MODIFIED ANTIBACTERIAL COMPOSITIONS AND METHODS
20200123328 ยท 2020-04-23
Inventors
- Greg GuangHua Qiao (Melbourne, Victoria, AU)
- Neil Martin O'Brien-Simpson (Melbourne, Victoria, AU)
- Shu Jie Lam (Melbourne, Victoria, AU)
- Anton Richard Blencowe (Melbourne, Victoria, AU)
- Eric Charles Reynolds (Melbourne, Victoria, AU)
Cpc classification
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
C08G83/00
CHEMISTRY; METALLURGY
Abstract
This invention relates to antibacterial compounds and compositions thereof. The invention also relates to the use of the compounds and compositions in methods of treating bacterial infections, particularly those bacterial infections including bacteria that exhibit antibiotic resistance. More specifically, the present invention provides a star shaped peptide polymer comprising a multifunctional core with a plurality of terminal arms extending therefrom, wherein the terminal arms are statistical or random peptide copolymers of at least a cationic amino acid residue and a hydrophobic amino acid residue.
Claims
1. A star shaped peptide polymer comprising a multifunctional core with a plurality of terminal arms extending therefrom, wherein the terminal arms are statistical or random peptide copolymers of at least a cationic amino acid residue and a hydrophobic amino acid residue.
2-5. (canceled)
6. A star shaped peptide polymer according to claim 1, wherein the cationic amino acid residue is a lysine residue (such as an L-lysine residue), and the hydrophobic amino acid residue is a valine residue (such as a D-valine, an L-valine, or DL-valine residues).
7. A star shaped peptide polymer according claim 1, wherein the copolymer exhibits a degree of polymerisation of at least 5 and up to 50.
8-10. (canceled)
11. A star shaped peptide polymer according to claim 1, wherein the multifunctional core is a dendrimer, the core comprising a dendrimer centre with a plurality of dendron arms extending therefrom, the dendron arms having a plurality of branches formed from repeat units, each branch terminated with a terminal unit having a terminal moiety and wherein the plurality of terminal arms are covalently bonded to terminal moieties of the dendrimer, wherein the repeat unit is an amidoamine, such as of the form R.sup.A[C.sub.2H.sub.4C(O)NH.sub.2C.sub.2H.sub.4N]R.sup.BR.sup.C where R.sup.A is a single covalent bond to either the dendrimer centre (in which case R.sup.A is an R.sup.1) or R.sup.A is a bond to a preceding repeat unit that is closer to the dendrimer centre (in which case R.sup.A is an R.sup.B or R.sup.C on the preceding repeat unit); R.sup.B and R.sup.C represent a single bond to a following repeat unit (in which case R.sup.B is an R.sup.A on the following repeat unit) or, where there are no following repeat units R.sup.B represents a single bond to the terminal arm, and R.sup.C represents a hydrogen atom.
12. (canceled)
13. A star shaped peptide polymer according to claim 1, wherein the multifunctional core includes a number of terminal arms of from at least 4 and up to 256 terminal arms.
14-19. (canceled)
20. A star shaped peptide polymer according to claim 7, wherein the degree of copolymerisation is about 5.
21-27. (canceled)
28. A star shaped peptide polymer according to claim 1, wherein the star shaped peptide polymer is selected from: ##STR00002## where m is 2.sup.n and n is a number between 2 and 8, preferably n is 2, 3, 4 or 5, and m is 4, 8, 16, or 32 accordingly.
29. (canceled)
30. A pharmaceutical composition comprising, consisting essentially of or consisting of a star shaped peptide polymer, wherein the star shaped polymer comprises a multifunctional core with a plurality of terminal arms extending therefrom, wherein the terminal arms are statistical or random peptide copolymers of at least a cationic amino acid residue and a hydrophobic amino acid residue and a carrier, diluent or excipient.
31. (canceled)
32. A pharmaceutical composition according to claim 30, wherein the composition further includes a chelating agent.
33. (canceled)
34. A pharmaceutical composition according to claim 32 wherein the chelating agent is EDTA or citric acid.
35. A pharmaceutical composition according to claim 30, wherein the carrier, diluent or excipient is substantially free of protein.
36. A pharmaceutical composition according to claim 30, wherein the carrier, diluent or excipient is substantially free of divalent ions.
37-42. (canceled)
43. A method of treating a bacterial infection in a subject, the method comprising administering to the subject an effective amount of a star shaped peptide polymer, wherein the star shaped peptide polymer comprises a multifunctional core with a plurality of terminal arms extending therefrom, wherein the terminal arms are statistical or random peptide copolymers of at least a cationic amino acid residue and a hydrophobic amino acid residue, thereby treating the bacterial infection in the subject.
44. A method of claim 43, wherein the bacterial infection comprises, consisting essentially of, or consists of Gram-negative bacteria.
45. A method of claim 43, wherein the bacterial infection comprises, consisting essentially of, or consists of Gram-positive bacteria.
46. A method of claim 43, wherein the bacterial infection includes both Gram-negative and Gram-positive bacteria.
47-50. (canceled)
51. A method according to claim 43, wherein the bacterial infection comprises an infection with antibiotic resistant bacteria.
52. A method according to claim 6, wherein the bacteria exhibit resistance to any one or more of the following antibiotics: (1) Macrolides or ketolides such as erythromycin, azithromycin, clarithromycin and telithromycin; (2) Beta ()-lactams such as penicillin G, penicillin V, methicillin, oxacillin, cloxacillin, dicloxacillin, nafcillin, ampicillin, amoxicillin, carbenicillin, ticarcillin, mezlocillin, piperacillin, azlocillin, temocillin, cepalothin, cephapirin, cephradine, cephaloridine, cefazolin, cefamandole, cefuroxime, cephalexin, cefprozil, cefaclor, loracarbef, cefoxitin, cefinetazole, cefotaxime, ceftizoxime, ceftriaxone, cefoperazone, ceftazidime, cefixime, cefpodoxime, ceftibuten, cefdinir, cefpirome, cefepime, aztreonam, imipenem, meropenem, ertapenem, doripenem, ceftobiprole, and ceftaroline; (3) Quinolones such as nalidixic acid, oxolinic acid, norfloxacin, pefloxacin, enoxacin, ofloxacin, levofloxacin, ciprofloxacin, temafloxacin, lomefloxacin, fleroxacin, grepafloxacin, sparfloxacin, trovafloxacin, clinafloxacin, gatifloxacin, moxifloxacin, sitafloxacin, garenoxacin, gemifloxacin and pazufloxacin; (4) Antibacterial sulfonanmides and antibacterial sulphanilamides, including para-aminobenzoic acid, sulfadiazine, sulfisoxazole, sulfamethoxazole and sulfathalidine; (5) Aminoglycosides such as streptomycin, neomycin, kanamycin, paromycin, gentamicin, tobramycin, amikacin, netilmicin, spectinomycin, sisomicin, dibekacin and isepamicin; (6) Tetracyclines such as tetracycline, chlortetracycline, demeclocycline, minocycline, oxytetracycline, methacycline, tigecycline, doxycycline; (7) Rifamycins such as rifampicin (also called rifampin), rifapentine, rifabutin, bezoxazinorifamycin and rifaximin; (8) Lincosamides such as lincomycin and clindamycin; (9) Glycopeptides such as telavancin, vancomycin and teicoplanin or lipopeptides such as daptomycin; (10) Streptogramins such as quinupristin and daflopristin; (11) Oxazolidinones such as linezolid; (12) Polymyxin, colistin and colymycin; and (13) Trimethoprim and bacitracin.
53-55. (canceled)
56. A method according to claim 51, wherein the bacterial infection comprises A. baumannii that exhibits resistance to treatment of any one or more of Amoxicillin/Clavulanic Acid, Ampicillin, Cefazolin, Cefepime, Cefoxitin, Ceftazidime, Ceftriaxone, Ciprofloxacin, Gentamicin, Meropenem, Nalidixic Acid, Nitrofurantoin, Norfloxacin, Piperacillin/Tazobactam, Ticarcillin/Clavulanic Aid, Tobramycin, Trimethoprim, Trimethoprim/Sulfamethoxazole, Imipenem and Colistin Sulfate.
57. A method according to claim 51, wherein the bacterial infection comprises P. aeruginosa that exhibits resistance to treatment of any one or more of Ampicillin, Aztreonam, Ceftazidime, Gentamicin, Piperacillin, Ticarcillin, Tobramycin and Colistin Sulfate.
58. A method according to claim 43, wherein the bacterial infection is an acute infection.
59-62. (canceled)
63. A method according to claim 43, wherein the subject had been previously administered an antibiotic with the intention of treating the bacterial infection, however the bacterial infection still persisted.
64-66. (canceled)
67. A method according to claim 43 wherein the bacterial infection is a cutaneous or dermal infection.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126]
[0127]
[0128]
[0129]
[0130]
[0131]
[0132]
[0133]
[0134]
[0135]
[0136]
[0137]
[0138]
[0139]
[0140]
[0141]
[0142]
[0143]
[0144]
[0145]
[0146]
[0147]
[0148]
[0149]
[0150]
[0151]
[0152]
[0153]
[0154]
[0155]
[0156]
[0157]
[0158]
[0159]
[0160]
[0161]
[0162]
[0163]
DETAILED DESCRIPTION OF THE EMBODIMENTS
[0164] It will be understood that the invention disclosed and defined in this specification extends to all alternative combinations of two or more of the individual features mentioned or evident from the text or drawings. All of these different combinations constitute various alternative aspects of the invention.
[0165] Reference to any prior art in the specification is not an acknowledgment or suggestion that this prior art forms part of the common general knowledge in any jurisdiction or that this prior art could reasonably be expected to be understood, regarded as relevant, and/or combined with other pieces of prior art by a skilled person in the art.
[0166] Reference will now be made in detail to certain embodiments of the invention. While the invention will be described in conjunction with the embodiments, it will be understood that the intention is not to limit the invention to those embodiments. On the contrary, the invention is intended to cover all alternatives, modifications, and equivalents, which may be included within the scope of the present invention as defined by the claims.
[0167] One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention. The present invention is in no way limited to the methods and materials described. It will be understood that the invention disclosed and defined in this specification extends to all alternative combinations of two or more of the individual features mentioned or evident from the text or drawings. All of these different combinations constitute various alternative aspects of the invention.
[0168] All of the patents and publications referred to herein are incorporated by reference in their entirety.
[0169] For purposes of interpreting this specification, terms used in the singular will also include the plural and vice versa.
[0170] The present invention is based on the discovery of star-shaped peptide polymer nanoparticles consisting of lysine and valine residues, synthesized via NCA-ROP, as a new class of antimicrobial agents. These star nanoparticles are referred to herein as Structurally Nanoengineered Antimicrobial Peptide Polymers (SNAPPs) and are star shaped peptide polymer of the invention. Unlike existing self-assembled antimicrobial macromolecules that will dissociate to unimers below their critical micelle concentration, star shaped peptide polymer of the invention are stable unimolecular architectures up to infinite dilution. The inventors demonstrated that star shaped peptide polymer of the invention exhibit superior antibacterial activity against a range of clinically-important Gram-negative and Gram-positive bacteria, possess high therapeutic indices, and display selectivity towards pathogens over mammalian cells. The inventors also showed that star shaped peptide polymer of the invention can combat antibiotic resistant bacteria and without being bound by any theory or mode of action have a multi-modal antimicrobial mechanism involving disruption of the integrity of the OM, cytoplasmic membrane (CM) disruption, unregulated ion efflux/influx, and induction of apoptotic-like death (ALD), which potentially accounts for the superior performance of star shaped peptide polymer of the invention and differs from that typically reported for most AMPs.
[0171] Star shaped peptide polymers of the invention are generally described as comprising a multifunctional core with a plurality of terminal arms extending therefrom, wherein the terminal arms are statistical or random peptide copolymers of at least a cationic amino acid residue and a hydrophobic amino acid residue. The multifunctional core, may for example be a dendrimer. The dendrimer comprises a dendrimer centre, a plurality of dendron arms having a plurality of branches formed from repeat units and terminate with a terminal unit having a terminal moiety. The star shaped peptide polymer, may in certain embodiments, have a multifunctional core that is based on this dendrimer structure, wherein a statistical or random peptide copolymer (of at least a cationic amino acid residue and a hydrophobic amino acid residue) is covalently bonded to the terminal moieties of the dendrimer.
[0172] In this context, the term dendrimer centre is intended to refer to the molecule at the center of the dendrimer that gives rise to the final structure of the dendrimer. In the context of dendrimers formed via divergent synthesis techniques, the dendron centre is is effectively an initiator molecule which contains functional groups capable of acting as the initial active sites for forming the dendrimer. By way of example, in the context of a PAMAM based dendrimer, the dendrimer centre is based on an ethylene diamine initiator. Once the dendrimer has formed, each of the primary amine groups originally on the ethylene diamine molecule have been reacted with, and covalently bound to two dendron arms. Thus, the resultant dendrimer centre has the form of an ethylene diamine molecule wherein each amine group is a tertiary amine, such as of the form R.sub.2N(CH.sub.2).sub.2NR.sub.2.
[0173] The term dendron arms is intended to refer to the branched groups that are covalently bound to the dendrimer centre. The number of dendron arms is dependent on the number of functional groups capable of acting as the initial active sites on the dendrimer centre. PAMAM has a core formed from an ethylene diamine initiator, and as such provides four active sites to which the dendron arms may be bound.
[0174] The dendron arms have a plurality of branches formed from repeat units and terminate with a terminal unity having a terminal moiety. It will be appreciated that the terms terminal unit(s) and the terminal moiety or terminal moieties relate to the dendrimer structure itself and are not intended to designate terminal groups of the star shaped peptide polymer. As is clear from the above, the star shaped peptide polymer further includes terminal arms (being statistical or random peptide copolymers of at least a cationic amino acid residue and a hydrophobic amino acid residue) which in one or more embodiments are covalently bound to the dendrimer via these terminal moieties on the terminal units of the dendrimer.
[0175] A number of different synthetic procedures can be used to generate the dendron arms. Typically, such procedures involve reacting functional groups on the core molecule with a further molecule having a first moiety that allows the nucleophilic addition of that further molecule onto the dendrimer centre (via the functional group on the dendrimer centre) and a second moiety for allowing the nucleophilic addition of two or more additional molecules. Again, in the context of PAMAM, the dendron arms can be formed via step (i) the Michael addition of two methyl acrylates onto each amine group of the ethylene diamine core, resulting in an ester-terminated outer layer, and step (ii) the subsequent coupling of ethylene diamine to ester-terminated outer layer to achieve two new amino-terminated surfaces for each amine surface prior to step (i). Thus, each repetition of reactions (i) and (ii) adds repeat units in a manner which doubles the number of branches in the dendron arms. Each repetition of this sequence of reactions to double the number of branches is referred to as a generation. The process may be repeated until dendron arms of the desired size (re desired number of generations) have been reached. The molecules that form the outer portions of the branches are the terminal units, and these terminal units include a terminal moiety (which in the context of PAMAM is an amine). Thus, in the context of this invention, the terminal moiety refers to the end moiety of the repeat units that form the branches of the dendron arms. Advantageously, another molecule (in particular a statistical or random peptide copolymer) can be conjugated to these terminal moieties.
[0176] A statistical or random peptide copolymer is a copolymer formed from at least two different peptide units or amino acid residues. Statistical copolymers are copolymers in which the sequence of monomer residues follows a statistical rule. If the probability of finding a given type monomer residue at a particular point in the chain is equal to the mole fraction of that monomer residue in the chain, then the polymer may be referred to as a random copolymer.
[0177] In this context, the amino acid residues is intended to refer to discrete amino acid monomers linked by peptide bonds in the copolymer. A cationic amino acid residue is one having a moiety exhibiting a positive charge. An example of this is a lysine residue which includes a protonated sidechain including an NH.sup.3+ moiety. A hydrophobic amino acid residue is one which includes a non-polar residue, such as valine which has an isopropyl side chain rendering the residue hydrophobic.
[0178] Star shaped peptide polymers of the invention exhibit one or more advantages including that bacteria do not, or do not readily, develop resistance and that the star shaped peptide polymers interact with lipopolysaccharide (LPS) such that LPS induced toxic shock is less likely to occur after treatment of the bacterial infection. More specifically, the star shaped peptide polymers dampen the toxic shock arising from treatment of a large bacterial infection as the peptides bind and sequester LPS and in doing so will reduce the huge inflammatory response associated with LPS. Due to the large size of the peptide polymers and how the bacterial membranes are disrupted, mutations of peptides or proteins on the surface of bacteria are less likely to reduce the function of star shaped peptide polymer polymers. Without wishing to be bound by theory, the inventors believe that due to the large size of the peptide polymers and the mechanisms by which bacterial membranes are disrupted, mutations at the surface of bacteria are unlikely to have an adverse impact on the functioning of star shaped peptide polymers.
[0179] Subjects suffering from a bacterial infection, or healthy control subjects, may be assessed before and after treatment of a star shaped peptide polymer of the invention, by using any one of, or combination of, numerous different standards or scales employed by a person having ordinary skill in the art. Examples of standards or scales for testing the effectiveness of the methods disclosed herein include assessment of body temperature, body weight, Lab-Score, procalcitonin levels, circulating white blood cell levels, Laboratory Risk Indicator for Necrotizing Fasciitis (LRINEC) score, mucus levels, urea breath test, or levels of bacteria present in a sample taken from a subject (e.g. blood, serum, mucus, skin, stool, urine, sputum, saliva, semen, or biopsy sample).
[0180] As used herein, a subject refers to an animal, such as a mammalian or an avian species, including a human, an ape, a horse, a cow, a sheep, a goat, a dog, and a cat. The subject may have a bacterial infection, may have been exposed to infectious bacteria, may be at risk for developing a bacterial infection, or may be at greater risk than the general population for developing a bacterial infection. Examples of subjects at greater risk for developing a bacterial infection include patients undergoing treatment for bacterial infections whereby normal gut flora is inhibited by antimicrobial therapy, patients with impaired immune function (e.g., immunoglobulin deficiency, splenic dysfunction, splenectomy, HIV infection, impaired leukocyte function, hemoglobinopathies), the elderly, people with certain malignancies (e.g., multiple myeloma, chronic lympocytic leukemia, lymphoma), people at increased occupational risk (e.g., public services workers, such a fire, water, sanitary, police, medical, and laboratory workers, hospital workers), people in closed populations (e.g., prisons, military, nursing homes) and others that have immunological deficiencies that might enhance their susceptibility to bacterial infection.
[0181] A bacterial infection generally refers to:
[0182] (1) an elevated level of bacteria in a sample taken from the individual compared to an uninfected control sample;
[0183] (2) an increased proportion of one or more types of bacteria in a sample taken from the individual compared to the total level of bacteria in an uninfected control sample;
[0184] (3) an increased proportion of bacteria relative to one or more other bacteria species in a sample taken from the individual when compared to an uninfected control sample; or
[0185] (4) the presence of a bacteria in a sample compared to an uninfected control sample when that same bacteria is undetectable in the uninfected control.
[0186] A subject may be diagnosed as having a bacterial infection by any method described herein or known in the art. A biological sample such as a bodily fluid sample (e.g. blood) or tissue sample or scraping. Then the sample is prepared (various ways) and then cultured on different agar plates with defined media that will classify the microbe. Real time PCR is another method that may be used to identify bacteria in a sample.
[0187] An acute bacterial infection refers to an infection in a subject that requires rapid treatment, generally in the range of 15 to 60 minutes, otherwise the infection may progress to endanger the life of the subject. Such acute infections may occur in infants or immunocompromised subjects as described herein.
[0188] In one aspect, the terms infection and bacterial infection refer to an infection caused by Gram-negative bacteria, also referred to as a Gram-negative infection. In one aspect of this embodiment, the Gram-negative infection is an infection resistant to one or more antibiotics. In one aspect of this embodiment, the Gram-negative infection is a multi-drug resistant infection. In certain embodiments, the Gram-negative bacterium is Acinetobacter spp. In certain embodiments, the Gram-negative bacterium is Acinetobacter spp., such as Acinetobacter baumannii. In certain embodiments, the Gram-negative bacterium is Burkholderia spp. In certain embodiments, the Gram-negative bacterium is Burkholderia pseudomallei. In certain embodiments, the Gram-negative bacterium is Pseudomonas aeruginosa. In certain embodiments, the Gram-negative bacterium is Enterobacteriaceae. In any of these embodiments, the Gram-negative infection arises from a pathogen or pathogen expressing one or more -lactamase. In any of these embodiments, the Gram-negative infection arises from a pathogen or pathogen expressing one or more Class A, Class C and/or Class D -lactamase. In any of these embodiments, the Gram-negative infection arises from a pathogen or pathogen expressing one or more Class A -lactamase. In any of these embodiments, the Gram-negative infection arises from a pathogen or pathogen expressing one or more Class C -lactamase. In any of these embodiments, the Gram-negative infection arises from a pathogen or pathogen expressing one or more Class D -lactamase.
[0189] An infection caused by Enterobacteriaceae refers to any of the Gram-negative bacteria in this family of bacteria which includes, but is not limited to, species such as Salmonella spp., Escherichia coli, Yersinia pestis, Klebsiella spp., Shigella spp., Proteus spp., Enterobacter spp., Serratia spp., and Citrobacter spp. Thus, treatment of a bacterial infection caused by Enterobacteriaceae includes any infection caused by any one or more bacteria which is part of this family. In one embodiment, a bacterial infection caused by Enterobacteriaceae includes bacterial infections which have at least one Salmonella spp. pathogen present. In one embodiment, a bacterial infection caused by Enterobacteriaceae includes bacterial infections which have at least one Escherichia coli pathogen present. In one embodiment, a bacterial infection caused by Enterobacteriaceae includes bacterial infections which have at least one Yersinia pestis pathogen present. In one embodiment, a bacterial infection caused by Enterobacteriaceae includes bacterial infections which have at least one Klebsiella spp. pathogen present. In one embodiment, a bacterial infection caused by Enterobacteriaceae includes bacterial infections which have at least one Shigella spp. pathogen present. In one embodiment, a bacterial infection caused by Enterobacteriaceae includes bacterial infections which have at least one Proteus spp. pathogen present. In one embodiment, a bacterial infection caused by Enterobacteriaceae includes bacterial infections which have at least one Enterobacter spp. pathogen present. In one embodiment, a bacterial infection caused by Enterobacteriaceae includes bacterial infections which have at least one Serratia spp. pathogen present. In one embodiment, a bacterial infection caused by Enterobacteriaceae includes bacterial infections which have at least one Citrobacter spp. pathogen present.
[0190] In certain embodiments, the terms infection and bacterial infection refer to a infection caused by Gram-negative bacteria, wherein the Gram-negative bacterium is Enterobacteriaceae which expresses one or more Class A, Class B, Class C and/or Class D -lactamase. In one aspect of this embodiment, the Gram-negative bacterium is an Enterobacteriaceae which expresses at least one Class B -lactamase.
[0191] In certain embodiments, the Gram-negative bacterium is Acinetobacter spp. which expresses one or more -lactamases. In one embodiment, the Gram-negative bacterium is Acinetobacter baumannii which expresses one or more Class A, Class C and/or Class D -lactamase. In one embodiment, the Gram-negative bacterium is Acinetobacter baumannii which expresses one or more Class A -lactamase. In one embodiment, the Gram-negative bacterium is Acinetobacter baumannii which expresses one or more Class C -lactamase. In one embodiment, the Gram-negative bacterium is Acinetobacter baumannii which expresses one or more Class D -lactamase. In one embodiment, the Gram-negative bacterium is Acinetobacter baumannii which expresses TEM-1 or KPC-2.
[0192] The term Gram-negative is art-recognized as those bacteria that do not retain crystal violet dye in the Gram staining protocol. For example, as used herein, the term Gram-negative bacteria describes one or more (i.e., a combination) of the following Acinetobacter baumannii, Acinetobacter haemolyticus, Actinobacillus actinomycetemcomitans, Aeromonas hydrophila, Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides distasonis, Bacteroides ovatus, Bacteroides vulgatus, Bordetella pertussis, Brucella melitensis, Burkholderia cepacia, Burkholderia pseudomallei, Burkholderia mallei, Fusobacterium, Prevotella corporis, Prevotella intermedia, Prevotella endodontalis, Porphyromonas asaccharolytica, Campylobacter jejuni, Campylobacter coli, Campylobacter fetus, Citrobacter freundii, Citrobacter koseri, Edwardsiella tarda, Eikenella corrodens, Enterobacter cloacae, Enterobacter aerogenes, Enterobacter agglomerans, Escherichia coli, Francisella tularensis, Haemophilus influenzae, Haemophilus ducreyi, Helicobacter pylori, Kingella kingae, Klebsiella pneumoniae, Klebsiella oxytoca, Klebsiella rhinoscleromatis, Klebsiella ozaenae, Legionella penumophila, Moraxella catarrhalis, Morganella morganii, Neisseria gonorrhoeae, Neisseria meningitidis, Pasteurella multocida, Plesiomonas shigelloides, Proteus mirabilis, Proteus vulgaris, Proteus penneri, Proteus myxofaciens, Providencia stuartii, Providencia rettgeri, Providencia alcalifaciens, Pseudomonas aeruginosa, Pseudomonas fluorescens, Salmonella typhi, Salmonella paratyphi, Serratia marcescens, Shigella flexneri, Shigella boydii, Shigella sonnei, Shigella dysenteriae, Stenotrophomonas maltophilia, Streptobacillus moniliformis, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Vibrio alginolyticus, Yersinia enterocolitica, Yersinia pestis, Yersinia pseudotuberculosis, Chlamydophila pneumoniae, Chlamydophila trachomatis, Rickettsia prowazekii, Coxiella burnetii, Ehrlichia chaffeensis, or Bartonella henselae. Moreover, it is expected that the a star shaped peptide polymer or composition of the present invention will be useful in treating one or more bacterial infections.
[0193] In another aspect, the Gram-negative bacteria may be any one or more of the following implicated in chronic periodontitis: Porphyromonas gingivalis, Treponema denticola, Tannerella forsythia, Aggregatibacter actinomycetemcomitans, Campylobacter rectus, Prevotella intermedia, Prevotella nigrescens, Fusobacterium nucleatum, Eikenella corrodens and Capnocytophaga ochracea. Therefore, the present invention finds application to treat intra-oral bacteria infection, including antibiotic resistant intra-oral bacteria.
[0194] In another aspect, the terms infection and bacterial infection refer to an infection caused by Gram-positive bacteria, also referred to as a Gram-positive infection.
[0195] Gram-positive bacteria refer to bacteria that are stained blue or violet by gram staining, and include, for example, Staphylococcus aureus, Lactobacillus spp, Bifidobacteria and Scardovia wiggsiae and the like. Gram-positive bacteria feature of having a thick peptidoglycan layer around a cell membrane and having no outer membrane on a periphery of the cell membrane. Gram-positive bacteria is not limited to Gram-positive cocci or Gram-positive bacilli.
[0196] Symptoms of toxic shock or toxic shock syndrome (TSS) vary depending on the underlying cause. TSS resulting from infection with the bacterium Staphylococcus aureus typically manifests in otherwise healthy individuals via signs and symptoms including high fever, accompanied by low blood pressure, malaise and confusion, which can rapidly progress to stupor, coma, and multiple organ failure. The characteristic rash, often seen early in the course of illness, resembles a sunburn, and can involve any region of the body including the lips, mouth, eyes, palms and soles. In patients who survive the initial phase of the infection, the rash desquamates, or peels off, after 10-14 days.
[0197] In contrast, TSS caused by the bacterium Streptococcus pyogenes, or TSLS, typically presents in people with pre-existing skin infections with the bacteria. These individuals often experience severe pain at the site of the skin infection, followed by rapid progression of symptoms as described above for TSS. In contrast to TSS caused by Staphylococcus, streptococcal TSS less often involves a sunburn-like rash.
[0198] For staphylococcal toxic shock syndrome, the diagnosis is based strictly upon CDC criteria defined in 2011, as follows:
[0199] 1. Body temperature >38.9 C. (102.02 F.)
