the addition of micro-glia precursor cells and suitable growth factors may allow microglia to be added to the model. Suitable cells may be monocytes (e.g., human monocytes), hematopoetic stem cells, respective (pro-)monocyte cell lines, and isolated microglia.

    [0171] 2. The addition of a blood-brain-barrier: The human brain is protected by a tight blood-brain-barrier that excludes many substances from the brain. For the first time, the techniques herein provide a method to form a blood-brain-barrier to the BMPS via cells such as, for example, human endothelial cells.

    [0172] 3. Addition of reporter and reporter cells: During the generation of the BMPS, cells carrying reporter for testing purposes may be used or added. These include, but are not limited to, fluorescent or luminescent markers to indicate a certain cell lineage or cell response. Genetic transient or permanent transfections are the primary, but not only, method of choice.

    [0173] 4. The BMPS may also be produced, entirely or in its components, from cells from a specific genetic background, e.g. from patients with a specific disease or after selective genetic manipulation of the cells.

    [0174] 5. The versatility of the BMPS may be improved by combining it with electrodes including, but not limited to, micro-electrode arrays (MEA).

    [0175] 6. The versatility of the BMPS may be improved by combining it with other MPS (organ models) platforms such as, for example, microfluidic human-on-chip systems, perfusion chambers and others.

    [0176] 7. Transportability of BMPS: Methods to cryopreserve BMPS were developed, which allow transport to other laboratories and testing or integration into multi-MPS platforms.

    [0177] Simplified neural in vitro systems do not reflect physiology, interactions between different cell types, or human genetics. Induced pluripotent stem cells (iPSC)-derived human-relevant microphysiological systems (MPS) better mimic the organ level, but are too complex for chemical and drug screening. As described herein, a reproducible 3D brain MPS (BMPS) that differentiates into mature neurons and glial cells (astrocytes and oligodendrocytes), which reproduces the topology of neuronal-glial interactions and connectivity in the central nervous system was developed. BMPS from healthy donors or patients evolve from a period of differentiation to maturity over about 8 weeks, including synaptogenesis, neuron-neuron interactions (e.g. spontaneous electric field potentials) and neuronal-glial interactions (e.g. myelination of axons), which mimic the microenvironment of the central nervous system. Effects of substances on neurodevelopment may be studied during this phase of BMPS development. In an exemplary embodiment, the techniques herein were used to study Parkinson's disease (PD) by evaluating neurotoxicants with a link to PD pathogenesis. Exposure to 5 M rotenone or 100 M 1-methyl-4-phenylpyridinium (MPP+) (or 1 mM 1-methyl-4-phenylpyridinium (MPP+) for gene expression studies) disrupted dopaminergic neurons, as observed by immunohistochemistry and altered expression of PD-related genes (TH, TBR1, SNCA, KEAP1, NDU1-131, ATP5C1, ATP50 and CASP1), thus recapitulating hallmarks of PD pathogenesis linked to toxicant compounds in the respective animal models. The BMPS, as described herein, provide a suitable and reliable model to investigate neuron-neuroglia function in neurotoxicity or other pathogenic mechanisms.

    [0178] There is growing concern about the continuing increase in neurodevelopmental and -degenerative disorders such as autism [1, 2], Parkinson's [3] and Alzheimer disease [4]. Although genetic factors play an important role, environmental factors such as pesticides, air pollution, cigarette smoke, and dietary toxicants appear to contribute [5, 6, 7]. Due to a lack of mechanistic understanding, it is difficult to study their contributions and interactions with respect to neurotoxicity and neurological disorders. The complexity of the CNS makes it challenging to find appropriate in vitro human-relevant models, ideally from different genetic backgrounds, that are able to recapitulate the relevant pathophysiology. The poor predictive ability of animal-based models for human health, which may fail to mimic human pathology as outlined in the costly and time-consuming current developmental neurotoxicity (DNT) guidelines, contributes to the lack of reliable information on DNT mechanisms [8]. At the same time, more than 90% of all drugs fail clinical trials after extensive animal testing [9] due, in part, to the fact that animal studies often do not reflect human physiology and inter-individual differences. Simple in vitro systems do not represent physiology and organ function [10], which creates a critical demand for better models in drug development, study of disease mechanisms and progression, bioengineering and toxicological testing.

    [0179] Attempts to generate more complex organotypic cultures or microphysiological systems (MPS) [11, 12, 13, 14] have resulted in more physiological multicellular 3D co-culture models able to simulate a functional part of the brain [15, 16]. 3D MPS have shown increased cell survival, differentiation, cell-cell interactions and can reproduce the complexity of the organ more closely [18]. Recent US research programs by NIH, FDA, DARPA, and DTRA have initiated the systematic development of MPS, including the model presented here, and their combinations to human-on-a-chip technologies to assess the safety and efficacy of countermeasures to biological and chemical terrorism and warfare [19].

    [0180] The discovery of induced pluripotent stem cells (iPSC) and new protocols to differentiate them into various cell types have boosted the development of human in vitro models [20, 21]. iPSC from healthy or patient donors with a specific disease [22, 23, 24, 12] used in MPS promise more human-representative models, e.g. the brain organoids by Lancaster et al. and Kadoshima et al., have been able to recapitulate features of human cortical development [15, 16]. These complex systems present novel tools to study biological mechanisms in the CNS, however, they have certain limitations: 1) an elaborate and complex protocol, 2) size differences between organoids, 3) necrosis in the center of the organoid, 4) low reproducibility in cell differentiation. The human BMPS described herein overcomes these limitations. The reproducible in vitro iPSC-derived human 3D brain microphysiological system (BMPS) is comprised of differentiated and mature neurons and glial cells (astrocytes and oligodendrocytes).

    [0181] The techniques herein provide a reproducible BMPS that contains several different cell types of the human brain, such as glutamatergic, dopaminergic and GABAergic neurons, astrocytes and oligodendrocytes. Moreover, the system has shown neural functionality as observed by spontaneous electrical activity and myelination of axons. Furthermore, the BMPS is reproducible from batch to batch and displays differences between healthy and patient donors. In addition, the obtained results demonstrate the application of such BMPS to the study of neurological disorders such as, for example, Parkinson's Disease (PD).

    [0182] The brain MPS described herein is a versatile tool for more complex testing platforms and strategies as well as research into neurotoxicity (e.g., developmental), CNS physiology and pathology. Some stem cell-derived brain microphysiological systems have been developed in the latest years showing the capability to recapitulate some of the in vivo biological process [36, 37, 38]. These models have an enormous advantage over the classical in vitro models to study various differentiation mechanisms, developmental processes and diseases [15]. However, they are mostly based on human embryonic stem cells raising ethical concerns and not allowing the use of patient cells. Moreover, they require complicated protocols that may reduce the reproducibility of the system and make it difficult to use in other fields such as chemical and drug screening. Some of these complex organoids have a large diameter, which can lead to extensive cell death, visible in the core of these tissues [15]. This may be due to insufficient diffusion of nutrients and oxygen in these non-vascularized systems, which may generate artifacts in toxicological and disease measurements and make it difficult to study different endpoints in a medium- to high-throughput manner. In addition, it will be challenging to adapt endpoints, established for relative simple 2D cultures, to such complex models. In the study described herein, the ability to generate a high number of viable (about 800 per batch), BMPS that are homogeneous in size (e.g., about 300 m) and shape using iPSC by applying a constant or regular gyratory shaking or stirring technique as described earlier for rat re-aggregating brain cell cultures [40] is shown. Control of the size using specific shaker speed allowed the aggregates to be maintained below 350 M in diameter (FIG. 1B) and avoid disparate morphology and/or necrosis in the middle of the organoids. Moreover, a spherical homogeneous shape facilitates fluorescent quantification and further imaging-based endpoints as well as reproducibility between aggregates. The BMPS had reproducible cell composition by immunomorphological quantification, assessment of imaging-based endpoints and neurophysiological testing.

    [0183] The 3D differentiation protocol described herein covered stages from neuronal precursors to different cell types of the mature CNS. After 2 weeks, BMPS consisted of an immature population of cells, showing minimal neuronal networks, low percentage of mature astrocytes and oligodendrocytes, with no myelin basic protein expression (FIG. 1C). Cell populations in the BMPS were further differentiated and matured over time (FIG. 2A). Evidence of iPSC differentiation into mature BMPS was supported by decreased Nestin expression over time. Nestin is normally expressed in embryonic tissue and its expression decreases with age in humans, therefore its decrement is a sign of maturation towards the adult phenotype [41, 42]. Also, the increasing presence of mature neuronal and glial markers such as MAP2, GFAP, Olig1 and MBP corroborate differentiation of the system. Different markers of pluripotency and proliferation decreased during the differentiation process, indicating maturing of the in vitro system (FIGS. 1C and 1D). Neuronal precursor markers such as Nestin, SOX1, SOX2 and the proliferation marker Ki67 decreased at the gene expression level and in flow cytometry measurements during the differentiation process (FIGS. 1C and 1D). Gene expression studies, flow cytometry, image analysis, immunostaining and miRNA studies have demonstrated an increase of cell maturation markers, which follows the BMPS differentiation (FIGS. 1A-1D, 2A-2H and 9A-9C). Obtained data demonstrate that this simple protocol is sufficient to generate representative CNS cell phenotypes that can reproduce various stages of differentiation. The presence of GABAergic neurons, dopaminergic neurons and glutamatergic neurons was observed by immunohistochemistry and real-time-PCR data (FIG. 1C and FIG. 2B). In addition, miRNAs such as mir-124, mir-132, mir-128, mir-137 and mir133b with a role in nervous system differentiation and neuronal degeneration [43, 44] increased during differentiation in patterns consistent with the in vivo situation. Moreover, the BMPS described herein produced spontaneous electrical activity (FIG. 3) confirming neuronal functionality of the system. However, further optimizations of the electrophysiological measurements using MEAs in 3D systems are needed.

    [0184] Most of the brain MPS published so far are entirely focused on neurons and not glia populations [45, 46]; the brain MPS described herein is the first 3D model with fully characterized mature human oligodendrocytes, astrocytes and neurons, derived from iPSC. Astrocytes and oligodendrocytes play an important role during neuronal development, plasticity and neuronal injury. Astrocytes have a role in protecting neurons, increasing neuronal viability and mitochondrial biogenesis from both exogenous (e.g. chemicals) or endogenous (such as glutamate-induced excitotoxicity or the Alzheimer related A131-42) toxicity [47, 48, 49, 50]. Astrocytes have an especially important role in neuroprotection from oxidative stress. Oxidative stress is known to be involved in a number of neuropathological conditions (such as neurodegenerative diseases) [51, 52, 53]. Thus, the presence of astrocytes in a biological system to study disease is crucial due to their role in detoxification and neuronal protection. Immunochemistry results from the iPSC-derived BMPS showed low numbers of astrocytes (GFAP-positive cells) at 2 weeks of differentiation, which increased continuously throughout differentiation (FIG. 2F-2H, and FIG. 2A). Real-time RT-PCR data supports these findings, as a continuous increase in both s100b and GFAP mRNA levels could be observed from 2 weeks up to 8 weeks old BMPS Immunohistochemistry and RT-PCR data results showed increasing numbers of astrocytes (GFAP-positive cells) in the BMPS model, reaching 19% astrocytes of the total cell population at 8 weeks. After 4 weeks of differentiation, astrocytes demonstrated increased positive staining for GFAP and the presence of glial network was observed (FIG. 2C, panels g, h). At the same time, the presence of oligodendrocytes and myelination of axons could be observed in the system described herein. This process is highly important, since it is known to be involved in many degenerative diseases such as multiple sclerosis [54], congenital hypomyelination [55], progressive multifocal leukoencephalopathy caused by JC virus infection [56], periventricular leukomalacia (PVL) [57] and Alzheimer's disease [58]. Moreover, several chemicals such as ethanol [59], tellurium [60] and lead [(61, 62, 63, 64, 65] have shown to have an effect on the myelination process.

    [0185] The presence of astroglia and oligodendroglia in the model described herein brings the system closer to the in vivo brain physiology, which is a crucial component to study neurodegeneration and neurotoxicity. In addition, the system has shown functionality as seen by imaging of cell-cell junctions, myelination, a rich astroglial network and electrical activity (FIG. 3). These characteristics make the BMPS described herein a promising tool to study interactions between human neuronal cells in neurological diseases. The use of iPSCs makes it possible to study genetic factors and gene/environment interactions.

    [0186] An assessment of the myelination process by quantification of MBP immunostaining along axons showed an increase over time reaching 42% of myelinated axons at 8 weeks (FIG. 2D). 3D reconstruction of confocal z-stacks images (FIGS. 2C and 2E) and electron microscopy confirmed the wrapping of axonal structures after 8 weeks of differentiation (FIG. 2C). These findings are of particular relevance since myelin is a critical element for proper neuronal function and development, the ensheathment of axons by myelin allows faster action potential transmission, reduces axonal energy consumption and protects the axons from degeneration[79]. Furthermore, recent evidence suggests that oligodendrocytes and myelin have a role in the metabolic support of axons independent of their role in action potential conduction, highlighting their importance in neuronal survival[80]. The ability of assessing oligodendroglia function and mechanisms associated with myelination in the BMPS model provide an excellent tool for future studies of neurological disorders such as multiple sclerosis and other demyelinating disorders.

    [0187] In one embodiment, the model described herein is useful for studying Parkinson's disease (PD). Traditionally, PD has been described as a pre-synaptic degenerative process that affects dopaminergic neurons and induces a fundamental motor disorder [66], however, non-motor symptoms can also be present [67]. Research in Parkinson's disease is experiencing an upswing at the moment, owing to a lack of curative drugs for the large number of patients. Drug testing is nearly exclusively performed in vivo in the so-called MPTP (the parent compound to the metabolite MPP+ used here), rotenone, methamphetamine and 6-hydroxydopamine models requiring tens of thousands of animals [68, 69, 70]. These model toxins are mainly used in mice and primates (and less in cell cultures) to model a disease state resembling PD. Human neurons, which would be most relevant, are not usually available and existing cell lines are only very poor substitutes. The model described herein shows that treatment with MPP+ or rotenone induced specific degeneration of dopaminergic neurons in agreement with Parkinson patients and current animal models of the disease (FIGS. 4E and 4F). The BMPS PD model has shown to recapitulate some of the molecular mechanisms of the human disease, e.g. increase in ROS production (FIGS. 4B and 3D) and changes in genes related to PD (FIG. 4G). BMPS treated with rotenone or MPP+ had decreased TH gene expression compared to controls, supporting the results presented in FIGS. 4E and 4F where the dopaminergic neuronal phenotype is altered after treatment with the two chemicals. TBR1 encodes a transcription factor involved in the regulation of developmental processes. It also plays a role in major neurological diseases such as Alzheimer Disease and PD [71]. This gene was down-regulated after treatment with non-cytotoxic concentrations of MPP+ and rotenone. At the same time, mRNA levels of SNAC were altered. -Synucleinopathy (common in Parkinson) is a neurodegenerative disease, which consists of the abnormal accumulation of aggregates of alpha-synuclein protein in neurons, nerve fibers or glial cells [72]. Alpha-synuclein plays regulatory roles such as synaptic maintenance, mitochondrial homeostasis, proteasome function, dopamine metabolism [73]. Reduction of SNCA (the alpha-synuclein encoding gene) after treatment with 5 M rotenone and to a lesser extent after 1 mM MPP+ exposure could be explained by the alteration of alpha-synuclein protein metabolism. However, it may be that longer exposure times are required to produce an increase in gene expression. Caspase-1 (CASP1) expression increased significantly after 24 h exposure to 1 M MPP+. Recently, some studies have identified human enzyme caspase-1 as the protease that cleaves -synuclein in vivo [74]. This cleavage generates -synuclein fragments that are prone to toxic aggregate formation. Finally, effects upon genes related with mitochondrial function (such as NDUFB1, ATP5C1 and ATP50) were down-regulated, more strongly in BMPS treated with MPP+ than rotenone. Changes in NDUFB1, indicate an alteration in mitochondrial function, agreeing with the phenomena already described in Parkinson's disease. This downregulation is linked to the increase in KEAP1 expression (oxidative stress marker) after 24 h exposure to 1 mM MPP+. The high variability in some of the genes may be explained by the selective effects of these chemicals (especially MPP+) to dopaminergic neurons, which represent only a subpopulation within the BMPS. While rotenone and MPP+ alter gene expression of this cell population, the other populations presented in BMPS appear not to be affected. Further studies using cell sorting could identify cell-specific effects.

    [0188] This disclosure provides for a description of a brain microphysiological system aiming to study various aspects of brain development, pathophysiology and disturbance by genetic and environmental factors. The possibilities to study developmental and neurodegenerative disorders, infections, toxicity and trauma are emerging with such a system. Furthermore, the potential to use iPSC from different donors adds a personalized component to these studies. The high reproducibility and relatively easy protocol, enables future higher throughput testing of chemicals, and drugs and their potential to induce or treat diseases.

    [0189] Autism

    [0190] Autism is a highly variable neurodevelopmental disorder that first appears during infancy or childhood, and generally follows a steady course without remission. Patients with autism may be severely impaired in some respects but normal, or even superior, in others. Overt symptoms gradually begin after the age of six months, become established by age two or three years, and tend to continue through adulthood, although often in more muted form.

    [0191] It is distinguished not by a single symptom, but by a characteristic triad of symptoms: impairments in social interaction; impairments in communication; and restricted interests and repetitive behavior. Other aspects, such as atypical eating, are also common but are not essential for diagnosis. Autism's individual symptoms occur in the general population and appear not to associate highly, without a sharp line separating pathologically severe from common traits.

    [0192] While autism is highly heritable, researchers suspect both environmental and genetic factors as causes. In rare cases, autism is strongly associated with agents that cause birth defects. Controversies surround other proposed environmental causes; for example, the vaccine hypotheses have been disproven. Autism affects information processing in the brain by altering how nerve cells and their synapses connect and organize; how this occurs is not well understood. It is one of three recognized disorders in the autism spectrum (ASDs), the other two being Asperger syndrome, which lacks delays in cognitive development and language, and pervasive developmental disorder, not otherwise specified (commonly abbreviated as PDD-NOS), which is diagnosed when the full set of criteria for autism or Asperger syndrome are not met.

    [0193] Globally, autism is estimated to affect 21.7 million people as of 2013. As of 2010, the number of people affected is estimated at about 1-2 per 1,000 worldwide. It occurs four to five times more often in boys than girls. About 1.5% of children in the United States (one in 68) are diagnosed with ASD as of 2014, a 30% increase from one in 88 in 2012. The rate of autism among adults aged 18 years and over in the United Kingdom is 1.1%. The number of people diagnosed has been increasing dramatically since the 1980s, partly due to changes in diagnostic practice and government-subsidized financial incentives for named diagnoses; the question of whether actual rates have increased is unresolved.

    [0194] Autism has a strong genetic basis, although the genetics of autism are complex and it is unclear whether ASD is explained more by rare mutations with major effects, or by rare multigene interactions of common genetic variants. Complexity arises due to interactions among multiple genes, the environment, and epigenetic factors which do not change DNA but are heritable and influence gene expression. Studies of twins suggest that heritability is 0.7 for autism and as high as 0.9 for ASD, and siblings of those with autism are about 25 times more likely to be autistic than the general population. However, most of the mutations that increase autism risk have not been identified. Typically, autism cannot be traced to a Mendelian (single-gene) mutation or to a single chromosome abnormality, and none of the genetic syndromes associated with ASDs have been shown to selectively cause ASD. Numerous candidate genes have been located, with only small effects attributable to any particular gene. The large number of autistic individuals with unaffected family members may result from copy number variationsspontaneous deletions or duplications in genetic material during meiosis. Hence, a substantial fraction of autism cases may be traceable to genetic causes that are highly heritable but not inherited: that is, the mutation that causes the autism is not present in the parental genome.

    [0195] Several lines of evidence point to synaptic dysfunction as a cause of autism. Some rare mutations may lead to autism by disrupting some synaptic pathways, such as those involved with cell adhesion. Gene replacement studies in mice suggest that autistic symptoms are closely related to later developmental steps that depend on activity in synapses and on activity-dependent changes. All known teratogens (agents that cause birth defects) related to the risk of autism appear to act during the first eight weeks from conception, and though this does not exclude the possibility that autism can be initiated or affected later, there is strong evidence that autism arises very early in development.

    [0196] Exposure to air pollution during pregnancy, especially heavy metals and particulates, may increase the risk of autism. Environmental factors that have been claimed to contribute to or exacerbate autism, or may be important in future research, include certain foods, infectious diseases, solvents, diesel exhaust, PCBs, phthalates and phenols used in plastic products, pesticides, brominated flame retardants, alcohol, smoking, illicit drugs, vaccines, and prenatal stress, although no links have been found, and some have been completely disproven.

