A NOVEL TUMOR VACCINE AND USES THEREOF

20200121770 ยท 2020-04-23

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention belongs to the field of biological medicine, particularly to a novel tumor vaccine. In order to solve the problem in the art that no technical scheme is available for generating lasting and high-effective anti-tumor immune responses, the present invention provides a tumor vaccine mainly containing a complex as a main active ingredient, wherein the complex is formed by nucleic acid, especially replicable nucleic acid not expressing exogenous gene, and cationic biomaterial. The nucleic acid and the cationic biomaterial in the tumor vaccine according to the present invention have synergistic interactions on direct killing of tumor cells, and induction of the innate immune response and adaptive immune response of body against tumor. In addition, the prepared tumor vaccine has simple drug component and is easy to produce and maintain quality control. The tumor vaccine has a good prospect for application.

    Claims

    1. A tumor vaccine, comprising complex formed by DNA and cationic biomaterial, the DNA has a length of 50-10000 bp, and the cationic biomaterial is at least one of cationic lipid material or cationic polymer.

    2. The tumor vaccine according to claim 1, characterized in that the DNA has a length of 100-6000 bp.

    3. The tumor vaccine according to claim 1, characterized in that the DNA is linear DNA or circular DNA.

    4. The tumor vaccine according to claim 3, characterized in that the linear DNA is mitochondrial DNA or mitochondrial DNA fragment.

    5. The tumor vaccine according to claim 3, characterized in that the circular DNA is plasmid.

    6. The tumor vaccine according to claim 5, characterized in that the plasmid is selected from at least one of pMVA, pMVA-1, pVAX1, pcDNA3.1, pBR322, and pUC18.

    7. The tumor vaccine according to claim 5, characterized in that the plasmid is a replicable plasmid which comprises a replicon, a resistance gene and a plasmid backbone sequence but is unable to express an exogenous gene.

    8. The tumor vaccine according to claim 7, characterized in that the replicable plasmid which comprises a replicon, a resistance gene and a plasmid backbone sequence but is unable to express an exogenous gene is pMVA plasmid, and the nucleotide sequence thereof is expressed as SEQ ID NO.1 or the nucleotide sequence thereof is at least 90% homologous to the sequence expressed as SEQ ID NO.1.

    9. The tumor vaccine according to claim 7, characterized in that the replicable plasmid which comprises a replicon, a resistance gene and a plasmid backbone sequence but is unable to express an exogenous gene is pMVA-1 plasmid, and the nucleotide sequence thereof is expressed as SEQ ID NO.2 or the nucleotide sequence thereof is at least 90% homologous to the sequence expressed as SEQ ID NO.2.

    10. The tumor vaccine according to claim 5, characterized in that the plasmid is loaded with other DNA.

    11. The tumor vaccine according to claim 10, characterized in that the other DNA has a length of 50-3000 bp.

    12. The tumor vaccine according to claim 11, characterized in that the other DNA has a length of 100-2500 bp.

    13. The tumor vaccine according to claim 10, characterized in that the other DNA is mitochondrial DNA or mitochondrial DNA fragment.

    14. The tumor vaccine according to claim 13, characterized in that the mitochondrial DNA fragment is selected from at least one of DNA fragments having the nucleotide sequences expressed as SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.5, or DNA fragments whose nucleotide sequences are at least 90% homologous to the sequences expressed as SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.5.

    15. The tumor vaccine according to claim 10, characterized in that the plasmid is selected from at least one of plasmids having the nucleotide sequences expressed as SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10 or SEQ ID NO.11, or plasmids whose nucleotide sequences are at least 90% homologous to the sequences expressed as SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10 or SEQ ID NO.11.

    16. The tumor vaccine according to claim 1, characterized in that the DNA is oxidized DNA.

    17. The tumor vaccine according to claim 16, characterized in that the oxidized DNA is formed in vitro by irradiation or treatment with oxidizing agents.

    18. The tumor vaccine according to claim 17, characterized in that the irradiation is at least one of irradiation with ultraviolet rays, gamma rays or X-rays; and the oxidizing agent is at least one of oxygen, ozone, F.sub.2, Cl.sub.2, Br.sub.2, nitrate, chlorate, perchlorate, HNO.sub.3, KMnO.sub.4, NaClO, CrO.sub.3, H.sub.2O, PbO.sub.2, NaBiO.sub.3, XeF.sub.2, Ce.sup.4+ or PdCl.sub.2.

    19. The tumor vaccine according to claim 1, characterized in that the cationic lipid material is cationic lipid or complex formed by cationic lipid and helper lipid.

    20. The tumor vaccine according to claim 19, characterized in that the cationic lipid is selected from at least one of 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), N-[1-(2,3-dioleyloxy) propyl]-N,N,N-trimethylammonium chloride (DOTMA), 2,3-dioleyloxy-N-[2(spermine carboxamido)ethyl]-N,N-dimethyl-1-propanaminium trifluoroacetate (DOSPA), dodecyltrimethylammonium bromide (DTAB), tetradecyltrimethylammonium bromide (TTAB), cetyltrimethylammonium bromide (CTAB), and dimethyldioctadecyl ammonium bromide (DDAB).

    21. The tumor vaccine according to claim 19, characterized in that the helper lipid is selected from at least one of phosphatidyl ethanolamine (PE), phosphatidylcholine (PC), cholesterol (Chol), and dioleoyl phosphoethanolamine (DOPE).

    22. The tumor vaccine according to claim 19, characterized in that the mass ratio of the cationic lipid to the helper lipid in the complex formed thereby is 1:0.1 to 1:10.

    23. The tumor vaccine according to claim 1, characterized in that the cationic polymer is selected from at least one of polyethyleneimine, polysaccharide, polyamide-amine PAMAM, and polymer containing an imidazole group.

    24. The tumor vaccine according to claim 23, characterized in that the polyethyleneimine has a molecular weight of 2-30 kD.

    25. The tumor vaccine according to claim 24, characterized in that the polyethyleneimine is PEI 2 kD, PEI 5 kD or PEI 25 kD.

    26. The tumor vaccine according to claim 23, characterized in that the polysaccharide is selected from at least one of chitosan, carboxymethyl chitosan, trimethyl chitosan and e chitosan quaternary ammonium salt.

    27. The tumor vaccine according to claim 26, characterized in that the polysaccharide has a molecular weight of 30-50 kD.

    28. The tumor vaccine according to claim 1, characterized in that the mass ratio of the DNA to the cationic biomaterial in the complex formed thereby is 1:1 to 1:100.

    29. The tumor vaccine according to claim 28, characterized in that the mass ratio of the DNA to the cationic biomaterial is 1:1 to 1:50.

    30. The tumor vaccine according to claim 1, characterized in that the DNA/cationic biomaterial complex has a particle diameter of 1-2,000 nm.

    31. The tumor vaccine according to claim 30, characterized in that the DNA/cationic biomaterial complex has a particle diameter of 50-1000 nm.

    32. The tumor vaccine according to claim 1, characterized in that the DNA/cationic biomaterial complex has a potential of 1-150 mv.

    33. The tumor vaccine according to claim 32, characterized in that the DNA/cationic biomaterial complex has a potential of 5-100 mV.

    34. A pharmaceutical composition, comprising the tumor vaccine according to claim 1 and a pharmaceutically acceptable excipient or auxiliary component.

    35. The pharmaceutical composition according to claim 34, characterized in that the excipient or auxiliary component is at least one of a diluent, an excipient, a filler, a binder, a wetting agent, a disintegrant, an absorption enhancer, a surfactant, a protective agent, an adsorption carrier or a lubricant.

    36. A medical kit, comprising the tumor vaccine according to claim 1, and at least one other drug for treating tumor.

    37. The medical kit according to claim 36, characterized in that the other drug for treating tumor is selected from at least one of a chemotherapeutic drug or an immune response modifier.

    38. The medical kit according to claim 37, characterized in that the immune response modifier is at least one of a cytokine, a class II HLA protein-binding accessory molecule, a CD40 agonist, a checkpoint receptor antagonist, a B7 costimulatory molecule, a FLt3 agonist or a CD40L agonist.