[0200] 2. Systolic blood pressure <90 mmHg
[0201] 3. Diffuse macular erythroderma
[0202] 4. Desquamation (especially of the palms and soles) 1-2 weeks after onset
[0203] 5. Involvement of three or more organ systems: [0204] Gastrointestinal (vomiting, diarrhoea) [0205] Muscular: severe myalgia or creatine phosphokinase level at least twice the upper limit of normal [0206] Mucous membrane hyperaemia (vaginal, oral, conjunctival) [0207] Kidney failure (serum creatinine >2 times normal) [0208] Liver inflammation (bilirubin, AST, or ALT>2 times normal) [0209] Low platelet count (platelet count <100,000/mm.sup.3) [0210] Central nervous system involvement (confusion without any focal neurological findings)
[0211] 6. Negative results of: [0212] Blood, throat, and CSF cultures for other bacteria (besides S. aureus) [0213] Negative serology for Rickettsia infection, leptospirosis, and measles
[0214] Cases are classified as confirmed or probable based on the following: [0215] Confirmed: All six of the criteria above are met (unless the patient dies before desquamation can occur); and [0216] Probable: Five of the six criteria above are met.
[0217] A bacteria may be considered as resistant to a certain antibiotic if the MIC is above its breakpoint. Breakpoint tables are published by the relevant committees and known to the skilled person, for example:
[0218] 1. European Committee on Antimicrobial Susceptibility http://www.eucast.org/clinical_breakpoints/Clinical breakpointsbacteria (v 6.0).
[0219] 2. Clinical and Laboratory Standards Institute (CLSI) http://clsi.org/m100/Any clinical or biochemical tests as described herein could be performed to determine whether particular bacteria are resistant to an antibiotic, including Broth microdilution (MIC) and disk diffusion assays.
[0220] Bacteria may be considered resistant to an antibiotic or anti-bacterial compound, if no bactericidal effect is observed at up to 5 mg/ml when tested in vitro. Alternatively, bacteria may be deemed resistant to an antibiotic or anti-bacterial compound because no improvement is seen clinically in a patient's condition upon administration of a full regimen of that antibiotic or anti-bacterial compound. Conversely, bacteria are considered to be sensitive to an antibiotic or anti-bacterial compound when bactericidal activity can be detected at therapeutically effective ranges or when an improvement is seen in a patient's condition upon administration of a full regimen of that antibiotic.
[0221] An antibiotic resistant bacteria or bacteria that exhibit antibiotic resistance may exhibit detectable resistance to one or more known antibiotics, including but not limited to:
[0222] (1) Macrolides or ketolides such as erythromycin, azithromycin, clarithromycin and telithromycin;
[0223] (2) Beta (6)-lactams such as penicillin G, penicillin V, methicillin, oxacillin, cloxacillin, dicloxacillin, nafcillin, ampicillin, amoxicillin, carbenicillin, ticarcillin, mezlocillin, piperacillin, azlocillin, temocillin, cepalothin, cephapirin, cephradine, cephaloridine, cefazolin, cefamandole, cefuroxime, cephalexin, cefprozil, cefaclor, loracarbef, cefoxitin, cefinetazole, cefotaxime, ceftizoxime, ceftriaxone, cefoperazone, ceftazidime, cefixime, cefpodoxime, ceftibuten, cefdinir, cefpirome, cefepime, aztreonam, imipenem, meropenem, ertapenem, doripenem, ceftobiprole, and ceftaroline;
[0224] (3) Quinolones such as nalidixic acid, oxolinic acid, norfloxacin, pefloxacin, enoxacin, ofloxacin, levofloxacin, ciprofloxacin, temafloxacin, lomefloxacin, fleroxacin, grepafloxacin, sparfloxacin, trovafloxacin, clinafloxacin, gatifloxacin, moxifloxacin, sitafloxacin, garenoxacin, gemifloxacin and pazufloxacin,
[0225] (4) Antibacterial sulfonanmides and antibacterial sulphanilamides, including para-aminobenzoic acid, sulfadiazine, sulfisoxazole, sulfamethoxazole and sulfathalidine;
[0226] (5) Aminoglycosides such as streptomycin, neomycin, kanamycin, paromycin, gentamicin, tobramycin, amikacin, netilmicin, spectinomycin, sisomicin, dibekacin and isepamicin,
[0227] (6) Tetracyclines such as tetracycline, chlortetracycline, demeclocycline, minocycline, oxytetracycline, methacycline, tigecycline, doxycycline;
[0228] (7) Rifamycins such as rifampicin (also called rifampin), rifapentine, rifabutin, bezoxazinorifamycin and rifaximin;
[0229] (8) Lincosamides such as lincomycin and clindamycin;
[0230] (9) Glycopeptides such as telavancin, vancomycin and teicoplanin or lipopeptides such as daptomycin;
[0231] (10) Streptogramins such as quinupristin and daflopristin;
[0232] (11) Oxazolidinones such as linezolid;
[0233] (12) Polymyxin, colistin and colymycin; and
[0234] (13) Trimethoprim and bacitracin.
[0235] Non-limiting examples of bacteria exhibiting resistance to aztreonam include examples of staphylococci, Staphylococcus aureus, Staphylococcus hemolyticus; Xanthomonas maltophilia; Aeromonas hydrophile; Citrobacter diversus; Enterobacter agglomerans, Haemophilus spp., Streptococcus pyogenes and P. aeruginosa.
[0236] Non-limiting examples of bacteria that exhibit resistance to colistin include Brucella, Burkholderia cepacia, Chryseobacterium indologenes, Edwardsiella, Elizabethkingia meningoseptica, Francisella tularensis spp. Gram-negative cocci, Helicobacter pylori, Moraxella catarrhalis, Morganella spp., Neisseria gonorrheae and Neisseria meningitides, Proteus, Providencia, Serratia, Stenotrophomonas maltophilia, Aeromonas, Vibrio, Prevotella, Fusobacterium, and Escherichia coli.
[0237] Exemplary bacteria which can result in an infection and which the present invention finds particular application in the treatment, prevention or prophylaxis of are now described below. Also described in the context of the different types of bacteria are conditions associated with, or caused by, a bacterial infection comprising or consisting of that type of bacteria.
[0238] Escherichia coli (E. coli) is a Gram-negative bacterium that is part of the normal flora of the gastrointestinal tract. There are hundreds of strains of E. coli, most of which are harmless and live in the gastrointestinal tract of healthy humans and animals. Currently, there are four recognized classes of enterovirulent E. coli (the EEC group) that cause gastroenteritis in humans. Among these are the enteropathogenic (EPEC) strains and those whose virulence mechanism is related to the excretion of typical E. coli enterotoxins. Such strains of E. coli can cause various diseases including those associated with infection of the gastrointestinal tract and urinary tract, septicemia, pneumonia, and meningitis. Antibiotics are not effective against some strains and do not necessarily prevent recurrence of infection.
[0239] For example, E. coli strain 0157:H7 is estimated to cause 10,000 to 20,000 cases of infection in the United States annually (Federal Centers for Disease Control and Prevention). Hemorrhagic colitis is the name of the acute disease caused by E. coli O157:H7. Preschool children and the elderly are at the greatest risk of serious complications.
[0240] Exemplary sequences for enterovirulent E. coli strains include Gen Bank Accession Numbers AB011549, X97542, AF074613, Y11275 and AJ007716.
[0241] Salmonella thyphimurium, are Gram-negative bacteria which cause various conditions that range clinically from localized gastrointestinal infections, gastroenterits (diarrhea, abdominal cramps, and fever) to enteric fevers (including typhoid fever) which are serious systemic illnesses. Salmonella infection also causes substantial losses of livestock.
[0242] Typical of Gram-negative bacilli, the cell wall of Salmonella spp. contains a complex lipopolysaccharide (LPS) structure that is liberated upon lysis of the cell and may function as an endotoxin, which contributes to the virulence of the organism.
[0243] Contaminated food is the major mode of transmission for non-typhoidal Salmonella infection, due to the fact that Salmonella survive in meats and animal products that are not thoroughly cooked. The most common animal sources are chickens, turkeys, pigs, and cows; in addition to numerous other domestic and wild animals. The epidemiology of typhoid fever and other enteric fevers caused by Salmonella spp. is associated with water contaminated with human feces.
[0244] Vaccines are available for typhoid fever and are partially effective; however, no vaccines are available for non-typhoidal Salmonella infection. Non-typhoidal salmonellosis is controlled by hygienic slaughtering practices and thorough cooking and refrigeration of food. Antibiotics are indicated for systemic disease, and Ampicillin has been used with some success. However, in patients under treatment with excessive amounts of antibiotics, patients under treatment with immunsuppressive drugs, following gastric surgery, and in patients with hemolytic anemia, leukemia, lymphoma, or AIDS, Salmonella infection remains a medical problem.
[0245] Pseudomonas spp. are motile, Gram-negative rods which are clinically important because they are resistant to most antibiotics, and are a major cause of hospital acquired (nosocomial) infections. Infection is most common in: immunocompromised individuals, burn victims, individuals on respirators, individuals with indwelling catheters, IV narcotic users and individual with chronic pulmonary disease (e.g., cystic fibrosis). Although infection is rare in healthy individuals, it can occur at many sites and lead to urinary tract infections, sepsis, pneumonia, pharyngitis, and numerous other problems, and treatment often fails with greater significant mortality.
[0246] Pseudomonas aeruginosa is a Gram-negative, aerobic, rod-shaped bacterium with unipolar motility. An opportunistic human pathogen, P. aeruginosa is also an opportunistic pathogen of plants. Like other Pseudomonas, P. aeruginosa secretes a variety of pigments. Definitive clinical identification of P. aeruginosa can include identifying the production of both pyocyanin and fluorescein as well as the organism's ability to grow at 42 C. P. aeruginosa is also capable of growth in diesel and jet fuel, for which it is known as a hydrocarbon utilizing microorganism (or HUM bug), causing microbial corrosion.
[0247] Vibrio cholerae is a Gram-negative rod which infects humans and causes cholera, a disease spread by poor sanitation, resulting in contaminated water supplies. Vibrio cholerae can colonize the human small intestine, where it produces a toxin that disrupts ion transport across the mucosa, causing diarrhea and water loss. Individuals infected with Vibrio cholerae require rehydration either intravenously or orally with a solution containing electrolytes. The illness is generally self-limiting; however, death can occur from dehydration and loss of essential electrolytes. Antibiotics such as tetracycline have been demonstrated to shorten the course of the illness, and oral vaccines are currently under development.
[0248] Neisseria gonorrhoea is a Gram-negative coccus, which is the causative agent of the common sexually transmitted disease, gonorrhea. Neisseria gonorrhoea can vary its surface antigens, preventing development of immunity to reinfection. Nearly 750,000 cases of gonorrhea are reported annually in the United States, with an estimated 750,000 additional unreported cases annually, mostly among teenagers and young adults. Ampicillin, amoxicillin, or some type of penicillin used to be recommended for the treatment of gonorrhea. However, the incidence of penicillin-resistant gonorrhea is increasing, and new antibiotics given by injection, e.g., ceftriaxone or spectinomycin, are now used to treat most gonococcal infections.
[0249] Staphylococcus aureus is a Gram-positive coccus which normally colonizes the human nose and is sometimes found on the skin. Staphylococcus can cause bloodstream infections, pneumonia, and surgical-site infections in the hospital setting (i.e., nosocomial infections). Staph. aureus can cause severe food poisoning, and many strains grow in food and produce exotoxins. Staphylococcus resistance to common antibiotics, e.g., vancomycin, has emerged in the United States and abroad as a major public health challenge both in community and hospital settings. Recently, a vancomycin-resistant Staph. aureus isolate has also been identified in Japan.
[0250] Mycobacterium tuberculosis is a Gram positive bacterium which is the causative agent of tuberculosis, a sometimes crippling and deadly disease. Tuberculosis is on the rise and globally and the leading cause of death from a single infectious disease (with a current death rate of three million people per year).
[0251] It can affect several organs of the human body, including the brain, the kidneys and the bones, however, tuberculosis most commonly affects the lungs.
[0252] In the United States, approximately ten million individuals are infected with Mycobacterium tuberculosis, as indicated by positive skin tests, with approximately 26,000 new cases of active disease each year. The increase in tuberculosis (TB) cases has been associated with HIV/AIDS, homelessness, drug abuse and immigration of persons with active infections. Current treatment programs for drug-susceptible TB involve taking two or four drugs (e.g., isoniazid, rifampin, pyrazinamide, ethambutol or streptomycin), for a period of from six to nine months, because all of the TB germs cannot be destroyed by a single drug. In addition, the observation of drug-resistant and multiple drug resistant strains of Mycobacterium tuberculosis is on the rise.
[0253] Helicobacter pylori (H. pylori) is a micro-aerophilic, Gram-negative, slow-growing, flagellated organism with a spiral or S-shaped morphology which infects the lining of the stomach. H. pylori is a human gastric pathogen associated with chronic superficial gastritis, peptic ulcer disease, and chronic atrophic gastritis leading to gastric adenocarcinoma. H. pylori is one of the most common chronic bacterial infections in humans and is found in over 90% of patients with active gastritis. Current treatment includes triple drug therapy with bismuth, metronidazole, and either tetracycline or amoxicillin which eradicates H. pylori in most cases. Problems with triple therapy include patient compliance, side effects, and metronidazole resistance. Alternate regimens of dual therapy which show promise are amoxicillin plus metronidazole or omeprazole plus amoxicillin.
[0254] Streptococcus pneumoniae is a Gram-positive coccus and one of the most common causes of bacterial pneumonia as well as middle ear infections (otitis media) and meningitis. Each year in the United States, pneumococcal diseases account for approximately 50,000 cases of bacteremia; 3,000 cases of meningitis; 100,000-135,000 hospitalizations; and 7 million cases of otitis media. Pneumococcal infections cause an estimated 40,000 deaths annually in the United States. Children less than 2 years of age, adults over 65 years of age and persons of any age with underlying medical conditions, including, e.g., congestive heart disease, diabetes, emphysema, liver disease, sickle cell, HIV, and those living in special environments, e.g., nursing homes and long-term care facilities, at highest risk for infection.
[0255] Drug-resistant S. pneumoniae strains have become common in the United States, with many penicillin-resistant pneumococci also resistant to other antimicrobial drugs, such as erythromycin or trimethoprim-sulfamethoxazole.
[0256] Treponema pallidium is a spirochete which causes syphilis. T. pallidum is exclusively a pathogen which causes syphilis, yaws and non-venereal endemic syphilis or pinta. Treponema pallidum cannot be grown in vitro and does replicate in the absence of mammalian cells. The initial infection causes an ulcer at the site of infection; however, the bacteria move throughout the body, damaging many organs over time. In its late stages, untreated syphilis, although not contagious, can cause serious heart abnormalities, mental disorders, blindness, other neurologic problems, and death.
[0257] Syphilis is usually treated with penicillin, administered by injection. Other antibiotics are available for patients allergic to penicillin, or who do not respond to the usual doses of penicillin. In all stages of syphilis, proper treatment will cure the disease, but in late syphilis, damage already done to body organs cannot be reversed.
[0258] Chlamydia trachomatis is the most common bacterial sexually transmitted disease in the United States and it is estimated that 4 million new cases occur each year. The highest rates of infection are in 15 to 19 year olds. Chlamydia is a major cause of non-gonococcal urethritis (NGU), cervicitis, bacterial vaginitis, and pelvic inflammatory disease (PID). Chlamydia infections may have very mild symptoms or no symptoms at all; however, if left untreated Chlamydia infections can lead to serious damage to the reproductive organs, particularly in women. Antibiotics such as azithromycin, erythromycin, ofloxacin, amoxicillin or doxycycline are typically prescribed to treat Chlamydia infection.
[0259] Bartonella henselae Cat Scratch Fever (CSF) or cat scratch disease (CSD), is a disease of humans acquired through exposure to cats, caused by a Gram-negative rod originally named Rochalimaea henselae, and currently known as Bartonella henselae. Symptoms include fever and swollen lymph nodes and CSF is generally a relatively benign, self-limiting disease in people, however, infection with Bartonella henselae can produce distinct clinical symptoms in immunocompromised people, including, acute febrile illness with bacteremia, bacillary angiomatosis, peliosis hepatis, bacillary splenitis, and other chronic disease manifestations such as AIDS encephalopathy.
[0260] The disease is treated with antibiotics, such as doxycycline, erythromycin, rifampin, penicillin, gentamycin, ceftriaxone, ciprofloxacin, and azithromycin.
[0261] Haemophilus influenzae (H. influenza) is a family of Gram-negative bacteria; six types of which are known, with most H. influenza-related disease caused by type B, or HIB. Until a vaccine for HIB was developed, HIB was a common causes of otitis media, sinus infections, bronchitis, the most common cause of meningitis, and a frequent culprit in cases of pneumonia, septic arthritis (joint infections), cellulitis (infections of soft tissues), and pericarditis (infections of the membrane surrounding the heart). The H. influenza type B bacterium is widespread in humans and usually lives in the throat and nose without causing illness. Unvaccinated children under age 5 are at risk for HIB disease. Meningitis and other serious infections caused by H. influenza infection can lead to brain damage or death.
[0262] Shigella dysenteriae (Shigella dys.) is a Gram-negative rod which causes dysentery. In the colon, the bacteria enter mucosal cells and divide within mucosal cells, resulting in an extensive inflammatory response. Shigella infection can cause severe diarrhea which may lead to dehydration and can be dangerous for the very young, very old or chronically ill. Shigella dys. forms a potent toxin (shiga toxin), which is cytotoxic, enterotoxic, neurotoxic and acts as a inhibitor of protein synthesis. Resistance to antibiotics such as ampicillin and TMP-SMX has developed, however, treatment with newer, more expensive antibiotics such as ciprofloxacin, norfloxacin and enoxacin, remains effective.
[0263] Listeria is a genus of Gram-positive, motile bacteria found in human and animal feces. Listeria monocytogenes causes such diseases as listeriosis, meningoencephalitis and meningitis. This organism is one of the leading causes of death from food-borne pathogens especially in pregnant women, newborns, the elderly, and immunocompromised individuals. It is found in environments such as decaying vegetable matter, sewage, water, and soil, and it can survive extremes of both temperatures and salt concentration making it an extremely dangerous food-born pathogen, especially on food that is not reheated. The bacterium can spread from the site of infection in the intestines to the central nervous system and the fetal-placental unit. Meningitis, gastroenteritis, and septicemia can result from infection. In cattle and sheep, Listeria infection causes encephalitis and spontaneous abortion.
[0264] Proteus mirabilis is an enteric, Gram-negative commensal organism, distantly related to E. coll. It normally colonizes the human urethra, but is an opportunistic pathogen that is the leading cause of urinary tract infections in catheterized individuals. P. mirabilis has two exceptional characteristics: 1) it has very rapid motility, which manifests itself as a swarming phenomenon on culture plates; and 2) it produce urease, which gives it the ability to degrade urea and survive in the genitourinary tract.
[0265] Yersinia pestis is the causative agent of plague (bubonic and pulmonary) a devastating disease which has killed millions worldwide. The organism can be transmitted from rats to humans through the bite of an infected flea or from human-to-human through the air during widespread infection. Yersinia pestis is an extremely pathogenic organism that requires very few numbers in order to cause disease, and is often lethal if left untreated. The organism is enteroinvasive, and can survive and propagate in macrophages prior to spreading systemically throughout the host.
[0266] Bacillus anthracis is also known as anthrax. Humans become infected when they come into contact with a contaminated animal. Anthrax is not transmitted due to person-to-person contact. The three forms of the disease reflect the sites of infection which include cutaneous (skin), pulmonary (lung), and intestinal. Pulmonary and intestinal infections are often fatal if left untreated. Spores are taken up by macrophages and become internalized into phagolysozomes (membranous compartment) whereupon germination initiates. Bacteria are released into the bloodstream once the infected macrophage lyses whereupon they rapidly multiply, spreading throughout the circulatory and lymphatic systems, a process that results in septic shock, respiratory distress and organ failure. The spores of this pathogen have been used as a terror weapon.
[0267] Burkholderia mallei is a Gram-negative aerobic bacterium that causes Glanders, an infectious disease that occurs primarily in horses, mules, and donkeys. It is rarely associated with human infection and is more commonly seen in domesticated animals. This organism is similar to B. pseudomallei and is differentiated by being nonmotile. The pathogen is host-adapted and is not found in the environment outside of its host. Glanders is often fatal if not treated with antibiotics, and transmission can occur through the air, or more commonly when in contact with infected animals. Rapid-onset pneumonia, bacteremia (spread of the organism through the blood), pustules, and death are common outcomes during infection. The virulence mechanisms are not well understood, although a type III secretion system similar to the one from Salmonella typhimurium is necessary. No vaccine exists for this potentially dangerous organism which is thought to have potential as a biological terror agent. The genome of this organism carries a large number of insertion sequences as compared to the related Bukholderia pseudomallei (below), and a large number of simple sequence repeats that may function in antigenic variation of cell surface proteins.
[0268] Burkholderia pseudomallei is a Gram-negative bacterium that causes meliodosis in humans and animals. Meliodosis is a disease found in certain parts of Asia, Thailand, and Australia. B. pseudomallei is typically a soil organism and has been recovered from rice paddies and moist tropical soil, but as an opportunistic pathogen can cause disease in susceptible individuals such as those that suffer from diabetes mellitus. The organism can exist intracellularly, and causes pneumonia and bacteremia (spread of the bacterium through the bloodstream). The latency period can be extremely long, with infection preceding disease by decades, and treatment can take months of antibiotic use, with relapse a commonly observed phenomenon. Intercellular spread can occur via induction of actin polymerization at one pole of the cell, allowing movement through the cytoplasm and from cell-to-cell. This organism carries a number of small sequence repeats which may promoter antigenic variation, similar to what was found with the B. mallei genome.
[0269] Burkholderia cepacia is a Gram-negative bacterium composed of at least seven different sub-species, including Burkholderia multivorans, Burkholderia vietnamiensis, Burkholderia stabilis, Burkholderia cenocepacia and Burkholderia ambifaria. B. cepacia is an important human pathogen which most often causes pneumonia in people with underlying lung disease (such as cystic fibrosis or immune problems (such as (chronic granulomatous disease). B. cepacia is typically found in water and soil and can survive for prolonged periods in moist environments. Person-to-person spread has been documented; as a result, many hospitals, clinics, and camps for patients with cystic fibrosis have enacted strict isolation precautions B. cepacia. Individuals with the bacteria are often treated in a separate area than those without to limit spread. This is because infection with B. cepacia can lead to a rapid decline in lung function resulting in death. Diagnosis of B. cepacia involves isolation of the bacteria from sputum cultures. Treatment is difficult because B. cepacia is naturally resistant to many common antibiotics including aminoglycosides (such as tobramycin) and polymixin B. Treatment typically includes multiple antibiotics and may include ceftazidime, doxycycline, piperacillin, chloramphenicol, and co-trimoxazole.
[0270] Francisella tularensis was first noticed as the causative agent of a plague-like illness that affected squirrels in Tulare County in California in the early part of the 20th century by Edward Francis. The organism now bears his namesake. The disease is called tularemia and has been noted throughout recorded history. The organism can be transmitted from infected ticks or deerflies to a human, through infected meat, or via aerosol, and thus is a potential bioterrorism agent. It is an aquatic organism, and can be found living inside protozoans, similar to what is observed with Legionella. It has a high infectivity rate, and can invade phagocytic and nonphagocytic cells, multiplying rapidly. Once within a macrophage, the organism can escape the phagosome and live in the cytosol.
[0271] The invention also finds use in veterinary applications. A healthy microflora in the gastro-intestinal tract of livestock is of vital importance for health and corresponding production of associated food products. As with humans, the gastrointestinal tract of a healthy animal contains numerous types of bacteria (i.e., E. coli, Pseudomonas aeruginosa and Salmonella spp.), which live in ecological balance with one another. This balance may be disturbed by a change in diet, stress, or in response to antibiotic or other therapeutic treatment, resulting in bacterial diseases in the animals generally caused by bacteria such as Salmonella, Campylobacter, Enterococci, Tularemia and E. coll. Bacterial infection in these animals often necessitates therapeutic intervention, which has treatment costs as well-being frequently associated with a decrease in productivity.
[0272] As a result, livestock are routinely treated with antibiotics to maintain the balance of flora in the gastrointestinal tract. The disadvantages of this approach are the development of antibiotic resistant bacteria and the carry over of such antibiotics and the resistant bacteria into resulting food products for human consumption.
[0273] The term treat, treating or treatment as used herein also refers to administering compositions or one or more of pharmaceutically active ingredients discussed herein, with or without additional pharmaceutically active or inert ingredients, in order to: (i) reduce or eliminate either a bacterial infection or one or more symptoms of the bacterial infection, or (ii) retard the progression of a bacterial infection or of one or more symptoms of the bacterial infection, or (iii) reduce the severity of a bacterial infection or of one or more symptoms of the bacterial infections, or (iv) suppress the clinical manifestation of a bacterial infection, or (v) suppress the manifestation of adverse symptoms of the bacterial infections. Further, the terms treating and treatment may include one or more of, ameliorating a symptom of a bacterial infection in a subject, blocking or ameliorating a recurrence of a symptom of a bacterial infection in a subject, decreasing in severity and/or frequency a symptom of a bacterial infection in a subject, stasis, decreasing, or inhibiting growth of a vegetative form of bacteria in a subject, inhibiting bacterial sporulation in a subject, inhibiting activation of a bacterial spore in a subject, inhibiting germination of a bacterial spore in a subject, and inhibiting outgrowth of a bacterial spore in a subject. Treatment means ameliorating, blocking, reducing, decreasing or inhibiting by about 1% to about 100% versus a subject to which a star shaped peptide polymer or composition of the present invention has not been administered. Preferably, the ameliorating, blocking, reducing, decreasing or inhibiting is 100%, 99%, 98%, 97%, 96%, 95%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or 1% versus a subject to which a star shaped peptide polymer or composition of the present invention has not been administered.
[0274] Successful treatment may generally mean improvement in any symptoms associated with or caused by a Gram-positive or Gram-negative bacterial infection for example may refer to an improvement in any of the following: fever, inflammation, swelling, vomiting, fatigue, cramping, coughing, sneezing, respiratory illness, diarrhea, meningitis, headaches, joint pain, body aches, blisters, rashes, nausea, chills, dizziness, drowsiness, sleeplessness, gagging, skin irritation, excessive mucus production (e.g. in the eyes, gastrointestinal tract, sinuses, or respiratory system), ulcers, gastrointestinal discomfort, skin loss, hair loss, necrosis, and organ dysfunction. Improvements in any of these symptoms or in the bacterial infection or conditions described herein can be readily assessed according to standard methods and techniques known in the art. The population of subjects treated by the method of the disease includes subjects suffering from the undesirable condition or disease, as well as subjects at risk for development of the condition or disease.
[0275] As used herein, the terms inhibit, inhibiting and inhibition have their ordinary and customary meanings, and include one or more of inhibiting growth or a function of bacteria, inhibiting growth of a vegetative form of bacteria, inhibiting a function of a vegetative form of bacteria, inhibiting propagation of bacteria, inhibiting bacterial sporulation, inhibiting activation of a bacterial spore, inhibiting germination of a bacterial spore, and inhibiting outgrowth of a bacterial spore. Such inhibition is an inhibition of about 1% to about 100% of the particular activity versus the activity in a subject to which a star shaped peptide polymer or composition of the present invention has not been administered. Preferably, the inhibition is an inhibition of 100%, 99%, 98%, 97%, 96%, 95%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or 1% of the activity versus a subject to which a star shaped peptide polymer or composition of the present invention has not been administered. As used herein, spore refers to both the conventionally used terms spore and endospore.
[0276] As used herein, the terms preventing and prevention have their ordinary and customary meanings, and includes one or more of preventing colonization of bacteria in a subject, preventing an increase in the growth of a population of bacteria in a subject, preventing activation, germination or outgrowth of bacterial spores in a subject, preventing sporulation of bacteria in a subject, preventing development of a disease caused by bacteria in a subject, and preventing symptoms of a disease caused by bacteria in a subject. As used herein, the prevention lasts at least about 0.5, 1, 2, 3, 4, 5, 6, 7, 10, 12, 15, 20, 25, 30, 35, 40 or more days after administration of a star shaped peptide polymer or composition of the present invention.