    [0197] Autism does not have a clear unifying mechanism at either the molecular, cellular, or systems level; it is not known whether autism is a few disorders caused by mutations converging on a few common molecular pathways, or is (like intellectual disability) a large set of disorders with diverse mechanisms. Autism appears to result from developmental factors that affect many or all functional brain systems, and to disturb the timing of brain development more than the final product. Neuroanatomical studies and the associations with teratogens strongly suggest that autism's mechanism includes alteration of brain development soon after conception. This anomaly appears to start a cascade of pathological events in the brain that are significantly influenced by environmental factors. Just after birth, the brains of children with autism tend to grow faster than usual, followed by normal or relatively slower growth in childhood. It is not known whether early overgrowth occurs in all children with autism. It seems to be most prominent in brain areas underlying the development of higher cognitive specialization. Hypotheses for the cellular and molecular bases of pathological early overgrowth include the following: an excess of neurons that causes local over connectivity in key brain regions, disturbed neuronal migration during early gestation, unbalanced excitatoryinhibitory networks, and abnormal formation of synapses and dendritic spines, for example, by modulation of the neurexing neuroligin cell-adhesion system, or by poorly regulated synthesis of synaptic proteins.

    [0198] The immune system is thought to play an important role in autism. Children with autism have been found by researchers to have inflammation of both the peripheral and central immune systems as indicated by increased levels of pro-inflammatory cytokines and significant activation of microglia. Biomarkers of abnormal immune function have also been associated with increased impairments in behaviors that are characteristic of the core features of autism such as deficits in social interactions and communication. Interactions between the immune system and the nervous system begin early during the embryonic stage of life, and successful neurodevelopment depends on a balanced immune response. It is thought that activation of a pregnant mother's immune system such as from environmental toxicants or infection can contribute to causing autism through causing a disruption of brain development. This is supported by recent studies that have found that infection during pregnancy is associated with an increased risk of autism.

    [0199] The relationship of neurochemicals to autism is not well understood; several have been investigated, with the most evidence for the role of serotonin and of genetic differences in its transport. The role of group I metabotropic glutamate receptors (mGluR) in the pathogenesis of fragile X syndrome, the most common identified genetic cause of autism, has led to interest in the possible implications for future autism research into this pathway. Some data suggests neuronal overgrowth potentially related to an increase in several growth hormones or to impaired regulation of growth factor receptors. Also, some inborn errors of metabolism are associated with autism, but probably account for less than 5% of cases.

    [0200] The mirror neuron system (MNS) theory of autism hypothesizes that distortion in the development of the MNS interferes with imitation and leads to autism's core features of social impairment and communication difficulties. The MNS operates when an animal performs an action or observes another animal perform the same action. The MNS may contribute to an individual's understanding of other people by enabling the modeling of their behavior via embodied simulation of their actions, intentions, and emotions. Several studies have tested this hypothesis by demonstrating structural abnormalities in MNS regions of individuals with ASD, delay in the activation in the core circuit for imitation in individuals with Asperger syndrome, and a correlation between reduced MNS activity and severity of the syndrome in children with ASD. However, individuals with autism also have abnormal brain activation in many circuits outside the MNS and the MNS theory does not explain the normal performance of children with autism on imitation tasks that involve a goal or object.

    [0201] The under connectivity theory of autism hypothesizes that autism is marked by under functioning high-level neural connections and synchronization, along with an excess of low-level processes. Evidence for this theory has been found in functional neuroimaging studies on autistic individuals and by a brainwave study that suggested that adults with ASD have local over connectivity in the cortex and weak functional connections between the frontal lobe and the rest of the cortex. Other evidence suggests the under connectivity is mainly within each hemisphere of the cortex and that autism is a disorder of the association cortex.

    [0202] From studies based on event-related potentials, transient changes to the brain's electrical activity in response to stimuli, there is considerable evidence for differences in autistic individuals with respect to attention, orientation to auditory and visual stimuli, novelty detection, language and face processing, and information storage; several studies have found a preference for nonsocial stimuli. For example, magnetoencephalography studies have found evidence in children with autism of delayed responses in the brain's processing of auditory signals.

    [0203] Relations have been found between autism and schizophrenia based on duplications and deletions of chromosomes; research showed that schizophrenia and autism are significantly more common in combination with 1q21.1 deletion syndrome. Research on autism/schizophrenia relations for chromosome 15 (15q13.3), chromosome 16 (16p13.1) and chromosome 17 (17p12) are inconclusive.

    [0204] Diagnosis is based on behavior, not cause or mechanism. Under the DSM-5, autism is characterized by persistent deficits in social communication and interaction across multiple contexts, as well as restricted, repetitive patterns of behavior, interests, or activities. These deficits are present in early childhood, typically before age three, and lead to clinically significant functional impairment. Sample symptoms include lack of social or emotional reciprocity, stereotyped and repetitive use of language or idiosyncratic language, and persistent preoccupation with unusual objects. The disturbance must not be better accounted for by Rett syndrome, intellectual disability or global developmental delay. ICD-10 uses essentially the same definition. A pediatrician commonly performs a preliminary investigation by taking developmental history and physically examining the child. If warranted, diagnosis and evaluations are conducted with help from ASD specialists, observing and assessing cognitive, communication, family, and other factors using standardized tools, and taking into account any associated medical conditions. A pediatric neuropsychologist is often asked to assess behavior and cognitive skills, both to aid diagnosis and to help recommend educational interventions.

    [0205] Clinical genetics evaluations are often done once ASD is diagnosed, particularly when other symptoms already suggest a genetic cause. Although genetic technology allows clinical geneticists to link an estimated 40% of cases to genetic causes, consensus guidelines in the US and UK are limited to high-resolution chromosome and fragile X testing. Metabolic and neuroimaging tests are sometimes helpful, but are not routine.

    [0206] Many medications are used to treat ASD symptoms that interfere with integrating a child into home or school when behavioral treatment fails. More than half of US children diagnosed with ASD are prescribed psychoactive drugs or anticonvulsants, with the most common drug classes being antidepressants, stimulants, and antipsychotics. Antipsychotics, such as risperidone and aripiprazole, have been found to be useful for treating some conditions associated with autism, including irritability, repetitive behavior, and sleeplessness. A person with ASD may respond atypically to medications, the medications can have adverse effects, and no known medication relieves autism's core symptoms of social and communication impairments. Experiments in mice have reversed or reduced some symptoms related to autism by replacing or modulating gene function, suggesting the possibility of targeting therapies to specific rare mutations known to cause autism. Although many alternative therapies and interventions are available, few are supported by scientific studies. Some alternative treatments may place the child at risk. A 2008 study found that compared to their peers, autistic boys have significantly thinner bones if on casein-free diets; in 2005, botched chelation therapy killed a five-year-old child with autism. There has been early research looking at hyperbaric treatments in children with autism.

    [0207] Parkinson's Disease

    [0208] Parkinson's disease (PD, also known as idiopathic or primary parkinsonism, hypokinetic rigid syndrome (HRS), or paralysis agitans) is a degenerative disorder of the central nervous system mainly affecting the motor system. The motor symptoms of Parkinson's disease result from the death of dopamine-generating cells in the substantia nigra, a region of the midbrain. The causes of this cell death are poorly understood. Early in the course of the disease, the most obvious symptoms are movement-related; these include shaking, rigidity, slowness of movement and difficulty with walking and gait. Later, thinking and behavioral problems may arise, with dementia commonly occurring in the advanced stages of the disease, and depression is the most common psychiatric symptom. Other symptoms include sensory, sleep and emotional problems. Parkinson's disease is more common in older people, with most cases occurring after the age of 50; when it is seen in young adults, it is called young onset PD (YOPD).

    [0209] The main motor symptoms are collectively called parkinsonism, or a parkinsonian syndrome. The disease can be either primary or secondary. Primary Parkinson's disease is referred to as idiopathic (having no known cause), although some atypical cases have a genetic origin, while secondary parkinsonism is due to known causes like toxins. The pathology of the disease is characterized by the accumulation of a protein into Lewy bodies in neurons, and insufficient formation and activity of dopamine in certain parts of the midbrain. Where the Lewy bodies are located is often related to the expression and degree of the symptoms of an individual. Diagnosis of typical cases is mainly based on symptoms, with tests such as neuroimaging being used for confirmation.

    [0210] Diagnosis of Parkinson's disease involves a physician taking a medical history and performing a neurological examination. There is no lab test that will clearly identify the disease, but brain scans are sometimes used to rule out disorders that could give rise to similar symptoms. People may be given levodopa and resulting relief of motor impairment tends to confirm diagnosis. The finding of Lewy bodies in the midbrain on autopsy is usually considered proof that the person had Parkinson's disease. The progress of the illness over time may reveal it is not Parkinson's disease, and some authorities recommend that the diagnosis be periodically reviewed. Other causes that can secondarily produce a parkinsonian syndrome are Alzheimer's disease, multiple cerebral infarction and drug-induced parkinsonism. Parkinson plus syndromes such as progressive supranuclear palsy and multiple system atrophy must be ruled out. Anti-Parkinson's medications are typically less effective at controlling symptoms in Parkinson plus syndromes. Faster progression rates, early cognitive dysfunction or postural instability, minimal tremor or symmetry at onset may indicate a Parkinson plus disease rather than PD itself. Genetic forms are usually classified as PD, although the terms familial Parkinson's disease and familial parkinsonism are used for disease entities with an autosomal dominant or recessive pattern of inheritance.

    [0211] The PD Society Brain Bank criteria require slowness of movement (bradykinesia) plus either rigidity, resting tremor, or postural instability. Other possible causes for these symptoms need to be ruled out prior to diagnosis with PD. Finally, three or more of the following features are required during onset or evolution: unilateral onset, tremor at rest, progression in time, asymmetry of motor symptoms, response to levodopa for at least five years, clinical course of at least ten years and appearance of dyskinesias induced by the intake of excessive levodopa. Accuracy of diagnostic criteria evaluated at autopsy is 75-90%, with specialists such as neurologists having the highest rates. Computed tomography (CT) and conventional magnetic resonance imaging (MRI) brain scans of people with PD usually appear normal. These techniques are nevertheless useful to rule out other diseases that can be secondary causes of parkinsonism, such as basal ganglia tumors, vascular pathology and hydrocephalus. A specific technique of MRI, diffusion MRI, has been reported to be useful at discriminating between typical and atypical parkinsonism, although its exact diagnostic value is still under investigation. Dopaminergic function in the basal ganglia can be measured with different PET and SPECT radiotracers. Examples are ioflupane (123I) (trade name DaTSCAN) and iometopane (Dopascan) for SPECT or fluorodeoxyglucose (18F) and DTBZ for PET. A pattern of reduced dopaminergic activity in the basal ganglia can aid in diagnosing PD.

    [0212] Treatments, typically the medications L-DOPA and dopamine agonists, improve the early symptoms of the disease. As the disease progresses and dopaminergic neurons continue to be lost, these drugs eventually become ineffective at treating the symptoms and at the same time produce a complication marked by involuntary writhing movements. Surgery and deep brain stimulation have been used to reduce motor symptoms as a last resort in severe cases where drugs are ineffective. Although dopamine replacement alleviates the symptomatic motor dysfunction, its effectiveness is reduced as the disease progresses, leading to unacceptable side effects such as severe motor fluctuations and dyskinesias. Furthermore, there is no therapy that will halt the progress of the disease. Moreover, this palliative therapeutic approach does not address the underlying mechanisms of the disease.

    [0213] The term parkinsonism is used for a motor syndrome whose main symptoms are tremor at rest, stiffness, slowing of movement and postural instability. Parkinsonian syndromes can be divided into four subtypes according to their origin: primary or idiopathic, secondary or acquired, hereditary parkinsonism, and Parkinson plus syndromes or multiple system degeneration. Usually classified as a movement disorder, PD also gives rise to several non-motor types of symptoms such as sensory deficits, cognitive difficulties or sleep problems. Parkinson plus diseases are primary parkinsonisms which present additional features. They include multiple system atrophy, progressive supranuclear palsy, corticobasal degeneration and dementia with Lewy bodies.

    [0214] In terms of pathophysiology, PD is considered a synucleiopathy due to an abnormal accumulation of alpha-synuclein protein in the brain in the form of Lewy bodies, as opposed to other diseases such as Alzheimer's disease where the brain accumulates tau protein in the form of neurofibrillary tangles. Nevertheless, there is clinical and pathological overlap between tauopathies and synucleinopathies. The most typical symptom of Alzheimer's disease, dementia, occurs in advanced stages of PD, while it is common to find neurofibrillary tangles in brains affected by PD. Dementia with Lewy bodies (DLB) is another synucleinopathy that has similarities with PD, and especially with the subset of PD cases with dementia. However, the relationship between PD and DLB is complex and still has to be clarified. They may represent parts of a continuum or they may be separate diseases.

    [0215] Mutations in specific genes have been conclusively shown to cause PD. These genes encode alpha-synuclein (SNCA), parkin (PRKN), leucine-rich repeat kinase 2 (LRRK2 or dardarin), PTEN-induced putative kinase 1 (PINK1), DJ-1 and ATP13A2. In most cases, people with these mutations will develop PD. With the exception of LRRK2, however, they account for only a small minority of cases of PD. The most extensively studied PD-related genes are SNCA and LRRK2. Mutations in genes including SNCA, LRRK2 and glucocerebrosidase (GBA) have been found to be risk factors for sporadic PD. Mutations in GBA are known to cause Gaucher's disease. Genome-wide association studies, which search for mutated alleles with low penetrance in sporadic cases, have now yielded many positive results.

    [0216] The role of the SNCA gene is important in PD because the alpha-synuclein protein is the main component of Lewy bodies. The histopathology (microscopic anatomy) of the substantia nigra and several other brain regions shows neuronal loss and Lewy bodies in many of the remaining nerve cells. Neuronal loss is accompanied by death of astrocytes (star-shaped glial cells) and activation of the microglia (another type of glial cell). Lewy bodies are a key pathological feature of PD.

    [0217] Alzheimer's Disease

    [0218] Alzheimer's disease (AD) accounts for 60% to 70% of cases of dementia. It is a chronic neurodegenerative disease that often starts slowly, but progressively worsens over time. The most common early symptom is short-term memory loss. As the disease advances, symptoms include problems with language, mood swings, loss of motivation, disorientation, behavioral issues, and poorly managed self-care. Gradually, bodily functions are lost, ultimately leading to death. Although the speed of progression can vary, the average life expectancy following diagnosis is three to nine years. The cause of Alzheimer's disease is poorly understood. About 70% of the risk is believed to be genetic with many genes involved. Other risk factors include a history of head injuries, hypertension, or depression. The disease process is associated with plaques and tangles in the brain.

    [0219] Alzheimer's disease is characterized by loss of neurons and synapses in the cerebral cortex and certain subcortical regions. This loss results in gross atrophy of the affected regions, including degeneration in the temporal lobe and parietal lobe, and parts of the frontal cortex and cingulate gyrus Alzheimer's disease has been hypothesized to be a protein misfolding disease (proteopathy), caused by accumulation of abnormally folded A-beta and tau proteins in the brain. Plaques are made up of small peptides, 39-43 amino acids in length, called beta-amyloid (also written as A-beta or A). Beta-amyloid is a fragment from a larger protein called amyloid precursor protein (APP), a transmembrane protein that penetrates through the neuron's membrane. APP is critical to neuron growth, survival and post-injury repair. In Alzheimer's disease, an unknown process causes APP to be divided into smaller fragments by enzymes through proteolysis. One of these fragments gives rise to fibrils of beta-amyloid, which form clumps that deposit outside neurons in dense formations known as senile plaques.

    [0220] A probable diagnosis is based on the history of the illness and cognitive testing with medical imaging and blood tests to rule out other possible causes. Initial symptoms are often mistaken for normal ageing. Examination of brain tissue is needed for a definite diagnosis. Alzheimer's disease is diagnosed through a complete medical assessment. There is no one clinical test that can determine whether a person has Alzheimer's. Usually several tests are performed to rule out any other cause of dementia. The only definitive method of diagnosis is examination of brain tissue obtained from a biopsy or autopsy. Tests (such as blood tests and brain imaging) are used to rule out other causes of dementia-like symptoms. Laboratory tests and screening include: complete blood cell count; electrolyte panel; screening metabolic panel; thyroid gland function tests; vitamin B-12 folate levels; tests for syphilis and, depending on history, for human immunodeficiency antibodies; urinalysis; electrocardiogram (ECG); chest X-ray; computerized tomography (CT) head scan; and an electroencephalogram (EEG). A lumbar puncture may also be informative in the overall diagnosis.

    [0221] There are no known medications or supplements that decrease risk of Alzheimer's. Additionally, no known treatments stop or reverse Alzheimer's progression, although some may temporarily improve symptoms.

    [0222] This invention is further illustrated by the following examples, which should not be construed as limiting. The contents of all references, patents, and published patent applications cited throughout this application, as well as the figures, are incorporated herein by reference.

    EXAMPLES

    Example 1: Characterization of BMPS by Expression of Neural Specific Genes During Differentiation

    [0223] According to the techniques herein, the BMPS model established herein follows a stepwise differentiation protocol (FIG. 1A). In the final step, cells were differentiated into various neuronal and glial cell types during constant gyratory shaking. Briefly, the BMPS were established as follows: cells were differentiated, by addition of B27, GDNF and BDNF and withdrawal of stempro, basic FGF and EGF, into different neuronal and glial cell types with CNS functions during constant gyratory shaking. Advantageously, the techniques herein provide that the BMPS that were produced were of a spherical shape and a consistent size. For example, the BMPS showed spherical shapes and controlled sizes that were below 350 m after 17 days in culture, a size that avoids necrosis in the center of the aggregate (FIG. 1B) that occurs in larger spheroids (e.g., >350 m) due to nutrient and oxygen deprivation. Nutrient and oxygen deprivation-induced necrosis could produce artifacts in the different endpoints measured, especially in disease and toxicity studies. Five days after initiation of aggregation in NPC medium, spheres were on average 1305 m in diameter; the size increased to 30040 m during the first 17 days in differentiation medium. From day 17 onwards size remained constant around 310 m. Advantageously, this technique significantly increases throughput of BMPS production by allowing simultaneous production of several batches with different conditions. Without the shaking condition, aggregates tend to stick together, grow in different shapes, attach to the bottom and in some point get necrotic in the middle of the sphere. Thus, constant gyratory shaking technology is a suitable method to control the shape and size of BMPS.

    [0224] In order to characterize different stages of the differentiation and maturation process, BMPS were collected every week up to 8 weeks of differentiation (FIGS. 1C1-C5). Analysis of different neuronal and glial cell-specific genes by real-time reverse transcription polymerase chain reaction (RT-PCR) was performed to characterize the presence of neurons, astrocytes, oligodendrocytes and neural precursor cells (NPC). NPC are self-renewing and proliferating multi-potent cells able to generate different cell types of the central nervous system. The differentiation of NPC in 3D was initiated by changing the medium to differentiation medium. Gene expression of the cell proliferation marker Ki67 decreased 95% after 2 weeks of differentiation (FIG. 1C1, proliferation and stem cell markers). The remaining Ki67 expression appears to be due to the presence of a small population of NPC and other proliferating cell types such as oligodendrocytes and astrocytes (FIG. 1C2, astroglia and oligodendroglia). Astrocyte-specific genes (S100B and GFAP) showed a constant increase after two weeks, while, differentiation of oligodendrocytes was induced later, after six weeks of differentiation as shown by OLIG2 gene expression (FIG. 1C2).

    [0225] Gene expression of specific neurotransmitters or their receptors was used to characterize the identity of different neuronal populations and the differentiation patterns of the human iPSC derived BMPS (FIG. 1C4, neuronal markers; right y-axis relative quantification of GRIN1 and GABRA1; MBP, FOXA2, and SLC1A3). GRIN1 encodes the essential Glutamate [NMDA] receptor subunit zeta-1 [25] was increased at very early stages of differentiation (one week after induction of differentiation) and continued to increase up to 5 weeks when it reached a plateau (FIG. 1C4). Similarly, GAD1, a GABAergic neuronal gene marker which encodes the Glutamate decarboxylase 1, and catalyzes decarboxylation of glutamate to GABA, showed an increase in expression during the first 4 weeks of differentiation, reaching a plateau thereafter (FIG. 1C4). The expression of tyrosine hydroxylase (TH) a gene, which identifies dopaminergic neurons, was observed first after three weeks, showing delayed differentiation compared to glutamatergic neurons. The expression of TH increased constantly thereafter reaching an 86-fold increase at seven weeks compared to NPC (week 0; FIG. 1C4). GABRA1, which encodes the gamma-aminobutyric acid (GABA) receptor, showed a steady increase of expression after 2 weeks and reached its maximum increase of a 150-fold change at 8 weeks compared to week 0 (FIG. 1C4). Moreover other markers for specific part of the brain, such as ventral midbrain neuron marker LMX1A, FOXO1 and FOXA2 (Hedlund et al., 2016; Stott et al., 2013), cerebral cortex marker FOXO4, or markers for myelination CNP and MBP (Li and Richardson, 2008; Agrawal et al., 1994) and L-glutamate transport SLC1A6 (Sery et al., 2015) has been studied (FIG. 1D d). Based on the patterns of expression of neuronal genes, the iPSC-derived BMPS model closely represents the different neuronal populations of different cortical and subcortical areas of the human CNS, suggesting that some of the mechanisms implicated in the early stages of nervous system development are reflected.

    [0226] To prove that BMPS can be generated from different IPCs, another healthy line (IPS IMR90) and Down syndrome line (DYP0730) were used (FIG. 1C5). Both lines were able to generate BMPS and differentiated to neurons (MAP2 marker), astrocytes (GFAP marker) and oligodendrocytes (OLIG1 marker).