    39. An antitumor drug, comprising the tumor vaccine according to claim 1 and tumor antigen.

    40. The antitumor drug according to claim 39, characterized in that the tumor antigen is selected from at least one of a tumor-associated antigen, an apoptotic tumor cell or a necrotic tumor cell.

    41. A method for manufacturing a drug for treating and/or preventing tumor, comprising the steps of: providing the tumor vaccine of claim 1, adding pharmaceutically acceptable excipient or auxiliary component to the mixture before and/or during and/or after mixing said DNA and cationic biomaterial, thereby preparing the drug for treating and/or preventing tumor.

    42. The method according to claim 41, characterized in that the tumor is selected from cervical cancer, ovarian cancer, breast cancer, lung cancer, nasopharyngeal cancer, gastric cancer, pancreatic cancer, esophageal cancer, colon cancer, rectal cancer, liver cancer, prostate cancer, kidney cancer, bladder cancer, skin cancer, sarcoma or lymphoma.

    43. A method for the preparation of a drug for treating or preventing tumor, comprising the steps of: providing the tumor vaccine of claim 1, providing at least one other drug for treating tumor, adding the tumor vaccine of claim 1, at least one other drug for treating tumor, and a pharmaceutically acceptable excipient or auxiliary component to the mixture before and/or during and/or after mixing said DNA and cationic biomaterial, thereby preparing the drug for treating and/or preventing tumor.

    44. The method according to claim 43, characterized in that the other drug for treating tumor is selected from at least one of a chemotherapeutic drug or an immune response modifier.

    45. The method according to claim 44, characterized in that the immune response modifier is at least one of a cytokine, a class II HLA protein-binding accessory molecule, a CD40 agonist, a checkpoint receptor antagonist, a B7 costimulatory molecule, a FLt3 agonist or a CD40L agonist.

    46. A method for treating tumor, comprising the step of administering a therapeutically effective amount of the tumor vaccine according to claim 1 to a mammal having tumor.

    47. The method according to claim 46, characterized in that the mammal is mouse, dog, monkey or human being.

    48. The method according to claim 46, characterized in that the tumor is selected from cervical cancer, ovarian cancer, breast cancer, lung cancer, nasopharyngeal cancer, gastric cancer, pancreatic cancer, esophageal cancer, colon cancer, rectal cancer, liver cancer, prostate cancer, kidney cancer, bladder cancer, skin cancer, sarcoma, and lymphoma.

    49. A method for preparing the tumor vaccine according to claim 1, comprising the steps of: (1) preparing DNA and cationic biomaterial; and (2) mixing the DNA with the cationic biomaterial in Step (1), and allowing the mixture to stand so as to obtain the tumor vaccine.

    50. A method for preparing the pharmaceutical composition according to claim 34, comprising the steps of: (1) preparing DNA and cationic biomaterial; (2) mixing the DNA with the cationic biomaterial in Step (1), and adding pharmaceutically acceptable excipient or auxiliary component to the mixture before and/or during and/or after mixing of the DNA and the cationic biomaterial so as to prepare the pharmaceutical composition.

    Description

    BRIEF DESCRIPTION OF DRAWINGS

    [0125] FIG. 1 Plasmid vector construction maps:

    [0126] A: pMVA plasmid construction map, including kanamycin resistance genes (No. 205-999 bp), pUC origin sequences (No. 1309-1972 bp) and plasmid skeleton sequences (No. 1-204 bp, No. 1000-1308 bp and No. 1973-1978 bp), totaling 1978 bp (as shown in SEQ ID NO.1).

    [0127] B: pMVA-1 plasmid construction map, including kanamycin resistance genes (No. 205-999 bp), pUC origin sequences (No. 1308-1971 bp) and plasmid skeleton sequences (No. 1-204 bp, No. 1000-1307 bp and No. 1972-1977 bp), totaling 1977 bp (as shown in SEQ ID NO.2).

    [0128] FIG. 2 Results of enzyme digestion of pMVA plasmids by NcoE I enzyme and Eco72 I enzyme verified by agarose gel electrophoresis, wherein the molecular weight of closed loop plasmids (i.e., pMVA-1 plasmids) is consistent with that of plasmid fragments after enzyme digestion by NcoE I enzyme and Eco72 I enzyme, approximately 2000 bp.

    [0129] FIG. 3 Detection diagram of DNA/DOTAP complexes with different mass ratios by agarose gel electrophoresis.

    [0130] FIG. 4 Detection diagram of pMVA-1/DOTAP complexes with different mass ratios inhibiting A549 cell activity in vitro: where, .circle-solid. represents pMVA-1/DOTAP complex with a DOTAP: pMVA-1 mass ratio of 1:1; .square-solid. represents pMVA-1/DOTAP complex with a DOTAP: pMVA-1 mass ratio of 6:1; .box-tangle-solidup. represents pMVA-1/DOTAP complex with a DOTAP:pMVA-1 mass ratio of 10:1; .Math. represents pMVA-1/DOTAP complex with a DOTAP:pMVA-1 mass ratio of 15:1; and .square-solid. represents pMVA-1/DOTAP complex with a DOTAP:pMVA-1 mass ratio of 20:1.

    [0131] FIG. 5 Detection diagram of pMVA1/PEI25D complexes with different mass ratios inhibiting A549 cell activity in vitro: where, .circle-solid. represents pMVA-1/PEI25KD complex with a PEI25KD: pMVA-1 mass ratio of 1:1; .Math. represents pMVA-1/PEI25KD complex with a DOTAP: pMVA-1 mass ratio of 10:1; and .diamond-solid. represents pMVA-1/PEI25KD complex with a DOTAP: pMVA-1 mass ratio of 20:1.

    [0132] FIG. 6 Detection diagram of pMVA1/chitosan complexes with different mass ratios inhibiting A549 cell activity in vitro: where, .circle-solid. represents pMVA-1/chitosan complex with a chitosan: pMVA-1 mass ratio of 1:1; .Math. represents pMVA-1/chitosan complex with a chitosan: pMVA-1 mass ratio of 10:1; and .diamond-solid. represents pMVA-1/chitosan complex with a chitosan: pMVA-1 mass ratio of 20:1.

    [0133] FIG. 7 Fluorescence micrograph of tumor apoptosis co-induced by pMVA-1/DOTAP complexes detected by PI-AnnexinV assay. Where, A: fluorescence micrograph of A549 apoptosis co-induced by pMVA-1/DOTAP complex, B: fluorescence micrograph of CT26 apoptosis co-induced by pMVA-1/DOTAP complex. After treatment with PMVA-1/DOTAP complexes for 24 h respectively, both A549 cells and CT26 cells showed significant PI positive and AnnexinV positive results, while no significant PI positive and AnnexinV positive cells were found in control groups.

    [0134] FIG. 8 Number of apoptotic cells in tumor cells treated with different samples determined by flow cytometry. A: Statistical chart of apoptotic A549 cells in each group determined by flow cytometry. B: Statistical chart of apoptotic CT26 cells in each group determined by flow cytometry. All results were expressed as mean relative expression SD, *p<0.05, involving blank control group (Control), pMVA plasmid control group (PMVA), DOTAP cationic liposome group (DOTAP), and pMVA-1/DOTAP complex treatment group (PMVA-DOTAP).

    [0135] FIG. 9 Statistical chart of ROS level in A549 cells determined by flow cytometry. Wherein, Cont blank control group: only medium was added to A549 cells; PMVA control group: pMVA-1 plasmids were added to A549 cells; DOTAP control group: DOTAP was added to A549 cells; PMVA-DOTAP treatment group: pMVA-1/DOTAP complex was added to A549 cells; NAC negative control group: pretreatment with 5 mM NAC before pMVA-1/DOTAP complex work; H2O2 positive control group: 200 M of H2O2 was added to A549 cells. All results were expressed as mean relative expression SD, *P<0.05.