[0277] As used herein, prophylaxis includes inhibiting the development of a productive or progressive infection by bacteria in a subject, where the prophylaxis lasts at least about 0.5, 1, 2, 3, 4, 5, 6, 7, 10, 12, 15, 20, 25, 30, 35, 40 or more days after administration of a star shaped peptide polymer or composition of the present invention Inhibition against development of a productive or progressive infection by a bacterial infection means that the severity of a bacterial infection in a subject is reduced by about 1% to about 100% versus a subject to which a star shaped peptide polymer or composition of the present invention has not been administered. Preferably, the reduction in severity is a 100%, 99%, 98%, 97%, 96%, 95%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or 1% reduction in severity. The severity of an infection may be based on the amount of bacteria present in a subject, the length of time that the bacteria can be detected in a subject, and/or the severity of a symptom of a bacterial infection, among other factors.
[0278] As used herein, the term contacting is meant to broadly refer to bringing a bacterial cell and a star shaped peptide polymer of the present invention into sufficient proximity that the star shaped peptide polymer can exert an effect on the bacterial cell. The star shaped peptide polymer may be transported to the location of the bacterial cell, or the star shaped peptide polymer may be situated in a location to which the bacterial cell travels or is brought into contact. The skilled artisan will understand that the term contacting includes physical interaction between a star shaped peptide polymer and a bacterial cell, as well as interactions that do not require physical interaction.
[0279] The therapeutically effective amount of any of a star shaped peptide polymer or compositions, and the amounts sufficient to achieve the stated goals of the methods disclosed herein, will vary depending upon the physical characteristics of the subject, the age of the subject, the severity of the subject's symptoms, the identity of the bacteria, the location of the bacterial infection(s), the formulation and the means used to administer the antibacterial agent(s), the number of doses being administered to the subject over the course of treatment, and the method being practiced. The specific doses for a given subject are usually set by the judgment of the attending physician. However, general ranges and some non-limiting specific examples are provided in the following paragraphs.
[0280] As used herein administration of a star shaped peptide polymer of the invention and a chelating agent includes either a fixed combination in one dosage unit form, or a kit of parts for the combined administration where a star shaped peptide polymer and chelating agent may be administered independently at the same time or separately within time intervals.
[0281] A chelating agent may be administered in combination with a star shaped peptide polymer of present invention wherein the chelating agent is administered prior to, simultaneously, or after a star shaped peptide polymer of the present invention. When simultaneous administration of a star shaped peptide polymer of the invention with a chelating is desired and the route of administration is the same, then a star shaped peptide polymer of the invention may be formulated with the chelating agent into the same dosage form.
[0282] The present invention also contemplates the use of more biocompatible chelators (e.g., citric acid), tethering of the chelator to the star shaped peptide polymer through chemical conjugation, on-demand release of the chelator at the infection site, or any combination thereof.
[0283] Star shaped peptide polymers and compositions of the invention may be formulated for any appropriate route of administration including, for example, topical (for example, transdermal or ocular), oral, buccal, nasal, vaginal, rectal or parenteral administration. The term parenteral as used herein includes subcutaneous, intradermal, intravascular (for example, intravenous), intramuscular, spinal, intracranial, intrathecal, intraocular, periocular, intraorbital, intrasynovial and intraperitoneal injection, as well as any similar injection or infusion technique. Other routes of administration include intra-oral, intra-sulcular and intra-periodontal pocket. In certain embodiments, compositions in a form suitable for oral use or parenteral use are preferred. Suitable oral forms include, for example, tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsions, hard or soft capsules, or syrups or elixirs. Within yet other embodiments, compositions provided herein may be formulated as a lyophilizate.
[0284] The various dosage units are each preferably provided as a discrete dosage tablet, capsules, lozenge, dragee, gum, or other type of solid formulation. Capsules may encapsulate a powder, liquid, or gel. The solid formulation may be swallowed, or may be of a suckable or chewable type (either frangible or gum-like). The present invention contemplates dosage unit retaining devices other than blister packs; for example, packages such as bottles, tubes, canisters, packets. The dosage units may further include conventional excipients well-known in pharmaceutical formulation practice, such as binding agents, gellants, fillers, tableting lubricants, disintegrants, surfactants, and colorants; and for suckable or chewable formulations.
[0285] Compositions intended for oral use may further comprise one or more components such as sweetening agents, flavouring agents, colouring agents and/or preserving agents in order to provide appealing and palatable preparations. Tablets contain the active ingredient in admixture with physiologically acceptable excipients that are suitable for the manufacture of tablets. Such excipients include, for example, inert diluents such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate, granulating and disintegrating agents such as corn starch or alginic acid, binding agents such as starch, gelatine or acacia, and lubricating agents such as magnesium stearate, stearic acid or talc. The tablets may be uncoated or they may be coated by known techniques to delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period. For example, a time delay material such as glyceryl monosterate or glyceryl distearate may be employed.
[0286] Formulations for oral use may also be presented as hard gelatine capsules wherein the active ingredient is mixed with an inert solid diluent such as calcium carbonate, calcium phosphate or kaolin, or as soft gelatine capsules wherein the active ingredient is mixed with water or an oil medium such as peanut oil, liquid paraffin or olive oil.
[0287] Aqueous suspensions contain the active ingredient(s) in admixture with excipients suitable for the manufacture of aqueous suspensions. Such excipients include suspending agents such as sodium carboxymethylcellulose, methylcellulose, hydropropylmethylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia, and dispersing or wetting agents such as naturally-occurring phosphatides (for example, lecithin), condensation products of an alkylene oxide with fatty acids such as polyoxyethylene stearate, condensation products of ethylene oxide with long chain aliphatic alcohols such as heptadecaethyleneoxycetanol, condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol mono-oleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides such as polyethylene sorbitan monooleate. Aqueous suspensions may also comprise one or more preservatives, for example ethyl, or n-propyl p-hydroxybenzoate, one or more colouring agents, one or more flavouring agents, and one or more sweetening agents, such as sucrose or saccharin.
[0288] Oily suspensions may be formulated by suspending the active ingredients in a vegetable oil such as Arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin. The oily suspensions may contain a thickening agent such as beeswax, hard paraffin or cetyl alcohol. Sweetening agents such as those set forth above, and/or flavouring agents may be added to provide palatable oral preparations. Such suspensions may be preserved by the addition of an antioxidant such as ascorbic acid.
[0289] Dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, suspending agent and one or more preservatives. Suitable dispersing or wetting agents and suspending agents are exemplified by those already mentioned above. Additional excipients, such as sweetening, flavouring and colouring agents, may also be present.
[0290] Pharmaceutical compositions may also be in the form of oil-in-water emulsions. The oily phase may be a vegetable oil such as olive oil or Arachis oil, a mineral oil such as liquid paraffin, or a mixture thereof. Suitable emulsifying agents include naturally-occurring gums such as gum acacia or gum tragacanth, naturally-occurring phosphatides such as soy bean lecithin, and esters or partial esters derived from fatty acids and hexitol, anhydrides such as sorbitan monoleate, and condensation products of partial esters derived from fatty acids and hexitol with ethylene oxide such as polyoxyethylene sorbitan monoleate. An emulsion may also comprise one or more sweetening and/or flavouring agents.
[0291] Syrups and elixirs may be formulated with sweetening agents, such as glycerol, propylene glycol, sorbitol or sucrose. Such formulations may also comprise one or more demulcents, preservatives, flavouring agents and/or colouring agents.
[0292] Compositions of the invention may be formulated for local or topical administration, such as for topical application to the skin. Formulations for topical administration typically comprise a topical vehicle combined with active agent(s), with or without additional optional components.
[0293] Suitable topical vehicles and additional components are well known in the art, and it will be apparent that the choice of a vehicle will depend on the particular physical form and mode of delivery. Topical vehicles include organic solvents such as alcohols (for example, ethanol, iso-propyl alcohol or glycerine), glycols such as butylene, isoprene or propylene glycol, aliphatic alcohols such as lanolin, mixtures of water and organic solvents and mixtures of organic solvents such as alcohol and glycerine, lipid-based materials such as fatty acids, acylglycerols including oils such as mineral oil, and fats of natural or synthetic origin, phosphoglycerides, sphingolipids and waxes, protein-based materials such as collagen and gelatine, silicone-based materials (both nonvolatile and volatile), and hydrocarbon-based materials such as microsponges and polymer matrices.
[0294] A composition may further include one or more components adapted to improve the stability or effectiveness of the applied formulation, such as stabilizing agents, suspending agents, emulsifying agents, viscosity adjusters, gelling agents, preservatives, antioxidants, skin penetration enhancers, moisturizers and sustained release materials. Examples of such components are described in MartindaleThe Extra Pharmacopoeia (Pharmaceutical Press, London 1993) and Martin (ed.), Remington's Pharmaceutical Sciences. Formulations may comprise microcapsules, such as hydroxymethylcellulose or gelatine-microcapsules, liposomes, albumin microspheres, microemulsions, nanoparticles or nanocapsules.
[0295] A topical formulation may be prepared in a variety of physical forms including, for example, solids, pastes, creams, foams, lotions, gels, powders, aqueous liquids, emulsions, sprays and skin patches. The physical appearance and viscosity of such forms can be governed by the presence and amount of emulsifier(s) and viscosity adjuster(s) present in the formulation. Solids are generally firm and non-pourable and commonly are formulated as bars or sticks, or in particulate form. Solids can be opaque or transparent, and optionally can contain solvents, emulsifiers, moisturizers, emollients, fragrances, dyes/colorants, preservatives and other active ingredients that increase or enhance the efficacy of the final product. Creams and lotions are often similar to one another, differing mainly in their viscosity. Both lotions and creams may be opaque, translucent or clear and often contain emulsifiers, solvents, and viscosity adjusting agents, as well as moisturizers, emollients, fragrances, dyes/colorants, preservatives and other active ingredients that increase or enhance the efficacy of the final product. Gels can be prepared with a range of viscosities, from thick or high viscosity to thin or low viscosity. These formulations, like those of lotions and creams, may also contain solvents, emulsifiers, moisturizers, emollients, fragrances, dyes/colorants, preservatives and other active ingredients that increase or enhance the efficacy of the final product. Liquids are thinner than creams, lotions, or gels, and often do not contain emulsifiers. Liquid topical products often contain solvents, emulsifiers, moisturizers, emollients, fragrances, dyes/colorants, preservatives and other active ingredients that increase or enhance the efficacy of the final product.
[0296] Emulsifiers for use in topical formulations include, but are not limited to, ionic emulsifiers, cetearyl alcohol, non-ionic emulsifiers like polyoxyethylene oleyl ether, PEG-40 stearate, ceteareth-12, ceteareth-20, ceteareth-30, ceteareth alcohol, PEG-100 stearate and glyceryl stearate. Suitable viscosity adjusting agents include, but are not limited to, protective colloids or nonionic gums such as hydroxyethylcellulose, xanthan gum, magnesium aluminum silicate, silica, microcrystalline wax, beeswax, paraffin, and cetyl palmitate. A gel composition may be formed by the addition of a gelling agent such as chitosan, methyl cellulose, ethyl cellulose, polyvinyl alcohol, polyquaterniums, hydroxyethylceilulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, carbomer or ammoniated glycyrrhizinate. Suitable surfactants include, but are not limited to, nonionic, amphoteric, ionic and anionic surfactants. For example, one or more of dimethicone copolyol, polysorbate 20, polysorbate 40, polysorbate 60, polysorbate 80, lauramide DEA, cocamide DEA, and cocamide MEA, oleyl betaine, cocamidopropyl phosphatidyl PG-dimonium chloride, and ammonium laureth sulfate may be used within topical formulations.
[0297] Preservatives include, but are not limited to, antimicrobials such as methylparaben, propylparaben, sorbic acid, benzoic acid, and formaldehyde, as well as physical stabilizers and antioxidants such as vitamin E, sodium ascorbate/ascorbic acid and propyl gallate. Suitable moisturizers include, but are not limited to, lactic acid and other hydroxy acids and their salts, glycerine, propylene glycol, and butylene glycol. Suitable emollients include lanolin alcohol, lanolin, lanolin derivatives, cholesterol, petrolatum, isostearyl neopentanoate and mineral oils. Suitable fragrances and colours include, but are not limited to, FD&C Red No. 40 and FD&C Yellow No. 5. Other suitable additional ingredients that may be included in a topical formulation include, but are not limited to, abrasives, absorbents, anticaking agents, antifoaming agents, antistatic agents, astringents (such as witch hazel), alcohol and herbal extracts such as chamomile extract, binders/excipients, buffering agents, chelating agents, film forming agents, conditioning agents, propellants, opacifying agents, pH adjusters and protectants.
[0298] Typical modes of delivery for topical compositions include application using the fingers, application using a physical applicator such as a cloth, tissue, swab, stick or brush, spraying including mist, aerosol or foam spraying, dropper application, sprinkling, soaking, and rinsing. Controlled release vehicles can also be used, and compositions may be formulated for transdermal administration (for example, as a transdermal patch).
[0299] Pharmaceutical compositions may be formulated as sustained release formulations such as a capsule that creates a slow release of modulator following administration. Such formulations may generally be prepared using well-known technology and administered by, for example, oral, rectal or subcutaneous implantation, or by implantation at the desired target site. Carriers for use within such formulations are biocompatible, and may also be biodegradable. Preferably, the formulation provides a relatively constant level of modulator release. The amount of modulator contained within a sustained release formulation depends upon, for example, the site of implantation, the rate and expected duration of release and the nature of the bacterial infection to be treated or prevented.
[0300] In one aspect, multiple doses of a star shaped peptide polymer or pharmaceutical composition may be required to treat an infection. Preferably, there are 2, 3, 4 or more doses, preferably in a 24 hour period. The dose may be about 2, 4, 6, 8 or more mg/kg.
[0301] In another aspect the present invention provides a kit or article of manufacture including a star shaped peptide polymer of the invention or pharmaceutical composition of the invention as described herein.
[0302] In other embodiments there is provided a kit for use in a therapeutic or prophylactic application mentioned herein, the kit including: [0303] a container holding a star shaped peptide polymer or pharmaceutical composition of the invention; and [0304] a label or package insert with instructions for use.
[0305] The kit or article of manufacture may comprise a container and a label or package insert on or associated with the container. Suitable containers include, for example, bottles, vials, syringes, blister pack, etc. The containers may be formed from a variety of materials such as glass or plastic. The container holds a star shaped peptide polymer or composition which is effective for treating the condition and may have a sterile access port (for example the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle). The label or package insert indicates that the star shaped peptide polymer or composition is used for treating a bacterial infection. In one embodiment, the label or package insert includes instructions for use and indicates that the therapeutic or prophylactic composition can be used to treat a bacterial infection described herein.
[0306] The kit may comprise (a) a therapeutic or prophylactic composition; and (b) a second container with a second active principle or ingredient contained therein. The kit in this embodiment of the invention may further comprise a package insert indicating the composition and other active principle can be used to treat a disorder or prevent a complication stemming from a bacterial infection described herein. Alternatively, or additionally, the kit may further comprise a second (or third) container comprising a pharmaceutically-acceptable buffer, such as bacteriostatic water for injection (BWFI), phosphate-buffered saline, Ringer's solution and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, and syringes.
[0307] In certain embodiments the therapeutic composition may be provided in the form of a device, disposable or reusable, including a receptacle for holding the star shaped peptide polymer or therapeutic or prophylactic pharmaceutical composition. In one embodiment, the device is a syringe. The device may hold 1-2 mL of the composition. The therapeutic or prophylactic composition may be provided in the device in a state that is ready for use or in a state requiring mixing or addition of further components.
EXAMPLES
Example 1
[0308] Synthesis of L-lysine(Z)-NCA (Lys NCA).
[0309] Dried H-Lys(Z)OH (1.24 g, 4.43 mmol) was added to anhydrous THF (25 mL) in an oven-dried two-necked round bottomed flask under argon. Triphosgene (580 mg, 1.96 mmol) was dissolved in anhydrous THF (5 mL) and added to the H-Lys(Z)OH suspension. The mixture was heated at 50 C. for 30 min with continuous stirring. The clear solution was allowed to cool to room temperature and added to anhydrous pentane (100 mL). The resulting precipitate was isolated via centrifugation and washed with anhydrous pentane (30 mL2). The resulting white solid was dried at ambient temperature in vacuo to afford Lys NCA, 0.910 g (81%). .sup.1H NMR (400 MHz, d.sub.6-DMSO) .sub.H 1.23-1.37 (m, -CH.sub.2, 2H), 1.37-1.45 (m, -CH.sub.2, 2H), 1.60-1.80 (m, -CH.sub.2, 2H), 2.94-3.02 (m, -CH.sub.2, 2H), 4.40-4.43 (m, -CH, 1H), 5.00 (dd, C.sub.6H.sub.5CH.sub.2, 2H), 6.90 (s, cyclic NH, 1H), 7.30-7.39 (m, C.sub.6H.sub.5, 5H).
Synthesis of DL-valine-NCA (Val NCA)
[0310] Dried DL-valine (1.24 g, 4.43 mmol) was dissolved in anhydrous THF (25 mL) in an oven-dried two-necked round bottomed flask under argon. Triphosgene (580 mg, 1.96 mmol) was dissolved in anhydrous THF (5 mL) and added to the DL-val-THF suspension. The mixture was heated at 50 C. for 30 min with continuous stirring. The clear solution was allowed to cool to room temperature and precipitated with anhydrous pentane (100 mL), followed by washing with more anhydrous pentane (30 mL2). The resulting residue was dried at ambient temperature in vacuo to afford Val NCA, 0.956 mg (85%). .sup.1H NMR (400 MHz, d.sub.6-DMSO) .sub.H 0.91 (dd, CH.sub.3, 6H), 2.00-2.12 (m, CH, 1H), 4.32 (dd, cyclic CH, 1H), 9.06 (s, cyclic NH, 1H).
Synthesis of poly(Z-L-lysine-r-DL-valine).SUB.arm.PAMAM-(NH.SUB.2.).SUB.16,core .Star Peptide Polymer S16.SUB.Z
[0311] Lys NCA (1.3 g, 4.19 mmol) and Val NCA (0.3 g, 2.1 mmol) were dissolved in anhydrous DMF (16 mL) and added via syringe to PAMAM-(NH.sub.2).sub.16 (dried, 43 mg, 13.1 mol) dissolved in anhydrous DMF (1 mL). After stirring for 24 h under argon, n-butyl alcohol (1 mL) was added and the mixture was stirred for a further 1 h. Precipitation of the concentrated peptide polymer solution into diethyl ether (340 mL), followed by isolation via centrifugation and drying (0.1 mbar), afforded (PZLL-r-PVal).sub.armPAMAM-(NH.sub.2).sub.16,core star peptide polymer S16.sub.Z as an off-white solid, 1.21 g (90%). .sup.1H NMR (400 MHz, d6-DMSO) .sub.H 0.67-0.89 (b, CH.sub.3, 6H), 1.11-1.77 (b, -CH.sub.2+-CH.sub.2+-CH.sub.2, 6H), 1.84-2.00 (b, CH, 1H), 2.78-3.00 (b, -CH.sub.2, 2H), 4.06-4.40 (b, -CH, 1H), 4.90-5.00 (b, C.sub.6H.sub.5CH.sub.2, 2H), 7.00-7.44 (b, C.sub.6H.sub.5, 5H), 7.60-8.30 (b, NH, 1H).
Synthesis of poly(Z-L-lysine-r-DL-valine).SUB.arm.PAMAM-(NH.SUB.2.).SUB.32,core .Star Peptide Polymer S32.SUB.Z
[0312] Lys NCA (1.3 g, 4.19 mmol) and Val NCA (0.3 g, 2.1 mmol) were dissolved in anhydrous DMF (16 mL) and added via syringe to PAMAM-(NH.sub.2).sub.32 (dried, 43 mg, 13.1 mol) dissolved in anhydrous DMF (1 mL). After stirring for 24 h under argon, n-butyl alcohol (1 mL) was added and the mixture was stirred for a further 1 h. Precipitation of the concentrated peptide polymer solution into diethyl ether (340 mL), followed by isolation via centrifugation and drying (0.1 mbar), afforded (PZLL-r-PVal).sub.armPAMAM-(NH.sub.2).sub.32,core star peptide polymer S16.sub.Z as an off-white solid, 1.15 g (85%). .sup.1H NMR (400 MHz, d6-DMSO) .sub.H 0.67-0.89 (b, CH.sub.3, 6H), 1.11-1.77 (b, -CH.sub.2+-CH.sub.2+-CH.sub.2, 6H), 1.84-2.00 (b, CH, 1H), 2.78-3.00 (b, -CH.sub.2, 2H), 4.06-4.40 (b, -CH, 1H), 4.90-5.00 (b, C.sub.6H.sub.5CH.sub.2, 2H), 7.00-7.44 (b, C.sub.6H.sub.5, 5H), 7.60-8.30 (b, NH, 1H).
Synthesis of Linear poly(Z-L-lysine-r-DL-valine) Peptide Polymer L.SUB.Z
[0313] Lys NCA (0.5 g, 1.63 mmol) and Val NCA (117 mg, 0.82 mmol) were dissolved in anhydrous DMF (6 mL) and added via syringe to benzylamine (10.3 L, 81.6 mol). After stirring for 24 h under argon, n-butyl alcohol (1 mL) was added and the mixture was stirred for a further 1 h. Precipitation of the concentrated peptide polymer solution into diethyl ether (340 mL), followed by isolation via centrifugation and drying (0.1 mbar), afforded linear PZLL-r-PVal peptide polymer L.sub.Z as an off-white solid, 420 mg (81%). .sup.1H NMR (400 MHz, d.sub.6-DMSO) .sub.H 0.67-0.89 (b, CH.sub.3, 6H), 1.11-1.77 (b, -CH.sub.2+-CH.sub.2+-CH.sub.2, 6H), 1.84-2.00 (b, CH, 1H), 2.78-3.00 (b, -CH.sub.2, 2H), 4.06-4.40 (b, -CH, 1H), 4.90-5.00 (b, C.sub.6H.sub.5CH.sub.2, 2H), 7.00-7.44 (b, C.sub.6H.sub.5, 5H), 7.60-8.30 (b, NH, 1H).
[0314] General Procedure for Deprotection of Peptide Polymers.
[0315] The peptide polymer was dissolved in TFA (200 mg/mL) and 33% HBr in acetic acid was then added (20 mL/g peptide polymer). After 24 h stirring at room temperature, the mixture was precipitated into diethyl ether (10 times the volume of the reaction). The precipitate was isolated via centrifugation, redissolved in hydrochloric acid solution (0.2 M, 0.2 mL/mg peptide polymer), and dialyzed against RO water for 4 days. The dialyzed solution was lyophilized to obtain the deprotected SNAPP (e.g., S16 and S32). S16 and S32: .sup.1H NMR (400 MHz, d.sub.6-DMSO) .sub.H 0.67-0.88 (b, CH.sub.3, 6H), 1.05-1.77 (b, -CH.sub.2+-CH.sub.2+-CH.sub.2, 6H), 1.84-2.00 (b, CH, 1H), 2.61-2.83 (b, -CH.sub.2, 2H), 4.00-4.39 (b, -CH, 1H), 7.60-8.30 (b, NH, 1H). L: .sup.1H NMR (400 MHz, d.sub.6-DMSO) .sub.H 0.67-0.88 (b, CH.sub.3, 6H), 1.05-1.77 (b, -CH.sub.2+-CH.sub.2+-CH.sub.2, 6H), 1.84-2.00 (b, CH, 1H), 2.61-2.83 (b, -CH.sub.2, 2H), 4.00-4.39 (b, -CH, 1H), 7.00-7.20 (b, C.sub.6H.sub.4, 4H), 7.60-8.30 (b, NH, 1H).
Synthesis of AMPs (Ovispirin, Magainin II and Melittin)
[0316] Ovispirin (NH.sub.2KNLRRIIRKIIHIIKKYG-COOH), magainin II (NH.sub.2-GIGKFLHSAKKFGKAFVGEIMNS-CONH.sub.2) and melittin (NH.sub.2-GIGAVLKVLTTGLPALISWIKRKRQQ-CONH.sub.2) were chemically synthesized on a CEM Liberty microwave peptide synthesizer (Ai Scientific, Victoria, Australia). The peptide-resins were assembled from Fmoc-Rink-AM SURE Resin in the Fmoc/TBu mode of synthesis. For a 0.1 mmol reaction scale, Fmoc-deprotection was performed in two stages by initial treatment with 20% piperidine/0.1 M HOBt/DMF (v/v, 7 ml) under microwave radiation for 30 s (40 W, 40 C.), followed by filtration and a second addition of the above solution (45 W, 75 C., 3 min). The peptide-resins were then rinsed with DMF (47 ml). Acylation, where required, was achieved by the addition of a solution containing amino acid (5 eq, relative to reaction scale), HBTU (5 eq) and DIEA (10 eq) in DMF/NMP (7:1, v/v; 4 ml) to the Na-deprotected peptide-resin and the mixture agitated under microwave radiation for 10 min (30 W, 75 C., vessel under external chilled air flow). Dichloromethane (DCM) (52 min) was used to rinse the peptide-resins prior to the cleavage step. The peptide was cleaved from the resin support by the addition of TFA/TIPS/thioanisole/phenol/water (90:2.5:2.5:2.5:2.5, % v/v/v/v/v; 5 ml) for 2.5 h, after which the combined cleavage filtrates were evaporated under nitrogen flow and the crude product was isolated by precipitation in cold ether (430 ml).
[0317] The crude peptide was purified using an Agilent 1200 series liquid chromatograph instrument (Agilent, NSW, Australia) equipped with a UV detector (model G1316A) and a Zorbax 300 SB-C18 reversed phase column (9.4 mm25 cm). Crude peptide analysis was achieved using a linear acetonitrile gradient in 0.1% TFA at a flow rate of 4 mL/min (linear gradient of 0 to 54% CH.sub.3CN over 15 min). Analysis of the purified peptide was performed using an Esquire HCT electrospray ionization-mass spectrometry system (Bruker Daltronics, NSW, Australia).
[0318] Bacterial cell culture. Freeze-dried cultures of Escherichia coli (E. coli, ATCC 25922), Klebsiella pneumoniae (K. pneumoniae, ATCC 13883), Acinetobacter baumannii (A. baumannii, ATCC 19606), multi-drug resistant (MDR) A. baumannii (FADDI-AB156), MDR P. aeruginosa (FADDI-PA067) and Staphylococcus aureus (S. aureus, ATCC 29213) were grown aerobically and maintained by passage at ambient temperature on horse blood agar (10% v/v defibrinated horse blood, 4.4% w/v Oxoid Blood Agar Base No. 2). Pseudomonas aeruginosa (P. aeruginosa, ATCC 47085) were cultured in a similar fashion, except at 37 C. Freeze-dried cultures of Streptococcus mutans (S. mutans, Ingbritt strain) were grown anaerobically and maintained by passage at 37 C. on Todd Hewitt agar (3.6% w/v Oxoid Todd-Hewitt Broth, 1.5% w/v sucrose, 1.5% w/v Bacto Agar, 0.8% w/v Oxoid Yeast Extract). For E. coli, K. pneumoniae, P. aeruginosa, MDR P. aeruginosa, A. baumannii, MDR A. baumannii and S. aureus, overnight cultures were made from transferring a colony (ca. half a loop) from the agar plates to culture tubes containing sterilized Luria-Bertani broth (LB, 1% w/v Bacto Tryptone, 1% w/v NaCl, 0.5% w/v Oxoid Yeast Extract) (20 mL). Bacterial cultures were incubated overnight at 37 C. with aeration and without agitation, with the exception of MDR P. aeruginosa which was cultured at 37 C. with aeration and agitation (150 rpm). On the next day, for E. coli, K. pneumoniae, P. aeruginosa, MDR P. aeruginosa and S. aureus, small aliquots (i.e., 0.5-2 mL) were taken from the culture tubes, further diluted with LB (20 mL), and incubated for 3-4 h at 37 C. with aeration before use. All bacterial cultures were cultured without agitation, with the exception of P. aeruginosa and MDR P. aeruginosa which were cultured with shaking at 150 rpm. For A. baumannii, an aliquot of 0.5 mL was taken from the overnight culture tube, further diluted with LB (200 mL), and incubated overnight at 37 C. with aeration before use. With regards to S. mutans, several colonies (ca. half a loop) from the agar plates were transferred to culture tubes containing sterilized Todd Hewitt broth (3.6% w/v Oxoid Todd-Hewitt Broth, 1.5% w/v sucrose, 0.8% w/v Oxoid Yeast Extract) (20 mL). The cultures were incubated overnight at 37 C. in the anaerobic chamber. After 24 h, a small aliquot (i.e., 0.5 mL) was taken from the culture tubes, further diluted with media (ca. 200 mL), and incubated overnight at 37 C. in the anaerobic chamber before use.