    Example 2: Characterization of BMPS by Flow Cytometry Analysis Shows Neuronal Maturation of the Human Induced Pluripotent Stem Cells Over Time

    [0227] In order to quantify cell populations in the iPSC-derived BMPS and verify the reproducibility between experiments and batches of the cell line (C1, CRL-2097), flow cytometry was performed using CNS-specific antibodies for identification of neural markers (Table 1). Flow cytometry allowed quantifying 60% of cells with proliferation marker (Ki67) at the NPCs stage (week 0), which was reduced during differentiation down to 9% at 2 weeks, 7% at 4 weeks and 1% at 8 weeks (FIG. 1D), indicating a fast reduction of proliferating cells after induction of differentiation. This confirms the gene expression data and indicates a fast reduction of proliferating cells after induction of differentiation. This result was confirmed by further analysis of NPC markers such as SOX1, SOX2 and Nestin. SOX1 and SOX2 are known to be involved in the maintenance of neural progenitor cell identity. The number of SOX1-, SOX2- and NES-positive (NPC marker) cells in the NPC population (week 0) was 46%, 68% and 60%, respectively. SOX1, SOX2 and NES expression was reduced dramatically with differentiation, showing very low positive populations at eight weeks (2%, 3% and 2%, respectively). This loss in the NPC population during differentiation was corroborated by Doublecortin (DCX), a microtubule-associated protein expressed in neuroblasts and immature neurons: the number of DCX-positive cells in NPC (week o) was around 30%, which reduced to 22% at two, 17% at four and 4% at eight weeks, respectively. On the other hand, the marker for mature neurons, Tuj1 (Neuron-specific class III beta-tubulin) presented the opposite pattern. Analysis showed low levels of Tuj1-positive cells at the NPC stage (week 0). The expression of this marker in the cell population increased to 70% after 2 weeks of differentiation and remained constant up to 8 weeks. These flow cytometry experiments indicate differentiation and maturation of the BMPS over time.

    [0228] Quantification of the cell population in at least three independent experiments showed low variability between cultures, demonstrating the reproducibility of the system. The variation (standard deviation, SD) between experiments decreased with the cell differentiation process and was very small at the latest maturation stage (eight weeks); DCX SD 0.9%, Ki67 SD 0.2%, SOX1 SD 0.7%, SOX2 SD 1.2%, NES SD 0.7% and Tuj1 SD 9.8% (FIG. 1E). These results indicate that after eight weeks of differentiation the cellular composition is similar and shows high reproducibility between different BMPS experiments.

    TABLE-US-00071 TABLE 1 Gene and miRNAs Taqman Assays. List of the primers used for the experiments. Catalog Assay ID Assay Type Availability Number Assay Name Gene Expression Taqman Primers Hs01060665 TaqMan Gene Inventoried 4331182 BACT Expression Assay Hs99999901 TaqMan Gene Inventoried 4331182 18S Expression Assay Hs04187831 TaqMan Gene Inventoried 4331182 NES Expression Assay Hs01032443 TaqMan Gene Inventoried 4331182 Ki67 Expression Assay Hs01088112 TaqMan Gene Inventoried 4331182 PAX6 Expression Assay Hs00909233 TaqMan Gene Inventoried 4331182 GFAP Expression Assay Hs00300164 TaqMan Gene Inventoried 4331182 OLIG2 Expression Assay Hs00902901 TaqMan Gene Inventoried 4331182 S100B Expression Assay Hs00609557 TaqMan Gene Inventoried 4331182 GRIN1 Expression Assay Hs00165941 TaqMan Gene Inventoried 4331182 TH Expression Assay Hs00971228 TaqMan Gene Inventoried 4331182 GABRA1 Expression Assay Hs01065893 TaqMan Gene Inventoried 4331182 GAD1 Expression Assay Hs00199577 TaqMan Gene Inventoried 4331182 SYN1 Expression Assay Hs00232429 TaqMan Gene Inventoried 4331182 TBR1 Expression Assay Hs01003383 TaqMan Gene Inventoried 4331182 SNCA Expression Assay Hs01003430 TaqMan Gene Inventoried 4331182 KEAP1 Expression Assay Hs00929425 TaqMan Gene Inventoried 4331182 NDUFB1 Expression Assay Hs01101219 TaqMan Gene Inventoried 4331182 ATP5C1 Expression Assay Hs00919163 TaqMan Gene Inventoried 4331182 ATP50 Expression Assay Hs00354836 TaqMan Gene Inventoried 4331182 CASP1 Expression Assay Hs00263981 TaqMan Gene Inventoried 4331182 CNP Expression Assay Hs01054576 TaqMan Gene Inventoried 4331182 FOXO1 Expression Assay Hs00188193 TaqMan Gene Inventoried 4331182 SLC1A3 Expression Assay Hs00936217 TaqMan Gene Inventoried 4331182 FOXO4 Expression Assay Hs00892663 TaqMan Gene Inventoried 4331182 LMX1A Expression Assay Hs00232764 TaqMan Gene Inventoried 4331182 FOXA2 Expression Assay miRNA Taqman Assays 1182 TaqMan Inventoried 4427975 mmu-miR- microRNA Assay 124a 2216 TaqMan Inventoried 4427975 hsa-miR- microRNA Assay 128a 457 TaqMan Inventoried 4427975 hsa-miR- microRNA Assay 132 2247 TaqMan Inventoried 4427975 hsa-miR- microRNA Assay 133b 1129 TaqMan Inventoried 4427975 mmu-miR- microRNA Assay 137 1094 Control miRNA Inventoried 4427975 RNU44 Assay

    Example 3: MicroRNAs as Neuronal Differentiation Markers in Human iPSC-Derived BMPS

    [0229] MicroRNAs (miRNA), known as posttranscriptional regulators of developmental timing, have recently been established as markers to study the differentiation process [26]. Expression of neural-specific miRNAs showed strong induction of miRNAs involved in neurogenesis (FIG. 1C3, miRNA). mir-124, the most abundant brain miRNA, was strongly induced in the earlier stages of differentiation, then slightly down-regulated at eight weeks of differentiation. This finding correlates with previous studies, where mir-124 was shown to promote neuronal lineage commitment at earlier stages of neural stem cells specification by targeting anti-neuronal factors [26]. mir-128, a modulator of late neural differentiation, was strongly up-regulated after 5 weeks of differentiation. mir-137, the most induced miRNA over time in the system described herein, is known as a regulator of neural differentiation of embryonic stem cells (ESCs) [27]. mir-132 and mir-133b which are involved in regulation of dopaminergic neuron maturation and function, were induced in week three of differentiation, a finding which correlates with the expression pattern of TH. Moreover, mir-132 is involved in dendritic spine formation [28]. These results support the view of a coordinated mechanism of neuronal differentiation as reflected by the patterns of neuronal gene and miRNA expression and neuronal and neurotransmitter identity.

    Example 4: Characterization of Human BMPS by Immunohistochemistry and Electron Microscopy Shows Evidence of Differentiation into Mature Brain Cell Types

    [0230] In order to assess the cellular composition and the process of maturation of the cells within the human BMPS, the expression of markers for different CNS cell populations including neurons and glial cells at 2, 4 and 8 weeks of differentiation were evaluated using immunohistochemistry and electron microscopy techniques. A reproducible pattern of expression consistent with maturation of the BMPS towards mature neural phenotypes was found. After 4 weeks of differentiation, the BMPS showed positive staining for mature neuronal markers such as microtubule-associated protein 2 (MAP2), neurofilament-heavy chain (NF, SMI32) and synaptophysin (FIG. 2A, 2B). Furthermore, different neuronal subtypes in the BMPS including dopaminergic (TH-positive neurons), glutamatergic (VGLUT1-positive neurons) and GABAergic interneurons (calbindin-positive neurons) (FIG. 2B, FIG. 8A) were observed. Moreover, the BMPS matured over time of differentiation as seen by decreased NES-positive cells (FIG. 2A) and increased cell-cell interactions (neuron-neuron and neuron glia) as subsets of neurons showed several processes, which resembled dendritic and axonal projections (FIG. 8A).

    [0231] A subset of neuronal cells exhibited immunoreactivity for markers such as NOGOA, 01, 02, and CNPase (FIG. 8B, panels a-j; FIG. 1C5), which identifies the presence of mature oligodendrocytes in the BMPS [31, 33]. Automatic image quantification showed that oligodendrocytes (CNPase, NOGOA, and Olig1) comprised 3, 9, and 11% of the total cell population, respectively, at 8 weeks of differentiation (FIG. 8C; FIG. 1C5). Similar to the in vivo physiology, these cells were immunoreactive for myelin basic protein (MBP) (FIG. 2), which characterizes myelinating oligodendrocytes [32]. Moreover, they had morphological features of normal human oligodendrocytes in vivo and appeared in close contact with neuronal processes (FIG. 8a-b, FIG. 2C, 2D) Similarly, populations of neuroglia such as astrocytes and oligodendrocytes were identified using specific antibody markers. A subset of neuroglial cells exhibit immunoreactivity for markers such as NOGOA, Olig1 and CNPase (FIG. 2C, panels a-f and 2C, panel i), which identify the presence of mature oligodendrocytes in the BMPS [29, 30, 31, 32]. This pattern of immunostaining suggests that oligodendrocytes within the BMPS are functional and myelinate axons. Similar to the in vivo physiology, these cells were also immunoreactive for myelin basic protein (MBP) (FIG. 2C panel i and 2C panel j), which characterizes myelinating oligodendrocytes [33, 30]. These cells had morphological features of normal human oligodendrocytes and appeared in close contact with neuron processes, which resemble axonal structures (FIG. 2C, panels j-m). In addition, a high number of mature astrocytes (FIG. 2Ca, 2Cb, 2Cg, 2Ch and 2F) at 4 and 8 weeks of differentiation were observed. Morphometric studies of neuronal processes identified by immunostaining with NF antibodies and MBP markers were used to estimate the percentage of myelinated axons within the BMPS with an average of 4% at 2 weeks, 25% at 4 weeks and 42% at 8 weeks of differentiation (p<0.001) (FIG. 2D). All analyzed BMPS showed similar extent of myelination at the same differentiation window. Percentages were calculated as the mean of at least 18 microscopy fields from at least 3 individual BMPS in 2 different experiments. Ultrastructural analysis by electron microscopy demonstrated cell projections, which enwrapped cell processes resembling axons after 8 weeks of differentiation (FIG. 2C).

    [0232] GFAP-positive cells formed numerous cell processes organized in a network typical for human astrocyte glial processes in vivo, which established contacts with other glial cells and neurons (FIG. 2Cg, 2Ch, 2F, and FIG. 8B). Image quantification revealed 19% of astrocytes in the total population (FIG. 8C). Altogether, the patterns of cell morphology, immunostaining and cell-cell interactions shown by neuronal and glial cell populations demonstrates that the BMPS recapitulates the cellular types and pattern of interactions seen in the human CNS and is, therefore, considered organotypic.

    [0233] The morphology of cell nuclei observed by immunocytochemistry and electron microscopy showed some variation in nuclear morphology attributed to (i) cell proliferation as seen by positive staining for Ki67 and Nestin markers, and (ii) nuclear fragmentation likely associated with apoptosis as indicated by caspase 3 staining (FIG. 2G, 2H) was observed. These observations were also confirmed by electron microscopy studies at 4 and 8 weeks of differentiation (FIG. 2H). The variation of nuclei morphology likely reflects the active stages of cell differentiation that BMPS exhibited during all stages of development. The presence of apoptotic nuclei likely resemble stages of cell death seen in normal neurodevelopment [34, 35]. Importantly, Caspase 3-positive nuclei did not concentrate in the center of the spheres and BMPS did not present necrosis in the center of the 3D structures (FIG. 2G). Thus, Caspase3-positive nuclei do not appear linked to deprivation of oxygen or nutrients. Caspase has been quantified at eight weeks in BMPS (FIG. 8C). Additionally, FIGS. 8D and 8E depict co-expression of mature oligodendroglia markers (MBP and 02) and expression of neuronal markers (VGLUT, TUJ1, SYN), respectively.

    [0234] Further analysis of neuronal cell populations and morphology presented a pattern of evolution that suggests BMPS maturation as seen by Nestin-positive cells decreasing over time of differentiation while MBP expressing cells increased (FIG. 2A). There was also evidence of cell-cell interactions as subsets of neurons showed several processes, which resemble dendritic and axonal projections that interact with other neurons as well as glial cells (FIG. 2B, FIG. 2H). Furthermore, cells immunostained with myelin binding protein (MBP) antibodies issued projections, which appear to enwrap neuronal processes, which resemble axons (FIG. 2C, panels i-k, 2C, panel m). The pattern of immunostaining with MBP and its association with neuronal processes suggests that oligodendrocytes within the BMPS exhibit myelinating properties such as in the human CNS in vivo. Ultrastructural analysis by electron microscopy demonstrated cell projections, which enwrapped cell processes resembling axons (FIG. 2C, panel m).

    Example 5: Microelectrode Array Recording of Spontaneous Electrical Activity of BMPS

    [0235] To test the neurophysiological properties of the cells within the BMPS model, spontaneous electrical activity in BMPS was analyzed by micro-electrode array (MEA)(see FIG. 3 generally). BMPS were plated in 12-well or 48-well MEA plates at 8 weeks of differentiation. The aggregates were attached to the MEAs using Matrigel coating. Spontaneous electrical activity was measured starting one week after plating up to two weeks. The activity was measured for 20 minutes on 7 different days. Electrodes were considered active when the recorded activity was above 0.05 spikes/sec. FIG. 3A shows a representative heatmap of a 48-well MEA plate measurement from one 20 minute recording. The heatmap represents the spike amplitude (V) with a minimum of 0 V and maximum of 40 V (FIG. 3A). The spikes showed a common waveform between different electrodes and measurements (FIG. 3B) and neurons were repeatedly firing. 25 electrodes, distributed over 19 wells, were included after the first step of data analysis. 20 to 40% of these 25 electrodes reached the threshold of 0.05 spikes/sec during each recording. FIG. 3F shows the spike events of active electrodes from one representative 20 minutes recording. These data show potential for the use of MEA to measure electrical activity of the 3D BMPS. Further optimization of the protocol may increase the measurement of the neuronal activity on the electrodes.

    Example 6: A Human 3D Model to Study Parkinson's Disease

    [0236] Due to the presence of TH-positive dopaminergic neurons in the iPSC-derived BMPS (FIG. 2B, panels k, 1, and FIG. 8), the possibility of using this model to study Parkinson's Disease (PD), a neurodegenerative disorder known to specifically affect dopaminergic neurons, was further explored. Two well-known neurotoxicants, which induce pathogenic processes resembling the mechanism associated with neurodegeneration in PD: the illicit drug MPTP's toxic metabolite MPP+ and the broadly used pesticide rotenone, were selected. Both MPP+ and rotenone interfere with oxidative phosphorylation in mitochondria by inhibiting complex I [36]. Initially, cytotoxicity experiments were performed to estimate sub-cytotoxic concentrations of these two compounds affecting only dopaminergic neurons (FIGS. 4A and 4C). Selective disruption of dopaminergic neurons but not of any other cell types in the systems described herein were observed with immunohistochemistry after exposure to 1 M rotenone and 100 M MPP+ for 24 h (FIGS. 4E and 4F). This effect was likely selective even at cytotoxic concentrations of 10 M rotenone and 1000 M MPP+ as these concentrations did not show any alterations in other neurofilament 200-positive neurons. Lower concentrations of these compounds may induce effects in dopaminergic neurons, however, the effect was not as obvious by immunocytochemistry. Higher concentrations of rotenone and MPP+(up to 50 M and 5000 M, respectively) led to general cytotoxicity and affected also other neuronal types stained positive for neurofilament 200 (FIGS. 4E and F). 5 M of rotenone and 1000 M of MPP+ were selected for further studies as these concentrations induced clear and selective dopaminergic effects. Reactive oxygen species (ROS) were measured in the cellular medium using the OxiSelect In Vitro ROS/RNS Assay Kit (Cellbiolabs, San Diego, Calif.) as an indication of oxidative stress. Exposure to rotenone at 5 M and MPP+at 1000 M showed an increase in ROS production after 24 hours exposure, while 12 hours showed no statistically significant changes. Real time RT-PCR was performed in order to determine effects of both chemicals on genes related to PD, mitochondrial dysfunction and oxidative stress. Tyrosine hydroxylase (TH, Dopaminergic neuronal marker) mRNA expression decreased by 84%11 after exposure to 5 M rotenone and 70%9 after exposure to 1000 M MPP+ for 24 hours. Additional genes related to PD also showed changes at sub-cytotoxic concentrations of MPP+ and rotenone. The expression of genes that encode T-box brain 1 (TBR1) and Alpha-synuclein (SNCA) protein decreased after 24 hours exposure. The reduction of TBR1 was 7013% (rotenone) and 7622% (MPP+) and the reduction of SNCA was 726% (rotenone) and 4140% (MPP, however, BMPS exposed to 1 mM MPP+ led to no statistically significant changes in SNCA expression). Expression of genes related to mitochondrial function complex I (NDUFB1) or complex 0 (ATP5C1 or ATP50) tended to decrease in expression but these changes were not statistically significant. Caspase-1 gene expression, which has been related to SNCA, increased after 24 hours exposure to MPP+. These results demonstrate the potential of BMPS for studies elucidating molecular mechanisms of PD, lending itself to PD drug and neurotoxicity screening.

    Example 7: Addition of Microglia

    [0237] Peripheral blood mononuclear cells (PBMCs) are isolated from fresh or commercially available cryo-preserved whole blood of pooled healthy donors by Ficoll or Percoll gradient centrifugation. Monocyte populations are obtained by negative magnet-antibody selection after Ficoll or Percoll gradient and then re-suspend in RPMI 1640. Monocytes are cultured in macrophage serum-free medium, stimulated with a cocktail of cytokines, GM-CSF and IL-34. Monocytes may also be obtained by differentiation of iPSCs, hematopoetic or other stem cells. The microglia-like cells are combined with neuronal precursor cells in shaker cultures to preferably arrive at a final concentration of 5-8% microglia.

    [0238] Primary monocytes or iPSC-derived monocytes may be incorporated into the system, both at early and later stages of BMPS differentiation. For the early stages, a number of 210.sup.6 NPCs mixed with 210.sup.4 monocytes are plated per 1 well (6 well-plate). Gyratory shaking is used at 88 rpms to generate spheres. After 2 days media are replaced with CNS differentiation medial (Neurobasal electro Medium (Gibco) supplemented with 5% B-27 Electrophysiology (Gibco), 1% glutamax (Gibco), 10 g human recombinant GDNF (Gemini), 10 g human recombinant BDNF (Gemini)) and macrophage differentiation media (Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% FCS, 0.055 mM -mercaptoethanol, M-CSF (50 ng/ml), and IL-3 (25 ng/ml) (R&D Systems). The medium is replaced every 3 days.

    [0239] Monocytes can also be incorporated after BMPS differentiation. For that, BMPS are differentiated up to 8 weeks. BMPS spheres are separated in 500 l Eppendorf tubes. 210.sup.4 monocytes are added to the Eppendorf with the BMPS. Tubes are shaking manually every hour, up to 8 hours. After that, BMPS-monocytes are collected and plated in 6 well plates. Cells are kept on constant shaking until use.

    [0240] The characterization of the immune-competent human organoids can be carried out by immunocytochemically assessing the presence of markers such as HLA-DR, and the ionized calcium-binding adapter molecule 1 (Iba1), specific microglial markers. Measures of cytokines and chemokines release and expression of receptors associated with microglia function (e.g., CCL2 and CX3CL) demonstrates successful engrafting of the microglia cells. This modified model is more suitable to investigate the neuroimmunological component associated with many substance exposures and diseases.

    Example 8: Addition of a Blood Brain Barrier

    [0241] The blood brain barrier (BBB) has a crucial role in neurotoxicity, being the last barrier for substances before reaching the brain. Moreover, the BBB is the bottleneck in brain drug development and is the single most important factor limiting the future growth of neurotherapeutics [81]. Most of the in vitro models do not incorporate BBB.

    [0242] Human brain microvascular endothelial cells (hBMECs) from human iPSCs are incorporated into the BMPS by two techniques. In the first approach, mature BBB endothelial cells and neuronal precursors cells (NPCs) are combined in a single cells suspension in a ratio of 1:5, gyratory shaking or stirring are used to generated spheroids and aggregates are cultured up to 8 weeks. In the second technique, mature BMPS (8 weeks of differentiation) are covered by BBB endothelial cells using gravity systems (aggrewell, gravity well or hanging drops). Cells may be covered as well with other cell types, such as fluorescent LUHMES cells (FIG. 7).

    Example 9: Addition of Reporters

    [0243] The BMPS gives the opportunity to develop cell-based assays allowing for high-content imaging (HCI) that can be adapted to high-throughput platforms, to evaluate the effects of toxicants on key cellular processes of neural development and physiology in the culture system.