    [0136] FIG. 10 Effect of ox-pMVA-1/DOTAP complexes formed by oxidized pMVA-1 plasmids and DOTAP cationic lipids on A549 apoptosis. All results were expressed as mean relative expression SD, *P<0.05.

    [0137] FIG. 11 Tumor apoptosis co-inducted by pMVA-1/DOTAP complexes is related to oxidative stress of tumor cells. Flow cytometry is performed to determine the death rate of A549 cells pretreated with NAC before pMVA-1/DOTP complexes were added. All results were expressed as mean relative expression SD, *P<0.05.

    [0138] FIG. 12 Fluorescence micrograph of pMVA-1/DOTAP complexes entering A549 cells and co-inducing loss of lysosomal acidity gradient after the pMVA-1/DOTAP complexes react with A549 cells for 0.5 h and 3 h.

    [0139] FIG. 13 Quantitative determination of changes of Lysotracker red fluorescence intensity in lysosomes of A549 cells exposed to different samples for 1 h, 3 h, 6 h and 9 h respectively by flow cytometry. The percentage of A549 cells with decreased Lysotracker red fluorescence intensity in each group was statistically analyzed. Wherein, blank control group: only medium was added to A549 cells; PMVA control group: pMVA-1 plasmids were added to A549 cells; DOTAP control group: DOTAP was added to A549 cells; PMVA-DOTAP treatment group: pMVA-1/DOTAP complex was added to A549 cells. All results were expressed as mean relative expression SD, *P<0.05.

    [0140] FIG. 14 Fluorogram of increased lysosoma membrane permeabilization of A549 cells co-induced by pMVA-1/DOTAP complexes. A: Increased lysosoma membrane permeabilization of A549 cells determined by FITC-Dextran intracellular localization method; B. release of lysosomal hydrolases of A549 cells into cytoplasm determined by Cathepsin B intracellular localization method. Wherein, blank control group: only medium was added to A549 cells; PMVA control group: pMVA-1 plasmids were added to A549 cells; DOTAP control group: DOTAP was added to A549 cells; PMVA-DOTAP treatment group: pMVA-1/DOTAP complex was added to A549 cells.

    [0141] FIG. 15 Determination of changes of mitochondrial membrane potential of tumor cells by TMRM fluorescence marker method. A: Percentage of A549 cells with mitochondrial membrane potential depolarization determined by flow cytometry; B: percentage of CT26 cells with mitochondrial membrane potential depolarization determined by flow cytometry. Wherein, blank control group: only medium was added to A549 cells; PMVA control group: pMVA-1 plasmids were added to A549 cells; DOTAP control group: DOTAP was added to A549 cells; PMVA-DOTAP treatment group: pMVA-1/DOTAP complex was added to A549 cells. All results were expressed as mean relative expression SD, *P<0.05.

    [0142] FIG. 16 Activation of Caspase protease in A549 cells induced by pMVA-1/DOTAP complexes. All results were expressed as mean relative expression SD, *P<0.05.

    [0143] FIG. 17 Inhibitory effects of stimulation of pMVA-1/DOTAP complexes and tumor cells on antigen uptake of DC cells. FITC-Dextran was model antigen taken up by DC cells. The phagocytic ability of DC cells was judged by determining the FITC mean fluorescence intensity of CD11c positive DC cells, thereby analyzing whether DC was induced to mature. *P<0.05. wherein, Control group (Control): only medium was added to BMDC cells, PMVA group: only pMVA-1 plasmids were added to BMDC cells, DOTAP group: only DOTAP cationic lipids were added to BMDC cells, PMVA-DOTAP group: only pMVA-1/DOTAP complex was added to BMDC cells; Tumor group: CT26 cells were added to BMDC cells, Tumor+PMVA group: CT26 cells treated with pMVA-1 plasmid vector were added to BMDC cells, Tumor+DOTAP group: CT26 cells treated with DOTAP cationic lipid were added to BMDC cells, Tumor+PMVA-DOTAP group: CT26 cells treated with pMVA-1/DOTAP complex were added to BMDC cells.

    [0144] FIG. 18 Statistical analysis of percentage of BMDC cells secreting cytokines after stimulation by CT26 cells determined by flow cytometry. A: percentage of BMDC secreting IFN-; B: percentage of BMDC secreting IL-1. All results were expressed as mean percentage SD, *P<0.05. wherein, control group: only medium was added to BMDC cells, Tumor group: CT26 cells were added to BMDC cells, Tumor+PMVA group: CT26 cells treated with pMVA-1 plasmid vector were added to BMDC cells, Tumor+DOTAP group: CT26 cells treated with DOTAP cationic lipid were added to BMDC cells, Tumor+PMVA-DOTAP group: CT26 cells treated with pMVA-1/DOTAP complex were added to BMDC cells.

    [0145] FIG. 19 pMVA-1/DOTAP complex significantly inhibited tumor growth in nude mouse models with peritoneal metastasis of cervical cancer. A: The weight of nude mice in pMVA-1/DOTAP complex group was significantly lower than that in other treatment groups; B: the amount of ascites in nude mice in pMVA-1/DOTAP complex group was significantly less than that in other groups; C: the number of knots in nude mice in pMVA-1/DOTAP complex group was significantly lower than that in other groups; D: the tumor weight of nude mice in pMVA-1/DOTAP complex group was significantly lower than that of other groups. **p<0.01.

    [0146] FIG. 20. Statistical analysis chart of percentage of apoptotic cells in ascites of nude mouse models with peritoneal metastasis of cervical cancer determined by flow cytometry.

    [0147] FIG. 21 DNA/DOTAP complex inhibited tumor growth in model mice with peritoneal metastasis of ovarian cancer. A: The amount of ascites in mice in DNA/DOTAP complex group was significantly less than that in other groups; B: the tumor weight of mice in DNA/DOTAP complex group was significantly lower than that in other groups; C: the number of cancer cells in ascites of mice in DNA/DOTAP complex group was significantly lower than that in other groups. **p<0.01.

    [0148] FIG. 22 plasmid DNA/DOTAP complex inhibited tumor growth in model mice with peritoneal metastasis of CT26. A: The number of mice that died naturally from the plasmid DNA/DOTAP complex in the treatment group was significantly lower than that in other control groups (P<0.01 or P<0.05); B: the tumor weight of mice in pMVA-3/DOTAP treatment group was significantly lower than that in other groups; C: the amount of ascites in mice in pMVA-3/DOTAP treatment group was significantly less than that in other groups; D: the number of cancer cells in ascites of mice in pMVA-3/DOTAP treatment group was significantly lower than that in other groups; E: the number of tumor nodules in mice in pMVA-3/DOTAP treatment group was significantly lower than that in other groups. **P<0.01, *P<0.05.

    [0149] FIG. 23 pMVA-1/DOTAP complex significantly inhibited the growth of sarcoma in mice. The tumor-free rate of mice in pMVA-1/DOTAP treatment group was 90%, which was significantly higher than 1% of NS group, 20% of DOTAP group and 20% of pMVA-1 group. **P<0.01,

    [0150] FIG. 24 pMVA-1/DOTAP complex significantly inhibited tumor growth in subcutaneous model mice with human nasopharyngeal carcinoma cells. **P<0.01.

    [0151] FIG. 25 pVMA-1/DOTAP complex inhibited tumor growth in model mice with peritoneal metastasis of CT26. A: There was no significant difference in weight of mice between pMVA-1/DOTAP group and normal group. B: The amount of ascites of mice in pMVA-1/DOTAP group was significantly less than that in negative control group, pMVA-1 group and DOTAP group. C: The survival time of mice in pMVA-1/DOTAP group was significantly longer than that in negative control group, pMVA-1 group and DOTAP group. D: The tumor weight of mice in pMVA-1/DOTAP group was significantly lower than that in negative control group, pMVA-1 group and DOTAP group. *p<0.05.