[0319] Bacterial Cell Counting.
[0320] A Cell Lab Quanta SC MPL flow cytometer was used to count the number of bacterial cells prior to use in assays. Cells were diluted with saline using an appropriate dilution factor and incubated with Syto 9 and PI (i.e., 1 mL cell solution to 1 L of each dye). Syto 9 stains the nucleic acids in all cells, while PI stains the nucleic acids in cells with damaged membranes. Using the Cell Lab Quanta SC software, the number of viable cells/mL (Syto 9-positive, PI-negative) was obtained.
[0321] Measurement of Minimum Bactericidal Concentrations (MBC).
[0322] A dilution series of each compound was made by diluting test compound stock in media to a desired range of concentrations and a final volume of 100 L in each well of a 96-well plate. Bacterial cells (which gave an optical density reading of 0.7 at 650 nm for E. coli, K. pneumoniae, P. aeruginosa, and S. aureus, 0.5 at 650 nm for A. baumannii and 1.8 at 650 nm for S. mutans) were diluted to 2.510.sup.6 cells/mL in media and 100 L of the bacteria solution was added to each well. The 96-well plate was then incubated at 37 C. for 90 min. For each well, microbial solution was diluted with saline (0.9% NaCl solution) using an appropriate dilution factor and placed on an agar plate (identical to that used for bacteria culture). For E. coli, K. pneumoniae, A. baumannii, and S. aureus, the agar plates were incubated overnight at room temperature, and then at 37 C. with aeration for 2 h. For P. aeruginosa and S. mutans, the agar plates were incubated at 37 C., with the former being incubated overnight with aeration and the latter in an anaerobic chamber for 48 h. The number of colony-forming units (CFU) was counted and expressed as CFU/mL. Positive controls consisting of cells without any treatment were used. Concentration-killing curves were plotted with CFU/mL as a function of compound concentration and linear regression analysis was used to determine the lowest concentration (MBC) at which the CFU/mL becomes zero (
[0323] Measurement of Minimum Inhibitory Concentrations (MIC).
[0324] The MICs of the PAMAM dendrimers were determined using a broth microdilution method. After the preparation of a dilution series of each compound and the addition of bacterial cells (Note: steps identical to that taken for the measurement of MBC), the optical density readings of each well at 630 nm were measured as a function of time using a microplate reader (Multiskan Ascent, Pathtech Pty. Ltd.). Positive controls containing cells alone were incorporated. Optical density was plotted against polymer concentration and linear regression analysis was used to determine the lowest concentration (MIC) at which the optical density reading becomes zero. A minimum of two independent experiments (biological replicates) of the assay were conducted and two technical replicates were used in each experiment for each bacterium, polymer, and concentration. Data is expressed as meanstandard deviation (SD) of the biological replicates and analysed using student's t-test.
[0325] Resistance Studies.
[0326] The method used was adapted from Gullberg et al. PLoS Pathog. 7, e1002158 (2011). Overnight cultures of A. baumannii cells (ATCC 19606 or FADDI-AB156) in LB broth were obtained from independent colonies grown on horse blood agar. The cells were then serially passaged by 400-fold dilution in 1 mL batch cultures every 24 h for 600 generations (ca. 25 generations of growth per serial passage) in MHB containing 1/10 of the MBC of S16 (for both strains). After every 100 generations of growth, the MBCs of S16 were obtained using cells that were serially passaged in the presence of the antimicrobial agent. As a control, MBCs were also obtained using cells serially passaged in fresh MHB alone.
[0327] Hemolysis Assay.
[0328] Fresh sheep red blood cells (RBCs) were diluted 1 in 20 in PBS (pH 7.4), pelleted by centrifugation, and washed three times in PBS (1000 g, 10 min). The RBCs were counted using a cell counter (Coulter Particle Counter Z series, Beckman Coulter) and diluted to a final concentration of 210.sup.7 cells/mL. 100 L aliquots of the RBC solution were seeded into a V-bottomed 96-well plate containing 100 L of test compound solution of varying concentrations (4-256 g/mL) and incubated in a humidified atmosphere containing 5% CO.sub.2 at 37 C. for 2 h. Following incubation, the 96-well plate was centrifuged (1000 g, 10 min) and aliquots (100 L) of supernatant were transferred to a flat-bottomed 96-well plate. Hemoglobin release upon lysis of the RBCs was monitored at 405 nm using a microplate reader (PerkinElmer 1420 Multilabel Counter VICTOR.sup.3). Positive and negative controls for hemolysis were taken as RBC lysed with 0.5% Triton X-100 (1:1 v/v) and RBC suspension in PBS, respectively. The percentage of hemolysis was calculated using the following formula:
[0329] The percentage hemolysis was plotted against peptide polymer concentration and linear regression analysis was used to determine the hemolytic concentration needed to lyse 50% (HC.sub.50) of RBCs. Two independent runs of the assay were conducted and two replicates were used in each run for each compound and concentration.
[0330] Mammalian Cell Culture.
[0331] Human embryonic kidney cells (HEK293T) were cultivated in complete RPMI-1640 medium (supplemented with 5% FBS, 1GlutaMAX, 1antibiotic-antimycotic, and 1MEM non-essential amino acids) in a humidified atmosphere containing 5% CO.sub.2 at 37 C. Cells were seeded in a T75 flask (ca. 310.sup.6 cells/ml) and passaged twice a week prior to performing the subsequent cell viability studies. Rat hepatoma cells (H4IIE) were cultivated in DMEM medium (supplemented with 10% FBS, 1GlutaMAX, and 1penicillin-streptomycin) in a humidified atmosphere containing 5% CO.sub.2 at 37 C. Cells were seeded in a T75 flask (ca. 310.sup.6 cells/ml) and passaged twice a week prior to performing the subsequent cell viability studies.
[0332] Apoptosis/Necrosis Assay.
[0333] Adherent HEK293T or H4IIE cells (obtained from the ATCC, and throughout the course of the study were checked for Mycoplasma contamination using Mycoplasma stain kit, Myc1, Aldrich) were grown to 80% confluence and trypsinized prior to assay. HEK293T and H4IIE cells were chosen for this study as they are standard cell lines used in toxicity studies. Cells were diluted 1:2 with complete medium (RPMI-1640 for HEK293T cells or DMEM for H4IIE cells) and seeded in a 24-well plate (1 mL per well). The cells were incubated at 37 C. in 5% CO.sub.2 for 24 h until ca. 95% confluence. The medium was removed. Varying concentrations of test compound (4 to 128 g/mL) were prepared and 200 L aliquots of each were added to the cells, after which the cells were incubated at 37 C. in 5% CO.sub.2 for 90 min. The cells were then harvested and all well contents were transferred to round-bottomed polypropylene tubes (5 mL). The cells were washed with cold DPBS, then stained with YO-PRO-1 and PI (0.2 mL from a stock solution, whereby both dyes were diluted 1:1000 in cold DPBS, per well), and incubated on ice for 20 to 30 min. The cells were analyzed by flow cytometry (Cytomics FC 500 MPL System). Standard compensation was performed using single-colour stained cells. Negative controls using untreated cells were included. Two independent runs of the assay were conducted and two replicates were used in each run for each test compound and concentration.
[0334] In Vivo Efficacy of SNAPP S16.
[0335] All experiments involving animals were performed according to protocols approved by the University of Melbourne Biochemistry and Molecular Biology, Dental Science, Medicine, Microbiology and Immunology, and Surgery Animal Ethics Committee (Project number 1513489). 10 to 14-week-old female C57BL/6 mice (weighing 23.21.7 g, animals under 20 g were not used in this study) were used in all in vivo studies with 5 animals per group. Experiments were conducted without randomization or blinded protocol. Using preliminary peritonitis infection data and a power analysis (using SPSS for Windows, version 12), a sample size 2 would be needed to detect a large effect size (d=0.8) with 95% power using a t test between means with alpha at 0.01. After 1 week of quarantine, inoculation (t=0) was performed by intraperitoneal injection of 300 L of 210.sup.8 cells, delivered in MEM, of non-MDR A. baumannii (ATCC 19606) or MDR A. baumannii (FADDI-AB056) with a 25-gauge syringe. Two groups (n=5 for ATCC 19606 and n=5 for FADDI-AB056) received either SNAPP S16 (8.3 mg/kg per dose in MEM, which corresponds to 1.5 in vitro MBC taking into account the average peritoneal/blood volume of mice) or imipenem (derived from the carbapenem antibiotic family and considered to be the most successful class of antibiotics in evading emerging antimicrobial resistance, 40 mg/kg per dose in MEM) treatment 0.5, 4 and 8 h after introduction of the inoculums. An untreated control group was included. Signs of animal distress were monitored, and mice that did not meet distress-related euthanasia criteria at t<24 h were defined as survived. At t=24 h, all mice were euthanized. Peritoneal washes were performed by injecting 3.0 mL of sterile MEM in the intraperitoneal cavity followed by a massage of the abdomen. Subsequently, the abdomen was opened and 3.0 mL of peritoneal fluid was recovered from the peritoneum for analysis of CFU/mL. Spleen of each mouse was removed and suspended in 5.0 mL MEM in a gentleMACS tube which was then subjected to automatic dissociation (gentleMACS dissociator, Miltenyl Biotec). The peritoneal fluid and supernatant from the dissociation of spleen were serially diluted in saline. A 10-L portion of each dilution was plated on horse blood agar plates and incubated overnight at 37 C. For mice that were still alive directly before euthanization, blood was also taken from the heart for immediate plating on horse blood agar plates. Colonies were counted and expressed as CFU/mL, and viable bacteria cell counts in the peritoneal cavity (
[0336] Fluorescent Tagging of SNAPP S16 with Alexa Fluor 488.
[0337] SNAPP S16 was dissolved in sodium bicarbonate buffer (0.1 M, pH 8.3) (2.5 mg/mL), and Alexa Fluor 488 (AF488) carboxylic acid succinimidyl ester dissolved in DMSO (10 mg/mL) was added (20 L/mg of peptide polymer) The mixture was stirred for 1 h at room temperature and then passed through a gel separation column (PD MidiTrap G-25) to remove the excess dye. The filtrate was lyophilized to afford the fluorescently tagged derivative, AF488-S16.
[0338] Sample Preparation for Imaging with 3D-SIM Super-Resolution Microscopy.
[0339] Sterilized chambered coverglasses were coated with poly-D-lysine (0.1 mL per well from a 0.1 mg/mL stock solution in DPBS) for 90 min. The excess poly-D-lysine was removed by washing with sterilized MilliQ water (20.5 mL) and the coverglasses were left to dry overnight in a sterile environment. E. coli cells (1.2510.sup.6 cells/mL, prepared as per described in the measurement of MBC) were incubated with AF488-S16 (8 to 256 g/mL) in a 96-well plate at 37 C. for 90 min. The cell suspension was then transferred to Eppendorf tubes (2 mL) and washed with HBSS twice (5000 g, 10 min). FM 4-64FX dye (0.2 mL from a 5 g/mL stock solution in HBSS) was added to the cell pellet and the cells were incubated on ice for 10 min with regular mixing. After incubation, the cells were washed with HBSS (5000 g, 10 min), resuspended in HBSS (0.5 mL), and then transferred to the chambered coverglass. Subsequently, the cells were washed in HBSS (800 g, 10 min) then fixed in 2% w/v paraformaldehyde in PBS for 10 min at room temperature. The fixative was removed with HBSS (800 g, 10 min) and HBSS (0.5 mL) was added to each well prior to imaging.
[0340] LPS Inhibition Assay.
[0341] SNAPP S16 (50 L) was incubated with LPS from E. coli 0111:84 (50 L) in MEM in a 96-well plate at 37 C. for 1 h. E. coli cells (which gave an optical density reading of 0.7 at 650 nm) were diluted to 2.510.sup.6 cells/mL in MEM and 100 L of the bacteria solution was added to the S16-LPS mixture. The final concentration of S16 was kept at 4 g/m L, whereas the LPS concentration was varied from 2 to 1000 g/mL. The 96-well plate was then incubated at 37 C. for 90 min. A 50 L aliquot was taken from each well, transferred to a second 96-well plate and 100 L of saline and dye mixture (i.e., saline with 0.1% of SYTO 9 and 0.1% of PI) was added. Each well in the second 96-well plate was analyzed with a Cell Lab Quanta SC MPL flow cytometer (Beckman Coulter) to determine the % PI-positive cells. Two independent runs of the assay were conducted and two replicates were used in each run for each variation.
[0342] Kinetics of Antimicrobial Activity.
[0343] SNAPP S16 (at a final concentration of 8 g/mL) was incubated with E. coli cells (at a final concentration of 1.2510.sup.6 cells/mL) in MEM at 37 C. Aliquots were taken at t=0, 15, 30 and 90 min for analysis to determine CFU/mL (refer to procedure for the measurement of MBC) and % of PI-positive cells (via flow cytometry using a Cell Lab Quanta SC MPL flow cytometer (Beckman Coulter)). An untreated control group was also included. Two independent experiments of the assay were conducted and two replicates were used in each experiment for each variation.
[0344] Preparation of Large Unilamellar Vesicles (LUVs) for Dye Release (Pore Formation) and Lucigenin (Chloride Ion Transport) Based Assays.
[0345] To represent a model of an E. coli cytoplasmic membrane large unilamellar vesicles (LUVs) consisting of 1-Palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoglycerol (POPG) at a 7:3 mole ratio, were used to encapsulate 2 mM rhodamine dextran (70 kDa; RD-40) and 2 mM fluorescein dextran (4 kDa; FD-4) in 10 mM Tris and 5 mM NaCl buffer solution (pH 7.3) for the dye release assay or 2 mM lucigenin solution containing NaCl (100 mM), and sodium phosophate salt (10 mM, pH 7.3) for the chloride ion transport assay, using the LUV preparation method we have previously described (Sani, M.-A. et al. Antimicrob. Agents Chemother. 57, 3593-3600 (2013)). The dye release assay was performed as previously described (Sani, M.-A. et al. Antimicrob. Agents Chemother. 57, 3593-3600 (2013)) and the chloride ion transport assay conducted as described by Elie, et al. Org. Biomol. Chem. 11, 923-928 (2013). LUVs were incubated (0.5 h for the dye release experiment or overnight for the chloride ion transport assay) with SNAPP S16 or control AMP maculatin 1.1 at lipid to peptide molar ratios ranging from 50:1 to 10000:1. To afford complete dye release or chloride ion transport, control LUVs were treated with 0.5% v/v Triton X-100. All measurements were made with a Varian Cary Eclipse spectrophotometer (Melbourne, Australia) using a 4-mm path-length quartz microfluorimeter cell (Starna, Hainault, United Kingdom) for the dye release experiment or a FLUOstar Optima plate reader (BMG Labtech, USA) for the chloride ion transport assay. Dye release or chloride ion transport was presented as the percent of fluorescence of RD-70 and FD-4 or lucigenin, respectively, compared to the Triton X-100 control. Data is representative of two independent assays completed in duplicates.
[0346] Membrane Potential Assay.
[0347] Membrane potential was determined by flow cytometry using a BacLight Bacterial Membrane Potential Kit (Invitrogen). When at low concentrations, the dye DiOC.sub.2(3) exhibits green fluorescence in all bacterial cells. The fluorescence shifts towards red emission as the dye molecules become more concentrated and self-associate in healthy cells that are maintaining a membrane potential. E. coli was inoculated to late exponential phase. Viable cells were then diluted to 2.510.sup.6 cells/mL in PBS and added with variable concentrations (0.5, 1 and 2MBC) of SNAPP S16. A fully depolarized control was provided by the addition of the proton ionophore carbonyl cyanide 3-chlorophenylhydrazone (CCCP) at a final concentration of 5 mM to the untreated cells. Prior to a 1 h incubation at 37 C., 30 mM DiOC.sub.2(3) was added to all of the samples. Membrane potential was determined by a Cell Lab Quanta SC MPL flow cytometer (Beckman Coulter) as a ratio of cells that exhibited a red fluorescence (FL-3) to those that displayed a green fluorescence (FL-1). Gates were drawn based on the untreated (polarized) and CCCP-treated (fully depolarized) controls. Data is representative of two independent assays completed in duplicates.
[0348] RNA Extraction and Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) Analysis for Programmed Cell Death Pathways.
[0349] To determine if the star peptide polymers induced PCD, E. coli cells were incubated with S16 at 1 and 5 the MBC, after which the mRNA levels of recA, lexA and mazEF relative to control genes and untreated E. coli were determined by RT-PCR. Escherichia coli ATCC 25922 was grown overnight at 37 C. in LB broth and used to freshly inoculate LB broth (2% v/v inoculum) and was grown to mid log-phase (O.D..sub.600=0.6) at 37 C. A 200 L aliquot of the cell suspension was mixed with 1 L of Syto9 and 1 L of PI and counted on the Cell Lab Quanta SC MPL flow cytometer (Beckman Coulter). After counting, cells were collected by centrifugation at 8000 g for 10 min at 4 C., washed twice in MEM and finally resuspended at 210.sup.6 cells/mL in MEM. A 500 L aliquot of a stock solution of SNAPP S16 (final concentration of 1MBC or 5MBC) was added to 500 L (final concentration of 110.sup.6 cells/mL) of E. coli cells. Following incubation (4 h), bacterial cells were collected by centrifugation at 8000 g for 10 min at 4 C. and immediately resuspended in 1 mL RNAprotect Bacteria Reagent (Qiagen).
[0350] Total RNA was extracted using the RNAprotect bacterial reagent and RNeasy kit (Qiagen). Cells were collected by centrifugation at 8000 g for 10 min at 4 C. and resuspended in 100 L TE buffer (10 mM TrisCl, 1 mM EDTA, pH 8.0) containing 1 mg/ml lysozyme. After a 5 min incubation at room temperature, 350 L of buffer RLT was added and the solution mixed by vortexing. Ethanol (250 L) was then added and the entire 700 L was added onto an RNeasy spin column and centrifuged at 16000 g for 1 min. The membrane was washed with 700 L of buffer RW1 followed by 500 L of buffer RPE. A final centrifugation at 16000 g for 1 min was performed to dry the membrane. RNase free water (50 L) was added to the membrane and the RNA was eluted by centrifugation at 16000 g for 1 min. RNA was quantified by absorbance (260 nm/280 nm) using a Nanodrop spectrophotometer (Thermo Scientific).
[0351] Extracted RNA was immediately DNase-treated using the TURBO DNA-free kit (Ambion). Briefly, 5 g of RNA was combined with 2 L of 10DNase buffer, 1 L of DNase and sufficient water to make up a 20 L reaction volume. The reaction was incubated for 20 min at 37 C., after which a further 1 L of DNase was added and the reaction incubated for another 20 min at 37 C. Following this second incubation, 2 L of DNase inactivation reagent was added. After a 5 min incubation at room temperature with occasional mixing, the inactivation reagent was pelleted by centrifugation at 10000 g for 1 min and the supernatant collected.
[0352] Reverse transcription was performed using the iScript Reverse Transcription Supermix (Bio-Rad). Briefly, 1 g (4 L) of the DNase-treated RNA extract was combined with 4 L of iScript master mix and 12 L of RNase free water. The reverse transcription reaction was performed with a 5 min, 25 C. priming step, a 30 min, 42 C. extension step followed by a 5 min, 85 C. inactivation step. A no-reverse transcription reaction was also set up using 1 g (4 L) of the DNase treated RNA extraction combined with 16 L of RNase free water.
[0353] RT-PCR was performed using the iTaq Universal SYBR Green Supermix (Bio-Rad). Template cDNA (25 ng, 1 L) was combined with 0.8 L of forward primer (5 nM), 0.8 L of reverse primer (5 nM) and 10 L of Sybr Green Supermix. Primers used for the RT-PCR; recA (For) AGATCCTCTACGGCGAAGGT, (rev) CCTGCTTTCTCGATCAGCTT; lexA (For) GACTTGCTGGCAGTGCATAA, (rev) TCAGGCGCTTAACGGTAACT; MazEF-1 (For) CTTCGTTGCTCCTCTTGC, (rev) CGTTGGGGAAATTCACCG; 16SrRNA (For) TGTAGCGGTGAAATGCGTAGA, (rev) CACCTGAGCGTCAGTCTTCGT. Thermal cycling was performed using 40 cycles of 95 C. for 15 s, 60 C. for 15 s and 72 C. for 15 s. A positive control of genomic DNA and a no-reverse transcription control were included in each cycling run. Cycling was performed on a Rotor Gene RG-3000A Thermal Cycler running Rotor-Gene V6.1 software (Corbett Research). Analysis of the PCR was performed using the LinRegPCR software version 2015.3. Comparative CT analysis was performed according to the method of Schmittgen and Livak.
[0354] ROS Production.
[0355] E. coli cells (which gave an optical density reading of 0.7 at 650 nm) were diluted to 2.510.sup.6 cells/mL in MEM and 100 L of the bacteria solution was added to each well containing either MEM (untreated control) or the test compound(s) at the desired concentrations (100 L). The 96-well plate was then incubated at 37 C. for 90 min. The cells were then stained with the CelIROX Orange Reagent at a final concentration of 750 nM following manufacturer's instructions and were incubated for 1 h at 37 C. The cells were analysed on the Cell Lab Quanta SC MPL flow cytometer (Beckman Coulter) where the fluorescence from the CelIROX Orange Reagent was measured on FL-3. A minimum of two independent experiments of the assay were conducted and two technical replicates were used in each experiment. Data is expressed as meanstandard deviation.
[0356] Effect of ALD Inhibition on the Membrane Disruption Ability of SNAPP S16.
[0357] E. coli cells (which gave an optical density reading of 0.7 at 650 nm) were diluted to 2.510.sup.6 cells/mL in MHB, and 5 mL of the bacterial cell solution was added to an equivolume of doxycycline hyclate (to yield a final concentration equivalent to its MIC of 0.5 g/mL). The mixture was incubated at 37 C. for 4 h and the cells were recovered via centrifugation (3000 g, 10 min) at the end of the incubation period. The recovered cells (100 L/well) were then incubated at 37 C. for a further 90 min in the absence or presence of SNAPP (at 0.5 and 1MBC, 100 L/well) in a 96-well plate. A 50 L aliquot was taken from each well, transferred to a second 96-well plate and 100 L of saline and dye mixture (i.e., saline with 0.1% of SYTO 9 and 0.1% of PI) was added. Each well in the second 96-well plate was analyzed with a Cell Lab Quanta SC MPL flow cytometer (Beckman Coulter) to determine the % PI-positive cells. Two independent runs of the assay were conducted and two replicates were used in each run for each variation.
[0358] Cryo-Transmission Electron Microscopy (Cryo-TEM).
[0359] Star peptide polymer S16 (35 g/mL in MHB, 15 and 35 g/mL in MEM), melittin (64 g/mL in MHB) or ovispirin (19 g/mL in MHB) was incubated with E. coli cells (1.2510.sup.6 cells/mL in MHB or MEM, prepared as per described in the measurement of MBC) at 37 C. for 90 min. After incubation, the cells were pelleted (10000 g, 20 min), washed with pre-filtered PBS and resuspended in the same buffer (ca. 10-30 L). Subsequent steps were taken based on the protocol previously described (Chen, Y.-Y. et al. Mol. Microbiol. 79, 1380-1401 (2011)).
[0360] Statistical Analysis.
[0361] Data obtained were determined to be normally distributed. Homogeneity of variances was assessed using the Levene's test (SPSS for Windows, version 12). Statistical analysis was also performed using a one-way classification of ANOVA and student's t-test (two-tailed), where differences were regarded as statistically significant with probability P<0.05.
[0362] Materials.
[0363] H-Lys(Z)OH (>99%, Fluke), DL-Valine (>99%, Acros Organics), sodium chloride (NaCl, Chem-Supply), potassium chloride (KCl, Chem-Supply), sodium phosphate dibasic (Na.sub.2HPO.sub.4, Chem-Supply), potassium phosphate monobasic (KH.sub.2PO.sub.4, 99%, Aldrich), TRIS powder (Aldrich), sucrose (Univar), D-(+)-glucose solution (100 g/L, Aldrich), diethyl ether (Chem-Supply), acetonitrile (Univar), generation 2.0 poly(amido amine) dendrimer (G2 PAMAM) (Dendritech), generation 3.0 poly(amido amine) dendrimer (G3 PAMAM) (Dendritech), 4-methylbenzylamine (97%, Aldrich), bis(trichloromethyl)carbonate (triphosgene, 99%, Aldrich), paraformaldehyde (Aldrich), trifluoroacetic acid (TFA) (99%, Aldrich), hydrobromic acid (33% in acetic acid) (Aldrich), pentane (anhyd., >99%, Aldrich), dimethyl sulfoxide (DMSO, Aldrich), N,N-dimethylformamide (DMF, anhyd., Acros Organics), Spectra/Por molecular porous membrane tubing 8000 MWCO (Spectrum Laboratories, Inc.), poly-D-lysine hydrobromide (70-150 kDa, Aldrich), Hanks' Balanced Salt solution (HBSS, with sodium bicarbonate, without phenol red, Aldrich), penicillin-streptomycin (Aldrich), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE, Avanti Polar Lipids), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoglycerol (POPG, Avanti Polar Lipids), lucigenin (N,N-dimethyl-9,9-biacridinium dinitrate, Aldrich), fluorescein isothiocyanate-dextran (4 kDa, Aldrich), rhodamine isothiocyanate-dextran (70 kDa, Aldrich), thiourea (>99%, Aldrich), and doxycycline hyclate (>98%, Aldrich) were used as received. THF (99%, Lab Scan) was distilled from sodium benzophenone ketal under argon. Dimetylsulfoxide-d.sub.6 (DMSO-d.sub.6) (99.9%) was purchased from Cambridge Laboratory Isotopes and used as received. RPMI-1640 medium without L-glutamine (GIBCO Cat. No. 21870), Dulbecco's Modified Eagle Medium (DMEM, GIBCO Cat. No. 11995), fetal bovine serum (FBS, GIBCO Cat. No. 10099), GlutaMAX supplement (100, GIBCO Cat. No. 35050), antibiotic-antimycotic (100, GIBCO Cat. No. 15240), MEM non-essential amino acids (100, GIBCO Cat. No. 11140), Dulbecco's Phosphate Buffered Saline (DPBS, GIBCO 14190), 0.05% trypsin-EDTA (1, GIBCO Cat. No. 25300), Alexa Fluor 488 carboxylic acid succinimidyl ester, FM 4-64FX, SYTO 9 green fluorescent nucleic acid stain, and propidium iodide (PI) were purchased from Invitrogen and used as received. Defibrinated horse and sheep blood were obtained from Commonwealth Serum Laboratories (CSL) Melbourne. Todd-Hewitt Broth (CM0189), Mueller-Hinton Broth (MHB) (CM0405), Blood Agar Base No. 2 (CM0271), and Yeast Extract (LP0021) were purchased from Oxoid. Bacto Tryptone, and Bacto Agar were purchased from BD Biosciences. Ultra-pure lipopolysaccharide (LPS) from Escherichia coli 0111:84 was purchased from Invivogen. Vybrant Apoptosis Assay Kit #4 (YO-PRO-1/PI, Invitrogen) was used to perform the apoptosis/necrosis assay. BacLight Bacterial Membrane Potential Kit (Invitrogen) was used to conduct the membrane potential assay. RNeasy Protect Bacteria Mini Kit (Qiagen), TURBO DNA-free kit (Ambion), iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad Laboratories), and iTaq Universal SYBR Green Supermix (Bio-Rad Laboratories) were used for RNA extraction and reverse transcriptase PCR analysis for programmed cell death pathways. CelIROX Orange Reagent (Invitrogen) was used to perform the reactive oxygen species (ROS) production assay. 96-well cell culture plates were used for cell culture. 8-Well Nunc Lab-Tek Chambered Coverglass (Thermo Scientific) was used to contain samples for imaging with 3D-SIM.