    [0244] Example of establishing fluorescent iPSC cell line: Creation of reporter cells lines greatly assists imaging efforts by allowing us to avoid complications associated with staining 3D cultures, to image subsets of cells, and to perform functional assays. Differentiated 3D aggregates from iPSC cultures spiked with 1-2% of iPSCs ubiquitously expressing fluorescent protein allow visualizing individual cells within the aggregates aiding quantification of phenotypic parameters, including neurite outgrowth and migration. Lines expressing markers allow measurement of synapse formation (PSD95, Synapsin 1), proliferation (Ki67), glial maturation (GFAP), and calcium signaling (GCaMP). Clustered Regularly Interspaced Short Palindromic Repeats/Cas (CRISPR) were used to create the various lines. Similar in function to the well-established zinc-finger (ZFNs) and TALEN nucleases, the Cas9-CRISPR system is a new entrant into the rapidly emerging field of genome engineering and has been quickly adopted and validated across a wide array of human stem cells. Gene-editing in hiPSCs has traditionally been a technically difficult task but with these advances it is now possible to generate reporter and mutant cell lines with genetically matched controls [83, 84, 85, 86]; essential tools not only for this project but also for the future success of using human iPSC-derived cells in quantitative live-cell phenotypic assays of toxicant testing.

    [0245] Using the CRISPR-Cas9 system, fluorescent protein (FxP) reporter cell lines were generated by generating gRNAs targeting the gene of interested. In this system as described herein, an RNA guided Cas9 endonuclease is used in conjunction with customizable small guide RNAs (gRNAs) to target and cleave any DNA template with a GN21GG sequence; the first G is for the U6 polymerase promoter while the N21GG is for the protospacer adjacent motif (PAM) sequence requirement of Cas9 [86, 87, 89].

    [0246] For reporter cell generation, homology-directed repair (HDR) guides the insertion of the appropriate DNA donor fragment into a target site at regions of homology between the donor fragment and the genomic DNA target. An ES line that ubiquitously expresses GFP was created by introducing CAG promoter-driven GFP into the AAVS1 safe harbor locus, and can use these constructs to transfect iPSC cells. For other reporters, constructs may be created that will direct the integration of a self-cleaving P2A peptide sequence [90] targeted fluorescent protein cassette in frame at the stop codon of the gene of interest. The P2A sequence engineered between the C-terminus of the endogenous protein and the fluorescent protein may minimize possible fusion protein functional defects. Plasmids encoding the Cas9 nuclease, the targeting gRNA, and appropriate donor DNA will be introduced by electroporation, recombinant hiPSC clones will be manually selected and screened for the desired insertion by PCR, and the genotype may be verified by sequencing. Reporter hiPSCs will be subjected to a differentiation protocol and expression of the reporter validated by examining expression patterns and through immunohistochemistry experiments where it may be determined whether the FxP expressing cells co-label with known markers.

    Example 10: Using Cells with Specific Genetic Backgrounds

    [0247] The use of iPSCs, as described herein, has created new opportunities to study human diseases and gene/environment interaction [20, 21]. Fibroblasts or other somatic cells from healthy and diseased individuals can be reprogrammed into iPSCs, and subsequently be differentiated into all neural cell types. Similarly, iPSC can be genetically modified before creating the BMPS. As a proof-of-principle, iPSCs were obtained from patients with Down's syndrome (FIGS. 1C5 and 5A-D), Rett Syndrome and from individuals with mutations in disrupted in schizophrenia 1 (DISCI). DISCI may have some functional overlap with TSC-iPSCs as both are involved in the mTOR cell signaling pathway.

    [0248] The Down's syndrome model is further characterized (see FIGS. 5A-5D). Down's syndrome iPSCs have been successfully differentiated into neural precursor cells (NPCs). Currently the cells are differentiated in 3D and characterization by gene expression and immunohistochemistry is being performed. The Down's syndrome model has been exposed to compounds that induce oxidative stress (rotenone and paraquat). The response was compared to the model from healthy donors, which were more sensitive to these compounds than the healthy model.

    Example 11: Combining the BMPS with Other Organoids

    [0249] In some embodiments, BMPS may be combined with other organs and/or organ model systems. Several groups have been developing organ-on-a-chip platforms for different organs by using microfluidic techniques. Those platforms are designed to mimic in-vivo fluidic flows in the organs by separating cell culture chambers and perfusion channels, and successfully demonstrate recapitulation of iPSC-based organ functions. Together with other organ models on these platforms, the BMPS can be integrated, which allow us to untwine the complex toxicology from organ interactions. Such platforms allow (1) in-situ and high-throughput production of mini-brains on chip, (2) in-vivo like fluidic flow around mini-brains with enough supply of nutrient and small molecule through diffusion, (3) a large number of parallel test of toxic materials, and (4) a real-time monitoring of electrophysiological activities from BMPS with integrated electrodes. Companies such as TissUse GmbH have designed microfluidics platform that allow culture of floating spheres like the BMPS as described herein.

    Example 12: Cryopreservation and Other Modes of Transportability

    [0250] In order to e.g. incorporate the BMPS into platforms or enable any use in other laboratories, transportability of the system was optimized. Preliminary studies have shown possible recovery of the neuronal 3D aggregates after cryopreservation (FIG. 6). A human embryonal carcinoma stem cell line, (hNT2), and iPSC derived-aggregates were differentiated into mature neurons (8 weeks of differentiation for each cell line) and then cryopreserved with regular cryopreservation medium (95% FBS and 5% DMSO) or STEMdiff Neural Progenitor Freezing Medium (Stem cells technologies). After 2 days in liquid nitrogen, cells were thawed. Freezing media was removed and fresh media was added. One day later, viability was measured using the resazurin cell viability assay. hNT2 aggregates presented a 70% decrease in viability in both freezing medias while iPSC derived mini-brains showed a 20%-35% reduction in viability (FIG. 6). However, viability recovery of the 3D aggregates is currently optimized using other viability and functional assays. Optimization of this protocol will vary additives (DMSO, HES, glycerol, serum etc.), the cooling temperature gradient as well as thawing protocol.

    [0251] Human iPSC derived mini-brains are kept in culture at 37 C. In order to transport the live mini-brains, temperature must be controlled. Different methods can be used to control temperature during transport. Heating pads combined with an insulated box have been used to transport live biological material. Disposable chemical pads employ a one-time exothermic chemical reaction such as catalyzed rusting of iron, or dissolving calcium chloride. The most common reusable heat pads are based on a chemical reaction that transforms a liquid into a solid thus releasing energy. Some new heating pads (such as Deltaphase Isothermal Pad 3SET, from Braintree Scientific, Inc.) have been able to maintain 37 C. for more than 6 hours. 3D mini-brains cultured up to 8 weeks are sent in an insulated material box with heating pads. After transport, viability may be measured.

    Example 13: Overview

    [0252] The techniques herein provide a human BMPS model that is a versatile tool for more complex testing platforms, as well as for research into CNS physiology, mechanisms associated with (developmental) neurotoxicity, and pathogenesis of neurological disorders. Prior art stem cell-derived brain model systems developed in the past few years have shown the capability to recapitulate some of the in vivo biological processes (Juraver-Geslin and Durand, 2015; Nakano et al., 2012; Krug et al., 2014) and have an advantage over other classical in vitro models as they facilitate the study of various differentiation mechanisms, developmental processes and diseases (Lancaster et al., 2013). Unfortunately, these prior art systems require complicated protocols that reduce the reproducibility of the system and make it difficult to use in other fields such as chemical toxicity and drug screening. Additionally, these prior art models are also limited by large diameters, which lead to extensive cell death in the interior regions due to insufficient diffusion of oxygen and nutrients (Lancaster et al., 2013) and other artifacts.

    [0253] The techniques herein overcome the limitations of the prior art by developing a human in vitro model by the gyratory shaking technique that enables reliably generation of a high number (about 500 per six-well plate) of viable BMPS that are homogeneous in size and shape. Control of size makes it possible to keep cell aggregates below 350 M in diameter (FIG. 1C) and thereby avoid disparate morphology and/or necrosis in the center of the spheres. Moreover, the BMPS showed reproducible cell composition by immunomorphological quantification, assessment of imaging-based endpoints and flow cytometry analysis.

    [0254] As described herein, the 3D differentiation protocol for the BMPS covers stages from neuronal precursors to different cell types of the mature CNS. As discussed in detail above, at two weeks, BMPS consisted of an immature population of cells, showing minimal neuronal networks, a low percentage of mature astrocytes and oligodendrocytes, and minimal but early stages of myelin basic protein (MBP) expression. iPSC differentiation into mature BMPS was indicated by decreasing NES expression over time and a progressive expression of mature neuronal and glial markers such as MAP2, GFAP, 01 and MBP. Gene expression studies, flow cytometry, image analysis, immunostaining and miRNA studies have shown increase of cell maturation markers, which follow the BMPS differentiation. The presence of GABAergic neurons, dopaminergic neurons and glutamatergic neurons was documented by immunohistochemistry and real-time PCR data. Moreover, the BMPS showed spontaneous electrical activity, indicating neuronal functionality of the system.

    [0255] Since astrocytes and oligodendrocytes play important roles during neuronal development, plasticity and injury, the presence of glial cell populations in the presently disclosed BMPS model provides an excellent opportunity for the evaluation of neuronal-glial interactions and the role of glia in pathogenesis and toxicity processes. Astrocytes have an important role in protecting neurons, increasing neuronal viability and mitochondrial biogenesis from both exogenous (e.g. chemicals) and endogenous toxicity (Shinozaki et al., 2014; Aguirre-Rueda et al., 2015), especially against oxidative stress (Shao et al., 1997; Schwab and McGeer, 2008). Thus, their presence in a biological system to study disease and neurotoxicity is crucial Immunohistochemistry and RT-PCR results showed increasing numbers of astrocytes (GFAP-positive cells) in the BMPS model reaching 19% astrocytes of the total cell population at eight weeks, which is earlier than in previously described cortical spheroids, where similar proportions of GFAP-positive cells were observed first at day 181, at day 86 the number of GFAP+ cells was below 10% (Pasca et al., 2015).

    [0256] The most novel element of this BMPS is the presence of mature human oligodendrocytes with myelination properties, which has not been achieved in the prior art. Immunocytochemical and ultrastructural studies confirmed the morphological identity of these cells (FIG. 2D) as multiple markers for mature oligodendrocytes were expressed by rounded cells with branching processes and membrane sheaths that are similar to the ones found in humans in vivo. The structure and morphology was further confirmed by electron microscopy. Quantitative assessment of the myelination process of MBP immunostaining along axons showed an increase over time of differentiation reaching 42% of myelinated axons at eight weeks (FIG. 2D). 3D reconstruction of confocal z-stacks images (FIG. 2A) and electron microscopy confirmed the wrapping of axonal structures after eight weeks of differentiation (FIG. 2C). These findings are of particular relevance since myelin is a critical element for proper neuronal function and development, and the covering of axons by myelin allows faster action potential transmission, reduces axonal energy consumption and protects the axons from degeneration (Nave, 2010). Furthermore, recent evidence suggests that oligodendrocytes and myelin have a role in the metabolic support of axons independent of their role in action potential conduction, highlighting their importance in neuronal survival (Saab et al., 2013). This is the first time that a 3D human microphysiological system, consisting of different types of neurons and glial cells, has achieved such a high percentage of myelination. The ability to assess oligodendroglia function and mechanisms associated with myelination in this BMPS model provides an excellent tool for future studies of neurological disorders such as multiple sclerosis and other demyelinating disorders. As an illustration it was recently discovered that astroglia cells could promote oligodendrogenesis via secreted molecules (Jiang et al., 2016). A human BMPS that consist of neurons, astrocytes and oligodendrocytes is essential to evaluate this mechanism further and to develop a potential therapy for demyelinating disorders.

    [0257] In conclusion, the techniques herein provide a BMPS that replicates crucial aspects of brain physiology and functionality. The potential for studying developmental and neurodegenerative disorders, brain infections, toxicity and trauma with such a system is growing. Furthermore, the potential to use iPSCs from different donors adds a personalized component to these studies. The high reproducibility and relatively simple protocol, enables future medium-throughput (96-well format) testing of chemicals, drugs and their potential to induce or treat diseases.

    [0258] Methods and Materials

    [0259] Chemicals

    [0260] Rotenone and MPP+ were supplied from Sigma-Aldrich (St. Louis, Mo.). A 10 mM rotenone stock was prepared in DMSO Hybri-Max (Sigma) while MPP+ was diluted in water to a concentration of 30 mM.

    [0261] iPSC Generation

    [0262] CCD1079Sk (ATCC CRL2097), IPS IMR90 (WiCELL) and ATCCDYP0730 Human (IPS) Cells (ATCC ACS1003) fibroblasts were originally purchased from ATCC. All studies followed institutional IRB protocols approved by the Johns Hopkins University School of Medicine. Human fibroblasts and mouse embryonic fibroblasts (MEFs) were cultured in Dulbecco's modified Eagle's medium (DMEM, Mediatech Inc.) supplemented with 10% fetal bovine serum (FBS, HyClone) and 2 mM L-glutamine (Invitrogen). MEFs were derived from E13.5 CF-1 mouse embryos. Human iPCS cells were generated with the EBV-based vectors as previously described [75]. iPSC from other sources were used as well. Colonies of iPSCs were manually picked after 3-6 weeks for further expansion and characterization. iPSCs (passage 20) were cultured on irradiated MEFs in human embryonic stem cell (hESC) medium comprising D-MEM/F12 (Invitrogen), 20% Knockout Serum Replacement (KSR, Invitrogen), 2 mM L-glutamine (Invitrogen), 100 M MEM NEAA (Invitrogen), 100 M -mercaptoethanol (Invitrogen), and 10 ng/mL human basic FGF (bFGF, PeproTech). Media were changed daily and iPSC lines were passaged using collagenase (Invitrogen, 1 mg/ml in D-MEM/F12 for 1 hr at 37 C.). These iPSC lines have been previously fully characterized [75].

    [0263] Neuronal Progenitor Cells (NPC) Production

    [0264] NPC generated followed the previous published protocol [75]. Briefly, iPSCs colonies were detached from the feeder layer with collagenase (1 mg/ml) treatment for 1 hr and suspended in EB medium, comprising of FGF-2-free hESC medium supplemented with Dorsomorphin (2 M) and A-83 (2 M), in non-treated polystyrene plates for 4 days with a daily medium change. After 4 days, EB medium was replaced by neural induction medium (hNPC medium) comprising of DMEM/F12, N2 supplement, NEAA, heparin (2 g/ml) for 15 more days. The floating neurospheres were then dissociated to single cells in Accutase and plated in 175 mm flasks and were allowed to expand for 7 days. NPCs were expanded in poly-1-ornithine and laminin-coated 175 mm flask on StemPro NSC SFM (Life Technologies). Half of the media was changed every day. Cultures were maintained at 37 C. in an atmosphere of 5% CO.sub.2. After NPC generation, iPSCs colonies were detached and NPCs were expanded in poly-1-ornithine and laminin-coated 175 mm flask in StemPro NSC SFM (Life Technologies). Half of the media was changed every day. Cultures were maintained at 37 C. in an atmosphere of 5% CO2.

    [0265] BMPS Differentiation

    [0266] At 100% confluence NPCs were detached mechanically and counted. 210.sup.6 cells per well were plated in 2 ml of medium in non-treated 6 well-plates. Cells were grown in NPC media for two days under constant gyratory shaking. Subsequently, medium was changed to differentiation medium (Neurobasal electro Medium (Gibco) supplemented with 5% B-27 Electrophysiology (Gibco), 1% glutamax (Gibco), 0.02 g/ml human recombinant GDNF (Gemini), 0.02 g/ml human recombinant BDNF (Gemini)) Cultures were maintained at 37 C., 5% CO.sub.2 under constant gyratory shaking for up to 8 weeks. Differentiation medium was routinely changed every 2 days.

    [0267] Size Measurement

    [0268] Aggregates (n=20) from 3 independent experiments were randomly selected per time point for obtaining pictures and measuring size using SPOT software 5.0. Results were expressed as meanSD. Cells were kept two days in NPC medium, indicated as NPC med. 2d in FIG. 1B.

    [0269] RNA and miRNA Extraction

    [0270] Total RNA was extracted from aggregates every week up to 8 weeks of differentiation using Tripure (Roche, Switzerland) according to Chomczynski and Sacchi (1987) [76]. The same RNA extraction method was used to isolate RNA after toxicant treatment. RNA quantity and purity was determined using NanoDrop 2000c (Thermo Scientific). One microgram of RNA was reverse-transcribed using the M-MI V Promega Reverse Transcriptase (Promega) according to the manufacturer's recommendations. For miRNA reverse-transcription 60 ng of RNA were reverse transcribed using TaqMan microRNA Reverse transcription kit in combination with miRNA specific stem-loop primers, which are a part of TaqMAn microRNA expression assay. Upto eight stem-loop primers were multiplexed in one reaction.

    [0271] Quantitative RT-PCR

    [0272] The expression of genes was evaluated using specific Taqman gene expression assays (Life Technologies). miRNA expression was analyzed using TaqMAn microRNA expression assay in combination with TaqMan miRNA Reverse Transcription kit using protocol described in [77]. Table 1 shows a summary of the genes assayed. Real time RT-PCRs were performed using a 7500 Fast Real Time system machine (Applied Biosystems). Fold changes were calculated using the 2(Ct) method [78]. -actin and 18 s were used as a housekeeping genes for mRNA and RNU44 for miRNA. There were no statistically significant differences in expression for -actin, 18s, and RNU44. Data were presented as meanSD, normalized to housekeeping genes and week 0.

    [0273] Immunocytochemistry of the BMPS

    [0274] BMPS aggregates were collected at 2, 4 and 8 weeks. BMPS were fixed in 4% paraformaldehyde for 1 hour, washed 3 times in PBS, then incubated for 1 hour in blocking solution consisting of 5% normal goat serum (NGS) in PBS with 0.4% TritonX (Sigma). BMPS were then incubated at 4 C. for 48 hours with a combination of primary antibodies (Table 2) diluted in PBS containing 3% NGS and 0.1% TritonX. BMPS were washed in PBS 3 times after which they were incubated with the appropriate fluorophore-tagged secondary antibody for 1 hour in PBS with 3% NGS at room temperature. Double immunostaining was visualized using the proper combination of secondary antibodies (e.g., goat anti-rabbit secondary antibody conjugated with Alexa 594 and goat anti-mouse secondary antibody conjugated with Alexa 488 (Molecular Probes). Nuclei were counterstained with DRAQS dye (Cell Signaling; 1:5000 in 1PBS) or NucRed Live (Molecular Probes) for 15 minutes before mounted on slides with coverslips and Prolong Gold antifade reagent (Molecular Probes); BMPS used as negative controls for immunostaining were processed omitting the primary antibody. Images were taken using a Zeiss UV-LSM 510 confocal microscope. The experiments were performed in duplicates; at least three different fields of view were analyzed for each combination of antibodies. 3D reconstruction was done using Imaris 7.6.4 software for scientific imaging.

    TABLE-US-00072 TABLE 2 Primary Antibodies. Antibody Host Type Source Dilution NF-H Rabbit Polyclonal Enzo 1:1000 GFAP Rabbit Polyclonal Dako 1:500 Olig 1 Mouse Monoclonal Millipore 1:500 CNPase Mouse Monoclonal Millipore 1:500 Calbindin Mouse Monoclonal SIGMA 1:500 NOGO-A Rabbit Polyclonal Santa Cruz 1:500 Map2 Mouse Monoclonal Chemicon 1:1000 MBP/SMI99 Mouse Monoclonal COVANCE 1:1000 SMI-32 Mouse Monoclonal Stenberger 1:2000 Monoclonals Synaptophysin Mouse Monoclonal SIGMA 1:500 VGLUT1 Rabbit Polyclonal Alpha Diagnostic 1:500 TH Mouse Monoclonal Millipore 1:250 Nestin Rabbit Polyclonal Millipore 1:200 Ki67 Rabbit Polyclonal abeam 1:100 Caspase3 Rabbit Polyclonal R&D 0.2 g/ml OLIG1 Mouse Monoclonal Millipore 1:200 TUJ1 Mouse Monoclonal Stemcell 1:200 technologies S100B Rabbit Polyclonal Santa Cruz 1:200

    [0275] Automated Quantitation of Cell Types

    [0276] BMPS was differentiated for 8 weeks. Randomly selected pictures from three experiments were acquired by confocal imaging and then analyzed with a custom algorithm created with the Cellomics TargetActivation (Thermo Fisher Scientific, Pittsburgh, Pa.) image-analysis software package. With this algorithm, cells were identified based on DRAQS stained nucleus and quantified oligodendrocytes and astrocytes based on staining of CNPase, NOGO1 and GFAP.

    [0277] Myelination Assessment and Quantification

    [0278] To calculate the percentage of axonal myelination, a semi-automated computer platform was used, termed computer-assisted evaluation of myelin formation (CEM) [82], which uses NIH Image J built-in tools as well as a Math lab processing functions. The results were generated as pixel counts and percent values. The percent of myelinated axons was calculated by dividing the pixel count for myelin by the pixel count for axons after cell body removal and multiplying by 100. For each time point at least 18 fields from at least two independent experiments were analyzed.