    [0152] FIG. 26 pMVA-1/DOTAP complex can induce the mice to generate systemic anti-tumor memory immune response after treating model mice with peritoneal metastasis of CT26. Under further stimulation of tumor cells, including tumor cells of the same type and different types, the growth of tumor cells can be inhibited through memory T cells and a large amount of immune cytokines secreted by the memory T cells so as to break the immune tolerance of tumors. A: After the mice intraperitoneally inoculated with CT26 cells for the first time and treated with pMVA-1/DOTAP complex were attacked by CT26 cells again (DOTAP+2 subcutaneously inoculated CT26 group), the tumor volume was significantly reduced compared with mice neither intraperitoneally inoculated with CT26 cells nor treated with pMVA-1/DOTAP complex, but attacked by CT26 cells (subcutaneously inoculated CT26 control group). B: After the mice intraperitoneally inoculated with CT26 cells for the first time and treated with pMVA-1/DOTAP complex were attacked by 4T1 cells (DOTAP+2 subcutaneously inoculated 4T1 group), the tumor volume was significantly reduced compared with mice neither intraperitoneally inoculated with CT26 cells nor treated with pMVA-1/DOTAP complex, but attacked by 4T1 cells (subcutaneously inoculated 4T1 control group).

    [0153] FIG. 27. pMVA-1/DOTAP complex in combination with Cisplatin significantly inhibited the growth of tumor cells in mouse models with subcutaneously inoculated U14. *P<0.05. Wherein, NS group: only 10% sucrose was injected, DOTAP group: only DOTAP was injected, pMVA1 group: only pMVA-1 plasmids were injected, Cisplatin: only Cisplatin was injected, LP group: pMVA-1/DOTAP complex, LP+Cisplatin group: pMVA-1/DOTAP complex in combination with Cisplatin.

    [0154] FIG. 28 pMVA-1/DOTAP complex in combination with radiotherapy significantly inhibited the growth of tumor cells in mouse models with subcutaneous U14. *P<0.05.

    [0155] FIG. 29 pVAX1/DOTAP complex was used as an adjuvant and mixed with apoptotic or necrotic CT26 cells to prepare a tumor cell vaccine, which significantly prolonged the survival time of tumor-bearing mice and had good anti-tumor effects. Wherein, NS: normal saline group; NECRO: necrotic tumor cell vaccine group prepared by pVAX1/DOTAP complex mixed with necrotic CT26 cells; APOP: apoptotic cell vaccine group prepared by pVAX1/DOTAP complex mixed with apoptotic CT26 cells.

    INTERPRETATION OF TECHNICAL TERMS

    [0156] 1. Mitochondrial DNA (mtDNA): closed-loop double-stranded DNA molecules with about thousands of copies in a single cell. An mtDNA contains 37 genes, encoding 13 respiratory chain polypeptides, 22 tRNAs and 2 rRNAs, and a non-coding region D-loop containing gene replication and transcription regulatory sequences.

    [0157] 2. Lysosoma membrane permeabilization (LMP):

    [0158] Although how lysosoma membrane permeabilization occurs is still controversial, LMP inducers include ROS, lipids and nanoparticles.

    [0159] (1) ROS:

    [0160] Under high-level oxidative stress, lysosome cannot degrade hydrogen peroxide due to absence of catalase or glutathione peroxidase, and a large amount of hydrogen peroxide is dispersed on lysosome membrane, which induces abundant divalent iron ions in the lysosome to catalyze hydrogen peroxide into hydroxyl radicals, thus triggering LMP.

    [0161] (2) Lipids:

    [0162] As some lipids and lipid metabolites are lysosomal, LMP can be induced.

    [0163] (3) Nanoparticles: Nanoparticles can aggregate in lysosome, destroy lysosome membrane, and induce apoptosis through LMP pathway.

    [0164] 3. Cell Death

    [0165] In normal tissues, normal cell death occurs frequently, which is necessary to maintain tissue functions and morphology. The ways of cell death usually involve necrosis, apoptosis and programmed cell death (PCD).

    [0166] Apoptosis is the most common and well-known form of PCD, which is generally performed by activated caspases, an intracellular cysteine protease. Therefore, apoptosis can be divided into caspases-dependent and caspases-independent in terms of the initiation mechanism. Typical morphological changes of apoptotic cells include chromatin condensation, nuclear fragmentation, DNA laddering, blebbing and cytoplasmic fragmentation (apoptosis bodies). Cell membrane is not destroyed during apoptosis. Degraded cell components are encapsulated to form apoptotic bodies which are finally removed by phagocytes or lysosomes of neighboring cells through heterophagocytosis. Therefore, there is no inflammatory response around dead cells during apoptosis.

    [0167] Necrosis is a phenomenon in which cells are affected by chemical factors (e.g., strong acid, strong alkali and toxic substances), physical factors (e.g., heat and radiation) and biological factors (e.g., pathogens), resulting in cell death. Morphological changes of necrotic cells are mainly caused by two pathological processes: enzymatic digestion and protein denaturation. In the early phase of necrosis, mitochondria and endoplasmic reticulum in cytoplasm swell and disintegrate, structural lipid droplets become free and vacuolated, protein particles increase, and nuclei shrink or break. With the denaturation, coagulation or fragmentation of intracellular proteins and the degradation of basophilic nucleoprotein, the cytoplasm is strongly eosinophilic. Subsequently, necrotic cells dissolve, resulting in complete disappearance of cellular structure. Finally, cell membranes and organelles rupture, DNA degrades and cell contents flow out, resulting in inflammatory responses of surrounding tissues. Residual fragments of necrotic cells can be phagocytized by macrophages or induce activation and maturation of DC cells.

    [0168] 4. Sting Signaling Pathway

    [0169] STING (stimulator of IFN genes), also known as ERIS/MYPS/MITA, is a multifunctional adaptor protein encoded by TMEM173 genes. STING signaling pathway (cGAS-23cGAMP-STING-TBK1-IRF3) is a key pathway for immune system to recognize cytoplasmic double-stranded DNA from abnormal sources and develop innate immunity. STING signaling pathway plays a key role in the body's spontaneous anti-tumor immune responses and radiotherapy-induced anti-tumor immune responses. Tumor-derived double-stranded DNA can also be ingested by DC in tumor microenvironment, activating cGAS to further catalyze ATP and GTP to synthesize 23cGAMP that combines with STING to change the conformation of STING protein; the activated STING recruits TBK1, IKK, T3K1 and IKK to interact with STING and then are phosphorylated. The phosphorylated TBK1 recruits IRF3, the phosphorylated IKK recruits NF-, then IRF3 and NF- enter nuclei as important transcription factors after phosphorylated to regulate the expression of downstream genes and promote the secretion of type I interferon and Th1 cytokines (e.g., INF-). Meanwhile, the activation of STING signaling pathway can promote the maturation and activation of APC (e.g., CD8.sup.+/CD103.sup.+DC), promote APC to present tumor-associated antigens, and initiate CD8.sup.+T cell specific anti-tumor immune responses.

    [0170] 5. Innate immunity: also known as nonspecific immunity, refers to an innate immune defense function gradually formed in the process of phylogenesis and evolution, which forms the body's first line of defense against invasion of pathogens. Innate immunity can be inherited stably with extensive immunization but no specificity. An innate immune system can develop immune effects upon first contact with antigens, but has no immune memory.

    [0171] For example, innate immune system is activated by the stimulation of microorganisms and products thereof. Toll-like receptors (TLRs) in immune cells such as macrophages, DC cells and neutrophils can recognize pathogen associated molecular pattern (PAMP) unique to the microorganisms, activate excitatory innate immunity response, secrete inflammatory cytokines (e.g., IL-12), and mediate inflammatory response.

    [0172] Pattern-recognition receptor (PRR) expressed by innate immune cells is activated by recognizing different PAMAs and expresses different cytokines, thus inducing naive T cells to differentiate into different T cells and determining the type of adaptive immune responses. Therefore, innate immune responses can regulate or affect the type and intensity of adaptive immune responses, and the maintenance of adaptive immune responses and the play of its effect must also be assisted and participated in by innate immunity.