[0364] Instrumentation.
[0365] GPC analysis was performed on a Shimadzu liquid chromatography system equipped with a Shimadzu RID-10 refractometer (A=633 nm), using three Waters Ultrahydrogel columns in series ((i) 250 porosity, 6 m diameter bead size; (ii) and (iii) linear, 10 m diameter bead size), operating at 60 C. The eluent was Milli-Q water containing 20% v/v acetonitrile and 0.1% w/v TFA (0.5 mL/min). The molecular weight characteristics of the analytes were determined with reference to a conventional column calibration with narrow molecular weight distribution poly(ethylene glycol) standards (Polymer Standards Service GmbH). All samples for GPC analysis were prepared at a concentration of 10 mg/mL and were filtered through 0.45 m nylon filters prior to injection. .sup.1H NMR spectroscopy was performed at room temperature using a Varian Unity400 (400 MHz) spectrometer with the deuterated solvent as reference and a sample concentration of ca. 10 mg/mL. DLS measurements were performed on a Malvern Zetasizer Nano ZS with a 4.0 mW HeNe laser (633 nm) at an angle of 173 and a temperature of 250.1 C. Initial sample concentrations of 1 mg/mL in either RO water, MEM or MHB were used and serial dilutions were performed until stable spectra were obtained. All sample solutions were filtered using 0.45 m syringe filters. Bacterial cell sample analysis was performed using a Cell Lab Quanta SC MPL flow cytometer (Beckman Coulter) equipped with a 100 W stabilized mercury arc lamp with wavelengths of 365, 404, and 435 nm, and a 488 nm diode laser. The fluorescence from SYTO 9 was measured through a 525-nm band-pass filter (Fluorescent Channel 1, FL-1), and the red emission of PI was measured with a 670-nm long pass filter (Fluorescent Channel 3, FL-3). The multiparametric data were analyzed using the Cell Lab Quanta SC software. Super-resolution fluorescence imaging was performed using three dimensional-structured illumination microscopy (3D-SIM) implemented on the DeltaVision OMX V4 Blaze imaging system (Applied Precision, a GE Healthcare Company). Briefly, 488 and 568 nm lasers (for Alexa Fluor 488 and FM4-64FX, respectively) were used to provide wide-field illumination and multi-channel images, which were captured on two PCO Edge scientific CMOS cameras (each dedicated to a specific channel) with acquisition rates of up to 400 fps. Data capture used an Olympus PlanApo N 601.42 NA oil objective and excitation and emission filter sets of 528/48 for Alexa Fluor 488 and 609/37 for FM 4-64FX. The immersion oil 1.514 (GE Healthcare Company) was used. The DeltaVision OMX Master Control Software was used for instrument control. All raw images were reconstructed using SoftWorX 4.0 (Applied Precision). Image analysis was performed using Fiji, a distribution of ImageJ.
[0366] Method Used for Calculating MBCs (Molar Concentrations):
[0367] The number average molecular weight, M.sub.n, obtained from GPC analysis was consistently used in this study to convert mass concentrations to molar concentrations. The reader is referred to Table 2 and Table 8 for the M.sub.n of SNAPPs and their linear analog, respectively.
[0368] The following formula was used:
[0369] The calculation is exemplified as below:
[0370] MBC of S16 against E. coli in MEM=7.6 g/mL
[0371] M.sub.n of S16=43800 g/mol
[0372] Therefore,
[0373] Determining the Degree of Labelling (DOL):
[0374] A calibration curve (
[0375] The labelled SNAPP (5.2 mg/mL) was found to have an absorbance of 0.78 at 490 nm. This correlates to approximately 0.11 mg/mL of AF488 dye based on the calibration curve. Taking into the account the molarities of the dye and SNAPP in solution, the DOL was found to be approximately 3 dye molecules per SNAPP S16 molecule.
Example 2
Synthesis and Characterization of SNAPPs
[0376] Summary
[0377] The synthetic scheme of SNAPPs is provided in
[0378] .sup.1H NMR Spectroscopic Analysis of SNAPPs
[0379] .sup.1H NMR spectroscopic analysis (
Synthesis and Characterization of SNAPPs
[0380] To demonstrate the potential of this new class of antimicrobial nanomaterial, SNAPPs in the form of 16- and 32-arm star peptide polymer nanoparticles S16 and S32, respectively, were synthesized via NCA-ROP (number-average molecular weight, M.sub.n=43.8 kDa (S16), 74.8 kDa (S32); hydrodynamic diameter, D.sub.H=7.7 nm (S16), 13.5 nm (S32); see
Example 3
[0381] In Vitro Antimicrobial Properties of SNAPPs.
[0382] We evaluated the antibacterial efficacy of SNAPPs by determining their minimum bactericidal concentrations (MBCs) against a range of Gram-positive (S. mutans and S. aureus) and Gram-negative (E. coli, P. aeruginosa, K. pneumoniae, and A. baumannii) bacteria. The MBC is defined as the minimum drug concentration that causes quantitative cell death (see Methods section in Examples,
[0383] In further studies using Gram-negative bacteria, S16 and S32 were also found to be effective against K. pneumoniae and A. baumannii, with S16 registering MBC values of 1.54 and 0.85 M, respectively, and S32 showing similar MBC values of 0.83 and 0.79 M. Further, both S16 and S32 were found to be equally effective against CMDR clinical isolates of P. aeruginosa (FADDI-PA067) and A. baumannii (FADDI-AB156) (Tables 5-6) as to drug-sensitive strains, yielding MBC values that range from 0.85 to 1.61 M (Table 1). We observed that the MBC values of SNAPPs against all bacteria tested were within a similar order of magnitude, which implied that the antimicrobial efficacies of S16 and S32 might not be species-specific for Gram-negative bacteria. This was surprising as P. aeruginosa and K. pneumoniae possess low antibiotic susceptibility as a result of their thick extracellular capsules, which contribute to reduced cell permeability and is a resistance mechanism against antibiotics and AMPs. Noteworthy, the probability of the PAMAM dendrimer centres contributing to the antimicrobial efficacies of S16 and S32 in this study was discounted, as the PAMAM cores were found to be non-active against the range of bacterial species tested above (Table 7).
[0384] Further, we conducted an antimicrobial resistance study to evaluate if resistance against SNAPPs could be generated easily. Following serial passaging of bacterial cells in the presence of sub-MBC levels of S16, we did not obtain de novo resistant mutants of wild type and CMDR A. baumannii to S16 even after 600 generations of growth (over a period of 24 days) (
[0385] As a comparator, we synthesized the linear analog L to represent one arm of S16 and S32 (
[0386] The antimicrobial activities of S16 and S32 were compared with several peptide-based antimicrobial agents known to be effective against Gram-negative pathogens, including magainin II, ovispirin and melittin (Table 1). The antimicrobial efficacies of these AMPs against certain Gram-negative pathogens have been well-documented; however, they (as with most AMPs) tend to demonstrate selective activity towards certain bacterial strains, even within the Gram-negative family (Table 1). This is in direct contrast to SNAPPs which displayed effective equipotent activity against all of the Gram-negative species tested. Furthermore, SNAPPs were orders of magnitude more effective than these AMPs (Table 1).
[0387] To explore the antimicrobial efficacy of SNAPPs in different media and to evaluate their toxicity against mammalian cells, we repeated the assays using minimal essential medium (MEM), which is a defined medium for mammalian cells. Both S16 and S32 exhibited at least four times lower MBC values (<0.19 M) against all bacterial species tested in MEM compared with MHB. In MHB, SNAPPs were found to aggregate to form particles with average D.sub.H values of 224.2 nm or greater, which is significantly larger in size compared to SNAPPs in MEM (D.sub.H=7.7 and 13.5 nm for S16 and S32, respectively) (
Example 4
[0388] Biocompatibility of SNAPPs.
[0389] As a test of biocompatibility, the hemolytic activities of SNAPPs were investigated by incubating them with red blood cells at different nanoparticle concentrations. Both S16 and S32 (as well as the control homolysine star) had negligible hemolytic activity (>45 M, Table 10). Even at a very high concentration of >100MBC, the extent of hemolysis was well below 30% (
Example 5
[0390] In Vivo Efficacy of SNAPPs.
[0391] The effectiveness of S16 in vivo was evaluated in a mouse peritonitis model, where the intraperitoneal (i.p.) dose of A. baumannii (210.sup.8 cells in MEM) resulted in the establishment of wide-spread bacterial infection by 24 h (
[0392] As S16 was effective in vitro against CMDR bacteria, we extended the peritonitis model by including the CMDR A. baumannii. Mice treated with S16 had significantly less bacteria in the peritoneal cavity (
Example 6
[0393] Preliminary Mechanistic Studies.
[0394] To directly observe the interactions between an antimicrobial agent and bacterial cells, we conducted super-resolution fluorescence imaging using 3D-Structured Illumination Microscopy (3D-SIM). Sample images of untreated E. coli are provided in
[0395] Based upon the fluorescence imaging studies conducted, we hypothesized that SNAPPs initially localize on the bacterial OM as a result of electrostatic interactions. This could cause areas of destabilization/fragmentation leading to SNAPPs possibly translocating to and disrupting the CM, thus leading to cell death. To investigate this hypothesis, we conducted a competitive inhibition assay with LPS. The co-incubation of LPS (from E. coli) with S16 was found to inhibit the ability of S16 to disrupt the membrane of E. coli cells in a dose-dependent manner (
[0396] To investigate if SNAPP-induced membrane disruption is a result of pore formation like some AMPs, we conducted a dye release assay using dextran-loaded large unilamellar vesicles (LUVs) as a mimic for Gram-negative CM. The results suggested that SNAPPs do not cause membrane disruption via pore formation (
[0397] A number of recent studies have shown that bacteria, like eukaryotic cells, have mechanisms of programmed cell death (PCD) that could be triggered under stressful conditions, such as membrane disruption. Two major PCD pathways have been described in bacteria: (i) the ALD pathway mediated by recA and lexA genes, and (ii) the mazEF pathway. Based on gene expression studies, S16 at 1MBC induced a 10- and 7-fold increase in recA and lexA but no change in mazEF levels (
[0398] Next, we used cryo-TEM to visualize the effect of SNAPP treatment on E. coli cell morphology. Prior to treatment, all cells showed intact OMs and CMs (
[0399] Taken together, we postulate that SNAPPs have a multi-modal mechanism of inducing bacterial cell death. Initially, SNAPPs bind via electrostatic interactions with LPS and the OM, leading to destabilized/fragmented areas. They then assemble and traverse the cell envelope driven by the transmembrane electrical potential (interior/cytosol being negative), most likely causing membrane perturbations that result in unregulated transmembrane ion movement in the CM. These membrane disruption events induce ALD at low SNAPP concentrations, thus leading to cell lysis. At high concentrations, SNAPPs rapidly cause cell lysis by direct disruption of the OM and CM. Collectively, fluorescence imaging, flow cytometry and cryo-TEM assays provided evidence for membrane association, membrane disruption, OM fragmentation/destabilization and cell lysis. Although the exact sequence of events is subjected to further investigations, we can conclude that the succession of antimicrobial events, as depicted in
[0400] AMPs as a whole class of compounds kill bacteria by multiple mechanisms but each specific AMP tends to kill bacteria by one major mechanism. The multi-faceted interactions shown here between SNAPPs and bacteria (in combination with indirect antimicrobial activity via neutrophil recruitment in vivo) are truly unique and this, to the best of our knowledge, has not been shown previously in a definitive manner for any one single AMP. The equipotency of SNAPPs against all of the Gram-negative bacteria tested suggested that the multi-modal mechanism of action is non-specific and we postulate that this is why bacteria did not acquire resistance to star S16 even after 600 generations of growth in the presence of the agent. The successful demonstration of the antimicrobial efficacy of SNAPPs against CMDR A. baumannii in vivo as well as their biocompatibility distinguishes SNAPPs as a new class of antimicrobial agents, capable of addressing the dearth of suitable drug candidates to combat Gram-negative pathogens resistant to conventional antibiotics.
[0401] Correlation of Antibacterial Activity with the Cellular Uptake of S16
[0402] Flow cytometric analysis was used to correlate the cellular uptake of SNAPP with the resulting bacterial membrane lysis. As a proof of concept, the same amount of the model gram-negative bacteria, E. coli, was treated with Alexa Fluor 488-tagged SNAPP S16 of varying concentrations using MHB as the medium and the mixtures were then subjected to analysis using the Cell Lab Quanta SC MPL system. The propidium iodide (PI) nucleic acid stain was added to the E. coli-S16 mixture to quantify cells with compromised membranes. Utilizing the ability of flow cytometers to provide accurate quantification of cell numbers, the counts of AF488- and PI-positive cells were measured for each S16 concentration (
[0403] Based on
[0404] SNAPP S16 Induces Reactive Oxygen Species (ROS) Production
[0405] We measured the production of ROS in untreated E. coli cells and in cells treated with S16 (at 0.25, 0.5, and 1its MBC), thiourea (75 mM) or a combination of S16 (0.5MBC) and thiourea (75 mM) for 90 min using the CelIROX Orange Reagent (
[0406] Inhibition of Protein Synthesis does not Affect SNAPP-Induce Membrane Disruption.
[0407] In initial experiments, using flow cytometry to enumerate the number of viable bacterial cells, the bacterial cell counts for E. coli incubated with doxycycline (1 its MIC) for 4 h remained the same as the starting inoculum. This was as expected as doxycycline is bacteriostatic against E. coli. Membrane disruption as measured by propidium iodide inclusion was not affected when E. coli was incubated with doxycycline (
Example 7
[0408] Effects of Polymer Structure on the Antimicrobial Activity and Biocompatibility of Star-Shaped Polypeptides
[0409] The following experiments investigate the relationship between polymer structure and function, i.e., (1) the effect of star arm(co)polymer structure (block copolymer or homopolymer versus random copolymer) on bacterial membrane disruption ability, antimicrobial activity and biocompatibility, and (2) the reason(s) as to why the one arm linear polypeptide equivalent of SNAPPs was inferior in efficacy.
[0410] To test these, a library consisting of 16- and 32-arm star polypeptides and linear polypeptides with varying polymer structure (block and random copolymers as well as homopolymers) was prepared.
[0411] The antimicrobial properties against Gram-positive and Gram-negative bacteria, and mammalian cell toxicity effects were assessed using standard antimicrobial susceptibility, hemolysis and apoptosis assays.
[0412] Also demonstrated herein is the use of a high-throughput approach based upon flow cytometry and nucleic acid staining of bacterial cells to enable the rapid screening of the membrane disrupting ability of the polypeptides.
[0413] To elucidate the effect of the star architecture and the possible contribution of secondary structure on antimicrobial activity, circular dichroism (CD) spectroscopy was conducted to compare the secondary structures of the star and linear polymers under conditions that mimicked interaction with the bacterial membrane.
[0414] Experimental Details
[0415] Materials
[0416] H-Lys(Z)OH (>99%, Fluke), DL-Valine (>99%, Acros Organics), sodium chloride (NaCl, Chem-Supply), potassium chloride (KCl, Chem-Supply), sodium phosphate dibasic (Na2HPO4, Chem-Supply), potassium phosphate monobasic (KH2PO4, 99%, Aldrich), D-(+)-glucose solution (100 g/L, Aldrich), diethyl ether (Chem-Supply), acetonitrile (Univar), generation 2.0 poly(amido amine) dendrimer (G2 PAMAM, 8.95% w/w in water, Dendritech), generation 3.0 poly(amido amine) dendrimer (G3 PAMAM, 8.84% w/w in water, Dendritech), 4-methylbenzylamine (97%, Aldrich), bis(trichloromethyl)carbonate (triphosgene, 99%, Aldrich), trifluoroacetic acid (TFA) (99%, Aldrich), hydrobromic acid (33% in acetic acid) (Aldrich), pentane (anhyd., >99%, Aldrich), dimethyl sulfoxide (DMSO, Aldrich), N,N-dimethylformamide (DMF, anhyd., Acros Organics), Spectra/Por molecular porous membrane tubing 8000 MWCO (Spectrum Laboratories, Inc.), and penicillin-streptomycin (Aldrich) were used as received. THF (99%, Lab Scan) was distilled from sodium benzophenone ketal under argon. Dimetylsulfoxide-d6 (DMSO-d6) (99.9%) was purchased from Cambridge Laboratory Isotopes and used as received. RPMI-1640 medium without L-glutamine (GIBCO Cat. No. 21870), Dulbecco's Modified Eagle Medium (DMEM, GIBCO Cat. No. 11995), fetal bovine serum (FBS, GIBCO Cat. No. 10099), GlutaMAX supplement (100, GIBCO Cat. No. 35050), antibiotic-antimycotic (100, GIBCO Cat. No. 15240), MEM non-essential amino acids (100, GIBCO Cat. No. 11140), Dulbecco's Phosphate Buffered Saline (DPBS, GIBCO 14190), 0.05% trypsin-EDTA (1, GIBCO Cat. No. 25300), SYTO 9 green fluorescent nucleic acid stain, and propidium iodide (PI) were purchased from Invitrogen and used as received. Defibrinated horse and sheep blood were obtained from Commonwealth Serum Laboratories (CSL) Melbourne. Mueller-Hinton Broth (CM0405), Blood Agar Base No. 2 (CM0271), and Yeast Extract (LP0021) were purchased from Oxoid. Bacto Tryptone, and Bacto Agar were purchased from BD Biosciences. Vybrant Apoptosis Assay Kit #4 (YO-PRO-1/PI, Invitrogen) was used to perform the apoptosis/necrosis assay. 96-well cell culture plates and T175 cell culture flasks (Corning) were used for cell culture.
Synthesis of L-lysine(Z)-NCA (Lys NCA)
[0417] H-Lys(Z)OH (1.24 g, 4.42 mmol) was added to anhydrous THF (15 mL) in an oven-dried two-neck round bottom flask under argon. Triphosgene (525 mg, 1.77 mmol) was dissolved in anhydrous THF (2 mL) and added to the H-Lys(Z)OH suspension. The mixture was heated at 50 C. for 30 min with continuous stirring.
[0418] The clear solution was allowed to cool to room temperature and added to anhydrous pentane (100 mL). The resulting precipitate was isolated via centrifugation and washed with anhydrous pentane (30 mL2). The resulting white solid was dried at ambient temperature in vacuo to afford Lys NCA, 1.097 g (81%).
[0419] .sup.1H NMR (400 MHz, d6-DMSO) H 1.23-1.37 (m, -CH.sub.2, 2H), 1.37-1.45 (m, -CH.sub.2, 2H), 1.60-1.80 (m, -CH.sub.2, 2H), 2.94-3.02 (m, -CH.sub.2, 2H), 4.40-4.43 (m, -CH, 1H), 5.00 (dd, C.sub.6H.sub.5CH.sub.2, 2H), 6.90 (s, cyclic NH, 1H), 7.30-7.39 (m, C.sub.6H.sub.5, 5H).
Synthesis of DL-valine-NCA (Val NCA)
[0420] DL-valine (1.24 g, 10.58 mmol) was dissolved in anhydrous THF (20 mL) in an oven-dried two-neck round bottom flask under argon. Triphosgene (1.26 g, 4.23 mmol) was dissolved in anhydrous THF (5 mL) and added to the DL-Val-THF suspension. The mixture was heated at 50 C. for 30 min with continuous stirring. The clear solution was allowed to cool to room temperature and precipitated with anhydrous pentane (100 mL), followed by washing with more anhydrous pentane (30 mL2). The resulting residue was dried at ambient temperature in vacuo to afford Val NCA, 1.29 g (85%).
[0421] .sup.1H NMR (400 MHz, d6-DMSO) 1H NMR (400 MHz, d6-DMSO) H 0.91 (dd, CH.sub.3, 6H), 2.00-2.12 (m, CH, 1H), 4.32 (dd, cyclic CH, 1H), 9.06 (s, cyclic NH, 1H).
Synthesis of poly(DL-valine-b-Z-L-lysine).SUB.arm.PAMAM-(NH.SUB.2.).SUB.16,core .Star Polymers SB.SUB.16,Z
[0422] Lys NCA (1.3 g, 4.19 mmol) was dissolved in anhydrous DMF (13 mL) and added via syringe to PAMAM-(NH.sub.2).sub.16 (dried, 43 mg, 13.1 mol) dissolved in anhydrous DMF (1 mL). After stirring for 24 h under argon, Val NCA (0.3 g, 2.1 mmol) dissolved in anhydrous DMF (3 mL) was added to the reaction mixture. The reaction mixture was stirred for a further 24 h under argon, after which n-butyl alcohol (1 mL) was added and the mixture was stirred for a further 1 h. Precipitation of the concentrated polymer solution into diethyl ether (340 mL), followed by isolation via centrifugation and drying (0.1 mbar), afforded (PVal-b-PZLL).sub.armPAMAM-(NH.sub.2).sub.16,core star polymer SB.sub.16,Z as an off-white solid, 1.2 g (89%).
Synthesis of poly(DL-valine-b-Z-L-lysine).SUB.arm.PAMAM-(NH.SUB.2.).SUB.32,core .Star Polymers SB.SUB.32,Z
[0423] Lys NCA (1.3 g, 4.19 mmol) was dissolved in anhydrous DMF (13 mL) and added via syringe to PAMAM-(NH.sub.2).sub.32 (dried, 45 mg, 6.5 mol) dissolved in anhydrous DMF (1 mL). After stirring for 24 h under argon, Val NCA (0.3 g, 2.1 mmol) dissolved in anhydrous DMF (3 mL) was added to the reaction mixture. The reaction mixture was stirred for a further 24 h under argon, after which n-butyl alcohol (1 mL) was added and the mixture was stirred for a further 1 h. Precipitation of the concentrated polymer solution into diethyl ether (340 mL), followed by isolation via centrifugation and drying (0.1 mbar), afforded (PVal-b-PZLL).sub.armPAMAM-(NH.sub.2).sub.32,core star polymer SB.sub.32,Z as an off-white solid, 1.17 g (87%).
Synthesis of poly(Z-L-lysine-r-DL-valine).SUB.arm.PAMAM-(NH.SUB.2.).SUB.16,core .Star Polymers SR.SUB.16,Z
[0424] Lys NCA (1.3 g, 4.19 mmol) and Val NCA (0.3 g, 2.1 mmol) were dissolved in anhydrous DMF (16 mL) and added via syringe to PAMAM-(NH.sub.2).sub.16 (dried, 43 mg, 13.1 mol) dissolved in anhydrous DMF (1 mL). After stirring for 24 h under argon, n-butyl alcohol (1 mL) was added and the mixture was stirred for a further 1 h. Precipitation of the concentrated polymer solution into diethyl ether (340 mL), followed by isolation via centrifugation and drying (0.1 mbar), afforded (PZLL-r-PVal).sub.armPAMAM-(NH.sub.2).sub.16,core star polymer SR.sub.16,Z as an off-white solid, 1.21 g (90%).
[0425] .sup.1H NMR (400 MHz, d.sub.6-DMSO) H 0.67-0.89 (b, CH.sub.3, 6H), 1.11-1.77 (b, -CH.sub.2+-CH.sub.2+-CH.sub.2, 6H), 1.84-2.00 (b, CH, 1H), 2.78-3.00 (b, -CH.sub.2, 2H), 4.06-4.40 (b, -CH, 1H), 4.90-5.00 (b, C.sub.6H.sub.5CH.sub.2, 2H), 7.00-7.44 (b, C.sub.6H.sub.5, 5H), 7.60-8.30 (b, NH, 1H).
Synthesis of poly(Z-L-lysine-r-DL-valine).SUB.arm.PAMAM-(NH.SUB.2.).SUB.32,core .Star Polymers SR.SUB.32,Z
[0426] Lys NCA (1.3 g, 4.19 mmol) and Val NCA (0.3 g, 2.1 mmol) were dissolved in anhydrous DMF (16 mL) and added via syringe to PAMAM-(NH.sub.2).sub.32 (dried, 43 mg, 13.1 mol) dissolved in anhydrous DMF (1 mL). After stirring for 24 h under argon, n-butyl alcohol (1 mL) was added and the mixture was stirred for a further 1 h. Precipitation of the concentrated polymer solution into diethyl ether (340 mL), followed by isolation via centrifugation and drying (0.1 mbar), afforded (PZLL-r-PVal).sub.armPAMAM-(NH.sub.2).sub.32,core star polymer SR.sub.32,Z as an off-white solid, 1.15 g (85%).
[0427] .sup.1H NMR (400 MHz, d6-DMSO) H 0.67-0.89 (b, CH.sub.3, 6H), 1.11-1.77 (b, -CH.sub.2+-CH.sub.2+-CH.sub.2, 6H), 1.84-2.00 (b, CH, 1H), 2.78-3.00 (b, -CH.sub.2, 2H), 4.06-4.40 (b, -CH, 1H), 4.90-5.00 (b, C.sub.6H.sub.5CH.sub.2, 2H), 7.00-7.44 (b, C.sub.6H.sub.5, 5H), 7.60-8.30 (b, NH, 1H).
Synthesis of poly(Z-L-lysine).SUB.arm.PAMAM-(NH.SUB.2.).SUB.16,core .Star Polymer SH.SUB.16,Z
[0428] Lys NCA (1 g, 3.26 mmol) was dissolved in anhydrous DMF (9 mL) and added via syringe to PAMAM-(NH.sub.2).sub.16 (dried, 33 mg, 10.2 mol) dissolved in anhydrous DMF (1 mL). After stirring for 24 h under argon, n-butyl alcohol (1 mL) was added and the mixture was stirred for a further 1 h. Precipitation of the concentrated polymer solution into diethyl ether (340 mL), followed by isolation via centrifugation and drying (0.1 mbar), afforded PZLL.sub.armPAMAM-(NH.sub.2).sub.16,core star polymer SH.sub.16,Z as an off-white solid, 770 mg (87%).
Synthesis of poly(Z-L-lysine).SUB.arm.PAMAM-(NH.SUB.2.).SUB.32,core .Star Polymer SH.SUB.32,Z
[0429] Lys NCA (1 g, 3.26 mmol) was dissolved in anhydrous DMF (9 mL) and added via syringe to PAMAM-(NH.sub.2).sub.32 (dried, 35 mg, 5.1 mol) dissolved in anhydrous DMF (1 mL). After stirring for 24 h under argon, n-butyl alcohol (1 mL) was added and the mixture was stirred for a further 1 h. Precipitation of the concentrated polymer solution into diethyl ether (340 mL), followed by isolation via centrifugation and drying (0.1 mbar), afforded PZLL.sub.armPAMAM-(NH.sub.2).sub.32,core star polymer SH.sub.32,Z as an off-white solid, 780 mg (87%).
Synthesis of Linear poly(Z-L-lysine) Polymer LH.SUB.Z
[0430] Lys NCA (0.5 g, 1.63 mmol) was dissolved in anhydrous DMF (5 mL) and added via syringe to 4-methylbenzylamine (6.9 L, 54.4 mol). After stirring for 24 h under argon, n-butyl alcohol (1 mL) was added and the mixture was stirred for a further 1 h. Precipitation of the concentrated polymer solution into diethyl ether (340 mL), followed by isolation via centrifugation and drying (0.1 mbar), afforded linear PZLL polymer LH.sub.Z as an off-white solid, 411 mg (95%).
Synthesis of Linear poly(Z-L-lysine-r-DL-valine) Polymer LR.SUB.Z
[0431] Lys NCA (0.5 g, 1.63 mmol) and Val NCA (117 mg, 0.82 mmol) were dissolved in anhydrous DMF (6 mL) and added via syringe to benzylamine (10.3 L, 81.6 mol). After stirring for 24 h under argon, n-butyl alcohol (1 mL) was added and the mixture was stirred for a further 1 h. Precipitation of the concentrated polymer solution into diethyl ether (340 mL), followed by isolation via centrifugation and drying (0.1 mbar), afforded linear PZLL-r-PVal polymer LR.sub.Z as an off-white solid, 420 mg (81%).