    [0279] Electron Microscopy

    [0280] BMPS aggregates were collected at 2, 4 and 8 weeks and were fixed in 2% glutaraldehyde and 4% formaldehyde in 0.1M Sodium Cacodylate buffer (EMS, electron microscopy sciences) pH 7.4 with 3% sucrose and 3 mM CaCl.sub.2). Post-fixation was done with 2% osmium for 2 hours. The BMPS aggregates were then stained en bloc with 2% uranyl acetate in distilled water for 30 min and subsequently dehydrated in graded ethanol. Embed 812 (EMS) was used as the embedding media. Thin sections (70-80 nm) were cut on a Reichert Jung Ultracut E microtome and placed on formvar coated 100 mesh copper grids. The grids were stained with uranyl acetate and followed by lead citrate. All imaging was performed on a Zeiss Libra 120 electron microscope with a Veleta (Olympus) camera.

    [0281] Treatment and Cytotoxicity Assay

    [0282] BMPS was exposed to different concentrations of rotenone and MPP+ for 24 and 48 hours after 4 weeks of differentiation. Rotenone working solutions were prepared in differentiation medium from 10 nM or 100 M stocks to reach final concentrations of 0.1, 1, 10, 25 and 50 M. DMSO was used as vehicle control. MPP+ working solutions were prepared in differentiation medium from 30 mM stocks to reach final concentrations of 10, 50, 100, 500, 1,000, 5,000 and 10,000 M. Four independent experiments in 3 replicates were performed for each experimental condition (control and toxicant exposure for the different time points). Resazurin reduction assay was performed in order to determine cell viability after rotenone and MPP+ treatment. Resazurin (7-Hydroxy-3H-phenoxazin-3-one 10-oxide) is a blue dye that is reduced into red fluorescent resorufin by redox reactions in viable cells. 100 l Resazurin (2 mg/ml stock) were added directly to the 6 well plates (2 ml/well). Plates were incubated for 3 h at 37 C., 5% CO.sub.2. Subsequently, 50 l of medium were transferred from each well in triplicates to a 96-well plate and fluorescence was measured at 530 nm/590 nm (excitation/emission) using a multi-well fluorometric reader CytoFluor series 4000 (PerSeptive Biosystems, Inc). Data were presented as meanSD. Statistical analysis was performed using Dunnett's test.

    [0283] Reactive Oxygen Species Measurement

    [0284] Reactive oxygen species (ROS) were measured in cell media collected 24 hours after treatment with 5 M rotenone or 1,000 M MPP+ using the OxiSelect In Vitro ROS/RNS Assay Kit (Cell Biolabs, San Diego, Calif.). This is a fluorescence-based assay measuring the presence of total free radicals within a sample and was used according to the manufacturer's protocol. The quenched fluorogenic dye dichlorodihydrofluorescin-DiOxyQ (DCFH-DiOxyQ) which is similar to the popular 2,7-dichlorodihydrofluorescein diacetate (DCFH-DA) is first primed with a quench removal reagent. The resulted highly reactive non-fluorescent DCFH can react with present ROS species in the cell supernatant and is then oxidized to the highly fluorescent DCF (2,7-dichlorodihydroxyfluorescein). At every time point, 50 l of the cell supernatant was added to a 96-well plate in triplicates and was mixed and incubated with the DCFH-DiOxyQ for 45 minutes. The fluorescence intensity was measured with a fluorescence microplate reader at 480 nm/530 nm (excitation/emission) and was proportional to the total ROS/RNS levels within the sample.

    [0285] Flow Cytometry

    [0286] In order to quantify percentage of NPCs, and neurons within the aggregates, flow cytometry with NPC and neuronal markers was performed. Flow cytometry was performed according to previously published protocol [77] with some optimization steps for 3D cultures. Aggregates were washed once with PBS/1 mM EDTA and trypsinized directly in the well using TrypLE Express containing 4 units/ml DNAse for 30 min at 37 C. on the shaker. Pipetting the aggregates up and down with a 1 ml syringe and a 26G3/8 needle ensured generation of single cell suspension. Cells were counted, washed once with PBS/1 mM EDTA, fixed with 2% PFA for 20 min at 4 C., washed twice with PBS/1% BSA (wash solution I, WS I) and blocked for 30 min in blocking solution (PBS/1% BSA/0.15% saponin/10% NGS). 110.sup.6 cells were stained for one hour at 4 C. with fluorochrome-conjugated antibodies dissolved in blocking solution (Table 3). Unstained cells as well as cells incubated with isotype controls were used as negative controls to set the gates for measurements. Cells were washed twice with PBS/1% BSA/0.15% saponin, once with PBS/1% BSA. Flow cytometry was performed using a Becton Dickinson FACSCalibur system by measuring 10.sup.4 gating events per measurement. Data was analyzed using FlowJo v10 software.

    TABLE-US-00073 TABLE 3 Antibodies for flow cytometry analysis Antibodies Host type Source Dilution Alexa Fluor Mouse Monoclonal, BD Pharmingen 1:05 647 Nestin clone 25 Alexa Fluor Mouse Monoclonal, BD Pharmingen 1:05 488 -III- clone TUJ1 Tubulin PerCP-Cy Mouse Monoclonal, BD Pharmingen 1:20 5.5 Sox2 clone 030-678 PerCP-Cy Mouse Monoclonal, BD Pharmingen 1:20 5.5 Sox1 clone N23-844 PE Doublecortin Mouse Monoclonal, BD Pharmingen 1:20 clone 30 Alexa Fluor Mouse Monoclonal, BD Pharmingen 1:20 647 Ki67 clone B56

    [0287] Microelectrode Array (MEA) Recordings

    [0288] After 8 weeks of differentiation, BMPS were plated on 48-well MEA plates previously coated with Matrigel. During two weeks spontaneous electrical activity was recorded using the Maestro MEA platform and Axion's Integraded Studio (AXIS) software [Axion Biosystems inc.; Atlanta, US]. Each well of the 48-well MEA plate contains 16 individual microelectrodes (40-50 m diameter, center-to-center spacing 350 m) with integrated ground electrodes, resulting in a total of 768 electrodes/plate. The Maestro MEA platform has an integrated heating system, which can be controlled by AXIS software. All recordings were performed at a constant temperature of 37 C. Prior to a twenty minutes recording, the MEA plates were placed in the Maestro MEA platform and equilibrated for five min. AXIS software was used to control heating system and monitor the recordings, which includes simultaneously sampling of the channels at 12.5 kHz/channel with a gain of 1200 and a band pass filter of 200-5000 Hz. The recordings were converted into RAW files. After a recording the RAW-files were re-recorded with AXIS to convert the data into a spike file, which includes spike timing and profile information. A variable threshold spike detector was used for the spike-file, it was set at 6 times standard deviations of the rms-noise on each channel. The spike file was later used for data analysis with NeuroExplorer [Nex Technologies, Madison (AL), US] to convert data into Microsoft Excel files. Using the function rate histogram, a summary of the spikes of all electrodes of one plate was put into one Excel sheet. Only electrodes that recorded activity higher than 0.05 spikes/sec at least once over the time measured were included for data analysis.

    [0289] Statistical Analysis

    [0290] Statistical analysis was performed using GraphPad InStat 3. The Dunnett's test was applied to all the experiments shown here that compare to a control group. Statistically significant values (p<0.01) are marked with an asterisk (*). For myelination quantification at the different time points, a Kruskal-Wallis test was employed, statistical significance was considered for p values <0.05.

    REFERENCES

    [0291] 1. K. Y. Liu, M. King, P. S. Bearman. Social influence and the autism epidemic. AJS 115, 1387-434 (2010). [0292] 2. M. Rutter. Incidence of autism spectrum disorders: changes over time and their meaning. Acta. Paediatr. 94, 2-15 (2005). [0293] 3. S. K. Van Den Eeden, C. M. Tanner, A. L. Bernstein, R. D. Fross, A. Leimpeter, D. A. Bloch, L. M. Nelson. Incidence of Parkinson's disease: variation by age, gender, and race/ethnicity. Am. J. Epidemiol. 157, 1015-22 (2003). [0294] 4. W, A. Kukull, R. Higdon, J. D. Bowen, W. C. McCormick, L. Teri, G. D. Schellenberg, G. van Belle, L. Jolley, E. B. Larson. Dementia and Alzheimer disease incidence: a prospective cohort study. Arch. Neurol. 59, 1737-46 (2002). [0295] 5. C. Mo, A. J. Hannan, T. Renoir. Environmental factors as modulators of neurodegeneration: Insights from gene-environment interactions in Huntington's disease. Neurosci. Biobehav. Rev. 52, 178-192 (2015). [0296] 6. S. Karama, S. Ducharme, J. Corley, F. Chouinard-Decorte, J. M. Starr, J. M. Wardlaw, M. E. Bastin, I. J. Deary. Cigarette smoking and thinning of the brain's cortex. Mol. Psychiatry. In press (2015). [0297] 7. O. van de Rest, A. A. Berendsen, A. Haveman-Nies, L. C. de Groot. Dietary Patterns, Cognitive Decline, and Dementia: A Systematic Review. Adv. Nutr. 13, 154-168. (2015) [0298] 8. L. Smirnova H. T. Hogberg, M. Leist and T. Hartung. Developmental neurotoxicitychallenges in the 21st century and in vitro opportunities. ALTEX 31, 129-156 (2014), [0299] 9. T. Hartung. Look back in angerwhat clinical studies tell us about preclinical work. ALTEX. 30, 275-91 (2013) [0300] 10. T. Hartung. Food for thought . . . on cell culture. ALTEX. 24, 143-52 (2007) [0301] 11. D. Huh, D. C. Leslie, B. D. Matthews, J. P. Fraser, S. Jurek, G. A. Hamilton, K. S. Thorneloe, M. A. McAlexander, D. E. Ingber. A human disease model of drug toxicity-induced pulmonary edema in a lung-on-a-chip microdevice. Sci. Transl. Med. 7, 4(159):159ra147 (2012). [0302] 12. D. Pamies, T. Hartung, H. T. Hogberg. Biological and medical applications of a brain-on-a-chip. Exp. Biol. Med. 239,1096-107 (2014) [0303] 13. A. Agarwal, J. A. Goss, A. Cho, M. L. McCain, K. K. Parker. Microfluidic heart on a chip for higher throughput pharmacological studies. Lab on a chip 13, 3599-3608 (2013). [0304] 14. H. T. Hogberg, J. Bressler, K. M. Christian, G. Harris, G. Makri, C. O'Driscol, D. Pamies, L. Smirnova, Z. Wen, T. Hartung. Toward a 3D model of human brain development for studying gene/environment interactions. Stem. Cell. Res. Ther. 4 Suppl 1:S4 (2013). [0305] 15. M. A. Lancaster, M. Renner, C. A. Martin, D. Wenzel, L. S. Bicknell, M. E. Hurles, T. Homfray, J. M. Penninger, A. P. Jackson, J. A. Knoblich. Cerebral organoids model human brain development and microcephaly. Nature 19, 373-9 (2013). [0306] 16. Kadoshima T, Sakaguchi H, Nakano T, Soen M, Ando S, Eiraku M, Sasai Y. Self-organization of axial polarity, inside-out layer pattern, and species-specific progenitor dynamics in human ES cell-derived neocortex. Proc. Natl. Acad. Sci. USA. 110, 20284-9 (2013). [0307] 17. D. Huh, H. J. Kim, J P Fraser, D. E. Shea, M. Khan, A. Bahinski, G. A Hamilton, D. E. Ingber. Microfabrication of human organs-on-chips. Nat. Protoc. 8, 2135-57 (2013). [0308] 18. N. Alpe, A Bahinski, M. Daneshian, B. De Wever, E. Fritsche, A. Goldberg, J. Hansmann, T. Hartung, J. Haycock, H. Hogberg, L. Hoelting, J. M. Kelm, S. Kadereit, E. McVey, R. Landsiedel, M. Leist, M. Lbberstedt, F. Noor, C. Pellevoisin, D. Petersohn, U. Pfannenbecker, K. Reisinger, T. Ramirez, B. Rothen-Rutishauser, M. Schfer-Korting, K. Zeilinger, M. G. Zurich. State-of-the-art of 3D cultures (organs-on-a-chip) in safety testing and pathophysiology. ALTEX. 31, 441-77 (2014). [0309] 19. T. Hartung, J. Zurlo. Alternative approaches for medical countermeasures to biological and chemical terrorism and warfare. ALTEX. 29, 251-60 (2012). [0310] 20. K. Takahashi, K. Tanabe, M. Ohnuki, M. Narita, T. Ichisaka, K. Tomoda, S. Yamanaka. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131: 861-872 (2007). [0311] 21. J. Yu, M. A. Vodyanik, K. Smuga-Otto, J. Antosiewicz-Bourget, J. L. Frane, S. Tian, J. Nie, G. A. Jonsdottir, V. Ruotti, R. Stewart, I. I. Slukvin, J. A. Thomson. Induced pluripotent stem cell lines derived from human somatic cells. Science 318: 1917-1920 (2007) [0312] 22. Y. Tsai, B. Lu, B. Bakondi, S. Girman, A. Sahabian, D. Sareen, C. N. Svendsen, S. Wang. Human iPSC-Derived Neural Progenitors Preserve Vision in an AMD-like Model. Stem. Cells. In press (2015). [0313] 23. K. Nieweg, A. Andreyeva, B. van Stegen, G. Tanriver, K. Gottmann Alzheimer's disease-related amyloid- induces synaptotoxicity in human iPS cell-derived neurons. Cell. Death. Dis. In press. (2015) [0314] 24. S. Raitano, L. Ordovas, L. De Muynck, W. Guo, I. Espuny-Camacho, M. Geraerts, S. Khurana, K. Vanuytsel, B. I. Toth, T. Voets, R. Vandenberghe, T. Cathomen, L. Van Den Bosch, P. Vanderhaeghen, P. Van Damme, C. M. Verfaillie. Restoration of progranulin expression rescues cortical neuron generation in an induced pluripotent stem cell model of frontotemporal dementia. Stem Cell Reports. 13, 16-24 (2015). [0315] 25. H. Monyer, R. Sprengel, R. Schoepfer, A. Herb, M. Higuchi, H. Lomeli, N. Burnashev, B. Sakmann, P. H. Seeburg. Heteromeric NMDA receptors: molecular and functional distinction of subtypes. Science 256, 1217-1221 (1992). [0316] 26. X. Li, P. Jin. Roles of small regulatory RNAs in determining neuronal identity. Nat. Rev. Neurosci. 11, 329-38 (2010). [0317] 27. C. Tarantino, G. Paolella, L. Cozzuto, G. Minopoli, L. Pastore, S. Parisi, T. Russo. miRNA 34a, 100, and 137 modulate differentiation of mouse embryonic stem cells. FASEB Journal 24, 3255-3263 (2010). [0318] 28. D. Yang, T. Li, Y. Wang, Y. Tang, H. Cui, X. Zhang, D. Chen, N. Shen, W. Le W. miR-132 regulates the differentiation of dopamine neurons by directly targeting Nurrl expression. Journal of Cell Science 125, 1673-1682 (2012). [0319] 29. D. Edbauer, J. R. Neilson, K. A. Foster, C. F. Wang, D. P. Seeburg, M. N. Batterton, T. Tada, B. M. Dolan, P. A. Sharp, M. Sheng. Regulation of synaptic structure and function by FMRP-associated microRNAs miR-125b and miR-132. Neuron 65, 373-384 (2010). [0320] 30. S. U. Kim, F. A. McMorris, T. J. Sprinkle Immunofluorescence demonstration of 2:3-cyclic-nucleotide 3-phosphodiesterase in cultured oligodendrocytes of mouse, rat, calf and human. Brain Res. 300, 195-9 (1984). [0321] 31. W. Deng, R. D. Poretz. Oligodendroglia in developmental neurotoxicity. Neurotoxicology. 24, 161-78 (2003). [0322] 32. S. P. Fancy, J. R. Chan, S. E. Baranzini, R. J. Franklin, D. H. Rowitch. Myelin Regeneration: A recapitulation of development? Annu. Rev. Neurosci. 34, 21-43 (2011) [0323] 33. M. E. Schwab. Functions of Nogo proteins and their receptors in the nervous system. Nat. Rev. Neurosci. 11, 799-811 (2010). [0324] 34. D. H. Meijer, M. F. Kane, S. Mentha, H. Liu, E. Harrington, C. M. Taylor, C. D. Stiles, D. H. Rowitch. Separated at birth? The functional and molecular divergence of OLIG1 and OLIG2. Nat. Rev. Neurosci. 13, 819-31 (2012). [0325] 35. Y. Yamaguchi, M. Miura. Programmed cell death in neurodevelopment. Dev. Cell. 32, 478-90 (2015). [0326] 36. H. A. Juraver-Geslin, B. C. Durand. Early development of the neural plate: new roles for apoptosis and for one of its main effectors caspase-3. Genesis. 53, 203-24 (2015). [0327] 37. A. K. Krug, S. Gutbier, L. Zhao, D. Pltl, C. Kullmann, V. Ivanova, S. Forster, S. Jagtap, J. Meiser, G. Leparc, S. Schildknecht, M. Adam, K. Hiller, H. Farhan, T. Brunner, T. Hartung, A. Sachinidis, M. Leist. Transcriptional and metabolic adaptation of human neurons to the mitochondrial toxicant MPP(+). Cell Death Dis. 5, e1222 (2014). [0328] 38. T. Nakano, S. Ando, N. Takata, M. Kawada, K. Muguruma, K. Sekiguchi, K. Saito, S. Yonemura, M. Eiraku, Y. Sasai. Self-formation of optic cups and storable stratified neural retina from human ESCs. Cell Stem Cell. 14, 771-85 (2012) [0329] 39. M. Eiraku, N. Takata, H. Ishibashi, M. Kawada, E. Sakakura, S. Okuda, K. Sekiguchi, T. Adachi, Y. Sasai. Self-organizing optic-cup morphogenesis in three-dimensional culture. Nature. 472, 51-6 (2012). [0330] 40. H. Suga, T. Kadoshima, M. Minaguchi, M. Ohgushi, M. Soen, T. Nakano, N. Takata, T. Wataya, K. Muguruma, H. Miyoshi, S. Yonemura, Y. Oiso, Y. Sasai. Self-formation of functional adenohypophysis in three-dimensional culture. Nature. 480, 57-62 (2011). [0331] 41. E. van Vliet, S. Morath, C. Eskes, J. Linge, J. Rappsilber, P. Honegger, T. Hartung, S. Coecke. A novel in vitro metabolomics approach for neurotoxicity testing, proof of principle for methyl mercury chloride and caffeine. Neurotoxicology. 29, 1-12 (2008). [0332] 42. J. Kim, K. Inoue, J. Ishii, W. B. Vanti, S. V. Voronov, E. Murchison, G. Hannon, A. Abeliovich. A MicroRNA feedback circuit in midbrain dopamine neurons. Science 317, 1220-1224 (2007). [0333] 43. C. Wiese, A. Rolletschek, G. Kania, P. Blyszczuk, K. V. Tarasov, Y. Tarasova, R. P. Wersto, K. R. Boheler, A. M. Wobus. Nestin expressiona property of multi-lineage progenitor cells? Cell. Mol. Life. Sci. 61, 2510-22 (2004). [0334] 44. C. Lpinoux-Chambaud, J. Eyer. Review on intermediate filaments of the nervous system and their pathological alterations. Histochem. Cell. Biol. 140, 13-22 (2013). [0335] 45. J. Park, B. K. Lee, G. S. Jeong, J. K. Hyun, C. J. Lee, S. H. Lee. Three-dimensional brain-on-a-chip with an interstitial level of flow and its application as an in vitro model of Alzheimer's disease. Lab Chip. 15, 141-50 (2015). [0336] 46. J. P. Done, B. Morrison, R. S. Schloss, M. L. Yarmush. Brain-on-a-chip microsystem for investigating traumatic brain injury: Axon diameter and mitochondrial membrane changes play a significant role in axonal response to strain injuries. Technology (Singap. World. Sci.). 2,106 (2014). [0337] 47. S. J. Mullett, D. A. Hinkle. DJ-1 knock-down in astrocytes impairs astrocyte-mediated neuroprotection against rotenone. Neurobiol. Dis. 33, 28-36 (2009). [0338] 48. Y. Shinozaki, M. Nomura, K. Iwatsuki, Y. Moriyama, C. Gachet, S. Koizumi Microglia trigger astrocyte-mediated neuroprotection via purinergic gliotransmission. Sci. Rep. 4, 4329 (2014). [0339] 49. D. Aguirre-Rueda, S, Guerra-Ojeda, M. Aldasoro, A. Iradi, E. Obrador, A. Ortega, M. D. Mauricio, J. M. Vila, S. L. Valles. Astrocytes protect neurons from A131-42 peptide-induced neurotoxicity increasing TFAM and PGC-1 and decreasing PPAR- and SIRT-1. Int. J. Med. Sci. 12, 48-56. (2015). [0340] 50. R. Sattler, M. Tymianski. Molecular mechanisms of glutamate receptormediated excitotoxic neuronal cell death. Mol. Neurobiol. 24, 107-129 (2001). [0341] 51. Y. Shao, M. Gearing, S. S. Mirra. Astrocyte-apolipoprotein E associations in senile plaques in Alzheimer disease and vascular lesions: a regional immunohistochemical study. J. Neuropathol. Exp. Neurol. 56, 376-381 (1997) [0342] 52. C. Schwab, P. L. McGeer. Inflammatory aspects of Alzheimer disease and other neurodegenerative disorders. J. Alzheimers. Dis. 13, 359-369 (2008). [0343] 53. P. Damier, E. C. Hirsch, P. Zhang, Y. Agid, F. Javoy-Agid. Glutathione peroxidase, glial cells and Parkinson's disease. Neuroscience 52, 1-6 (1993). [0344] 54. C. Xie, Y. Q. Liu, Y. T. Guan, G. X. Zhang. Induced Stem Cells as a Novel Multiple Sclerosis Therapy. Curr Stem Cell Res Ther. In press (2015). [0345] 55. S. Wang, J. Bates, X. Li, S. Schanz, D. Chandler-Militello, C. Levine, N. Maherali, L. Studer, K. Hochedlinger, M. Windrem, S. A. Goldman. Human iPSC-derived oligodendrocyte progenitor cells can myelinate and rescue a mouse model of congenital hypomyelination. Cell Stem Cell. 12, 252-64 (2013) [0346] 56. M. Pinto, S. Dobson. BK and JC virus: a review. J. Infect. 68 Suppl 1:S2-8 (2014). [0347] 57. X. B. Liu, Y. Shen, J. M. Plane, W. Deng. Vulnerability of premyelinating oligodendrocytes to white-matter damage in neonatal brain injury. Neurosci. Bull. 29, 229-38 (2013). [0348] 58. G. Bartzokis. Age-related myelin breakdown: a developmental model of cognitive decline and Alzheimer's disease. Neurobiol. Aging. 25, 5-18 (2004). [0349] 59. H. Okamoto, T. Miki, K. Y. Lee, T. Yokoyama, H. Kuma, Z. Y. Wang, H. Gu, H. P. Li, Y. Matsumoto, S. Irawan, K. S. Bedi, Y. Nakamura, Y. Takeuchi. Oligodendrocyte myelin glycoprotein (OMgp) in rat hippocampus is depleted by chronic ethanol consumption. Neurosci. Lett. 406, 76-80 (2006). [0350] 60. T. W. Bouldin, G. Samsa, T. S. Earnhardt, M. R. Krigman. Schwann cell vulnerability to demyelination is associated with internodal length in tellurium neuropathy. J. Neuropathol. Exp. Neurol. 47, 41-47 (1988). [0351] 61. P. David, K. Subramaniam. Prenatal alcohol exposure and early postnatal changes in the developing nerve-muscle system. Birth Defects Res. A. Clin. Mol. Teratol. 73, 897-903 (2005). [0352] 62. G. J. Harry, A. D. Toews, M. R. Krigman, P. Morell. The effect of lead toxicity and milk deprivation of myelination in the rat. Toxicol. Appl. Pharmacol. 77, 458-464 (1985). [0353] 63. S. J. Rothenberg, A. Poblano, S. Garza-Morales. Prenatal and perinatal low level lead exposure alters brainstem auditory evoked responses in infants. Neurotoxicology 15, 695-699 (1994). [0354] 64. E. Tiffany-Castiglioni, J Zmudzki, G. R. Bratton. Cellular targets of lead neurotoxicity: in vitro models. Toxicology 42, 303-315 (1986). [0355] 65. E. Tiffany-Castiglioni. Cell culture models for lead toxicity in neuronal and glial cells. Neurotoxicology. 14, 513-36 (1993). [0356] 66. J. Parkinson. An essay on the shaking palsy. 1817. J. Neuropsychiatry Clin. Neurosci. 14, 223-36 (2002) [0357] 67. K. R. Chaudhuri, P. Odin. The challenge of non-motor symptoms in Parkinson's disease. Prog. Brain. Res. 184, 325-41 (2010). [0358] 68. P. McGonigle. Animal models of CNS disorders. Biochem. Pharmacol. 87, 140-9 (2014). [0359] 69. K. Tieu. A guide to neurotoxic animal models of Parkinson's disease. Cold. Spring. Harb. Perspect. Med. In press (2011). [0360] 70. S. E. Cavanaugh, J. J. Pippin, N. D. Barnard. Animal models of Alzheimer disease: historical pitfalls and a path forward. ALTEX. 31, 279-302 (2014). [0361] 71. A. Pombero, C. Bueno, L. Saglietti, M. Rodenas, J. Guimera, A. Bulfone, S. Martinez. Pallial origin of basal forebrain cholinergic neurons in the nucleus basalis of Meynert and horizontal limb of the diagonal band nucleus. Development. 138, 4315-26 (2011). [0362] 72. H. McCann, C. H. Stevens, H. Cartwright, G. M. Halliday. -Synucleinopathy phenotypes. Parkinsonism. Relat. Disord. 20 Suppl 1, S62-7 (2014). [0363] 73. V. N. Uversky. A protein-chameleon: conformational plasticity of alphasynuclein, a disordered protein involved in neurodegenerative disorders. J. Biomol. Struct. Dyn. 21, 211-34 (2003) [0364] 74. G. A. Petsko and D. Ringer. Ice cleaved alpha-synuclein a biomarker. Patent WO2012061786 A1. (2012) [0365] 75. Wen Z, Nguyen H N, Guo Z, Lalli M A, Wang X, Su Y, Kim N S, Yoon K J, Shin J, Zhang C, Makri G, Nauen D, Yu H, Guzman E, Chiang C H, Yoritomo N, Kaibuchi K, Zou J, Christian K M, Cheng L, Ross C A, Margolis R L, Chen G, Kosik K S, Song H, Ming G L. Synaptic dysregulation in a human iPS cell model of mental disorders. Nature. 2014 Nov. 20; 515(7527):414-8. [0366] 76. P. Chomczynski, N. Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156-9 (1987). [0367] 77. L. Smirnova, A. E. M. Seiler, A. Luch. microRNA profiling as tool for developmental neurotoxicity testing (DNT). Toxicol. 64:20.9.1-20.9.22, 2015 [0368] 78. K. J. Livak, T. D. Schmittgen. Analysis of relative gene expression data using real-time quantitative PCR and the 2(Delta Delta C(T)) Method. Methods. 25, 402-8 (2001). [0369] 79. Nave, K. A. Myelination and support of axonal integrity by glia. Nature 468, 244-252, (2010). [0370] 80. Saab, A. S., Tzvetanova, I. D. & Nave, K. A. The role of myelin and oligodendrocytes in axonal energy metabolism. Current opinion in neurobiology 23, 1065-1072, (2013). [0371] 81. Pardridge, W. M. Crossing the blood brain barrier: are we getting it right? Drug Disc. Today January 1; 6(1): 1-2, (2001). [0372] 82. Kerman, B. E. et al. In vitro myelin formation using embryonic stem cells. Development 142, 2213-2225, (2015) [0373] 83. Gaj T, Gersbach C A, Barbas C F 3rd. ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends Biotechnol. July; 31(7):397-405, (2013). [0374] 84. Hockemeyer D, Soldner F, Beard C, Gao Q, Mitalipova M, DeKelver R C, Katibah G E, Amora R, Boydston E A, Zeitler B, Meng X, Miller J C, Zhang L, Rebar E J, Gregory P D, Urnov F D, Jaenisch R. Efficient targeting of expressed and silent genes in human ESCs and iPSCs using zinc-finger nucleases. Nat Biotechnol. September; 27(9):851-7, (2009). [0375] 85. Hockemeyer D, Wang H, Kiani S, Lai C S, Gao Q, Cassady J P, Cost G J, Zhang L, Santiago Y, Miller J C, Zeitler B, Cherone J M, Meng X, Hinkley S J, Rebar E J, Gregory P D, Urnov F D, Jaenisch R. Genetic engineering of human pluripotent cells using TALE nucleases. Nat Biotechnol. July 7; 29(8):731-4, (2011). [0376] 86. Mali P, Aach J, Stranges P B, Esvelt K M, Moosburner M, Kosuri S, Yang L, Church G M. CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nat Biotechnol. September; 31(9):833-8, (2013). [0377] 87. Chang N, Sun C, Gao L, Zhu D, Xu X, Zhu X, Xiong J W, Xi J J. Genome editing with RNA-guided Cas9 nuclease in zebrafish embryos. Cell Res. April; 23(4):465-72, (2013). [0378] 88. Cong L, Ran F A, Cox D, Lin S, Barretto R, Habib N, Hsu P D, Wu X, Jiang W, Marraffini L A, Zhang F. Multiplex genome engineering using CRISPR/Cas systems. Science. February 15; 339(6121):819-23, (2013). [0379] 89. Ran F A, Hsu P D, Wright J, Agarwala V, Scott D A, Zhang F. Genome engineering using the CRISPR-Cas9 system. Nat Protoc. November; 8(11):2281-308, (2013). [0380] 90. Kim W R, Sun W. 2011. Programmed cell death during postnatal development of the rodent nervous system. Development, growth &differentiation 53: 225-235, (2011).