    [0173] 6. CpG motif: also known as immunostimulatory sequences (ISS), refers to a type of sequences with non-methylated cytosine-phosphate-guanine (CpG) as the core. As a natural ligand of TLR9, the CpG motif is a powerful non-specific immunostimulatory DNA sequence that can activate a variety of immune cells. DNA containing CpG motifs can be endocytosed by innate immune cells and recognized by intracellular TLR9, activating MyD88, TRAF6 and downstream NF-kB and MAPK pathways, resulting in a variety of transcription factors, and inducing the expression of Th1-type cytokines such as TNF-, IL-6, IL-12 and IFN-, thus promoting the differentiation of naive T cells into Th1 cells. IFN- secreted by the Th1 cells further induces the activation of NK cells and macrophages, and promotes the division, proliferation and antibody production of B lymphocytes, thus comprehensively enhancing the cellular immunity and humoral immunity of hosts.

    [0174] mtDNA in eukaryocytes is derived from the circular genomes of bacteria and also contains a large amount of unmethylated CpG motifs, which can act as PAMP on PRRs. In the case of mitochondrial dysfunction such as oxidative stress, a large amount of reactive oxygen species (ROS) are produced. mtDNA is released from mitochondria into cytoplasm as a stimulus to activate TLR9 signaling pathway, and induce neutrophil P38 MAPK pathway to produce inflammatory cytokines (e.g., IL-12) and chemokines, thus triggering adaptive immune responses, inducing naive T cells to differentiate into Th1 cells, and releasing a large amount of IFN-.

    [0175] 7. Adaptive immune response: also known as specific immune response, refers to a process in which specific T and B cells in vivo are activated, proliferated and differentiated into effector cells after being stimulated by antigens to induce a series of biological effects. The adaptive immune response is characterized by specificity, memory and tolerance.

    [0176] The first phase of adaptive immune response is antigen recognition. After being ingested, processed and treated by antigen-presenting cells, antigen forms MHC complex with MHC molecules on antigen presenting cells and is specifically recognized by naive T cell or naive B cell surface receptors (TCR or BCR). Antigen-presenting cells include DC cells, macrophages and neutrophils.

    [0177] The second phase is a proliferation and differentiation phase of naive T cells or naive B cells. T/B cells specifically recognize antigens and generate a first signal for activation. The T/B cells interact with a variety of adhesion molecules on surfaces of antigen-presenting cells to provide a second signal (i.e., a co-stimulatory signal) for activation of T cells or B cells. As a third signal, multiple lymphokines produced by activated antigen-presenting cells and T cells participate in lymphocyte proliferation and differentiation through autocrine and paracrine actions, and eventually form effector T cells or plasmocytes. The most important function of effector T cells is to kill infected cells through CD8.sup.+ cytotoxic T cells (CTL) and activate macrophages through Th1 cells, which make up cellular immunity together. In addition, B cells are activated by Th2 cells to produce different types of antibodies, thereby activating humoral immune responses.

    [0178] The third phase is an effector phase in which immune effector cells and effector molecules (cytokines and antibodies) work together to remove non-autoantigens and keep the body in a normal physiological state.

    [0179] 8. Memory immune response: Immune memory is an important feature of adaptive immunity, that is, the body will present a secondary response with increased response speed and intensity when exposed to the antigen resulting in sensitization for the first time again. The key to immune memory is the formation and maintenance of memory lymphocytes. Induction of protective immune memory responses includes humoral immune responses mediated by memory B lymphocytes and cellular immune responses mediated by memory T lymphocytes.

    [0180] Antigen stimulation determines the number of antigen-specific CD8+T cells produced in a primary response. About 5% of antigen-specific CD8+T cells are transformed into memory CD8+T cells. Memory T cells (Tm) can rapidly mature into effector memory T cells (T.sub.EM) after being stimulated by the antigen again, and produce a large amount of IFN-, IL-4 and IL-5 in the early phase.

    [0181] Compared with naive T cells stimulated by antigen for the first time, the memory T cells have the following advantages: (1) when exposed to the same antigen again, the memory T cells can present stronger proliferation ability, cytokine secretion ability and CTL activity. (2) The reactivation of memory T cells by the same antigen requires a lower threshold than the primary response. (3) It is generally believed that the maintenance of memory CD8+T cells does not need continuous stimulation of the antigen and has self-renewal capability. (4) Reactivated memory T cells can release a large number of cytokines such as IFN-, IL-4 and IL-5, thus promoting T cells to kill tumors. (5) Memory T cells can produce effector cells with rapid and strong immune responses without homing to secondary lymphoid organs.

    [0182] 9. DNA/Cationic Lipid Materials:

    [0183] The cationic lipids of the invention have positive charges on surfaces thereof and are easy to form DNA/cationic lipid materials by electrostatic interaction with negatively charged DNA. Generally, positive charges on the surfaces of the formed DNA/cationic lipid materials are adsorbed to negatively charged cell surfaces by electrostatic interaction, and DNA is transferred into cells through fusion with cell membranes or endocytosis to form inclusion bodies or enter lysosomes. Under the action of the cationic lipids, anionic lipids on cell membranes lose original balance due to destabilization of membranes and diffuse into complexes, forming neutral ion pairs with cations in the cationic lipids, so that DNA originally bound with liposomes can dissociate out and enter cytoplasm.

    [0184] 10. Plasmids

    [0185] Plasmids in the art generally refer to original circular DNA molecules that can replicate autonomously by attaching to non-cellular chromosomes or nucleus regions in cells.

    [0186] It should be noted that the invention reconstructs a type of replicable circular DNA molecules that cannot express exogenous genes, which belong to a type of new plasmids. The plasmids constructed by the invention can enter tumor cells after forming complexes with cationic biomaterials. As a result, ROS in the tumor cells increases obviously, so that plasmids in the plasmid/cationic biomaterial complexes can be oxidized by ROS to form oxidized DNA, allowing lysosomes in the tumor cells to rupture, which can directly mediate tumor cell necrosis on one hand, and activate anti-tumor immune responses on the other hand. In addition, the plasmids in the plasmid/cationic biomaterial complexes constructed by the invention can also oxidize DNA in advance by various reported means in vitro, and then enter the bodies to enhance the anti-tumor effects.

    [0187] 11. DNA Oxidation and Oxidative Damages

    [0188] DNA is often stimulated by various factors in vivo and vitro, such as physicochemical factors, including rays, strong oxidants, strong acids and strong bases as well as endogenous ROS, which will lead to oxidation of DNA under the attack of free radicals. Oxidation often causes oxidative damages to DNA, such as DNA double strand breaks (DSBs), DNA single strand breaks, excision or substitution of bases or base pairs.

    DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS

    [0189] Technical schemes of the invention will be further illustrated below in conjunction with preferred embodiments. It should be noted that some common molecular biology manipulations and common procedures for preparing pharmaceutical preparations in the invention can be completed by a person skilled in the art on the basis of reading the specification of the invention in combination with existing textbooks, manuals and instructions for use of related equipments and reagents in the art.

    [0190] The invention will be further described in detail below in combination with examples and drawings, but embodiments of the invention are not limited thereto.

    Example 1 Construction and Expression of pMVA and pMVA-1 Plasmids

    [0191] (1) Construction and Expression of pMVA Plasmid

    [0192] A 1978 bp nucleotide sequence, including a pUC origin sequence and kanamycin genes as well as two plasmid skeleton sequences was synthesized by total gene synthesis, which was ligated and cyclized into a pMVA plasmid having a nucleotide sequence as shown in SEQ ID NO.1. The structure of the pMVA plasmid was shown in FIG. 1A.

    [0193] Agarose gel electrophoresis was performed for enzyme digestion verification, with experimental results as shown in FIG. 2.

    [0194] The constructed pMVA plasmid was expressed in Escherichia coli DH5a.

    [0195] (2) Construction and Expression of pMVA-1 Plasmid

    [0196] The constructed pMVA plasmid was subjected to base site-directed mutagenesis or deletion to obtain a pMVA-1 plasmid having 1977 bp in total. Mutation sites included bases 2, 3, 4, 41 and 1950 of the nucleotide sequence shown in SEQ ID NO. 1, and deletion site was base 1075 of the nucleotide sequence shown in SEQ ID NO. 1. The nucleotide sequence of the pMVA-1 plasmid vector was shown in SEQ ID NO. 2. The structure of the pMVA-1 plasmid was shown in FIG. 1B.