[0432] .sup.1H NMR (400 MHz, d6-DMSO) H 0.67-0.89 (b, CH.sub.3, 6H), 1.11-1.77 (b, -CH.sub.2+-CH.sub.2+-CH.sub.2, 6H), 1.84-2.00 (b, CH, 1H), 2.78-3.00 (b, -CH.sub.2, 2H), 4.06-4.40 (b, -CH, 1H), 4.90-5.00 (b, C.sub.6H.sub.5CH.sub.2, 2H), 7.00-7.44 (b, C.sub.6H.sub.4, 4H), 7.60-8.30 (b, NH, 1H).
[0433] NMR Spectroscopic Analysis
[0434] .sup.1H NMR spectroscopy was performed at room temperature using a Varian Unity 400 (400 MHz) spectrometer with the deuterated solvent as reference and a sample concentration of ca. 10 mg/mL.
[0435] Gel Permeation Chromatography (GPC)
[0436] GPC analysis was performed on a Shimadzu liquid chromatography system equipped with a Shimadzu RID-10 refractometer (A=633 nm), using three Waters Ultrahydrogel columns in series ((i) 250 porosity, 6 m diameter bead size; (ii) and (iii) linear, 10 m diameter bead size), operating at 60 C. and a flowrate of 0.5 mL/min. The eluent was Milli-Q water containing 20% v/v acetonitrile and 0.1% w/v TFA). The molecular weight characteristics of the analytes were determined with reference to a conventional column calibration with narrow molecular weight poly(ethylene glycol) standards. All samples for GPC analysis were prepared at a concentration of 10 mg/mL and were filtered through 0.45 m nylon filters prior to injection.
[0437] Dynamic Light Scattering (DLS)
[0438] DLS measurements were performed on a Malvern Zetasizer Nano ZS with a 4.0 mW HeNe laser (633 nm) at an angle of 173 and a temperature of 250.1 C. Initial sample concentrations of 1 mg/mL in water (purified by reverse osmosis) were used and serial dilutions were performed until stable spectra were obtained. All sample solutions were filtered using 0.45 m syringe filters.
[0439] Measurement of Minimum Disruptive Concentrations (MDC)
[0440] The detailed protocols for bacterial cell culture are provided herein. A dilution series of each polypeptide was made by diluting polypeptide stock in sterilized Mueller-Hinton broth (MHB) for Escherichia coli, Luria broth (LB) for Staphylococcus aureus or Todd Hewitt broth for Streptococcus mutans to a desired concentration range with a final volume of 100 L in each well of a 96-well plate. Bacterial cells (which gave an optical density reading of ca. 0.7 at 650 nm for E. coli and S. aureus and ca. 1.8 at 650 nm for S. mutans) were diluted to 2.5106 cells/mL and 100 L of the bacteria solution was added to each well. The 96-well plate was then incubated at 37 C. for 90 min. A 50 L aliquot was taken from each well, transferred to a second 96-well plate and 100 L of saline and dye mixture (i.e., saline with 0.1% of SYTO 9 and 0.1% of PI) was added. Each well in the second 96-well plate was analyzed with a Cell Lab Quanta SC MPL flow cytometer to determine the % of cells with intact membranes and cells with compromised membranes for each polymer at each concentration. Positive controls containing cells alone were incorporated. Percentage of cells with intact membranes was plotted against polymer concentration and linear regression analysis was used to determine the lowest concentration (MDC) at which all of the cells had their membranes disrupted. Two independent runs of the assay were conducted and two replicates were used in each run for each bacteria, polymer, and concentration.
[0441] Measurement of Minimum Bactericidal Concentrations (MBC)
[0442] Identical to the preparative steps taken for the measurement of MDC, a dilution series of each polypeptide was prepared and incubated with bacterial cells at 37 C. for 90 min. For each well, microbial solution was diluted with saline using an appropriate dilution factor and placed on an agar plate (identical to that used for bacteria culture). For E. coli and S. aureus, the agar plates were incubated overnight at room temperature and then at 37 C. with aeration for 2 h. For S. mutans, the agar plates were incubated at 37 C. in an anaerobic chamber for 48 h. The number of colony-forming units (CFU) was counted and expressed as CFU/mL. Positive controls consisting of cells without any treatment were used. CFU/mL was plotted against polymer concentration and linear regression analysis was used to determine the lowest concentration (MBC) at which the CFU/mL becomes zero. Two independent runs of the assay were conducted and two replicates were used in each run for each bacteria, polymer, and concentration.
[0443] To evaluate TIs, MBC measurements were also performed in minimal essential medium (MEM, 136.9 mM NaCl, 10.1 mM Na.sub.2HPO.sub.4, 2.7 mM KCl, 1.8 mM KH2PO4, 0.2% w/v D-(+)-glucose) for SR16 and SR32.
[0444] Measurement of Minimum Inhibitory Concentrations (MIC)
[0445] The MICs of the polypeptides were determined using a broth microdilution method. After the preparation of a dilution series of each polypeptide and the addition of bacterial cells (Note: steps identical to that taken for the measurement of MDC), the optical density readings of each well at 630 nm were measured as a function of time using a microplate reader (Multiskan Ascent, Pathtech Pty. Ltd.). Positive controls containing cells alone were incorporated. Optical density was plotted against polymer concentration and linear regression analysis was used to determine the lowest concentration (MIC) at which the optical density reading becomes zero. Two independent runs of the assay were conducted and two replicates were used in each run for each bacteria, polymer, and concentration.
[0446] Circular Dichroism (CD)
[0447] CD spectra were recorded at 25 C. on an Aviv Biomedical CD Spectrometer Model 410 with stopped flow unit add-on. A glass cuvette with a path length of 1 mm was used. Spectra were generated from 195 to 250 nm wavelengths at 0.5 nm intervals, 4 s averaging time, 0.333 s settling time, and 1 nm bandwidth. Polymers were dissolved to a final concentration of 0.2 mg/mL in RO water with 0%, 20%, 50%, and 80% TFE. The spectra were plotted as mean residue ellipticity, [8], against wavelength.
[0448] Hemolysis Assay
[0449] Fresh sheep red blood cells (RBCs) were diluted 1 in 20 in PBS (pH 7.4), pelleted by centrifugation, and washed three times in PBS (1000 g, 10 min). The RBCs were counted using a cell counter (Coulter Particle Counter Z series, Beckman Coulter) and diluted to a final concentration of 2107 cells/mL. 100 L aliquots of the RBC solution were seeded into a V-bottomed 96-well plate containing 100 L of polypeptide solution of varying concentrations (4-256 g/mL) and incubated in a humidified atmosphere containing 5% CO.sub.2 at 37 C. for 2 h. Following incubation, the 96-well plate was centrifuged (1000 g, 10 min) and aliquots (100 L) of supernatant were transferred to a flat-bottomed 96-well plate. Hemoglobin release upon lysis of the RBCs was monitored at 405 nm using a microplate reader (PerkinElmer 1420 Multilabel Counter VICTOR3). Positive and negative controls for hemolysis were taken as RBC lysed with 0.5% Triton X-100 (1:1 v/v) and RBC suspension in PBS, respectively. The percentage of hemolysis was calculated using the following formula:
[0450] The percentage hemolysis was plotted against polypeptide concentration and linear regression analysis was used to determine the hemolytic concentration needed to lyse 50% (HC.sub.50) of RBCs. Two independent runs of the assay were conducted and two replicates were used in each run for each polypeptide and concentration.
[0451] Apoptosis/Necrosis Assay
[0452] Adherent HEK293T or H4IIE cells were grown to 80% confluence and trypsinized prior to assays. Cells were diluted 1:2 with complete medium (RPMI-1640 for HEK293T cells or DMEM for H4IIE cells) and seeded in a 24-well plate (1 mL per well). The cells were incubated at 37 C. in 5% CO2 for 24 h until ca. 95% confluence. The medium was removed. Varying concentrations of polypeptides (4 to 128 g/mL) were prepared and 200 L aliquots of each were added to the cells, after which the cells were incubated at 37 C. in 5% CO2 for 90 min. The cells were then harvested and all well contents were transferred to round-bottomed polypropylene tubes (5 mL). The cells were washed with cold DPBS, then stained with YO-PRO-1 and PI (0.2 mL from a stock solution, whereby both dyes were diluted 1:1000 in cold DPBS, per well), and incubated on ice for 20 to 30 min. The cells were analyzed by flow cytometry (Cytomics FC 500 MPL System). Standard compensation was performed using single-colour stained cells. Negative controls using untreated cells were included. Two independent runs of the assay were conducted and two replicates were used in each run for each polypeptide and concentration.
[0453] Flow cytometry. Bacterial cell sample analysis was performed using a Cell Lab Quanta SC MPL flow cytometer (Beckman Coulter) equipped with a 100 W stabilized mercury arc lamp with wavelengths of 365, 404, and 435 nm, and a 488 nm diode laser. The fluorescence from SYTO 9 was measured through a 525-nm band-pass filter (Fluorescent Channel 1, FL-1), and the red emission of PI was measured with a 670-nm long pass filter (Fluorescent Channel 3, FL-3). The multiparametric data were analyzed using the Cell Lab Quanta SC software. Cell samples from the apoptosis/necrosis assay were analyzed using a Cytomics FC 500 MPL flow cytometer (Beckman Coulter) equipped with a 20 mW argon ion laser operating at 488 nm and a solid-state 25 mW red diode laser operating at 635 nm. The green fluorescence from YO-PRO-1 was measured with a 525 nm filter (FL-1) and PI was measured through a 575 nm filter (FL-2). For each run, a total of 50 000 cells were acquired and cell debris was gated out using forward and side scatter properties.
[0454] Results and Discussion
[0455] Star Polypeptide Design and Synthesis
[0456] A polymer library consisting of six star polypeptides was synthesized via ROP of amino acid NCA monomers using the primary amines of multifunctional dendrimers as initiators (
[0457] The arrangement of lysine and valine repeat units along the polymer chains was also systematically varied. 16- and 32-arm star polymers SB16,Z and SB32,Z, respectively, possess block copolypeptide arms consisting of poly(DL-valine) (PVal) at the corona and poly(-Z-L-lysine) (PZLL; carboxybenzyl (Cbz or Z) protected) nearer to the core. For 16- and 32-arm star polymers SR16,Z and SR32,Z, respectively, lysine and valine NCAs were randomly polymerized to form random copolypeptide arms. Stars SH16,Z and SH32,Z, on the other hand, are 16- and 32-arm star polymers, respectively, with PZLL homopeptide arms.
[0458] Successful synthesis of the star polypeptides was confirmed by 1H NMR spectroscopic analysis (
[0459] Resonances resulting from the G2 and G3 PAMAM cores were difficult to observe upon star formation as they overlap with the broad polypeptide peaks. It is also likely that the intensities of the core resonances were much smaller relative to those resulting from the polypeptide arms, as the contribution of the PAMAM core to the overall molecular weight of the star is relatively small. The subsequent removal of the carboxylbenzyl (Cbz or Z) protecting groups on the lysine residues along the arms of the star polypeptides using HBr yielded water-soluble stars (SB16, SB32, SR16, SR32, H16, and SH32) with pendent protonated amine functionalities along the arms. At physiological pH, the pendent amine groups (pKa=10.5) would remain protonated. 1H NMR spectroscopic analysis revealed quantitative deprotection (i.e., >99% removal of the Cbz protecting groups) for all of the polymers (
[0460] In order to characterize the solvated dimensions of the star polypeptides, dynamic light scattering (DLS) analysis was conducted in water. The particle size distribution of each polymer was monomodal with hydrodynamic diameters (DH) that range from 7.5 to 16.8 nm (
[0461] Antimicrobial Properties of Star Polypeptides
[0462] The antibacterial efficacy of the star polypeptides against Escherichia coli and Staphylococccus aureuscommonly used model Gram-negative and positive bacteria, respectivelyis presented in Table 15. The antimicrobial activities were assessed in nutrient-rich media (i.e., undiluted Mueller-Hinton broth, MHB, for E. coli and Luria broth, LB, for S. aureus) to ensure optimum bacterial growth. Firstly, as we have previously demonstrated that the bactericidal action of SNAPPs involved membrane disruption, the ability of the star polypeptides synthesized herein to disrupt bacterial membranes was evaluated via determination of their minimum membrane disruptive concentrations (MDCs). The MDC is defined as the minimum drug (in this case, polypeptide) concentration that causes membrane disruption in all cells, and was determined using a combination of nucleic acid staining and a high throughput flow cytometric analytical protocol as previously reported by us (O'Brien-Simpson et al. PLoS ONE 2016, 11, e0151694). The MDC assay is a rapid and quantitative method that enables the assessment of antimicrobial activities by measuring peptide-bacteria interactions and lysed cell numbers. Compared to growth-based minimum bactericidal concentration (MBC) and minimum inhibitory concentration (MIC) assays that require at least an overnight incubation, the use of flow cytometry enables MDC determination to be completed within 90 min.
[0463] Star polypeptide SR16 with random copolypeptide arms was the most effective at causing membrane disruption, with MDCs of 0.8 and 1.0 M against E. coli and S. aureus, respectively. By comparing these values to those of several common AMPs, such as ovispirin, magainin II, alamethicin, and caerin 1.1, SR16 was found to possess higher membrane disrupting abilities by at least one order of magnitude. On the other hand, star polymer SB16 with block copolypeptide arms registered the highest MDC (i.e., lowest membrane disrupting ability) against E. coli compared to the star polymers with random copolypeptide arms and homopeptide PLL arms. Furthermore, within the concentration range tested 100 M), the star polypeptide SB16 did not show any significant disruptive activity towards the membranes of S. aureus. This might be expected as the cationic PLL block necessary for interaction with the anionic bacterial cell membrane was shielded by the neutral, outer poly(DL-valine) (PVal) block. Homopeptide star SH16 with cationic arms was more effective than block copolypeptide star SB16 in disrupting the membranes of E. coli and S. aureus, but was inferior to the random copolypeptide star SR16. Similar trends were also observed for the 32-arm star polypeptides (Table 15). These results elucidate the importance of both peptide composition and sequence in dictating the membrane lysis abilities of these macromolecular antimicrobials. Specifically, the presence of both (i) unshielded cationic segments and (ii) hydrophobic segments is necessary for microbial membrane disruption. While it is postulated that stars having block copolypeptide arms with PLL on the corona and PVal nearer to the core might display membrane lytic properties comparable to or even better than those of stars SR16 and SR32, precipitation of the PVal star (due to aggregation as a result of -sheet formation) prior to addition of the second block rendered the synthesis of these block copolypeptide stars challenging.
[0464] The MDCs of the star polypeptides were compared to their MBCs and MICs (Table 15), which were measured via standard antimicrobial susceptibility testing methods, to provide more comprehensive insights on the effect(s) of the polypeptides on E. coli and S. aureus. When tested against E. coli, the MBCs and MICs of stars SB16, SB32, SR32 and SH16 were in agreement with their respective MDCs. This indicated that membrane disruption (as indicated by the MDC) and cell death (as indicated by the MBC and suggested by the MIC) occurred simultaneously for the aforementioned polypeptides. From the antibacterial tests against S. aureus, star polymers SB16 and SB32 displayed no MBCs or MICs, which was consistent with their inability to disrupt the membrane of S. aureus.
[0465] The star polypeptide SH32 was found to be bactericidal against E. coli; interestingly its MDC of 2.0 M was much higher than its MBC of 0.9 M and MIC of 0.8 M. These differences indicate that membrane disruption was not the primary mechanism involved in the killing of E. coli by polymer SH32. As previously reported by us, the production of reactive oxygen species (ROS) and the induction of apoptotic-like death (ALD) responses were supplementary bactericidal mechanisms of SR16, aside from its primary mode of actionmembrane disruption. In the case of star SH32, it is postulated that the supplementary mechanisms could dominate, resulting in the ability of the star to effect cell death even before quantitative membrane disruption. Further, the existence of other antibacterial mechanisms is also possible, such as the inhibition of cellular processes through interactions with other intracellular enzyme or nucleic acid targets. Interestingly, homopeptide stars SH16 and SH32, which were able to quantitatively disrupt the membrane of S. aureus, did not register any MBC or MIC against S. aureus within the range of concentrations tested. Furthermore, polymer SR16, which was the most effective star polymer in terms of membrane disruption, had an MBC against S. aureus that was higher than its MDC. A possible explanation is that while these polymers were capable of disrupting bacterial membranes, membrane disruption itself was not sufficient to induce quantitative death in S. aureus. In fact, it is likely that the membrane pores induced by these polymers had low overall stability and half-lives, thereby allowing the fluid lipid bilayers of the bacterial membrane to reorganize and recover from the initial disruptive effects of the polymers. Hence, in the case of SR16, a polymer concentration higher than its MDC (i.e., MBC 4.6 M) was needed for complete cell death of S. aureus. Taken together, these results indicated the complex nature of the antibacterial mechanism of the star polypeptides studied due to the multiple targets involved, which highlighted the importance of performing in-depth mechanistic studies (such as evaluating polymer-membrane interactions through MDC determination as shown) to better understand the structure-activity relationships of antimicrobial polymers in general.
[0466] The poor correlation noted between the MICs of several polymers and their respective MBCs and/or MDCs implied that MIC measurements might not be a reliable technique for this class of polymers, possibly due to the interactions between the polymers and medium contents.
[0467] It was noted that the MICs of several star polymers are higher than their MDCs and MBCs, such as star SR16 against E. coli and star SR32 against S. aureus. Typically, MIC values should be at least equal to the MBC values, if not lower, as cell death correlates to the inhibition of growth. The discrepancies observed herein could possibly be attributed to the fact that for the MIC assays, the polymers were incubated with bacterial cells in nutrient broth for an extended duration (i.e., overnight as compared to 90 min for MDC and MBC measurements). Hence, the precision of the MIC measurements could be affected by polymer aggregation as a result of interactions with the nutrient broth components (e.g., proteins). The formation of aggregates with medium contents has been previously observed for SR16, as well as reported in literature for several cationic antimicrobials. The aggregated polymers could scatter spectrophotometer light and interfere with the optical density (OD) measurements, thereby explaining why substantial OD is still present when most cells have been killed in the aforementioned cases.
[0468] Further, MBC and MDC assays, which measure bacterial cell death/lysis, are able to provide more conclusive insights on the antibacterial activities of the polypeptides compared to the MIC assay, which evaluates bacterial growth inhibition. Based upon the MDCs and MBCs, it can be concluded that the star polymers with random copolypeptide arms (SR16 and SR32) were superior to other star polymers in the library, displaying excellent activity against E. coli and satisfactory potency against S. aureus.
[0469] Overall, all star variants were also found to be more effective against E. coli than S. aureus.
[0470] Effect of the Star Architecture on the Antimicrobial Efficacy of Polypeptides
[0471] To investigate the effect of the star architecture on antibacterial activity, linear homo (LH) and random (LR) polypeptide analogues were prepared for comparison. While polypeptide LH was synthesized to represent one arm of stars SH16 and SH32, the polypeptide LR is the linear analogue (one arm equivalent) of stars SR16 and SR32. It should be noted that linear counterparts of star polypeptides SB16 and SB32 were not synthesized as the linear amphiphilic block copolymers could possibly self-assemble or aggregate in solution, making them unreliable for any systematic comparison. Further, the preparation of linear, amphiphilic polypeptides with similar molecular weights as the stars (>500 repeat units needed) was not possible synthetically, which highlighted the advantage of the star polymer platform in synthesizing high molecular weight, stable and covalently-linked peptides that are hard to access via other methods. Details characterization the linear polypeptides are shown in
[0472] The antibacterial properties of the linear polypeptides are provided in Table 15. The amphiphilic star polypeptides SR16 and SR32 possessed efficacy against both E. coli and S. aureus, while their linear analogue LR was poorly active with an MBC that was 40-fold higher. In this study, by evaluating the MDCs and MICs, we validated that LR displayed weak antibacterial action, both in terms of bacterial membrane disruption and growth inhibition, with an MDC that was 14-fold higher than those of the stars and no MIC recorded within the range of concentrations tested 100 M). In the case of the purely cationic PLL polymers, the star polymers SH16 and SH32 were found to exhibit enhanced antimicrobial activity compared to the linear analogue LH, albeit to a lesser extent (5 to 15-fold in terms of the MBCs) compared to the random copolypeptides.
[0473] To investigate whether this observation applies to other bacteria, antimicrobial testing was conducted on another bacterial species, Streptococcus mutans. As expected, the amphiphilic star polypeptides SR16 and SR32 displayed good bactericidal activity (MBC 1.8-3.6 M), while LR was ineffective as shown in Table 17.
[0474] These results strongly suggested that the star architecture had a significant effect on enhancing the antimicrobial effect of polypeptides, especially random copolypeptides, against a range of Gram-positive and Gram-negative bacteria.
[0475] To further investigate the rationale behind this observation, CD spectroscopy was used to assess the secondary structure of the star and linear polypeptides in water with incremental additions of trifluoroethanol (TFE). TFE, which is a well-known secondary structure inducer, is commonly used to mimic the hydrophobic cell membrane environment. By progressively increasing the amount of TFE in an aqueous environment, we investigated the propensity of the polypeptides to form distinct secondary structure. At 0, 20 and 50% v/v TFE, none of the polypeptides exhibited any distinct secondary structures (
[0476] While the star architecture (from a peptide valency of 1 to 16) was found to enhance antimicrobial activity, our results suggested that increasing the number of star arms from 16 to 32 did not result in any substantial improvement in antimicrobial efficacy, and no obvious trends in MDCs, MBCs and MICs could be detected.
[0477] Polypeptide Biocompatibility
[0478] As an initial test of biocompatibility, the hemolytic activities were assessed of all polypeptides (which are their abilities to lyse red blood cells (RBCs)) by incubating them with RBCs at different polypeptide concentrations. While the star architecture and peptide (co)polymer structure were shown to influence antimicrobial activity significantly, these factors did not seem to have an effect on the hemocompatibility of the polypeptides. Minimal hemolysis was demonstrated for all the polypeptides used in this study and even at a high concentration of 1 mg/mL, the extent of hemolysis was well below 50% (see
[0479] Subsequently, the viability of two types of mammalian cells, human embryonic kidney (HEK293T) cells and rat hepatoma (H4IIE) cells, in response to the polypeptides was investigated. The adhered cells were incubated with the polypeptides for 90 minutes, stained with YO-PRO-1 and PI dyes, and analyzed by flow cytometry. Using YO-PRO-1 as an indicator of early apoptosis and PI as a measure of necrosis or cell death, viable cells were determined as cells that were negative for both YO-PRO-1 and PI (
[0480] The cell line-dependent cytotoxic effects shown here were not unexpected, as similar observations have been reported for other polymeric nanoparticles and were attributed to the differences in resistance between different cell lines. It is interesting to note that while star polypeptides SR16 and SR32 were found to have excellent antibacterial efficacies compared to the other polypeptides, they displayed toxicity towards mammalian cells that was higher than most of the other polypeptides as well. In spite of this, against certain bacterial species such as E. coli, these star polypeptides were bactericidal at concentrations which were a few times (i.e., 4 to 8 times) lower than those needed to kill mammalian cells. However, it should be noted that different environmental conditions were used in determining the IC.sub.50 and MBC.sub.50 values, where the media used for the antimicrobial susceptibility tests had higher protein contents than that used in determining 10.sub.50. As shown in our previous study, an increase in antimicrobial efficacy was observed when the antimicrobial assays were conducted in minimal essential medium (MEM) used for mammalian cell growth. Hence, by comparing the MBC.sub.50 values determined in MEM to the IC.sub.50 values, SR16 and SR32 were found to possess TIs (IC.sub.50/MBC.sub.50) that ranged from 16 to 57 (see Table 21). These indices are more favourable compared to a range of commercial pharmaceutical drugs, such as digoxin (cardiac drug, TI 2-3), fluconazole (antifungal drug, TI ca. 10 against certain fungal strains), amphotericin (antifungal drug, TI ca. 16 against certain fungal strains), gentamicin, and polymyxin B (antibiotics, TI<10 against certain bacterial strains).
[0481] In this study, we have successfully synthesized and characterized a library of polypeptides, consisting of 16- and 32-arm star polymers with different peptide arrangements along the arms, as well as their linear analogues. Combining advanced flow cytometery techniques with traditional antimicrobial susceptibility assays, the antimicrobial properties of the polypeptides were determined. Among the star polypeptides, stars with random copolypeptide arms of lysine and valine were found to efficiently disrupt the membranes and kill model Gram-positive and Gram-negative bacteria, with superior performance compared to the block copolypeptide and homolysine stars. Based on secondary structure analysis, the enhancement in antimicrobial efficacy observed by the star polypeptides with random copolypeptide arms was possibly attribute to their ability to adopt -helical conformations in the presence of hydrophobic environments. Importantly, no significant hemolytic activity was observed for the polypeptides over a wide range of concentrations, regardless of polypeptide composition and copolymer structure. Although the random copolypeptide star polymers induced greater toxicity towards mammalian cells compared to the other polypeptides studied, their therapeutic indices were still found to be favourable as a result of their excellent antimicrobial activity. This study highlights the potential of the star architecture with random copolypeptide arms as a new design motif to develop highly potent but safe antimicrobial polypeptides that could potentially kill a wide range of multi-drug resistant and clinically significant bacteria.
Example 8
[0482] In this study we investigated the bio-nano interactions between SNAPPs and biological molecules, and the effects of such interactions on the antibacterial efficacy and mechanism of SNAPPs. To the best of our knowledge, such studies are rare in the field of antimicrobial research and no study has been reported on polymer-based macromolecular antimicrobials, as the few investigations that have been conducted in this area were mostly focused on antibioticsand linear AMPs. Our study was achieved by assessing the antimicrobial efficacy of SNAPPs in media that mimic the ionic and protein composition in vivo. Specifically, we tested SNAPPs against four different Gram-negative bacterial species in simulated body fluid (SBF)a solution with an ion concentration similar to that in blood plasmaand animal serum, which contains physiologically relevant salt and protein concentrations. The effects of polymer-medium interactions on the bactericidal action of SNAPPs were further probed by using OM and IM permeability assays based on fluorometric assessment and flow cytometry. Based on our observations, we suggest and demonstrate a strategy to improve the effectiveness of SNAPPs against bacteria under physiological conditions.
[0483] Materials.
[0484] Sodium chloride (NaCl, Chem-Supply), potassium chloride (KCl, Chem-Supply), sodium phosphate dibasic (Na2HPO4, Chem-Supply), potassium phosphate monobasic (KH2PO4, 99%, Aldrich), sodium bicarbonate (NaHCO.sub.3, 99.5%, Aldrich), potassium phosphate dibasic trihydrate (K2HPO4.3H2O, 99.0%, Aldrich), magnesium chloride hexahydrate (MgCl2.6H2O, 99.0-102.0%, Aldrich), hydrochloric acid (HCl, Chem-Supply), calcium chloride (CaCl2, 99.9%, Aldrich), sodium sulphate (Na2SO4, 99.0%, Aldrich), Tris base (NH2C(CH2OH)3, Aldrich), ethylenediaminetetraacetic acid disodium salt dihyrate (EDTA, 99.0-101.0%, Aldrich), N-phenyl-1-naphthylamine (NPN, 98%, Aldrich), D-(+)-glucose solution (100 g/L, Aldrich), HEPES (1 M, GIBCO Cat. No. 15630, Life Technologies), MEM non-essential amino acids (100, GIBCO Cat. No. 11140, Life Technologies), fetal bovine serum (FBS, GIBCO Cat. No. 10099, Life Technologies), SYTO 9 green fluorescent nucleic acid stain (Cat. No. S-34854, Life Technologies), propidium iodide (PI, 1.0 mg/mL solution in water, Cat. No. P3566, Life Technologies), bovine serum albumin (BSA, Bovogen Biologicals), Blood Agar Base No. 2 (CM0271, Oxoid, Mueller-Hinton broth (CM0405, Oxoid), yeast extract (LP0021, Oxoid), tryptone (LP0042, Oxoid), Bacto Agar (BD Biosciences), and fresh defibrinated horse blood (Commonweath Serum Laboratories, Melbourne) were used as received. 96-well cell culture plates (Greiner Bio-One) were used for cell culture.