    Example 14

    [0381] Human induced pluripotent stem cells (iPSCs), together with 21st century cell culture methods, have the potential to better model human physiology with applications in toxicology, disease modeling, and the study of host-pathogen interactions. Several models of the human brain have been developed recently, demonstrating cell-cell interactions of multiple cell types with physiologically relevant 3D structures. Most current models, however, lack the ability to represent the inflammatory response in the brain because they do not include a microglial cell population. Microglia, the resident immunocompetent phagocytes in the central nervous system (CNS), are not only important in the inflammatory response and pathogenesis; they also function in normal brain development, strengthen neuronal connections through synaptic pruning, and are involved in oligodendrocyte and neuronal survival. Here, we have successfully introduced a population of human microglia into 3D human iPSC-derived brain spheres (BrainSpheres, BS) through co-culturing cells of the Immortalized Human MicrogliaSV40 cell line with the BS model (OS). We detected an inflammatory response to lipopolysaccharides (LPS) and flavivirus infection, which was only elicited in the model when microglial cells were present. A concentration of 20 ng/mL of LPS increased gene expression of the inflammatory cytokines interleukin-6 (IL-6), IL-10, and IL-1b, with maximum expression at 6-12 h post-exposure. Increased expression of the IL-6, IL-1b, tumor necrosis factor alpha (TNF-), and chemokine (C-C motif) ligand 2 (CCL2) genes was observed in BS following infection with Zika and Dengue Virus, indicating a stronger inflammatory response in the model when microglia were present than when only astrocyte, oligodendrocyte, and neuronal populations were represented. Microglia innately develop within cerebral organoids (Nature communications), the findings indicate that the BS model is more physiologically relevant and has potential applications in infectious disease and host-pathogen interactions research.

    INTRODUCTION

    [0382] Microphysiological systems and organotypic cell culture models are increasingly being used to model human physiology in vitro because these models better mimic the in vivo situation compared to traditional monolayer cell culture systems (Marx et al., 2016; Pamies and Hartung, 2017; Smirnova et al., 2018). In addition, such models allow for the mechanistic understanding of biological processes that would be challenging to study in vivo. In particular, the human brain is a highly complex structure that cannot easily be interrogated in vivo and has proven difficult to model in vitro. Recently, the first in vitro human organotypic models of the brain have been developed, including 3D structures and heterogeneous cell populations. Many of these models seek to represent key events in human brain development and cell-cell interactions between various cell types (Kadoshima et al., 2013; Lancaster et al., 2013; Pasca et al., 2015; Pamies et al., 2017; Sandstrom et al., 2017). The basis for the majority of these models is a neural progenitor cell (NPC) population; however, microglia, arise from erythromyeloid precursor cells in the embryonic yolk sac, unlike the other cell types in the brain which arise from the neuroectoderm (Alliot et al., 1999; Ginhoux et al., 2013; Kierdorf et al., 2013; Sousa et al., 2017). Thus, because microglia cannot be derived from NPCs, many of the current in vitro models of the human brain do not include a microglial cell population.

    [0383] Microglia are the resident mononuclear phagocytic cells in the central nervous system (CNS) (Ginhoux et al., 2013). These cells are both neuroprotective and immunocompetent, as they play critical roles in brain development, strengthen neuronal connections through synaptic pruning, are involved in neuronal maintenance and support, and are responsible for the inflammatory response in the brain following an injury or pathogenic infection (Kettenmann et al., 2011; Paolicelli et al., 2011; Michell-Robinson et al., 2015; Thompson and Tsirka, 2017). In response to local alterations, lesions, or pathogen invasion, microglia become active. Microglial activation involves changes in morphology, the release of multiple substances such as proinflammatory cytokines, chemokines, and reactive oxygen species, migration to affected areas, proliferation, and phagocytosis of cell debris (Kettenmann et al., 2011; Boche et al., 2013; Thompson and Tsirka, 2017). This process is also a prominent feature of inflammation in neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, multiple sclerosis, and infectious processes (Wang et al., 2015; Thompson and Tsirka, 2017). Various models have been developed to study neurological disorders and lipopolysaccharide (LPS) has been widely used as an inducer of neuroinflammation and neurotoxicity as it has been shown to act as a potent stimulator of microglia (Gao et al., 2002; Hu et al., 2012; Olajide et al., 2013; Kempuraj et al., 2017). Additionally, inflammation related neurodegeneration induced by LPS is a common approach to study mechanisms of cellular neuroimmunology (Hu et al., 2012). Neurotropic virus infections are major pathogens in the CNS and cause inflammation (Ludlow et al., 2016). The Flavivirus genus constitutes some of the most serious human pathogens, including Japanese encephalitis (JEV), dengue (DENV), zika (ZIKV), and yellow fever (YF), all of which are can invade the central and peripheral nervous system and are regarded as neurotropic viruses (Neal, 2014). The mechanisms by which flaviviruses alter the immune and the CNS have only recently been examined, but remain largely unclear (Daep et al., 2014). The NPC model has been used in ZIKV studies to understand mechanisms that govern neuropathogenesis and immunopathogenesis in CNS infection (Dang et al., 2016; Garcez et al., 2016; Tang et al., 2016; Qian et al., 2017), but these models do not contain microglia. We previously developed a 3D brain model (BrainSpheres, BS) derived from human-induced pluripotent stem cells (iPSCs) and demonstrated that this model is reproducible with respect to size and shape and is comprised of populations of neurons, astrocytes, and oligodendrocytes (Pamies et al., 2017). In addition, the model has been applied to the study of developmental neurotoxicity (Pamies et al., 2018). In this study, we introduced a population of human microglia into the BS model and compared the inflammatory response of BS without microglia to BS co-cultured with microglia (BS) after treatment with LPS, ZIKV, or DENY. In addition, we quantified cell death following ZIKV infection because there is evidence that ZIKV infection can impair brain growth via cell death of developing neurons.

    [0384] Materials and Methods

    [0385] Induced Pluripotent Stem Cell Generation

    [0386] Fibroblasts (American Type Culture Collection (ATCC), Manassas, Va., United States, CCD-1079Sk ATCC CRL-2097) were used to generate iPSCs as previously described (Wen et al., 2014; Pamies et al., 2017). iPSCs (passage 20) were cultured on irradiated MEFs in human embryonic stem cell (hESC) medium comprised of D-MEM/F12 (Invitrogen, Carlsbad, Calif., United States) 20% Knockout Serum Replacement (KSR, Invitrogen, Carlsbad, Calif., United States), 2 mM L-glutamine (Invitrogen, Carlsbad, Calif., United States), 100 M MEM NEAA (Invitrogen, Carlsbad, Calif., United States), 100 M -mercaptoethanol (Invitrogen, Carlsbad, Calif., United States), and 10 ng/mL human basic FGF (bFGF, PeproTech, Rocky Hill, N.J., United States). Cell culture medium was changed daily. iPSCs were passaged using collagenase (Invitrogen, Carlsbad, Calif., United States, 1 mg/mL in D-MEM/F12 for 1 h at 37 C.).

    [0387] Neural Progenitor Cell Production

    [0388] NPC were generated following the previously published protocol (Wen et al., 2014). NPCs were cultured with StemPro NSC SFM media (Life Technologies, Carlsbad, Calif., United States) in 175 cm.sup.2 flasks (Thermo Scientific, Waltham, Mass., United States, Nunc Filter Cap EasYFlask) coated with Poly-L-ornithine hydrobromide (Sigma-Aldrich, St. Louis, Mo., United States, P3655) and laminin (Sigma-Aldrich, L2020, from Engelbreth-Holm-Swarm murine sarcoma basement membrane). Half of the media was changed daily. Cultures were maintained at 37 C. with 5% CO2. NPCs were passaged by mechanical detachment with a cell scraper (Sarstedt, N.C., United States, 2-position, Blade 25,83.1830).

    [0389] BrainSpheres Differentiation

    [0390] The production of BS was published previously (Pamies et al., 2017). Briefly, to produce BS, NPCs were detached mechanically with a cell scraper (Sarstedt, 2-position, Blade 25, 83.1830), re-pipetted for disaggregation, and counted using the Countess Automated Cell Counter (Invitrogen, Carlsbad, Calif., United States). 210.sup.6 cells per well were plated in non-treated Falcon Polystyrene 6-well plates (Corning, Corning, N.Y., United States). Cells were grown in differentiation medium [Neurobasal electro Medium (Gibco, Gaithersburg, Md., United States)] supplemented with 2% B-27 Electrophysiology (Gibco), 1% GlutaMAX (Gibco), 0.01 g/mL human recombinant GDNF (Gemini, Woodland, Calif., United States), and 0.01 g/mL human recombinant BDNF (Gemini). Cultures were maintained at 37 C. in an atmosphere of 5% CO2 under constant gyratory shaking (88 rpm) for 7 weeks. Differentiation medium was changed every 2 days.

    [0391] Microglia Culture

    [0392] Immortalized Human MicrogliaSV40 (Applied Biological Materials Inc., Richmond, BC, Canada) were grown in non-treated 75 cm.sup.2 flasks (Thermo Scientific, Waltham, Mass., United States, Nunc Filter Cap EasYFlask). Cells were expanded using Prigrow III medium (Applied Biological Materials Inc.) supplemented with 10% Fetal Bovine Serum (Gibco, Gaithersburg, Md., United States, Certified, Heat Inactivated, United States Origin) and 1% Penicillin-Streptomycin (Gibco, 10,000 U/mL). Microglia were passaged by mechanical detachment using a cell scraper (Sarstedt, 2-position, Blade 25, 83.1830). Cultures were maintained at 37 C. in an atmosphere of 5% CO.sub.2 immortalized Human MicrogliaSV40 cell line was declared mycoplasma free by a mycoplasma testing using a PCR based MycoDtect kit from Greiner Bio-One (Genetic Resource Core Facility is a core resource of the Johns Hopkins School of Medicine, Institute of Genetic Medicine).

    [0393] Formation of BS with Microglia (pBS)

    [0394] The density of microglia added to the aggregates was studied previously and the optimal number of cells was chosen to avoid the formation of microglia-only spheres and to allow enough microglia attachment to aggregates. BS were differentiated for 7 weeks at which time, 310.sup.5 microglia/well were added to the BS suspension. Upon addition of microglia, plates were kept in static conditions in the incubator at 37 C. with 5% CO2 for 24 h, with manual shaking of the plates every 6 h. This allowed for the attachment of the microglia to the surface of the BS while avoiding BS agglomeration. Microglia which did not attach to BS during this time attached to the bottom of the well. We then carefully removed aggregates from the well and transferred them to a new plate. BS aggregates were then washed twice with PBS, and new differentiation media was added. After the incorporation of microglia, BS were maintained in culture for one more week.

    [0395] Histology and Immunohistochemistry

    [0396] BS with and without incorporated microglia were fixed in 4% formalin/PBS. After fixation, spheres were carefully embedded into low-melting agarose and the solidified mixture was processed into paraffin blocks using an ASP300S dehydration machine (Leica, Wetzlar, Germany) and an EG1160 tissue embedding system (Leica, Wetzlar, Germany) Sections (2 m) were stained with hematoxylin-eosin (H&E) or processed for immunohistochemistry as follows: After dewaxing and inactivation of endogenous peroxidases (PBS/3% hydrogen peroxide), antibody specific antigen retrieval was performed using the Ventana Benchmark XT machine (Ventana, Tucson, Ariz., United States). Sections were blocked (PBS/10% FCS) and afterward incubated with the primary antibodies TMEM119 (1:100; Sigma), Mertk (1:100; R&D), Ax1 (1:100; LSBio), CD11b (1:2,000; Abcam), and P2ry12 (1:100; Sigma). For double staining of microglia and neurons, microglia were detected with TMEM119 and visualized with DAB in brown, whereas neurons were stained with NeuN (1:50; Millipore) and incubated with anti-mouse AP-coupled secondary antibody and developed in red. Bound primary antibodies were detected with secondary antibodies using Histofine Simple Stain MAX PO immune-enzyme polymer (Nichirei Biosciences) and stained with 3,3-Diaminobenzidine (DAB) substrate using the ultraView Universal DAB Detection Kit (Ventana). Tissues were counterstained with hematoxylin. Representative images were taken with a Leica DMD108 digital microscope.