    [0197] The constructed pMVA-1 plasmid was expressed in Escherichia coli DH5a, and the yield was significantly better than that of the pMVA plasmid.

    Example 2 Screening of Mitochondrial DNA (mtDNA) Target Sequence

    [0198] 50-3000 bp mtDNA was selected, including mtDNA as shown in SEQ ID NO. 3, 4 and 5. mtDNA or mtDNA fragment was rich in CpG motifs, thus it could be used as an agonist of TLR9 pathway or STING pathway. When tumor cells were under oxidative stress, the selected mtDNA target sequence could effectively activate the body's anti-tumor innate immunity response.

    Example 3 Construction and Expression of Plasmid

    [0199] (1) Construction and Amplification of pMVA-2 Plasmid

    [0200] An mtDNA nucleotide sequence 1 as shown in SEQ ID NO. 3 screened in Example 2 and a linear sequence before cyclization of the pMVA in Example 1 were genetically synthesized, and then ligated and cyclized into a pMVA-2 plasmid having 2098 bp in total. The nucleotide sequence of the pMVA-2 plasmid was shown in SEQ ID NO. 6, wherein the nucleotide sequence at sites 33 to 152 was shown in SEQ ID NO. 3.

    [0201] The constructed pMVA-2 plasmid was amplified in Escherichia coli DH5a.

    [0202] (2) Construction and Amplification of pMVA-3 Plasmid

    [0203] An mtDNA nucleotide sequence 2 as shown in SEQ ID NO. 4 screened in Example 2 and a linear sequence before cyclization of the pMVA in Example 1 were genetically synthesized, and then ligated and cyclized into a pMVA-3 plasmid having 2578 bp in total. The nucleotide sequence of the pMVA-3 plasmid was shown in SEQ ID NO. 7, wherein the nucleotide sequence at sites 33 to 632 was shown in SEQ ID NO. 4.

    [0204] The constructed pMVA-3 plasmid was amplified in Escherichia coli DH5a.

    [0205] (3) Construction and Amplification of pMVA-4 Plasmid

    [0206] An mtDNA nucleotide sequence 3 as shown in SEQ ID NO. 5 screened in Example 2 and a linear sequence before cyclization of the pMVA in Example 1 were genetically synthesized, and then ligated and cyclized into a pMVA-4 plasmid having 3978 bp in total. The nucleotide sequence of the pMVA-4 plasmid was shown in SEQ ID NO. 8, wherein the nucleotide sequence at sites 33 to 2032 was shown in SEQ ID NO. 5.

    [0207] The constructed pMVA-4 plasmid was amplified in Escherichia coli DH5a.

    [0208] (4) Construction and Amplification of pMVA-5 Plasmid

    [0209] A nucleotide sequence 1 of the mtDNA fragment shown in SEQ ID NO. 3 screened in Example 2 and a linear sequence before cyclization of the pMVA-1 in Example 1 were genetically synthesized, and then ligated and cyclized into a pMVA-5 plasmid. The nucleotide sequence of the pMVA-5 plasmid was shown in SEQ ID NO. 9, wherein the nucleotide sequence at sites 33 to 152 was an inserted nucleotide sequence shown in SEQ ID NO. 3.

    [0210] The constructed pMVA-5 plasmid was amplified in Escherichia coli DH5a.

    [0211] (5) Construction and Amplification of pMVA-6 Plasmid

    [0212] A nucleotide sequence 2 of the mtDNA fragment shown in SEQ ID NO. 4 screened in Example 2 and a linear sequence before cyclization of the pMVA-1 were genetically synthesized, and then ligated and cyclized into a pMVA-6 plasmid. The nucleotide sequence of the pMVA-6 plasmid was shown in SEQ ID NO. 10, wherein the nucleotide sequence at sites 33 to 632 was an inserted nucleotide sequence shown in SEQ ID NO. 4.

    [0213] The constructed pMVA-6 plasmid was amplified in Escherichia coli DH5a.

    [0214] (6) Construction and Amplification of pMVA-7 Plasmid

    [0215] A nucleotide sequence 3 of the mtDNA fragment shown in SEQ ID NO. 5 screened in Example 2 and a linear sequence before cyclization of the pMVA-1 in Example 1 were genetically synthesized, and then ligated and cyclized into a pMVA-7 plasmid. The nucleotide sequence of the pMVA-7 plasmid was shown in SEQ ID NO. 11, wherein the nucleotide sequence at sites 33 to 2032 was an inserted nucleotide sequence shown in SEQ ID NO. 5.

    [0216] The constructed pMVA-7 plasmid was amplified in Escherichia coli DH5a.

    Example 4 Preparation of Cationic Biomaterial

    [0217] 1. Preparation Method of Cationic Lipid Material (DOTAP/CHOL Complex or DOTAP)

    [0218] (1) As shown in Table 1, weighed heat-free DOTAP and heat-free cholesterol (CHOL) were mixed, then 1-1.5L of anhydrous ethanol solution was added to obtain a mixed solution which was heated to 50 C. to completely dissolve lipid under stirring.

    [0219] (2) The mixed solution from Step (1) was subject to rotary evaporation at 40 C., 0.08 MPa to of the volume of the solution, and then diluted with water to a constant volume.

    [0220] (3) The solution obtained in Step (2) was homogenized in a high pressure homogenizer at a pressure of 700-800 bar for 3-10 times and extruded from an 50 C. extruder (100 nm film) for 1-2 times to obtain a cationic lipid material (DOTAP/CHOL complex or DOTAP) with a particle diameter of 100-150 nm and PDI<0.3.

    TABLE-US-00001 TABLE 1 DOTAP and CHOL compounded by different mass ratios Lipid Mass DOTAP CHOL ratio (g) (g) 1:0 1 0 .sup.1:5.2 2 10.4 1.8:1.sup. 9.655 5.345 2:1 10 5 2.26:1 10.4 4.6

    [0221] 2. Preparation Method of PEI Polymer

    [0222] PEI 25 kD was prepared with distilled water into 6 mg/mL, 4 mg/mL and 0.4 mg/mL solutions.

    [0223] 3. Preparation Method of Chitosan

    [0224] Medium molecular weight chitosan was dissolved in a dilute acid to prepare 6 mg/mL, 4 mg/mL and 0.4 mg/mL solutions.

    Example 5 Preparation of DNA/Cationic Biomaterial Complexes

    [0225] The screened mtDNA or fragments thereof and the constructed plasmid vector or plasmid were aseptically mixed with the cationic biomaterial prepared in Example 4 respectively in equal volume at different concentrations shown in Tables 2-4 to obtain mixed solutions, then the solutions were allowed to stand for 0.5 h to form DNA/cationic biomaterial complexes.

    TABLE-US-00002 TABLE 2 DNA/cationic lipid materials with different mass ratios Concentration Mass DNA DOTAP DOTAP/CHOL ratio (mg/ml) (mg/ml) (mg/ml) 1:1 0.4 0.4 0.4 1:6 0.4 2.4 2.4 1:10 0.4 4 4 1:15 0.4 6 6 1:20 0.3 6 6

    TABLE-US-00003 TABLE 3 DNA/PEI 25 kD complexes with different mass ratios Concentration Mass DNA PEI 25 kD ratio (mg/ml) (mg/ml) 1:1 0.4 0.4 1:10 0.4 4 1:20 0.3 6

    TABLE-US-00004 TABLE 4 DNA/chitosan complexes with different mass ratios Concentration Mass DNA Chitosan ratio (mg/ml) (mg/ml) 1:1 0.4 0.4 1:10 0.4 4 1:20 0.3 6

    Example 6 Characterization of DNA/Cationic Biomaterial Complexes

    [0226] 1. Determination of Particle Size and Potential of DNA/Cationic Biomaterial Complexes:

    [0227] (1) Preparation of DNA/Cationic Biomaterial Complex Samples:

    [0228] Sterile distilled water was added to the DNA/cationic biomaterial complexes with different mass ratios prepared in Example 5 to dissolve the complexes under high speed oscillation to obtain mixed solutions which were allowed to stand at room temperature.