[0485] SNAPPs were synthesized and characterized based on the materials and methods as described herein.
[0486] Instrumentation.
[0487] Bacterial cell sample analysis was performed using a Cell Lab Quanta SC MPL flow cytometer (Beckman Coulter) equipped with a 100 W stabilized mercury arc lamp with wavelengths of 365, 404, and 435 nm, and a 488 nm diode laser. The fluorescence from SYTO 9 was measured through a 525-nm band-pass filter (Fluorescent Channel 1, FL-1), and the red emission of PI was measured with a 670-nm long pass filter (Fluorescent Channel 3, FL-3). The multiparametric data were analyzed using the Cell Lab Quanta SC software.
[0488] Bacterial Strain, Culture Media and Growth Conditions.
[0489] Freeze-dried cultures of Escherichia coli (E. coli, ATCC 25922), Klebsiella pneumoniae (K. pneumoniae, ATCC 13883), Acinetobacter baumannii (A. baumannii, ATCC 19606), and Pseudomonas aeruginosa (P. aeruginosa, ATCC 47085) were grown aerobically and maintained by passage at ambient temperature on horse blood agar (10% v/v defibrinated horse blood, 4.4% w/v Oxoid Blood Agar Base No. 2). Overnight cultures were made from transferring a colony from the agar plates to culture tubes containing sterilized Luria-Bertani broth (LB, 1% w/v tryptone, 1% w/v NaCl, 0.5% w/v Oxoid Yeast Extract) (20 mL). Bacterial cultures were incubated overnight at 37 C. with aeration and without agitation. On the next day, for E. coli, K. pneumoniae, and P. aeruginosa, small aliquots (i.e., 0.5-2 mL) were taken from the culture tubes, further diluted with LB (20 mL), and incubated for 3-4 h at 37 C. with aeration before use. All bacterial cultures were cultured without agitation, with the exception of P. aeruginosa which was cultured with shaking at 150 rpm. For A. baumannii, an aliquot of 0.5 mL was taken from the overnight culture tube, further diluted with LB (200 mL), and incubated overnight at 37 C. with aeration before use.
[0490] Bacterial Cell Counting.
[0491] Prior to use in assays, the bacterial cells were pelleted (3000 g, 10 min, 25 C.), washed and resuspended in the relevant medium (20 mL). A Cell Lab Quanta SC 28 MPL flow cytometer was used to count the number of bacterial cells. Cells were diluted with saline using an appropriate dilution factor and incubated with SYTO 9 and PI (i.e., 1 mL cell solution to 1 L of each dye). SYTO 9 stains the nucleic acids in all cells, while PI stains the nucleic acids in cells with damaged membranes. Using the Cell Lab Quanta SC software, the number of viable cells/mL (SYTO 9-positive, PI-negative) was obtained.
[0492] Measurement of Minimum Inhibitory Concentrations (MIC).
[0493] The MICs of SNAPPs S16 and S32 were determined using a broth microdilution method. Nine types of media were used for the assay: minimal essential medium (MEM; 1phosphate-buffered saline with 1MEM non-essential amino acids and 2 g/L D-(+)-glucose), simulated body fluid (SBF; prepared according to the protocol reported by Kokubo et al. 44 and supplemented with 1MEM non-essential amino acids and 2 g/L D-(+)-glucose), modified SBF (mSBF; prepared in a similar manner to SBF but without the addition of CaCl2) and MgCl2.6H2O), SBF without CaCl2) (prepared in a similar manner to SBF but without the addition of CaCl2), SBF without MgCl2.6H2O (prepared in a similar manner to SBF but without the addition of MgCl2.6H2O), 10% serum (10% v/v FBS in MEM), 50% serum (50% v/v FBS in MEM), 0.22 mg/mL BSA in MEM, and 1.1 mg/mL BSA in MEM.
[0494] A dilution series of each peptide polymer was made by diluting SNAPP stock solutions in medium to a desired range of concentrations and a final volume of 100 L in each well of a 96-well plate. Bacterial cells (which gave an optical density reading of ca. 0.7 at 650 nm for E. coli, K. pneumoniae, and P. aeruginosa, and ca. 0.5 at 650 nm for A. baumannii) were diluted to 2.5106 cells/mL in medium and 100 L of the bacteria solution was added to each well. The 96-well plate was then incubated at 37 C. for 90 min, after which Mueller-Hinton broth (MHB, 50 L, 2.1% w/v Oxoid Mueller-Hinton Broth) was added. The optical density readings of each well at 630 nm were then measured as a function of time over a period of 24 h at 37 C. using a microplate reader (Multiskan Ascent, Pathtech Pty. Ltd.). Positive controls containing cells alone were incorporated. Optical density was plotted against SNAPP concentration and linear regression analysis was used to determine the lowest concentration (MIC) at which the optical density reading becomes zero. A minimum of two independent experiments (biological replicates) of the assay were conducted and two technical replicates were used in each experiment for each bacterial species, peptide polymer, and concentration. Data is expressed as meanstandard deviation (SD) of the biological replicates.
[0495] Note that the antimicrobial action of SNAPPs have been shown herein to be fully effected within 90 min. The addition of MHB after the 90 min incubation period was to allow for optimal growth of any remaining viable bacterial cells in the microplate reader.
[0496] NPN Uptake (Outer Membrane, OM, Permeability) Assays.
[0497] The assays were conducted in either mSBF or SBF. A dilution series of SNAPP S16 was made by diluting S16 stock in medium to concentrations of 0.2 to 11.7 M and a final volume of 50 L in each well of a 96-well plate. A 5 mM NPN stock solution in acetone was prepared which was then diluted to 40 M in the medium of interest before use. S16 (50 L), NPN (40 M, 50 L), and medium (50 L) were pipetted into the 96-well plates in advance, and either E. coli or A. baumannii cell suspension (50 L, 5106 cells/mL in medium) was added to each well immediately before fluorescence measurement using a microplate reader (PerkinElmer 1420 Multilabel Counter VICTOR3). The fluorescence values were recorded after 5 min and until a plateau was reached. Control wells which included (i) medium alone (200 L), (ii) medium (150 L) and bacterial cell suspension (50 L), (iii) medium (150 L) and NPN (40 M, 50 L), and (iv) medium (100 L), NPN (40 M, 50 L) and bacterial cell suspension (50 L) were incorporated. For E. coli, an additional set was conducted in SBF with EDTA (final concentration of 1.5 mg/mL EDTA) as an additive. The results are expressed in relative fluorescence units (RFUs) where the fluorescence value of cell suspension and NPN (control iv) was subtracted from that of the test well RFUs. A minimum of two independent experiments (biological replicates) of the assay were conducted and two technical replicates were used in each experiment for each bacterial species and S16 concentration. Data is expressed as meanstandard deviation (SD) of the biological replicates.
[0498] Inner Membrane (IM) Disruption Assays Using Flow Cytometry.
[0499] Briefly, the IM disruption assay was conducted as previously described (O'Brien-Simpson et al. PLoS One 2016, 11, e0151694). Bacterial cells (100 L, final concentration of 2.5106 cells/mL) were added to SNAPP S16 (100 L, final concentration of 0.09 M) in the relevant medium in a 96-well plate. The plate was then incubated at 37 C. for 90 min. A 50 L aliquot was taken from each well, transferred to a second 96-well plate and 100 L of saline and dye mixture (i.e., saline with 0.1% of SYTO 9 and 0.1% of PI) was added. Each well in the second 96-well plate was analyzed with a Cell Lab Quanta SC MPL flow cytometer to determine the % of cells with intact membranes (PI-negative) and cells with compromised membranes (PI-positive). Positive controls containing cells alone were incorporated. Two independent runs of the assay were conducted and two replicates were used in each run for each bacteria.
[0500] Investigating the Effect of EDTA on the MIC of SNAPP S16.
[0501] The assays were conducted using the broth microdilution method described above, except that different concentrations of EDTA disodium salt (0.5 to 2 mg/mL) were added to the S16 solution prior to the addition of bacterial cells.
[0502] Results and Discussion
[0503] 16- and 32-arm SNAPPs S16 and S32, respectively, were synthesized via ring-opening polymerization (ROP) of -amino acid (i.e., lysine and valine)N-carboxyanhydride (NCA) monomers as previously reported (see
[0504] Antimicrobial Studies in Simulated Body Fluid (SBF).
[0505] Although MEM is able to sustain bacterial viability for antimicrobial susceptibility testing purposes, its ionic composition does not reflect the type and concentration of salts in vivo. For example, divalent cations such as magnesium (Mg2+) and calcium (Ca2+) ions, which are present in the blood, are absent in MEM. Therefore, to better reflect the therapeutic efficacy of SNAPPs in vivo, the MICs of the peptide polymers were evaluated in SBF supplemented with amino acids and glucose (see Materials and Methods for composition). The ionic composition of SBF mimics that of human blood plasma, containing Mg2+ and Ca2+ ions at physiological concentrations. Interestingly, we observed significant reductions (P<0.05) in inhibitory activity (as indicated by the increase in MIC values) by at least 9 times from nM to low M MICs for both S16 and S32 against E. coli, P. aeruginosa and K. pneumoniae when SBF was used as the medium, instead of MEM (Table 22). The antimicrobial activity of S32 against E. coli was the most severely antagonized compared to the other polymer-bacteria combinations, as the MIC of S32 against E. coli increased more than 30 times from 0.05 M in MEM to 1.68 M in SBF.
[0506] We hypothesized that the reductions in activity observed were a result of the antagonistic effects exhibited by one or more of the salts in SBF towards SNAPPs. To validate this hypothesis, modified versions of SBF were prepared in the same way as SBF but with certain salts (such as magnesium and/or calcium salts) removed. SNAPP S16 was chosen as the model compound for subsequent studies, and its antimicrobial activity was evaluated in the modified media. The MICs of S16 against E. coli were found to be 1.620.17 M in the absence of a magnesium salt (MgCl2.6H2O) and 0.390.01 M in the absence of a calcium salt (CaCl2), which in both cases were lower than its MIC in SBF. The removal of Ca2+ ions resulted in a more substantial recovery in inhibitory activity, although the resulting MIC was still more than double of that in MEM. In modified SBF without both MgCl2.6H2O and CaCl2 (hereby denoted as mSBF), the MIC of S16 dropped to 0.220.03 M, which was comparable to its activity in MEM (i.e., 0.17 M). Similarly, the MIC of S16 against P. aeruginosa was reduced by almost 12-fold from 1.64 M in SBF to 0.140.06 M in mSBF, close to its MIC in MEM.
[0507] These observations implied an antagonistic effect of both Mg2+ and Ca2+ divalent cations on the antimicrobial activity of SNAPPs. Interestingly, in our study, the antagonistic effect displayed by Mg2+ and Ca2+ seemed to be species-dependent. While the antimicrobial activity of S16 and S32 against E. coli, K. pneumoniae and P. aeruginosa were affected, their activity against A. baumannii remained unchanged regardless of the salt composition of the medium used.
[0508] To explore the effect of divalent cations on the antimicrobial mechanism of SNAPPs, we conducted an OM permeability assay using a hydrophobic 1-N-phenylnaphthylamine (NPN) fluorescent probe. NPN emits weak fluorescence in an aqueous environment and only fluoresces strongly in a hydrophobic environment such as in the bacterial membrane.38 As NPN, like most hydrophobic substances, is normally excluded by intact OMs, an increase in fluorescence intensity when incubated with Gram-negative bacterial cells would indicate disruption to the OM. Bacterial cells (either E. coli or A. baumannii) were added to varying concentrations of SNAPP S16 in the presence of NPN, and the fluorescence intensity (expressed in terms of relative fluorescence units, RFU) was measured as a function of time (
[0509] When E. coli cells were treated with S16 in mSBF, NPN was taken up in a dose-dependent manner and the RFU recorded at each concentration reached its maximum 5 min after the addition of bacterial cells (
[0510] In SBF, only a slight increase in NPN uptake with S16 concentration was observed (RFU5000) 5 min after the addition of E. coli cells (
[0511] Similar to the observations made for E. coli, the NPN uptake of A. baumannii proceeded in a dose-dependent fashion (
[0512] Subsequently, in order to better understand the effects of different media on polymer-OM interactions, we compared the initial increase in RFU as a function of S16 concentration (slope of curve before a plateau was reached) across the different media and time points (Table 23). Against E. coli, it was noted that the slopes obtained at 5 min when either mSBF or a combination of SBF and EDTA (1.5 mg/mL) was used were comparable (ca. 3000 RFU.Math.mL/g). However, when the NPN assay was conducted in SBF, the slope was smaller and remained relatively constant (991-1301 RFU.Math.mL/g) even when the incubation time was increased from 5 to 90 min. In the case of A. baumannii, while the slope obtained after a 5-min incubation in SBF was significantly (ca. 8 times) lower than that in mSBF, it increased by close to 4-fold when the incubation time was extended to 25 min.
[0513] Based on these results (
[0514] A. baumannii is an opportunistic pathogen that is responsible for a significant number of hospital-acquired infections and has become extensively resistant to numerous antibiotics. SNAPP S16 has been demonstrated to possess excellent in vivo efficacy against wild-type and colistin-multidrug-resistant (CMDR) A. baumannii species. The results herein substantiated the potential of SNAPPs as effective antimicrobial agents against A. baumannii infections as their potency against this species was retained at physiologically relevant salt concentrations. Despite the reduction in efficacy against the other bacterial species tested (i.e., E. coli, K. pneumoniae and P. aeruginosa), SNAPPs were still able to maintain good MIC values within the range of 0.59 to 4.68 M, which are superior (e.g., >20 times more effective against E. coli) to the MICs of several AMPs, such as LL-37, indolicidin, defensin, and magainin I.
[0515] Next, we conducted an inner membrane (IM) disruption assay to validate the species-dependent effects of divalent cations on the antimicrobial activity of SNAPPs. Based on earlier observations (
[0516] Effect of Chelating Agent Addition.
[0517] We postulated that the addition of a chelating agent such as ethylenediaminetetraacetic acid (EDTA) disodium salt which chelates Ca2+ and Mg2+ ions could attenuate the antagonistic effect of the divalent cations on antimicrobial activity. To validate this, we treated E. coli cells with S16 and varying concentrations of EDTA disodium salt, and observed a reduction in MIC of S16 as the concentration of EDTA disodium salt was increased (
[0518] Antimicrobial Studies in Serum.
[0519] To facilitate the evaluation of SNAPPs S16 and S32 for possible therapeutic utility, we developed an ex vivo assay to assess their antimicrobial efficacies in animal serum (i.e., fetal bovine serum (FBS); diluted to 10% and 50% in MEM). Serum is a cell-free biomatrix isolated from the coagulation of blood and plasma components, with associated activation of proteases and other factors. Besides salts which have been shown to have an inhibitory effect on antimicrobial activity, blood serum contains serum albumin and a range of other proteins such as transferrin and lactoferrin which could collectively form a protein corona around antimicrobials and decrease their therapeutic activity by reducing the free fraction of drug or nanoparticle available for bacteria association and/or killing.
[0520] When 10% FBS in MEM was used, the MICs of SNAPPs S16 and S32 increased significantly by ca. 3 to 17 times depending on the peptide polymer and bacterial species tested against (Table 22). The activity of SNAPP S32 against K. pneumoniae was reduced by almost 10 times, while S16 became non-active against K. pneumoniae within the range of concentrations tested (6 M). When tested against A. baumannii, a relatively weaker effect (ca. 3 to 5-fold reduction in activity) was observed for both S16 and S32. These observations substantiated the potential of SNAPPs as effective antimicrobials against A. baumannii even under physiologically-relevant conditions. The reduction in activity (albeit to different extents depending on serum concentration and bacterial species tested against) may be attributed to weaker membrane disruption activities in the presence of serum. The extent of membrane disruption caused by SNAPP S16 against E. coli, as indicated by flow cytometry, dropped from 55.8% in MEM to 10.2% in 10% serum (
[0521] While the activity of the SNAPPs were lowered in serum they still exhibited significant anti-bacterial effects and highlights their utility in treating bacterial infections.
Example 9
Synthesis of SNAPPs
[0522] This example reports an alternative method for producing SNAPPs. In the examples discussed above, the SNAPPs were prepared through random ring opening polymerisation (ROP) of the cationic capable (S-carboxybenzyl, CBz, Z protected) L-lysine and hydrophobic racemic D,L-valine amino acid N-carboxyanhydride (NCA) monomers. Polymerisation was performed through a core-first approach, initiated by the terminal primary amines of a PAMAM dendrimer core, and conducted at room temperature. However, the inventors have now found that reducing the reaction temperature during polymerisation, to as low as 0 C., can slow down and reduce side reactions in primary amine initiated NCA ROP, resulting in greater livingness of the polymers and lead to improved control of polymerisation.
[0523]
[0524]
[0525] The methods used to synthesise the NCAs and the SNAPPs, and the method for the subsequent deprotection of the SNAPPs is outlined below.
[0526] Synthesis of D,L-Valine and (Z)-L-Lysine N-Carboxyanhydrides (NCAs). -(Z)-L-Lysine and D,L-Valine NCAs were synthesized as per the previous examples, with the inclusion of an additional purification step to remove hydrochloride impurities from the reaction. Dried H-Lys(Z)OH (2 g, 7.14 mmol) or D,L-Valine (2 g, 17.0 mmol)) were suspended in anhydrous THF (50 mL) in a three-necked round bottomed flask under argon. Triphosgene (lys: 0.85 g, 2.86 mmol, 1.2 equiv. phosgene; val: 2.0 g, 6.74 mmol, 1.2 equiv. phosgene) was then added and the mixture was refluxed at 65 C. for 2 h with continuous stirring. After cooling to room temperature, the reaction mixture was sparged with argon for 45 mins into a sat. NaOH solution, then solvent removed completely in vacuo to a white solid. The solid was then suspected in EtOAc (anhydrous), chilled and placed into a separator funnel where the crude NCA solution was gently washed with chilled saturated brine solution (50 mL), and 0.5% w/v NaHCO.sub.3 solution (50 mL). The organic phase was then dried with MgSO4, filtered and concentrated to an oil under low heat, and re-crystalized (2) from EtOAc (anhydrous) and n-pentane (anhydrous). The resulting crystals were then filtered and washed with n-pentane (dry), then re-precipitated and washed (2) with dry n-pentane to afford white powder solids (Yields: 80%).sup.1H NMR (CDCl.sub.3): (Z)-L-Lysine NCA .sup.1H NMR (400 MHz, CDCl3): .sub.H 1.40-1.60 (m, 4H, NHCH.sub.2CH.sub.2CH.sub.2CH.sub.2), 1.81-1.94 (m, 2H, NHCH.sub.2CH.sub.2CH.sub.2CH.sub.2), 3.18 (m, 2H, NHCH.sub.2CH.sub.2CH.sub.2CH.sub.2), 4.25 (t, 1H, CHN), 4.97 (s, 1H, side chain NH), 5.09 (s, 2H, CH.sub.2ArH), 7.04 (s, 1H, ring NH), 7.3-7.4 (m, H, ArH). D,L-Valine NCA .sup.1H NMR (400 MHz, CDCl.sub.3): .sub.H 1.02 (d, 3H, J=7.0 Hz, CH.sub.3), 1.08 (d, 3H, J=7.0 Hz, CH.sub.3), 2.25 (m, 1H, CH(CH.sub.3).sub.2), 4.22 (d, 1H, J=4.4 Hz, CHNH), 6.95 (s, 1H, CONH).
[0527] General Procedure for Synthesis of (PZLL-r-PVal).sub.arm PAMAM-(NH.sub.2).sub.m,core.
[0528] In line with the previous examples, a theoretical lysine-to-valine ratio of approximately 2.5:1 was targeted. To account for different observed reactivity rates of the two monomers, Lys NCA and Val NCA in approximately 2:1 molar ratio were both dissolved in anhydrous DMF ([NCA].sub.total=55 mg/mL) and added via syringe to a test tube containing PAMAM-(NH.sub.2).sub.m (dried) dissolved completely in anhydrous DMSO (volume corresponding to 10% v/v of final reaction volume) under N.sub.2. The test tube was then immersed in an ice chest and stirred for 24 h in ice under constant nitrogen flow and with a bleed for CO.sub.2 removal (Note: S8.sub.VL was stirred for total 50 h). n-butanol (0.86 L/mg of NCA.sub.total added to reaction) was then added to quench remaining NCA monomer and the mixture stirred for a further 1 h. The reaction mixture was then concentrated under vacuum and transferred into diethyl ether to precipitate. The precipitate was then washed thoroughly with ether and dried in vacuo to afford an off-white solid. Average yield 60%
[0529] General Deprotection of (PLL-r-PVal).sub.arm PAMAM-(NH.sub.2).sub.m,core.
[0530] Protected star polymer was first fully dissolved in TFA (5 mL/g polymer). 33% HBr in acetic acid was then added (10 mL/g polymer), the reaction mixture stoppered and stirred at room temperature with precipitate forming soon after. After stirring for a total of 2 h at room temperature, the solution was added directly into diethyl ether, washed further in ether (2) and dried under vacuum. The dried solid was then dissolved up in minimal DI water, transferred to 3.5 kDa dialysis tubing and dialysed against a large volume of DI water (180 times volume of original dialysis content)(3) for 24 h. The dialysed solutions were then lyophilised to obtain the deprotected SNAPP as a dried white solid. .sup.1H NMR (D20): .sub.H 0.9 (s, 2(CH).sub.3), 1.3-1.9 (m, NHCH.sub.2CH.sub.2CH.sub.2CH.sub.2), 2.0 (br s, CHNH valine), 3.0 (s, NHCH.sub.2CH.sub.2CH.sub.2CH.sub.2), 4.0-4.15 (s, CHNH backbone valine), 4.2-4.4 (s, CHNH backbone lysine).
[0531] Characterisation of SNAPPs.
[0532] .sup.1H NMR analysis was performed using a Varian unity Plus 400 MHz NMR spectrometer using the deuterated solvent as reference. Size exclusion chromatography (SEC) analysis was performed on an aqueous gel permeation chromatography (GPC) units using an eluent of Milli-Q water containing 0.1% v/v trifluoroacetic acid (TFA). The system was operated at a flow rate of 1 mL min.sup.1 at 25 C. A Shimadzu Liquid Chromatography system was utilized, equipped with a Shimadzu RID-10 refractometer (A=633 nm) and Wyatt 3-angle light scattering detector, with three Waters Ultrahydrogel columns in series ((i) 250 porosity, 6 m diameter bead size; (ii) and (iii) linear, 10 m diameter bead size) for separation. The do/dc value of the S4.sub.M, S8.sub.M, and S16.sub.M SNAPPs were calculated to be 0.187, 0.183, 0.188 respectively at 25 C. using a batch injection protocol and Wyatt ASTRA SEC/LS software. Molecular weight and polydispersity values were calculated on the Wyatt ASTRA SEC/LS software package using Debye modelling with a fit of 2. All GPC samples prepared at a concentration of 5 mg/mL and were filtered through 0.45 m nylon filters prior to injection. DLS measurements were performed on a Malvern Zetasizer Nano ZS with 4.0 mW HeNe laser operating at 632.8 nm. Analysis was performed at an angle of 173 at a constant temperature of 250.01 C. Samples were made to an initial concentration of 1 mg/mL in DMEM (the same media conducted for antibacterial studies) serial dilutions performed until stable spectra was obtained. Measurements were performed in triplicate. All samples filtered through 0.45 m nylon filters to measurement.
[0533] Results
[0534] The star-shaped SNAPPs and their corresponding characterisation data is shown in Table 24. All stars contained similar lysine to valine ratios and close to the theoretical ratio of 2.5:1 as determined through .sup.1H NMR analysis. Absolute molecular weight (MW) of the stars was calculated through size exclusion chromatography (SEC) using light scattering measurements, which in conjunction with NMR studies, lead to highly accurate determination of star arm length (arm DP) and arm composition. SEC profiles of all SNAPPs displayed typical mono-modal profiles (see
[0535] The polydispersities of these stars 1.8) were considerably lower than that report in the earlier examples. It must be noted that the PDIs of these particular star-shaped polypeptides are expected to be intrinsically higher than other polypeptide star systems due to the use of valine, an amino acid well known to produce insoluble -sheet structures in situ, and therefore likely to have an impact on polymerisation control.
[0536] To investigate the effect of arm number, S4, S8 and S16 star shaped SNAPPs were prepared, each with a similar medium (M) range in arm length of 14 repeat units per arm (S4.sub.M, S8.sub.M, S16.sub.M respectively). This arm length was targeted as it was similar to the calculated arm length of the S16 SNAPP we reported previously. As expected, SEC analysis showed an increase in star MW with increasing arm number. (Table 24,
[0537] Three additional S4 SNAPPs were synthesised with different arm lengths; short (S) with DP of 5, long (L) with DP of 18, and very long (VL) with DP of 27. SEC analysis confirmed the increasing MW of these species (
Example 10
[0538] This example reports in vitro tests using a selection of the SNAPPs synthesised in Example 9.
[0539] Materials and Methods
[0540] Materials.
[0541] Mueller-Hinton broth (MHB), Dulbecco's modified eagle medium (DMEM) and phosphate-buffered saline (PBS) were purchased from Sigma-Aldrich. BacLight viability kit was purchased from Thermo Fisher Scientific.
[0542] Bacterial Strains.
[0543] Escherichia coli (ATCC 25922), Acinetobacter baumannii (ATCC 19606), Pseudomonas aeruginosa (ATCC 47085), Klebsiella pneumoniae (ATCC 13883), Staphylococcus aureus (ATCC 29213), methicillin resistant Staphylococcus aureus (MRSA, ATCC 43300), Enterococcus faecalis (ATCC 29212).
Instrumentation.
[0544] MIC values were calculated using a Multiskan Ascent (Labsystems) microplate reader. MDC values were calculated by flow cytometry using a Quanta SC MPL (Beckman Coulter Pty, Ltd) equipped with a 100-W stabilised mercury arc lamp with wavelengths of 365, 404, and 435 nm, and a 488-nm diode laser.
[0545] Antimicrobial AssaysGeneral Sample Preparation.
[0546] 150 L of serial 2-fold dilutions of SNAPPs (200-3.12 mg.Math.mL.sup.1) in DMEM were added to a 96-well microplate. A bacterial inoculum in MHB was incubated at 37 C. with orbital shaking (200 rpm) for 2 h to reach exponential growth. After this time, the culture was diluted with DMEM to give final concentration of 2.5.10.sup.6 cells.Math.mL.sup.1, and 150 L of this stock of bacteria were mixed with the SNAPP dilutions in the microplate, to give a final mixture of bacteria and SNAPP (100-1.56 mg.Math.mL.sup.1) of 300 L. A sample of bacteria without SNAPP was prepared likewise as negative antimicrobial control by replacing the SNAPP solution with neat DMEM. This microplate was incubated at 37 C. standing still for 90 min. After this time, the MIC, MDC and MBC experiments described below were performed. The results from all antimicrobial assays described herein were collected from two independent experiments (i.e. biological replicates), and each sample was analysed as five (MIC and MDC) or three (MBC) technical replicates.
[0547] Minimum Inhibitory Concentration (MIC).
[0548] After 90 min of incubation (see Antimicrobial assaysGeneral sample preparation above), 100 L of the SNAPP and bacteria mixtures were diluted with the same volume of MHB in a new microplate. This microplate was incubated at 37 C. with orbital shaking (180 rpm) in a microplate reader, and the optical density at 630 nm (OD.sub.630) of the samples was read every 20 min over 20 h. The OD.sub.630 of the samples at the time point were the control without SNAPP finished exponential growth were normalised to the OD.sub.630 of this control (100% relative growth), plotted against SNAPP concentration and fitted to an exponential regression (
[0549] Minimum Disruptive Concentration (MDC).