    [0397] Virus Propagation and Titering

    [0398] Vero (ATCC, Manassas, Va., United States, ATCC CCL81) and BHK-21 (ATCC, C-13 ATCC CCL-10) cell lines were cultured in D-MEM (Gibco) containing 10% Fetal Bovine Serum (Gibco, Certified, Heat Inactivated, United States Origin), 2 mM L-glutamine (Invitrogen), Penicillin-Streptomycin (Gibco 10,000 U/mL), and 10 mM Hepes buffer (Gibco) in an incubator at 37 C. with 5% CO.sub.2. Vero and BHK-21 cells were passaged 3 times a week. To passage Vero and BHK-21 cells, the cells were incubated with 0.05% trypsin (Gibco) in 1PBS (Gibco) at 37 C. with 5% CO.sub.2 for 5 min, resuspended in 10 mL D-MEM, and centrifuged at 1200 rpm for 8 min. The supernatant is then removed and the cells were resuspended in fresh media and transferred to a new flask.

    [0399] Two strains of ZIKV (ATCC, VR-1838, Uganda 1947, ZIKV-UG, and Brazil 2015, ZIKV-BR) were propagated in Vero cells and Dengue Virus type 1 (ATCC, VR-1586, DENV-1) was propagated in BHK-21 cells. ZIKV-BR was isolated from a febrile non-pregnant Brazilian woman with a rash in Paraiba, Brazil in 2015 and kindly provided by Professor Pedro Vasconcelos from the Instituto Evandro Chagas, Belem, State of Para, Brazil (Pompon et al., 2017). ZIKV-UG was isolated in 1947 from a rhesus macaque exposed to mosquitos in Uganda. The Viral stocks were prepared by infecting Vero or BHK-21 cells at 80-90% confluency in 25 cm.sup.2 flasks with 2 mL of virus dilution in OptiPro SFM media (Gibco) at a multiplicity of 0.1. The cells were incubated for 6 h at 37 C. with 5% CO2, then the supernatant was removed and the cell lines were washed two times with 1PBS and replaced with 10 mL of D-MEM. The infected cells were further incubated for 5 days, and then the supernatants were collected and transferred to a 75 cm.sup.2 flask with respective cell lines at 90% confluence. The ZIKV-UG, ZIKVBR, and DENV-1 were collected after 7 days post-infection (p.i.), clarified by centrifugation at 500g for 10 min, and filtered through a 0.22-m membrane. All viral stocks were stored in 1 mL aliquots at 80 C. Virus titers used in the assays were determined by double-overlay plaque assay of Vero and BHK-21 cells to ZIKV and DENV, respectively, as previously described (Baer and Kehn-Hall, 2014).

    [0400] Lipopolysaccharide Treatment

    [0401] After 8 weeks of differentiation, 2 l from a 10 g/mL stock of LPS were added to 2 mL media containing ether the microglia, BS or BS, obtaining a final concentration of 20 ng/mL. Samples were collected 3, 6, 12, and 24 h after the exposure. Time 0 refers to samples before LPS exposure. Samples were collected for qPCRs.

    [0402] Viral Infection

    [0403] Immortalized Human MicrogliaSV40 were plated in 24-well plates at a density of 2.510.sup.5 cells per well. The BS and BS or microglia from one well were transferred to a 24-well-plate (and divided into triplicates) before infecting with ZIKV-UG, ZIKVBR, and DENV-1. A MOI of 0.1 for 6 h at 37 C. with 5% CO.sub.2 was used. Three wells of non-infected BS, BS, and microglia were used as control (MOCK). The cells were washed 3 times with 500 l PBS, and then 250 l of supernatant were collected for each condition as time zero of infection. The PBS was totally removed and BS, BS or microglia were re-suspended in fresh complete media. BS and BS were then transferred back to a 6-well plate containing media. The plates containing the infected and uninfected cells were incubated at 37 C. with 5% CO.sub.2 for 24 to 72 h. The supernatant was collected at different times points 24, 48, and 72 h post infection (p.i.) to check viral load. The cells were collected at 48 and 72 h p.i. to analyze gene expression, Annexin-V, and cell cycle (3 technical replicates). One well of BS, BS and microglia were used for confocal microscope analysis. All work with infectious ZIKV was performed in an approved BSL-3 facility.

    [0404] Analysis of Cell Viability and Cytotoxicity Using Flow Cytometry

    [0405] Apoptosis in microglia cells, BS, and BS was assayed using the Muse Annexin V and Dead Cell kit (Millipore, Billerica, Mass., United States) according to the user guide and the manufacturer's instructions. After 72 h incubation at 37 C. in 5% CO.sub.2, microglia cells for all conditions were harvested through mechanical detachment with a cell scraper (Sarstedt, Blade 25, 83.1830) in 500 l of the PBS, and centrifuged for 5 min at 2000 RPM. Two aggregates of BS and BS were collected using a 1 mL micropipette. The pellet was resuspended in 100 L of the PBS with 1% FBS, mixed with 100 L of the Muse Annexin V and Dead Cell Reagent at room temperature. Tubes were mixed using a vortex for 10 s. Samples were incubated for 20 min at room temperature and protected from light. The percentages of apoptotic cells were analyzed by flow cytometry using Muse Cell Analyzer (Millipore, United States) system and values were expressed as mean of apoptotic cells relative to mock with error bars representing the SD. All values are expressed as meanSD (n=3). Statistical significance (defined as P-value <0.05) was evaluated using multiple t-test to compare control and infected or treated cells (Graph Prism 7 Software, San Diego, Calif., United States).

    [0406] Flow Cytometry Analysis of Cell Cycle

    [0407] Microglia cells, BS and BS (infected and uninfected) were cultivated in 6-well plates and incubated for 48 h. Microglia cells for all conditions were harvested through mechanical detachment with a cell scraper (Sarstedt, Blade 25, 83.1830) in 500 l of the PBS, and centrifuged for 5 min at 2000 RPM. Two aggregates of BS and BS were collected using a 1 mL micropipette. Obtained pellets were fixed with 70% ethanol. The cells were kept in 20 C. overnight. After ethanol removal, cells were suspended in 250 L PBS and centrifuged for 5 min at 2000 RPM. Cell pellets were suspended in 200 L of Muse Cell Cycle Reagent and were incubated for 30 min at room temperature and protected from light. The cell suspension was transferred to a 1.5 mL microcentrifuge tube prior to analysis on Muse Cell Analyzer. Cell cycle was assessed by fluorescence-activated cell analysis using a Muse Cell Analyzer (Merck, Millipore, United States). All values are expressed as meanSEM (n=3). Statistical significance (defined as P-value <0.05) was evaluated using multiple t-test to compare control and infected or treated cells with LPS (Graph Prism 7 Software).

    [0408] Viral RNA Extraction

    [0409] Viral RNA for the real-time RT-PCR (qPCR) assays was purified from the culture supernatant of the uninfected and infected microglia, BS and BS. The viral RNA was extracted from 240 l of culture supernatant by using the QlAamp MinElute virus spin kit (Qiagen, Valencia, Calif., United States) according to the manufacturer's instructions, with the exception of the elution volume, which was 65 l.

    [0410] DENV-1 and ZIKV qPCR

    [0411] RNA isolated from the supernatant after DENV-1 and ZIKV infections were used in qPCR independently. The MOCK samples were used as negative controls in both qPCRs. The QuantiTect One-Step RT-PCR kit (Qiagen, Hilden, Germany) was used with a 25 l reaction mixture under the following conditions: 5 l of kit master mixture (including Taq polymerase and RT enzyme), 1.25 l of 10 M of each primer, 0.5 l of 10 M of probe, 7 l of RNA-free-water (Mol Bio grade, Hamburg, Germany), and 10 l of the extracted sample. Each amplification run contained negative control (NC) of each experiment (MOCK); non-template control (NTC), and positive control (PC). The non-template control consisted of blank reagent and water. For the positive control, nucleic acid extracted from each virus stock were used after dilution 1:1000 to avoid cross-contamination. The protocol used to ZIKV and DENV-1 qPCR was the same conditions except primers and probes (Table 4) and cycling thermal. The DENV-1 qPCR was done as described previously (Johnson et al., 2005) with some modification; a single cycle of reverse transcription for 30 min at 50 C., 15 min at 95 C. for reverse transcriptase (RT) inactivation, and DNA polymerase activation followed by 45 amplification cycles of 15 s at 95 C. and 1 min 55 C. (annealing-extension step). The following thermal profile was used to ZIKV qPCR a single cycle of reverse transcription for 30 min at 50 C., 15 min at 95 C. for RT inactivation, and DNA polymerase activation followed by 40 amplification cycles of 15 s at 95 C. and 1 min 60 C. (annealing-extension step). For RNA standards, RNA was isolated from purified, titered stock of ZIKV-UG or DENV-1. RNA yield was quantified by spectrometry and the data was used to calculate genomes/l. ZIKV-UG and DENY-1 RNA was serially diluted 1:10 in 8 points of dilution for standard curve (10.sup.7 to 10.sup.1). The standard curve was amplified in duplicate using primers and conditions described above for each specific qPCR. The number of infectious viral RNA transcripts detected was calculated by generating a standard curve from 10-fold dilutions of RNA isolated.

    TABLE-US-00074 TABLE4 Oligonucleotideprimersandfluorogenicprobes usedinDENV-1andZIKVvirusqPCRassay. Virus Genome posi- Fluoro- detection Sequence5-3 tion phone DENV-1 CAAAAGGAAGTCGTGCAATA 8978- reverse 8993 primer DENV-1 CTGAGTGAATTCTCTCTACTGAACC 9084- reverse 9109 primer DENV-1 CATGTGGTTGGGAGCACGC 8998- FAM/ probe 9017 BHQ-1 ZIKV AARTACACATACCARAACAAAGTGGT 9271- forward 9297 primer ZIKV TCCRCTCCCYCTYTGGTCGGT 9352- reverse 9373 primer ZIKV CTYAGACCAGCTGAAR 9304- FAM/ probe 9329 BHQ-1

    [0412] Analysis of Confocal Microscopy

    [0413] After 72 h exposure BS and BS were collected and fixed with PFA (4%) for 1 h at room temperature. Subsequently, BS, and BS were washed twice with PBS (1) and incubated with blocking solution (10% goat serum, 1% BSA, 0.15% saponin in PBS) at 4 C. for 1 h. The BS were washed with washing solution (1% BSA, 0.15% saponin in PBS), and incubated overnight at 4 C. with primary antibodies: Zika NS1 (OWL, 55788, 1:200, ZIKV) anti-NF200 (Sigma Aldrich, N4142, 1:200, neurofilament for all neurons), and IBA1 (WAKO, Richmond, Va., United States, 019-19741, 1:200, microglia) diluted in blocking solution. The next day the BS and BS were washed twice with washing solution and incubated with the secondary antibody 568-Alexa anti-rabbit and 488-Alexa anti-mouse both 1:200 diluted in blocking solution for 24 h at 4 C. and protected from light. Thereafter, BS and BS were washed twice again with washing solution. Nuclei were stained with Hoechst 33342, diluted 1:10,000 in PBS for 1 h. The BS were transferred to microscope glass slides and mounted with Immuno mount and imaged with a confocal microscope Zeiss LSM 510 Confocal III (Zeiss) with a 20 objective.

    [0414] Cellular RNA Isolation and qPCR

    [0415] Total RNA was extracted from microglia, BS and BS 72 h post infection (p.i.) using RNAeasy Mini Kit (Qiagen, Hilden, Germany). RNA quantity and purity was determined using a NanoDrop 2000c (Thermo Scientific). 1 g of RNA was reverse-transcribed using the MLV Promega RT (Promega) according to the manufacturer's recommendations. The expression of genes was evaluated using specific TaqMan Gene Expression Assays (Life Technologies). Table 5 shows a summary of the assayed genes. qPCR was performed using a 7500 Fast Real Time system machine (Applied Biosystems). Fold changes were calculated using the 2 (Ct) method (Livak and Schmittgen, 2001). -actin and 18s were used as housekeeping genes for mRNA. Data are presented as meanSD, normalized to housekeeping genes and MOCK.

    TABLE-US-00075 TABLE 5 List of TaqMan assays used for QPCR analysis CCL2 Chemokine (C-C motif) ligand 2 Hs00234140_m1 TNF- Tumor necrosis factor alpha Hs01113824_g1 IL10 Interleukin 10 Hs00961622_m1 IL6 Interleukin 6 Hs009S5839_m1 IL1b Interleukin 1 beta Hs01555410_m1 ACTB Beta-actin Hs01060665_g1

    [0416] Results

    [0417] Incorporation of SV40-Immortalized Human Microglial Cells Into a 3D BS Model

    [0418] Microglia cells were added to the BS at 7 weeks of differentiation (FIG. 9A) and were able to attach to the surface of the BS. However, as the microglia cell line used for this study

    is immortalized and proliferation takes place, we were only able to maintain (IBS (BS with microglia) for 1 week after incorporation for our experiments Immunohistochemistry of (IBS demonstrated they were positive for microglia markers such as TMEM19, Mertk, Ax1 (FIG. 9B), and IBA1 (FIG. 9C). Microglia grew on the surface of the BS, forming a microglia protuberance on the sphere (FIGS. 9C,D). These formations appear in 50% of the aggregates, seemingly due to the co-culture technique.

    [0419] Presence of Microglia in BS Alters Gene Expression of Cytokines in Response to Inflammatory Stimuli

    [0420] Once microglial cells were successfully incorporated into BS, we evaluated whether the IBS model would then respond to inflammatory stimuli in a distinct manner to BS. Microglial culture, BS, and IBS were exposed to 20 ng/mL LPS, which is a potent activator of inflammatory pathways in myeloid cells (Fujihara et al., 2003). Cells were collected at 0, 3, 6, 12, and 24 h post-treatment (p.t.) and levels of CCL2, TNF-, IL-1b, IL-6, and IL-10 RNA were quantitated by qPCR. In the absence of microglia, BS responded poorly to LPS (FIG. 10A). Conversely, cultures containing solely microglial cells responded to LPS by upregulating the expression of CCL2 and TNF- 24 h p.t. No significant changes in the levels of IL-6, IL-1b, and IL-10 were observed. The mixing of both populations into uBSs, however, led to distinct responses against LPS, specifically for IL-1b, IL-6, and IL-10, which were all upregulated in the first 12 h p.t. and downregulated 24 h p.t. The increased RNA expression of CCL2 and TNF- in sole microglia cultures was not observed in BS cultures, indicating that the presence of other cell types in the BS indirectly (through secreted factors) or directly (by cell-to-cell interactions) altered the LPS-response, which was observed in myeloid cells. This indicates crosstalk between microglia and other cell populations in the BS model. After LPS treatment, microglia showed an increase in dividing cells, characterized by a higher percentage of cells in S or G2/M phases when compared to non-treated microglia (FIG. 10B). In addition, cell viability decreased after LPS treatment in microglia and in BS, indicating that microglia may play an important role in viral neurotoxicity (FIG. 10C).

    [0421] The BS Support Replication of Dengue 1 (DENV-1) and Zika Viruses (ZIKV)

    [0422] Organoids have been previously used as models for virus pathogenesis (Gabriel et al., 2017; Salick et al., 2017; Watanabe et al., 2017). To evaluate whether the incorporation of microglial cells into BS would interfere with viral replication, microglia, BS, and BS were infected with DENY-1 and two distinct strains of ZIKV (ZIKV-UG and ZIKV-BR). FIG. 11 represents immunohistochemistry on BS and BS for control (mock) and treated samples (ZIKV-BR, ZIKV-UG, and DENY). Mock samples did not show any positive staining for ZIKV (FIG. 11) or DENY (data no shown). Cultured cells and aggregates were exposed to the three pathogens and viral growth in the supernatants was measured every 24 h for 3 days (FIG. 12A). Microglia and BS showed higher replication efficiency in the first 48 h showing a significant difference after 72 h in microglia infected with ZIKV-UG and ZIKV-BR. However, DENY-1 did not show significant changes between models after 72 h (FIG. 12A). Viral infection was confirmed by immune staining (FIG. 11). Both BS and BS were found to be infected by ZIKVBR, ZIKV-UG, and DENY which upon qualitatively analyzing the images, showed higher virus accumulation in microglia cells than in the other cell types (FIG. 11). This together with the replication results (FIG. 12A) indicate that these flavivirus infect microglia or that microglia internalize more viral particles via phagocytosis. DENY-1 infection led to a slight increase in dividing cells in BS and BS, characterized by a higher percentage of cells in S or G2/M phases when compared to sole microglia (FIG. 12B). However, DENY-1 was slightly more cytotoxic to microglia and BS than BS (FIG. 12C), indicating a protective role for microglial cells in the 3D model. Similar results were observed against ZIKV-UG, which appeared to be more cytotoxic to BS (FIG. 12C), despite no changes in the cell cycle among all conditions (FIG. 12B). This could be due to the protective capability of microglia and their role in internalizing viral particles. Interestingly, ZIKV-BR infection in BS caused a significant increase in dividing cells concomitantly to a slight decrease in viability (not statistically significant), indicating that microglial cells contribute to higher cytotoxicity in response to a more aggressive ZIKV strain.

    [0423] The Presence of Microglia Alters the Cytokine Gene Expression in Response to Flavivirus Infection

    [0424] As part of the innate immune response, microglial cells respond to viral infection by secreting inflammatory cytokines. To determine whether the addition of microglial cells to BS modulates the immune response against flavivirus infection, the levels of intracellular TNF-, CCL2, IL-1b, and IL-6 mRNA were measured in sole microglia, BS, and BS 72 h after exposure to DENY-1, ZIKV-UG, and ZIKV-BR. After DENY-1 infection, cytokine expression was observed mostly in microglia and BS, but not BS. Interestingly, the secretion pattern varied between the analytes (FIG. 12D). While TNF- and IL-6 production increased in sole microglia post-infection, CCL2 and IL-1b, were upregulated only in BS (FIG. 12D). The presence of microglia cells in BS also led to an increase in ZIKV-induced cytokine production when compared to sole microglia and BS. Moreover, cytokine levels in BS were significantly higher in response to ZIKV-BR than those observed with the Uganda strain.

    Discussion

    [0425] 3D brain models have been increasingly used in the last years, primarily in ZIKV studies (Qian et al., 2016, 2017; Wells et al., 2016; Salick et al., 2017; Watanabe et al., 2017; Zhou et al., 2017). These studies, however, have mainly focused on neurogenesis. The relevance of other brain populations such as microglia has been highlighted, indicating that these tissue-resident brain macrophages are key players in brain homeostasis, development, and diseases (Derecki et al., 2014; Salter and Stevens, 2017). Microglia incorporation into 3D models has not been achieved previously. In this study, we have successfully introduced microglia into our 3D brain spheroids, and demonstrated they alter the response to viral infection. Two techniques were compared to establish the protocol: in the first approach, human microglia immortalized cells were added on top of the NPCs before the formation of the spheres, and then differentiated in 3D over 8 weeks (FIG. 13). Without wishing to be bound by theory, the nature of the microglia used (immortalized by SV40) made this initial protocol impossible due to the constant proliferation leading to a high microglia population. Immortalized cell lines tend to be used as a high-throughput model for experimentation as they are homogeneous in culture. The human microglia immortalized with SV-40 used in our study exhibits biological characteristics such as morphological, phenotypical, and functional properties similar to those documented in primary human microglia (Patel et al., 2016; Zhu et al., 2016; Sousa et al., 2017). Also, immortalized microglia demonstrate appropriate migratory and phagocytic activity, and can elicit the pro-inflammatory cytokine response, which is characteristic of human microglia (Garcia-Mesa et al., 2017). When adding microglia cells to NPCs (FIG. 13, cells added during the aggregation stage with the NPCs), around 50% of the spheres led to overgrowth of microglia and some neuronal cell death. The use of iPSC-derived microglia, however, could solve this problem in the future (Muffat et al., 2016). In order to avoid microglial proliferation, microglia cells were added after BS differentiation in the second regimen, after 7 weeks differentiation, and kept for a maximum of 1 week in co-culture (FIG. 9A). Microglia were then identified by using different markers such as TMEM119, Mertk, Ax1, and IBA1, showing their attachment and growth in the BS (FIGS. 9B,C). The pro-inflammatory stimulus LPS from Gram-negative bacteria as used here and Gram-positive lipoteichoic acid as shown earlier (Kinsner et al., 2005, 2006; Boveri et al., 2006) activate microglia in infections. LPS was used to challenge the BS system and to compare its effects with both BS and microglia cultures. In response to LPS, microglia produce large quantities of proinflammatory cytokines such as TNF-, IL-1b, and IL-6. This is normally followed by the production of anti-inflammatory cytokine IL-10 (de WaalMalefyt et al., 1991; Randow et al., 1995). Microglia cultures showed no statistically significant changes neither in pro-inflammatory marker RNA levels (IL-6 and IL-1(3) or in the anti-inflammatory marker (IL-10). This could be due to the need of other CNS cell types such as astrocytes for the release of these specific cytokines. However, TNF- and CCL2 were strongly upregulated 24 h after LPS treatment (FIG. 10A) since microglia is the major producer of TNF and CCL2 is a gene that encodes a small cytokine that recruits monocytes between other inflammatory cells (such as memory T cells and dendritic cells) into the inflammation area. Microglia exposed to LPS showed higher expression (lower Ct values) of most of the genes studied compared to BS and BS (data no shown). This indicates that microglia express higher levels of these genes, or that in the presence of other cell types in the BS, these dilute the expression levels of these genes as other cells do not express them (but expression is normalized to housekeeping genes expressed by all cell types). Pro-inflammatory cytokine-encoding genes IL-6 and IL-1 showed a clear increase in expression (FIG. 10A) in BS. Interestingly, the anti-inflammatory marker IL-10 was also upregulated after LPS treatment in BS. Cytokines are released very rapidly after inflammatory stimuli and are regulated within a few hours, this could explain the observed co-expression of both anti- and pro-inflammatory genes. The TNF- gene was not modified significantly after LPS exposure in BS, BS, and microglia at the early time points. However, microglia exposed to LPS during 24 h LPS exposure showed a high up-regulation. BS and microglia cultures per se did not show statistically significant responses to IL6, IL10, and ILlb at the mRNA level, however, BS were able to elicit a response which otherwise was not induced in BS after LPS treatment. This indicates that the interaction between microglia and CNS cells (such as neurons, astrocytes and oligodendrocytes) are required for a specific inflammatory response. This study demonstrates the importance of including microglial populations in in vitro models to better predict human pathogenicity.