    [0229] (2) Determination of Particle Size and Potential of DNA/Cationic Biomaterial Complexes

    [0230] The DNA/cationic biomaterial complex samples prepared in Step (1) were added to sample dishes of a Malverl Zetasizer Nano ZS, then the sample dishes were put into a test cell to test 3 groups of data in parallel for each sample, with the equilibrium time set at 1 min, thus obtaining the mean particle size and Zeta potential of the complex samples. The test results were shown in Tables 5-7.

    TABLE-US-00005 TABLE 5 Particle size and potential of DNA/cationic lipid materials with different mass ratios Mass ratio Particle size Zeta potential (DNA:cationic lipid) (nm) PdI (mV) 1:1 122 0.215 14.6 1:6 149.1 0.193 23.3 1:10 140.7 0.228 23.0 1:15 134.0 0.238 25.2 1:20 124.1 0.236 23.4

    TABLE-US-00006 TABLE 6 Particle size and potential of DNA/PEI 25 kD complexes with different mass ratios Mass ratio Particle size Zeta potential (DNA:PEI25 kD) (nm) (mV) 1:1 50.9 19.4 1:10 60.27 25.3 1:20 74.47 34.7

    TABLE-US-00007 TABLE 7 Particle size and potential of DNA/chitosan complexes with different mass ratios Mass ratio Particle size Zeta potential (DNA:chitosan) (nm) (mV) 1:1 135.4 26.4 1:10 163 28.3 1:20 236.6 51.4

    Example 7 Determination of DNA/Cationic Lipid Material Complexes with Different Mass Ratios by Agarose Gel Electrophoresis

    [0231] (1) Preparation of 1% agarose gel: agarose was weighed and placed in a conical flask, then 1TAE was added, and the agarose was heated and boiled in a microwave oven until the agarose was completely melted, then DNA dye Golden View was added, and the conical flask was shaken well to prepare a 1.0% agarose gel solution.

    [0232] (2) Preparation of gel slab: after a gel slab is prepared, the agarose gel prepared in Step (1) was cooled to 65 C. and poured on a glass plate in an inner groove to form a uniform gel layer which was allowed to stand at room temperature until the gel is completely coagulated, and the gel and the inner groove were put into an electrophoresis tank. Then 1TAE electrophoresis buffer was added until it was 1-2 mm above the gel slab.

    [0233] (3) Sample loading: DNA/DOTAP complex samples with DOTAP: DNA mass ratios of 1:1, 6:1, 10:1, 15:1 and 20:1 were mixed with a loading buffer respectively and then added to gel pores prepared in Step (2).

    [0234] (4) Electrophoresis: after sample loading, the gel slab was electrified immediately for electrophoresis. When bromophenol blue moved to a position about 1 cm from the lower edge of the gel slab, electrophoresis was stopped.

    [0235] (5) A gel imaging system was used for photographing and preservation.

    [0236] As shown in FIG. 3, the determination of DNA/cationic lipid material complexes with different mass ratios by agarose gel electrophoresis showed that DNA could be effectively retained under the action of agarose gel electrophoresis when DOTAP:DNA mass ratios of DNA/DOTAP complexes were 1:1, 6:1, 10:1, 15:1 and 20:1 respectively.

    Example 8 Determination of Activity of A549 Cells Treated with pMVA-1/DOTAP Complexes by CCK8 Method

    [0237] (1) Cell Plate Culture

    [0238] A549 cells in logarithmic growth phase were prepared into a cell suspension which was diluted to 510.sup.4 cells/ml with 10% FBS-1640 to obtain a diluent, then the diluent was inoculated to a 96-well cell culture plate at a ratio of 100l/well, and incubated in 5% CO.sub.2 at 37.0 C. for 24 h. After cell attachment, the cells were starved in a serum-free 1640 medium for 24 h.

    [0239] (2) Preparation of Samples to be Tested

    [0240] The pMVA-1/DOTAP complexes prepared by mixing at different mass ratios (with DOTAP:pMVA-1 mass ratios of 1:1, 6:1, 10:1, 15:1 and 20:1 respectively) were diluted with a 1640 medium to 200 g/ml, and then diluted by 3, with a total of 9 dilution gradients, to prepare test samples with different DOTAP concentrations.

    [0241] (3) Sample Loading

    [0242] The 1640 medium in the 96-well plate was absorbed, then the test samples in Step (2) and control samples were added, with 3 parallel gradients for each gradient, 9 gradients in total. The last row was used as cell blank control and blank control. The samples were incubated in 5% CO2 at 37.0 C. for 48 h.

    [0243] (4) Determination of Cell Activities by CCK-8

    [0244] CCK-8 and 1640 medium were mixed at a ratio of 1:1, then added to the 96-well plate in Step (3) at a ratio of 20 l/well, and incubated in 5% CO2 at 37.0 C. for 2 h to read OD450 nm absorbance by a microplate reader.

    [0245] (5) Data Analysis

    [0246] The absorbance determined in Step (4) and the concentration gradients of samples to be tested were fitted into a 4-parameter curve which was a horizontal S curve, and inhibitory concentration (IC50) was calculated according to the fitted curve.

    [0247] As shown in FIG. 4, the pMVA-1/DOTAP complexes with different mass ratios inhibited the activities of A549 tumor cells in vitro, which showed that the pMVA-1/DOTAP complexes with DOTAP:pMVA-1 mass ratios of 1:1, 6:1, 10:1, 15:1 and 20:1 respectively could effectively inhibit the growth activities of A549 cells.

    Example 9 Determination of Bioactivities of pMVA-1/PEI 25 kD Complexes by A549 Cells

    [0248] (1) Cell Plate Culture

    [0249] The method was the same as that in Example 8.

    [0250] (2) Preparation of Samples to be Tested

    [0251] The complexes prepared by mixing at different mass ratios (with PEI 25 kD:pMVA-1 mass ratio and chitosan:pMVA-1 mass ratio of 1:1, 10:1 and 20:1 respectively) were diluted with a 1640 medium to 200 g/ml, and then diluted by 3, with a total of 9 dilution gradients, to prepare test samples with different PEI 25 kD concentrations.

    [0252] (3) Sample Loading

    [0253] The method was the same as that in Example 8.

    [0254] (4) Determination of Cell Activities by CCK-8

    [0255] The method was the same as that in Example 8.

    [0256] (5) Data Analysis

    [0257] The method was the same as that in Example 8.

    [0258] As shown in FIG. 5, the pMVA-1/PEI 25 kD complexes with different mass ratios inhibited the activities of A549 tumor cells in vitro, which showed that the pMVA-1/PEI 25 kD complexes with DOTAP:pMVA-1 mass ratios of 1:1, 10:1 and 20:1 respectively could effectively inhibit the growth activities of A549 cells.

    [0259] The DNA/PEI complexes were prepared into a tumor vaccine and applied to the treatment of tumor-bearing mice, which could effectively induce anti-tumor immune responses of the tumor-bearing mice and inhibit the growth of tumor cells.

    Example 10 Determination of Bioactivities of pMVA-1/Chitosan Complexes by A549 Cells

    [0260] (1) Cell Plate Culture

    [0261] The method was the same as that in Example 8.

    [0262] (2) Preparation of Samples to be Tested

    [0263] Test samples with different chitosan concentrations were prepared respectively by the same method as that in Example 9.

    [0264] (3) Sample Loading

    [0265] The method was the same as that in Example 8.

    [0266] (4) Determination of Cell Activities by CCK-8

    [0267] The method was the same as that in Example 8.

    [0268] (5) Data Analysis

    [0269] The method was the same as that in Example 8.