[0550] After 90 min of incubation (see Antimicrobial assaysGeneral sample preparation above), 100 L of the SNAPP and bacteria mixtures were diluted with 100 L of PBS containing 0.1% v/v of BacLight dyes: Syto 9 (3.34 mM stock solution) and propidium iodide (50 g.Math.mL.sup.1 stock solution). These samples were incubated for 10 min in the dark at room temperature, to be then analysed by flow cytometry measuring Syto 9 emission at 525 nm (fluorescence channel 1, FL-1) and propidium iodide emission at 670 nm (fluorescence channel 3, FL-3). A sample of bacteria treated for 30 min with 70% v/v ethanol in water, centrifuged and resuspended in DMEM, was analysed likewise as positive control for membrane damage. The MDC was defined as the lowest concentration of SNAPP that caused membrane damage in 99.9% of the bacterial cells, and was determined as the concentration that corresponded to a normalised 99.9% propidium iodide-positive (PI+) cells (
[0551] Minimum Bactericidal Concentration (MBC).
[0552] After 90 min of incubation (see Antimicrobial assaysGeneral sample preparation above), the SNAPP and bacteria mixtures were serially diluted 10-fold four times. 10 L of each dilution were spotted on MHB agar plates and incubated at room temperature and/or 37 C. until individual colonies were visible. Bacterial colonies, or colony forming units (CFUs), were counted at the dilution that allowed to count the most individual colonies without significant overlap between them. The MBC was defined as the lowest concentration of SNAPP that caused a decrease of 99.9% in viable bacterial cells (i.e. CFU.Math.mL.sup.1) as compared to a control sample in the absence of SNAPP (
[0553] MIC Calculation.
[0554] The optical density at 630 nm (OD.sub.630) of bacterial cultures with different concentrations of SNAPPs was recorded every 20 min, and the OD.sub.630 values at the time point were the control sample with 0 g.Math.mL.sup.1 of SNAPP finished exponential growth (e.g. 3 h in
[0555] MDC Calculation.
[0556] The emission of bacteria in the FL-1 and FL-3 channels (see Minimum Disruptive Concentration (MDC) above) was measured by flow cytometry, setting a gate for bacteria with damaged membranes as propidium iodide positive (PI+) events above a FL-3 threshold (
[0557] MBC Calculation.
[0558] The number of colony forming units (CFUs) found in bacterial samples spotted on agar plates (see Minimum Bactericidal Concentration (MBC) above) was corrected for dilution and plotted as CFU/mL against SNAPP concentration (
[0559] Results
[0560]
[0561]
[0562]
[0563]
[0564]
[0565]
[0566]
[0567]
[0568] From
[0569]
Tables
[0570]
TABLE-US-00001 TABLE 1 Antimicrobial Activity of SNAPPs and Other Peptides against a Range of Gram-Negative Pathogens. MBC.sup.a, AM MDR MDR Antimicrobial type Code/Name Media E. coli P. aeruginosa K. pneumoniae A. baumannii P. aerugmosa A. baumannii SNAPP S16 MHB 0.72 0.06 1.42 0.08 1.54 0.08 0.85 0.05 1.38 0.03 1.61 0.23 MEM 0.17 0.01 0.07 0.04 0.19 0.05 0.05.sup.b 0.08.sup.b 0.05 0.01 S32 MHB 0.72 0.54 0.97 0.05 0.83 0.14 0.79 0.02 1.00.sup. 0.85 0.03 MEM 0.05 0.01 0.02 0.08 0.02 0.02.sup.b 0.03 0.01 0.03 0.01 Ovispirin.sup.c MHB 8.39 0.44 95.49 9.73 11.49 4.86 2.21 0.88 Not Tested Not Tested Magainin II.sup.c MHB 47.85 6.08 55.96 2.84 154.59 9.32 19.87 3.24 Not Tested Not Tested Melittin.sup.c MHB 33.71 5.18 29.37 8.24 109.25 20.43 0.91 0.09 Not Tested Not Tested .sup.aMBC is defined as the minimum drug concentration that causes quantitative bacterial cell death (refer to Materials and Methods section, and FIG. 14 and Table 3 for further clarification). All data are expressed as mean and standard deviations of four replicates (n = 4) completed in two independent experiments. .sup.bThe MBC values obtained were identical across all replicates. .sup.cThe amino acid sequences of ovispirin, magainin II and melittin are KNLRRIIRKIIHIIKKYG-COOH, GIGKFLHSAKKFGKAFVGEIMNS-CONH.sub.2, and GIGAVLKVLTTGLPALISWIKRKRQQ-COOH, respectively. Ovispirin and magainin II were synthesized using standard solid-phase peptide synthesis protocols for Fmoc (9-fluorenylmethoxy carbonyl) chemistry and their antimicrobial activities were evaluated as per SNAPPs.
TABLE-US-00002 TABLE 2 Composition, Molecular Weight and Dispersity of the Star Peptide Polymers Peptide Arm Lysine:Valine, M.sub.n M.sub.w Polymer Number a:b.sup.a (kDa).sup.b (kDa).sup.b .sup.b Before S16.sub.z 16 1.83:1 deprotection S32.sub.z 32 1.97:1 After S16 16 1.83:1 43.8 127.9 2.9 deprotection S32 32 1.97:1 74.8 141.1 1.9 .sup.aDetermined by .sub.1H NMR spectroscopic analysis. .sup.bThe number-average (M.sub.n) and weight-average (M.sub.w) molecular weights and the dispersity () values were determined by aqueous GPC using a conventional calibration with PEG standards for the peptide polymers in the deprotected form. The dispersity () values of SNAPPs as indicated by GPC analysis (Table 2) are not necessarily a true reflection of the uniformity of SNAPPs due to potential interactions between the amphiphilic stars with the GPC columns causing tailing. Hence in this case, GPC analysis is not considered as the primary analytical tool but simply served as a routine inspection for SNAPPs. TEM and DLS analysis (FIGS. 11-13) represent most accurately the uniformity of SNAPPs as they provide direct visualization of the nanoparticles in their native form and thus should be used primarily in judging the size distribution of the nanoparticles.
TABLE-US-00003 TABLE 3 Killing Levels of SNAPPs Bacteria Media MBC (M).sup.a % reduction.sup.b S16 E. coli MHB 0.72 0.06 94.1 MEM 0.17 0.01 98.7 P. aeruginosa MHB 1.42 0.08 91.3 MEM 0.07 0.04 99.8 K. pneumoniae MHB 1.54 0.08 95.1 MEM 0.19 0.05 96.7 A. baumannii MHB 0.85 0.05 92.9 MEM 0.05 98.1 MDR P. aeruginosa MHB 1.38 0.03 96.8 MEM 0.08 97.9 MDR A. baumannii MHB 1.61 0.23 95.7 MEM 0.05 0.01 99.5 S32 E. coli MHB 0.72 0.54 94.9 0.1 MEM 0.05 0.01 99.7 P. aeruginosa MHB 0.97 0.05 95.8 0.1 MEM 0.02 98.5 K. pneumoniae MHB 0.83 0.14 99.2 MEM 0.08 0.02 99.4 A. baumannii MHB 0.79 0.02 99.9 MEM 0.02 99.2 MDR P. aeruginosa MHB 1.00 95.9 MEM 0.03 0.01 96.9 MDR A. baumannii MHB 0.85 0.03 96.4 MEM 0.03 0.01 98.3 .sup.aThe MBC listed in this column was determined over two independent experiments with two replicates for each variation in each experiment. .sup.bThe % reduction was calculated by comparing the CFU/mL at x concentration to the CFU/mL of the untreated control at the end of a 90 min incubation.
TABLE-US-00004 TABLE 4 MBCs of SNAPPs against Gram-Positive Pathogens MBC.sup.a (M) SNAPP S. aureus S. mutans S16 4.58 1.13 3.55 1.20 S32 2.23 0.62 1.80 0.14 .sup.aAll data are expressed as mean and standard deviations of four replicates (n = 4) completed in two independent experiments.
TABLE-US-00005 TABLE 5 Antibiogram of MDR P. aeruginosa (FADDI-PA067) Antibiotic Susceptibility.sup.a Aztreonam Resistant Ceftazidime Resistant Ciprofloxacin Sensitive Gentamicin Resistant Piperacillin Resistant Ticarcillin Resistant Tobramycin Resistant Colistin Sulfate Resistant (>110.8 M) .sup.aSusceptibility of the bacteria species towards a particular antibiotic is interpreted based on resistant breakpoints provided by the Clinical and Laboratory Standards Institute.
TABLE-US-00006 TABLE 6. Antibiogram of MDR A. baumannii (FADDI-AB156) Antibiotic MIC (M) Susceptibility.sup.a Amikacin 109.3 Resistant Ampicillin 91.6 Resistant Amoxicillin/Clavulanic Acid 87.6 Resistant Cefazolin 140.8 Resistant Cefepime 133.2 Resistant Cefoxitin 149.7 Resistant Ceftazidime 117.1 Resistant Ceftriaxone 115.4 Resistant Ciprofloxacin 12.1 Resistant Gentamicin 33.5 Resistant Meropenem 41.7 Resistant Nalidixic Acid 137.8 Resistant Nitrofurantoin 2149.8 Resistant Norfloxacin 50.1 Resistant Piperacillin/Tazobactam 247.3 Resistant Ticarcillin/Clavulanic Aid 333.0 Resistant Tobramycin 34.2 Resistant Trimethoprim 55.1 Resistant Trimethoprim/Sulfamethoxazole 1102.2 Resistant Imipenem 213.8 Resistant Colistin Sulfate.sup.b 13.8 Resistant .sup.aSusceptibility of the bacteria species towards a particular antibiotic is interpreted based on resistant breakpoints provided by the Clinical and Laboratory Standards Institute.
TABLE-US-00007 TABLE 7 MICs of PAMAM G2 and G3 dendrimers MIC.sup.a (M) PAMAM E. coli P. aeruginosa K. pneumoniae A. baumannii G2 157.2 78.6 >314.5 >314.5 G3 >148.2 148.2 >148.2 >148.2 .sup.aMIC is defined as the minimum concentration of an antimicrobial agent at which no visible microbial growth is observed. Identical MIC values were obtained across four replicates completed in two independent experiments.
TABLE-US-00008 TABLE 8 Composition, Molecular Weight, and Dispersity of the Linear Random Co-peptide Polymer L Peptide Polymer Lysine:Valine, a:b.sup.a M.sub.n (kDa).sup.b M.sub.n (kDa).sup.c M.sub.w (kDa).sup.b .sup.b L 1.89:1 4.9 7.7 12.7 1.7 .sup.aDetermined from .sup.1H NMR spectroscopic analysis of peptide polymer L. Ratio was the same as before deprotection. .sup.bDetermined from DP.sub.n and the lysine:valine ratio obtained via .sup.1HNMR spectroscopic analysis of peptide polymer L. .sup.cDetermined by aqueous GPC using PEG standards. As mentioned above, the dispersity () values of the peptide polymer L as indicated by GPC analysis (Table 8) are not necessarily a true reflection of the uniformity of L due to potential interactions between the amphiphilic peptide polymer L with the GPC columns causing tailing. Hence in this case, GPC analysis is not considered as the primary analytical tool but simply served as a routine inspection for L. TEM and DLS analysis (FIG. 18) represent most accurately the uniformity of L as they provide direct visualization of the nanoparticles in their native form and thus should be used primarily in judging the size distribution of the nanoparticles.
TABLE-US-00009 TABLE 9 MBCs of Linear Random Co-peptide Polymer L against a Range of Bacteria (in Nutrient-Rich Medium) Bacteria MBC (M) E. coli 29.50 S. aureus 213.37
TABLE-US-00010 TABLE 10 Hemolytic Activity of SNAPPs Antimicrobial type Code/Name Media HC.sub.50.sup.a, M SNAPP S16 MHB 58.3 MEM S32 MHB 45.3 MEM Linear L MHB 674.5 analog AMP Ovispirin MHB 61.8 Magainin II MHB 81.1 Melittin MHB 2.8 .sup.aHC.sub.50 is the peptide concentration that results in 50% hemolysis.
TABLE-US-00011 TABLE 11 Biocompatibility of SNAPPs (as Determined by YO-PRO-1/P1 Apoptosis Assay) HEK293T H4IIE Therapeutic Therapeutic IC50.sup.a MBC.sub.50.sup.b index, IC50.sup.a MBC.sub.50.sup.b index, SNAPP (M) (M) IC.sub.50/MBC.sub.50 (M) (M) IC.sub.50/MBC.sub.50 S16 2.78 0.027 102 1.43 0.027 52 S32 1.71.sup.c 0.010 171 1.39 0.010 139 .sup.a1C.sub.50 is the SNAPP concentration that results in death in 50% of the cell population. .sup.bMBC.sub.50 refers to the SNAPP concentration that results in death in 50% of the bacterial cell population. The MBC.sub.50 values here (rounded to the nearest two significant figures) were against CMDR A. baumannii. .sup.cThe % live cells at the highest concentration tested (i.e., 128 g/mL or 1.71 M) is 54.9 0.3%. All experiments were conducted in minimal essential medium (MEM). The adhered cells were incubated with SNAPPs for 90 minutes, stained with YO-PRO-1 and PI dyes, and analyzed by flow cytometry. Using YO-PRO-1 as an indicator of early apoptosis and PI as a measure of necrosis or cell death, viable cells were determined as cells that are negative for both YO-PRO-1 and PI.
TABLE-US-00012 TABLE 12 MBCs of SNAPP S16 before and after fluorescent labelling against E. coli MBC.sup.a (M) Peptide Polymer MHB MEM S16 0.72 0.06 0.17 0.01 AF488-S16 2.50 0.03 0.39.sup.b .sup.aAll data are expressed as mean and standard deviations of four replicates (n = 4) completed in two independent experiments. .sup.bIdentical results were obtained across all replicates. Although the conjugation of AF488 to SNAPP S16 was found to slightly decrease its potency (3.5 and 2.2 times less effective against E. coli in MHB and MEM, respectively), the interaction mechanism of the fluorescently tagged SNAPP with bacteria was expected to be similar to that before fluorescent tagging.
TABLE-US-00013 TABLE 13 Composition, Molecular Weight and Dispersity of the Star Peptide Polymers Peptide Arm Lysine:Valine, M.sub.n M.sub.w Polymer Number a:b.sup.a (kDa).sup.b (kDa).sup.b .sup.b Before S16.sub.z 16 1.83:1 deprotection S32.sub.z 32 1.97:1 After S16 16 1.83:1 43.8 127.9 2.9 deprotection S32 32 1.97:1 74.8 141.1 1.9 .sup.aDetermined by .sup.1H NMR spectroscopic analysis. .sup.bThe number-average (Mn) and weight-average (Mw) molecular weights and the dispersity () values were determined by aqueous GPC using a conventional calibration with PEG standards for the peptide polymers in the deprotected form. Note: The dispersity () values of SNAPPs as indicated by GPC analysis (in Table 13 above) are not necessarily a true reflection of the uniformity of SNAPPs due to potential interactions between the amphiphilic stars with the GPC columns causing tailing. Hence in this case, GPC analysis is not considered as the primary analytical tool but simply served as a routine inspection for SNAPPs.
TABLE-US-00014 TABLE 14 Composition, Molecular Weight and Dispersity of the Star Polypeptides Lysine:Valine, M.sub.u M.sub.w Star Polypiptide Arm Number a:b.sup.a (kDa).sup.b (kDa).sup.b .sup.b Before SB.sub.16,Z 16 2.45:1 deprotection SB.sub.32,Z 32 2.87:1 SR.sub.16,Z 16 1.83:1 SR.sub.32,Z 32 1.97:1 SH.sub.16,Z 16 SH.sub.32,Z 32 After SH.sub.16 16 2.45:1 11.0 32.1 2.9 deprotection SH.sub.32 32 2.87:1 15.2 44.8 2.9 SR.sub.16 16 1.83:1 43.8 127.9 2.9 SR.sub.= 32 1.97:1 74.8 141.1 1.9 SH.sub.16 16 27.6 40.7 1.5 SH.sub.= 32 56.3 88.7 1.6 .sup.aDetermined by 1H NMR spectroscopic analysis. Ratios were the same before and after deprotection. .sup.bDetermined by aqueous GPC using a conventional calibration with narrow molecular weight PEG standards for the deprotected star polypeptides.
TABLE-US-00015 TABLE 15 MDCs and MBCs of the Star and Linear Polypeptides against E. coli and S. aureus E. coil S. aureus MDC.sup.a MBC.sup.b MIC.sub.c MDC MBC MIC Polypeptide (M) (M) (M) (M) (M) (M) Star Block SB.sub.16 173.3 1.3 10.5 4.7 10.5 5.1 >100 >100 >100 SB.sub.32 6.2 0.1 6.1 1.3 4.9 0.1 >100 >100 >100 Random SR.sub.16 0.8 0.1 0.7 0.1 3.2 0.1 1.0 0.1 4.6 1.1 3.9 0.7 SR.sub.32 0.5 0.1 0.7 0.3 1.1 0.1 1.7 0.3 2.2 0.6 >100 Homo SH.sub.16 3.0 1.0 2.9 0.1 2.4 0.2 5.7 1.6 >100 >100 SH.sub.32 2.0 0.1 0.9 0.4 0.8 0.1 2.9 0.2 >100 >100 Linear Random LR 11.4 2.9 29.5 0.1 >100 92.8 0.1 >100 11.0 0.9 Homo LH 27.5 0.6 13.4 1.6 18.6 0.1 28.5 4.2 44.1 8.5 9.9 0.1 .sup.aMDC is defined as the minimum polymer concentration that causes membrane disruption in all cells. .sup.bMBC is defined as the minimum polymer concentration that causes 100% bacterial cell death. .sup.cMIC is defined as the minimum polymer concentration that causes microbial growth inhibition.
TABLE-US-00016 TABLE 16 Composition, Molecular Weight, and Dispersity of the Linear Polypeptides Polymer Lysine:Valine, a:b.sup.a M.sub.n (kDa).sup.b M.sub.n (kDa).sup.c M.sub.w (kDa).sup.c .sup.c LH NA 1.6 6.2 8.8 1.4 LR 1.89:1 4.9 7.7 12.7 1.6 .sup.aDetermined by 1H NMR for polymers after deprotection. Ratios were the same as before deprotection. .sup.bDetermined based upon DPn obtained via 1H NMR for polymers after deprotection. .sup.cDetermined by aqueous GPC using PEG standards for polymers in the deprotected form.
TABLE-US-00017 TABLE 17 MDCs, MBCs, and MICs of the Polypeptides against S. mutans Bacteria Polypeptide MDC (M) MBC (M) MIC (M) S. mutans SR.sub.16 0.4 0.1 3.6 1.2 3.2 0.3 SR.sub.32 0.3 0.1 1.8 0.1 >100 LR >100 >100 >100
TABLE-US-00018 TABLE 18 Biocompatibility of SR16 and SR32 (Determined by Hemolysis (HC.sub.50) and YO-PRO-1/PI Apoptosis (IC.sub.50) Assays) IC.sub.50.sup.c, g/mL (M) Polypeptide HC.sub.50.sup.a, g/mL (M) HC.sub.50/MBC.sub.50.sup.b (E. coli) HEK293T H4IIE SR.sub.16 2550 (58.3) 161.sup.d 121.8 (2.8) 62.8 (1.4) SR.sub.32 3390 (45.3) 126.sup.d 128.0 (1.7) 103.9 (1.4) .sup.aHC.sub.50 is the peptide concentration which results in 50% hemolysis. Since the hemolytic activites of SR16 and SR32 at the highest concentration tested (1 mg/mL) were below 50%, their HC.sub.50 values were extrapolated from FIG. 59. .sup.bMBC.sub.50 is the peptide concentration which results in 50% bacterial cell death. .sup.cIC.sub.50 is the peptide concentration which results in 50% mammalian cell death.
TABLE-US-00019 TABLE 19 HC.sub.10, HC.sub.50 and HC.sub.50/MBC.sub.50 of Polypeptides Synthesized. HC.sub.50.sup.a/ HC.sub.10, HC.sub.50.sup.a, MBC.sub.50 Polypeptide g/mL (M) g/mL (M) (E. coli) Star Block SB.sub.16 11.1 (1.0) 6110 (555.5) 105 SB.sub.32 33.3 (2.2) 1850 (121.7) 40 Random SR.sub.16 25.4 (0.6) 2550 (58.3) 161 SR.sub.32 17.6 (0.2) 3390 (45.3) 126 Homo SH.sub.16 18.3 (0.7) 3300 (119.6) 82 SH.sub.32 16.9 (0.3) 5330 (94.7) 223 Linear Random LH 22.6 (6.3) 3070 (852.8) 127 Homo LR 27.2 (5.6) 5190 (1059.2) 72 Antimicrobial Ovispirin.sup.b 27 (61.8) 15 Peptide Magainin II.sup.b 33 (81.1) 3 M elitiin.sup.b 1.0 (2.8) 0.2 .sup.aBased upon extrapolation from FIG. 59. .sup.bThe amino acid sequences of ovispirin, magainin
TABLE-US-00020 TABLE 20 IC.sub.50 of Polypeptides using H4IIE Cells (Determined by the YO- PRO-1/PI Apoptosis Assay). Polypeptide IC.sub.50, g/mL, (M) SH.sub.32 92.0 ( 1.6) LH 109.6 (30.4)
TABLE-US-00021 TABLE 21 Therapeutic indices of SR16 and SR32 (where MBC and MBC.sub.50 were determined against E. coli in minimal medium) Therapeutic index, IC.sub.50/MBC.sub.50,MEM Polypeptide MBC.sub.MEM. (M) MBC.sub.50,MEM (M) HEK293T H4IIE SR.sub.16 0.17 0.09 31 16 SR.sub.32 0.05 0.03 57 46
TABLE-US-00022 TABLE 22 Antimicrobial Activity of SNAPPs against a Range of Gram- Negative Pathogens Tested in Different Media MIC.sup.a (M) MBC.sup.b (M) Bacteria SNAPP MEM SBF 10% serum 50% serum MEM E. coli S16 0.17 0.01 3.43 0.05 2.89 0.42 4.09 0.28 0.17 0.01 S32 0.05 0.00 1.68 0.07 0.49 0.01 2.24 0.15 0.05 0.01 P. aeruginosa S16 0.08 0.05 1.64 0.13 1.10 0.41 2.89 0.02 0.07 0.04 S32 0.04 0.01 0.59 0.18 0.48 0.03 0.95 0.20 0.02 0.00 K. pneumomine S16 0.30 0.10 4.68 0.34 >6.00 Not tested 0.19 0.05 S32 0.21 0.01 1.92 0.14 1.95 0.54 Not tested 0.08 0.02 A. baumannii S16 0.13 0.05 0.17 0.01 0.66 0.05 Not tested 0.05 0.00 S32 0.08 0.02 0.10 0.00 0.21 0.00 Not tested 0.02 0.00 .sup.aMIC is defined as the minimum drug concentration that causes quantitative bacterial growth inhibition. .sup.bMBC is defined as the minimum drug concentration that causes quantitative bacterial cell death. All MIC and MBC data are expressed as mean and standard deviations of four replicates (n = 4) completed in two independent experiments.
TABLE-US-00023 TABLE 23 Initial Increase in RFU as a Function of S16 Concentration (Slope of Curve Before Plateau) Incubation Slope (RFU .Math. mL/g) Medium time (min) E. coli A. baaumannii mSBF 5 3443 15794 SBF 5 1104 1955 25 1302 7487 90 991 SBF + 1.5 mg/mL EDTA 5 3000
TABLE-US-00024 TABLE 24 Characterisation of SNAPPs synthesised in Example 9. Arm SNAPP code number Lys/Val.sup.a M.sub.n (kDa).sup.b .sup.b Arm DP D.sub.h (nm).sup.c S4.sub.S 4 2.1 3.3 1.3 5 1.0 0.4 S4.sub.M 4 2.3 8.8 1.3 12 4.4 0.7 S4.sub.L 4 2.5 14.1 1.5 18 5.6 0.7 S4.sub.VL 4 2.8 19.2 1.7 26 6.6 0.5 S8.sub.M 8 2.4 23.4 1.5 15 7.9 1.2 S8.sub.vL 8 2.6 43.4 1.8 29 12.2 0.6 S16.sub.M 16 2.5 41.1 1.7 14 9.4 0.5 Subscript values represent star arm length (S = small, M = medium, L = long, VL = very long). .sup.aDetermined through .sup.1H NMR analysis in D.sub.2O. .sup.bAbsolute number-average molecular weight (M.sub.n) and dispersity index (PDI) determined through SEC light scattering using measured dn/dc values. .sup.cHydrodynamic diameters and standard deviations of SNAPPs determined by DLS. Values represent number distributions in DMEM at concentrations < 1 mg/ml. Values represent an average of 3 sets containing 15 measurements per set.
TABLE-US-00025 TABLE 25 Antimicrobial activities of SNAPPs against E. coli. MIC MDC MBC SNAPP g .Math. mL.sup.1 M g .Math. mL.sup.1 M g .Math. mL.sup.1 M S16.sub.M (29% V) 6.207 0.041 0.151 0.001 5.745 0.030 0.140 0.001 6.25 0.152 S8.sub.M 8.534 0.052 0.365 0.002 7.699 0.058 0.329 0.002 12.5 0.534 S4.sub.M 28.22 0.168 3.207 0.019 27.62 0.094 3.139 0.011 50 5.682 S4.sub.VL 8.737 0.036 0.455 0.002 10.71 0.082 0.558 0.004 12.5 0.651 S4.sub.L 8.896 0.034 0.631 0.002 8.211 0.111 0.582 0.008 12.5 0.887 S4.sub.S >100 >30 >100 >30 >100 >30 S8.sub.VL 5.505 0.038 0.127 0.001 5.557 0.030 0.128 0.001 6.25 0.144 S16.sub.M (43% V) 8.869 0.808 0.240 0.022 7.704 0.098 0.209 0.003 12.5 0.339 S16.sub.M (36% V) 5.331 0.327 0.135 0.008 4.260 0.049 0.108 0.001 6.25 0.158 S16.sub.M (24% V) 6.083 0.037 0.153 0.001 4.885 0.031 0.123 0.001 12.5 0.314 NB: the % V in this table and elsewhere herein relates to the % of total amino acid present in each S16.sub.M molecule that is valine.
TABLE-US-00026 TABLE 26 Antimicrobial activities of SNAPPs against S. aureus. MIC MDC MBC SNAPP g .Math. mL.sup.1 M g .Math. mL.sup.1 M g .Math. mL.sup.1 M S16.sub.M (29% V) 2.937 0.039 0.071 0.001 n/a n/a 3.12 0.076 S8.sub.M 2.269 0.047 0.097 0.002 n/a n/a 3.12 0.133 S4.sub.M 1.756 0.145 0.200 0.016 n/a n/a 1.56 0.177 S4.sub.VL 5.428 0.452 0.283 0.024 n/a n/a 6.25 0.326 S4.sub.L 2.535 0.052 0.180 0.004 n/a n/a 1.56 0.111 S4.sub.S 7.216 0.130 2.187 0.039 n/a n/a 12.5 3.788
TABLE-US-00027 TABLE 27 Antimicrobial activities of SNAPPs against P. aeruginosa. MIC MDC MBC SNAPP g .Math. mL.sup.1 M g .Math. mL.sup.1 M g .Math. mL.sup.1 M S16.sub.M (29% V) 28.53 2.319 0.694 0.056 14.62 0.316 0.356 0.008 >100 >2 S8.sub.M 37.22 3.839 1.591 0.164 15.00 0.949 0.641 0.041 >100 >4 S4.sub.L 33.79 4.435 2.396 0.315 9.246 0.583 0.656 0.041 >100 >7
TABLE-US-00028 TABLE 28 Antimicrobial activities of S16.sub.M (29% V) against other Gram-negative (A. baumanii and K. pneumoniae) and Gram-positive (methicillin resistant S. aureus, or MRSA, and E. faecalis). MIC MDC MBC SNAPP g .Math. mL.sup.1 M g .Math. mL.sup.1 M g .Math. mL.sup.1 M A. baumanii 10.4 0.218 0.253 0.005 6.978 0.248 0.170 0.006 6.25 0.152 K. pneumoniae 100 2.433 50 1.217 100 2.433 MRSA 9.123 0.255 0.222 0.006 n/a n/a 6.25 0.152 E. faecalis 8.746 0.079 0.213 0.002 6.873 0.056 0.167 0.001 6.25 0.152
[0571] It will be understood that the invention disclosed and defined in this specification extends to all alternative combinations of two or more of the individual features mentioned or evident from the text or drawings. All of these different combinations constitute various alternative aspects of the invention.