    [0426] Flavivirus (DENY-1, ZIKV-BR, and ZIKV-UG) infection induced different responses depending of the model used (microglia, BS or BS). Flavivirus infection resulted in produced a higher number of RNA virus copies in microglia cells (FIG. 12A). Moreover, these viruses were also able to replicate in BS, which is rarely observed in vitro. There was an initial increase in viral replication when microglia were added to BS (FIG. 12A), however, levels of RNA copies/mL were similar between BS and BS at 72 h. Microglia showed no changes in viability after virus infection (FIG. 12C). ZIKV-BR infection led to higher replication compared to ZIKV-UG and DENY-1 independent of the model, which could indicate that this flavivirus strain is more aggressive than the others (FIG. 12A). Moreover, ZIKV-BR infection showed a higher replication rate in microglia and BS than in BS (FIG. 12A) indicating that microglia may somehow influence the replication rate.

    [0427] Flavivirus infection in BS and BS showed differences in the expression profile of the genes studied. After infection of BS by ZIKV-BR and ZIKV-UG, upregulation of TNF-, IL6, IL1b, and CCL2 was observed when compared with BS (FIG. 12D). Moreover, DENY-1 infection led to the upregulation of CCL2 and IL-1 in the presence of microglia (OS) and upregulation of TNF- and IL-6 in microglia alone. The BS model presented a stronger upregulation of all cytokines studied after ZIKV infection, indicating that the interaction between BS and microglia produce more drastic changes in gene expression, which is more relevant to study the physiological response to infection. Moreover, ZIKV-BR infection led to G2/M arrest in BS when compared to ZIKV-UG and DENY-1 (FIG. 12B). Similar results have demonstrated that ZIKVBR infection deregulates the cell cycle, resulting in attenuated hNPC growth (Dang et al., 2016; Garcez et al., 2016; Tang et al., 2016; Ghouzzi et al., 2017). Furthermore, phagocytosis of apoptotic cells by microglia cells has been described as a general mechanism to clear these cells from tissues (Arandjelovic and Ravichandran, 2015). Duque and Descoteaux described that beside the secretion of cytokines, macrophages can increase their phagocytotic process, contributing to the defense against pathogens (Arango Duque and Descoteaux, 2014).

    [0428] The findings indicate that the microglia-driven inflammatory response to ZIKV infection may be exacerbated by endogenous signaling molecules such as viral proteins that can contribute to the pathological damage of neurons. Based on these findings, the activated microglia in BS play a potential role in enhancing the expression of pro-inflammatory cytokines such as interleukin (IL)-1, IL-6, and TNF- in response to ZIKV-BR infection.

    [0429] In conclusion, the incorporation of human microglia in BS produced an inflammatory response following LPS or flavivirus exposure. This has not been studied previously in a 3D in vitro brain model which includes a population of microglial cells. Both exposures produced changes in cell cycle and Annexin V analysis in presence of microglia, indicating that the microglia-driven inflammatory response induces cytotoxicity leading to a decrease in cell viability. Without being bound by theory, microglia derived from iPSC-derived microglia can represent an improvement of this model to limit proliferation and extend the co-culture period. As microglia occupy a central position in the defense and maintenance of the CNS, a 3D in vitro model including microglia can be fundamental for studies of the brain. Moreover, various anti-inflammatory drugs have been identified in treating microglia-mediated neuroinflammation in the CNS (Baby et al., 2014). Without wishing to be bound by theory, the disclosed model can serve as a potential tool for the screening of therapeutic targets in neurological disorders and recovery from brain injury. In conclusion, the findings indicate that the BS model has potential applications as a physiologically relevant model to study infectious disease, host-pathogen interactions, and neuro-inflammation.

    REFERENCES CITED IN THIS EXAMPLE

    [0430] Alliot, F., Godin, I., and Pessac, B. (1999). Microglia derive from progenitors, originating from the yolk sac, and which proliferate in the brain. Brain Res. Dev. Brain Res. 117, 145-152. doi: 10.1016/S0165-3806(99)00113-3. [0431] Arandjelovic, S., and Ravichandran, K. S. (2015). Phagocytosis of apoptotic cells in homeostasis. Nat. Immunol. 16, 907-917. doi: 10.1038/ni.3253. [0432] Arango Duque, G., and Descoteaux, A. (2014). Macrophage cytokines: involvement in immunity and infectious diseases. Front. Immunol. 5:491. doi: 10.3389/fimmu.2014.00491. [0433] Baby, N., Patnala, R., Ling, E. A., and Dheen, S. T. (2014). Nanomedicine and its application in treatment of microglia-mediated neuroinflammation. Curr. Med. Chem. 21, 4215-4226. doi: 10.2174/0929867321666140716101258. [0434] Baer, A., and Kehn-Hall, K. (2014). Viral concentration determination through plaque assays: using traditional and novel overlay systems. J. Vis. Exp. 93:e52065. doi: 10.3791/52065. [0435] Boche, D., Perry, V. H., and Nicoll, J. A. (2013). Review: activation patterns of microglia and their identification in the human brain. Neuropathol. Appl. Neurobiol. 39, 3-18. doi: 10.1111/nan.12011. [0436] Boveri, M., Kinsner, A., Berezowski, V., Lenfant, A. M., Draing, C., Cecchelli, R., et al. (2006). Highly purified lipoteichoic acid from gram-positive bacteria induces in vitro blood-brain barrier disruption through glia activation: role of pro-inflammatory cytokines and nitric oxide. Neuroscience 137, 1193-1209. doi: 10.1016/j.neuroscience.2005.10.011. [0437] Daep, C. A., Munoz-Jordan, J. L., and Eugenin, E. A. (2014). Flaviviruses, an expanding threat in public health: focus on dengue, West Nile, and Japanese encephalitis virus. J. Neurovirol. 20, 539-560. doi: 10.1007/s13365-014-0285-z. [0438] Dang, J., Tiwari, S. K., Lichinchi, G., Qin, Y., Patil, V. S., Eroshkin, A. M., et al. (2016). Zika virus depletes neural progenitors in human cerebral organoids through activation of the innate immune receptor TLR3. Cell Stem Cell 19, 258-265. doi: 10.1016/j.stem.2016.04.014. de Waal Malefyt, R., Abrams, J., Bennett, B., Figdor, C. G., and de Vries, J. E. (1991). Interleukin 10(IL-10) inhibits cytokine synthesis by human monocytes: an autoregulatory role of IL-10 produced by monocytes. J. Exp. Med. 174, 1209-1220. doi: 10.1084/jem.174.5.1209. [0439] Derecki, N. C., Katzmarski, N., Kipnis, J., and Meyer-Luehmann, M. (2014). Microglia as a critical player in both developmental and late-life CNS pathologies. Acta Neuropathol. 128, 333-345. doi: 10.1007/s00401-014-1321-z. [0440] Fujihara, M., Muroi, M., Tanamoto, K., Suzuki, T., Azuma, H., and Ikeda, H. (2003). Molecular mechanisms of macrophage activation and deactivation by lipopolysaccharide: roles of the receptor complex. Pharmacol. Ther. 100, 171-194. doi: 10.1016/j.pharmthera.2003.08.003. [0441] Gabriel, E., Ramani, A., Karow, U., Gottardo, M., Natarajan, K., Gooi, L. M., et al. (2017). Recent zika virus isolates induce premature differentiation of neural progenitors in human brain organoids. Cell Stem Cell 20, 397.e5-406.e5. doi: 10.1016/j.stem.2016.12.005. [0442] Gao, H. M., Jiang, J., Wilson, B., Zhang, W., Hong, J. S., and Liu, B. (2002). Microglial activation-mediated delayed and progressive degeneration of rat nigral dopaminergic neurons: relevance to Parkinson's disease. J. Neurochem. 81, 1285-1297. doi: 10.1046/j.1471-4159.2002.00928.x. [0443] Garcez, P. P., Loiola, E. C., Madeiro da Costa, R., Higa, L. M., Trindade, P., Delvecchio, R., et al. (2016). Zika virus impairs growth in human neurospheres and brain organoids. Science 352, 816-818. doi: 10.1126/science.aaf6116. [0444] Garcia-Mesa, Y., Jay, T. R., Checkley, M. A., Luttge, B., Dobrowolski, C., Valadkhan, S., et al. (2017). Immortalization of primary microglia: a new platform to study HIV regulation in the central nervous system. J. Neurovirol. 23, 47-66. doi: 10.1007/s13365-016-0499-3. [0445] Ghouzzi, V. E., Bianchi, F. T., Molineris, I., Mounce, B. C., Berto, G. E., Rak, M., et al. (2017). ZIKA virus elicits P53 activation and genotoxic stress in human neural progenitors similar to mutations involved in severe forms of genetic microcephaly and p53. Cell Death Dis. 8:e2567. doi: 10.1038/cddis.2016.446. [0446] Ginhoux, F., Lim, S., Hoeffel, G., Low, D., and Huber, T. (2013). Origin and differentiation of microglia. Front. Cell. Neurosci. 7:45. doi: 10.3389/fnce1.2013.00045. [0447] Hu, X., Zhou, H., Zhang, D., Yang, S., Qian, L., Wu, H. M., et al. (2012). Clozapine protects dopaminergic neurons from inflammation-induced damage by inhibiting microglial overactivation. J. Neuroimmune Pharmacol. 7, 187-201. doi: 10.1007/s11481-011-9309-0. [0448] Johnson, B. W., Russell, B. J., and Lanciotti, R. S. (2005). Serotype-specific detection of dengue viruses in a fourplex real-time reverse transcriptase PCR assay. J. Clin. Microbiol. 43, 4977-4983. doi: 10.1128/JCM.43.10.4977-4983.2005. [0449] Kadoshima, T., Sakaguchi, H., Nakano, T., Soen, M., Ando, S., Eiraku, M., et al. (2013). Self-organization of axial polarity, inside-out layer pattern, and species-specific progenitor dynamics in human ES cell-derived neocortex. Proc. Natl. Acad. Sci. U.S.A. 110, 20284-20289. doi: 10.1073/pnas.1315710110. [0450] Kempuraj, D., Thangavel, R., Selvakumar, G. P., Zaheer, S., Ahmed, M. E., Raikwar, S. P., et al. (2017). Brain and peripheral atypical inflammatory mediators potentiate neuroinflammation and neurodegeneration. Front. Cell. Neurosci. 11:216. doi: 10.3389/fnce1.2017.00216. [0451] Kettenmann, H., Hanisch, U. K., Noda, M., and Verkhratsky, A. (2011). Physiology of microglia. Physiol. Rev. 91, 461-553. doi: 10.1152/physrev.00011.2010. [0452] Kierdorf, K., Erny, D., Goldmann, T., Sander, V., Schulz, C., Perdiguero, E. G., et al. (2013). Microglia emerge from erythromyeloid precursors via Pu.1- and Irf8-dependent pathways. Nat. Neurosci. 16, 273-280. doi: 10.1038/nn.3318. [0453] Kinsner, A., Boveri, M., Hareng, L., Brown, G. C., Coecke, S., Hartung, T., et al. (2006). Highly purified lipoteichoic acid induced pro-inflammatory signaling in primary culture of rat microglia through Toll-like receptor 2: selective potentiation of nitric oxide production by muramyl dipeptide. J. Neurochem. 99, 596-607. doi: 10.1111/j.1471-4159.2006.04085.x. [0454] Kinsner, A., Pilotto, V., Deininger, S., Brown, G. C., Coecke, S., Hartung, T., et al. (2005). Inflammatory neurodegeneration induced by lipoteichoic acid from Staphylococcus aureus is mediated by glia activation, nitrosative and oxidative stress, and caspase activation. J. Neurochem. 95, 1132-1143. doi: 10.1111/j.1471-4159.2005.03422.x. [0455] Lancaster, M. A., Renner, M., Martin, C. A., Wenzel, D., Bicknell, L. S., Hurles, M. E., et al. (2013). Cerebral organoids model human brain development and microcephaly. Nature 501, 373-379. doi: 10.1038/nature12517. [0456] Livak, K. J., and Schmittgen, T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 211CT. Methods 25, 402-408. doi: 10.1006/meth.2001.1262. [0457] Ludlow, M., Kortekaas, J., Herden, C., Hoffmann, B., Tappe, D., Trebst, C., et al. (2016). Neurotropic virus infections as the cause of immediate and delayed neuropathology. Acta Neuropathol. 131, 159-184. doi: 10.1007/s00401-015-1511-3. [0458] Marx, U., Andersson, T. B., Bahinski, A., Beilmann, M., Beken, S., Cassee, F. R., et al. (2016). Biology-inspired microphysiological system approaches to solve the prediction dilemma of substance testing. ALTEX 33, 272-321. doi: 10.14573/altex.1603161. [0459] Michell-Robinson, M. A., Touil, H., Healy, L. M., Owen, D. R., Durafourt, B. A., Bar-Or, A., et al. (2015). Roles of microglia in brain development, tissue maintenance and repair. Brain 138, 1138-1159. doi: 10.1093/brain/awv066. [0460] Muffat, J., Li, Y., Yuan, B., Mitalipova, M., Omer, A., Corcoran, S., et al. (2016). Efficient derivation of microglia-like cells from human pluripotent stem cells. Nat. Med. 22, 1358-1367. doi: 10.1038/nm.4189. [0461] Neal, J. W. (2014). Flaviviruses are neurotropic, but how do they invade the CNS? J. Infect. 69, 203-215. doi: 10.1016/j.jinf.2014.05.010. [0462] Olajide, O. A., Bhatia, H. S., de Oliveira, A. C., Wright, C. W., and Fiebich, B. L. (2013). Inhibition of neuroinflammation in LPS-activated microglia by cryptolepine. Evid. Based Complement. Ahern. Med. 2013:459723. doi: 10.1155/2013/459723. [0463] Pamies, D., Barreras, P., Block, K., Makri, G., Kumar, A., Wiersma, D., et al. (2017). A human brain microphysiological system derived from induced pluripotent stem cells to study neurological diseases and toxicity. ALTEX 34, 362-376. doi: 10.14573/altex.1609122. [0464] Pamies, D., Block, K., Lau, P., Gribaldo, L., Pardo, C. A., Barreras, P., et al. (2018). Rotenone exerts developmental neurotoxicity in a human brain spheroid model. Toxicol. Appl. Pharmacol. 354, 101-114. doi: 10.1016/j.taap.2018.02.003. [0465] Pamies, D., and Hartung, T. (2017). 21st century cell culture for 21st century toxicology. Chem. Res. Toxicol. 30, 43-52. doi: 10.1021/acs.chemrestox.6b00269. [0466] Paolicelli, R. C., Bolasco, G., Pagani, F., Maggi, L., Scianni, M., Panzanelli, P., et al. (2011). Synaptic pruning by microglia is necessary for normal brain development. Science 333, 1456-1458. doi: 10.1126/science.1202529. [0467] Pasca, A. M., Sloan, S. A., Clarke, L. E., Tian, Y., Makinson, C. D., Huber, N., et al. (2015). Functional cortical neurons and astrocytes from human pluripotent stem cells in 3D culture. Nat. Methods 12, 671-678. doi: 10.1038/nmeth.3415. [0468] Patel, A. B., Tsilioni, I., Leeman, S. E., and Theoharides, T. C. (2016). Neurotensin stimulates sortilin and mTOR in human microglia inhibitable by methoxyluteolin, a potential therapeutic target for autism. Proc. Natl. Acad. Sci. U.S.A. 113, E7049-E7058. doi: 10.1073/pnas.1604992113. [0469] Pompon, J., Morales-Vargas, R., Manuel, M., Huat Tan, C., Vial, T., Hao Tan, J., et al. (2017). A Zika virus from America is more efficiently transmitted than an Asian virus by Aedes aegypti mosquitoes from Asia. Sci. Rep. 7:1215. doi: 10.1038/s41598-017-01282-6. [0470] Qian, X., Nguyen, H. N., Jacob, F., Song, H., and Ming, G. L. (2017). Using brain organoids to understand Zika virus-induced microcephaly. Development 144, 952-957. doi: 10.1242/dev.140707. [0471] Qian, X., Nguyen, H. N., Song, M. M., Hadiono, C., Ogden, S. C., Hammack, C., et al. (2016). Brain-region-specific organoids using mini-bioreactors for modeling ZIKV exposure. Cell 165, 1238-1254. doi: 10.1016/j.cell.2016.04.032. [0472] Randow, F., Syrbe, U., Meisel, C., Krausch, D., Zuckermann, H., Platzer, C., et al. (1995). Mechanism of endotoxin desensitization: involvement of interleukin 10 and transforming growth factor beta. J. Exp. Med. 181, 1887-1892. doi: 10.1084/jem.181.5.1887. [0473] Salick, M. R., Wells, M. F., Eggan, K., and Kaykas, A. (2017). Modelling zika virus infection of the developing human brain in vitro using stem cell derived cerebral organoids. J. Vis. Exp. 127:e56404. doi: 10.3791/56404. [0474] Salter, M. W., and Stevens, B. (2017). Microglia emerge as central players in brain disease. Nat. Med. 23, 1018-1027. doi: 10.1038/nm.4397. [0475] Sandstrom, J., Eggermann, E., Charvet, I., Roux, A., Toni, N., Greggio, C., et al. (2017). Development and characterization of a human embryonic stem cell-derived 3D neural tissue model for neurotoxicity testing. Toxicol. In Vitro 38, 124-135. doi: 10.1016/j.tiv.2016.10.001. [0476] Smirnova, L., Kleinstreuer, N., Corvi, R., Levchenko, A., Fitzpatrick, S. C., and Hartung, T. (2018). 3S-systematic, systemic, and systems biology and toxicology. ALTEX 35, 139-162. doi: 10.14573/altex.1804051. [0477] Sousa, C., Biber, K., and Michelucci, A. (2017). Cellular and molecular characterization of microglia: a unique immune cell population. Front. Immunol. 8:198. doi: 10.3389/fimmu.2017.00198. [0478] Tang, H., Hammack, C., Ogden, S. C., Wen, Z., Qian, X., Li, Y., et al. (2016). Zika virus infects human cortical neural progenitors and attenuates their growth. Cell Stem Cell 18, 587-590. doi: 10.1016/j.stem.2016.02.016. [0479] Thompson, K. K., and Tsirka, S. E. (2017). The diverse roles of microglia in the neurodegenerative aspects of central nervous system (CNS) autoimmunity. Int. J. Mol. Sci. 18:504. doi: 10.3390/ijms18030504. [0480] Wang, W. Y., Tan, M. S., Yu, J. T., and Tan, L. (2015). Role of pro-inflammatory cytokines released from microglia in Alzheimer's disease. Ann. Transl. Med. 3:136. doi: 10.3978/j.issn.2305-5839.2015.03.49. [0481] Watanabe, M., Buth, J. E., Vishlaghi, N., de la Torre-Ubieta, L., Taxidis, J., Khakh, B. S., et al. (2017). Self-organized cerebral organoids with human-specific features predict effective drugs to combat zika virus infection. Cell Rep. 21, 517-532. doi: 10.1016/j.celrep.2017.09.047. [0482] Wells, M. F., Salick, M. R., Wiskow, O., Ho, D. J., Worringer, K. A., Ihry, R. J., et al. (2016). Genetic ablation of AXL does not protect human neural progenitor cells and cerebral organoids from zika virus infection. Cell Stem Cell 19, 703-708. doi: 10.1016/j.stem.2016.11.011. [0483] Wen, Z., Nguyen, H. N., Guo, Z., Lalli, M. A., Wang, X., Su, Y., et al. (2014). Synaptic dysregulation in a human iPS cell model of mental disorders. Nature 515, 414-418. doi: 10.1038/nature13716. [0484] Zhou, T., Tan, L., Cederquist, G. Y., Fan, Y., Hartley, B. J., Mukherjee, S., et al. (2017). High-content screening in hPSC-neural progenitors identifies drug candidates that inhibit zika virus infection in fetal-like organoids and adult brain. Cell Stem Cell 21, 274.e-283.e. doi: 10.1016/j.stem.2017.06.017. [0485] Zhu, W., Carney, K. E., Pigott, V. M., Falgoust, L. M., Clark, P. A., Kuo, J. S., et al. (2016). Glioma-mediated microglial activation promotes glioma proliferation and migration: roles of NaC/HC exchanger isoform 1. Carcinogenesis 37, 839-851. doi: 10.1093/carcin/bgw068.

    EQUIVALENTS

    [0486] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.