    [0270] As shown in FIG. 6, the pMVA-1/chitosan complexes with different mass ratios inhibited the activities of A549 tumor cells in vitro, which showed that the pMVA-1/chitosan complexes with DOTAP:pMVA-1 mass ratios of 1:1, 10:1 and 20:1 respectively could effectively inhibit the growth activities of A549 cells.

    [0271] The DNA/chitosan complexes were prepared into a tumor vaccine and applied to the treatment of tumor-bearing mice, which could effectively induce anti-tumor immune responses of the tumor-bearing mice and inhibit the growth of tumor cells.

    Example 11 Experiment of pMVA-1/DOTAP Complex Synergistically Inducing Tumor Cell Death

    [0272] 1. A549 Cell Death Test by PI-AnnexinV

    [0273] (1) Inoculation of A549 Cells in Plates:

    [0274] A549 cells in the logarithmic growth phase were prepared into single cell suspension, inoculated into a 6-well plate as per approximately 110.sup.5 cells per well. Then, 2 ml of medium was added to each well and cultured in a 5% CO.sub.2 incubator at 37 C. for 24-36 h.

    [0275] (2) Preparation of Spiked Sample: [0276] a. 5 mg/ml of pMVA-1 plasmid vector solution was added to 100 l of 1640 serum-free medium for preparing a pMVA-1 plasmid vector control group; [0277] b. 1 mg/ml of DOTAP cationic lipid was dissolved in 100 l of 1640 serum-free medium for preparing a DOTAP cationic lipid control group; [0278] c. the pMVA-1/DOTAP complex with a mass ratio of 1:6 prepared in Example 5 was dissolved in 100 l of 1640 serum-free medium for preparing a pMVA-1/DOTAP complex experimental group.

    [0279] (3) Treatment of A549 Cells with Spiked Sample:

    [0280] Some of the medium was pipetted from the 6-well plate in Step (1) until the medium in each well reached 900 l. The pMVA-1/DOTAP complex (pMVA-DOTAP) (prepared in Step (2) ) of the experimental group as well as the pMVA-1 plasmid vector (PMVA) and DOTAP cationic lipid (DOTAP) of the control group was added to A549 cells cultured in Step (1) respectively to make the total volume of 1 ml. At the same time, a blank control group containing only medium was made, and incubated in a 5% of CO.sub.2 incubator at 37 C. for 24 h.

    [0281] (4) PI-Annexin V Staining Marker

    [0282] A549 cells treated with different samples in Step (3) were washed twice with PBS, and 500 L of binding buffer from the apoptosis kit (Annexin V-PI assay kit, made by BD Biosciences) was added to each well, 10 l of PI and 10 l of Annexin V were added for staining, and then incubated at room temperature for 15 min in the dark.

    [0283] (5) Observation under fluorescence microscope:

    [0284] The cells stained with PI and Annexin V in Step (4) were washed once with PBS and observed under a fluorescence microscope. Then images were saved.

    [0285] (6) Test results of A549 cell death by PI-AnnexinV:

    [0286] As shown in FIG. 7A, a large number of PI-positive and AnnexinV-positive cells existed after A549 cells were treated with the pMVA-1/DOTAP complex for 24 h, while the pMVA-1 plasmid vector group and DOTAP cationic lipid group (both were control groups) did not indicate obvious PI uptake and AnnexinV-labeled positive cells. The experimental results show that the pMVA-1/DOTAP complex can synergistically induce the death of A549 cells. 2. CT26 cell death test by PI-AnnexinV [0287] (1) Experimental method: same as 1. [0288] (2) Test results of CT26 cell death by PI-AnnexinV:

    [0289] As shown in FIG. 7B, a large number of PI-positive and AnnexinV-positive cells existed after CT26 cells were treated with the pMVA-1/DOTAP complex for 24 h, while the pMVA-1 plasmid vector group and DOTAP cationic lipid group (both were control groups) did not indicate obvious PI uptake and obvious AnnexinV-labeled positive cells. The experimental results show that the pMVA-1/DOTAP complex can synergistically induce the death of CT26 cells.

    [0290] 3 A549 Cell Death Test by Flow Cytometry

    [0291] (1) Inoculation of A549 Cells in Plates:

    [0292] The method was the same as that in 1(1).

    [0293] (2) Preparation of Spiked Sample:

    [0294] The method was the same as that in 1(2), wherein, the concentration of DOTAP cationic lipid was 4 g/ml, 8 g/ml, 16 g/ml and 32 g/ml respectively, and the concentration of the pMVA-1/DOTAP complex was expressed by that of DOTAP cationic lipid.

    [0295] (3) Treatment of A549 Cells with Spiked Sample:

    [0296] The method was the same as that in 1(3).

    [0297] (4) Quantitative Test of A549 Cell Death by Flow Cytometry [0298] a. A549 cells treated by different samples in the Step (3) were washed twice with cold PBS, and resuspended with 1 binding buffer for preparing a cell suspension with a density of 110.sup.6 cells/ml; [0299] b. 100 l of A549 cell suspension prepared in Step a was pipetted into the flow test tube; [0300] c. 5 l of FITC Annexin V and 5 l of PI were added to the flow test tube in Step b, mixed gently, and incubated at room temperature for 15 min in the dark; [0301] d. 400 l of 1 binding buffer was added to the flow test tube in Step c and tested by flow cytometry;

    [0302] (5) Quantitative Test Results of A549 Cell Death by Flow Cytometry:

    [0303] Compared with the blank control group to which only medium was added, Annexin-V single positive cells, PI single positive cells and PI/Annexin-V double positive cells from A549 cells did not increase significantly in the pMVA-1 plasmid vector group (PMVA) and DOTAP cationic lipid group (DOTAP) (both were control groups). However, the PI uptake and Annexin-V increased significantly in the experimental group, i.e. the pMVA-1/DOTA complex group (pMVA/DOTA), compared with the blank control group and the control group, and the percentage of dead cells increased with the increase of concentration of the pMVA-1/DOTAP complex, indicating a significant dose-dependent relationship. As shown in FIG. 8A, when the concentration of pMVA-1/DOTAP complex was 4 g/ml, 8 g/ml, 16 g/ml and 32 g/ml, the percentage of total dead cells (including necrotic cells and apoptotic cells) was 1.68%, 21.63%, 57.22% and 65.37%, respectively.

    [0304] 4 CT26 Cell Death Test by Flow Cytometry

    [0305] (1) Experimental method: same as 3, wherein the concentration of DOTAP cationic lipid was 2 g/ml, 4 g/ml, 8 g/ml and 16 g/ml respectively, and the concentration of the pMVA-1/DOTAP complex was expressed by that of DOTAP cationic lipid.

    [0306] (2) Test results of CT26 cell death by flow cytometry:

    [0307] As shown in FIG. 8B, it was observed that experimental result of CT26 cells was similar to that of A549 cells, i.e., the pMVA-1/DOTAP complex could synergistically induce the death of tumor cells.

    [0308] The experimental results show that neither pMVA-1 plasmid nor DOTAP cationic lipid can cause apoptosis or necrosis of tumor cells when they act on tumor cells separately, but when the pMVA-1/DOTAP complex formed by pMVA-1 plasmid and DOTAP cationic lipid acts on tumor cells, it can induce the death of tumor cells, and the process of apoptosis or necrosis is different from the rapid death of tumor cells caused by DOTAP cationic lipid alone in the absence of serum, which is a slow death process.

    Example 12 ROS Level Increase in Tumor Cells Synergistically Induced by pMVA-1/DOTAP Complex Detected by H2DCF-DA Fluorescence Molecular Probe Method

    [0309] (1) Sample loading: A549 cells were treated with the medium (blank control group), pMVA-1 plasmid (control group PMVA), DOTAP cationic lipid (control group DOTAP) and pMVA-1/DOTAP complex (experimental group PMVA-DOTAP) for 3 h respectively. Then, a negative control group (NAC) was made for pretreatment with 5 mM NAC before the action of pMVA-1/DOTAP complex, and a positive control group (H.sub.2O.sub.2) was made by adding 200 M of H.sub.2O.sub.2 to A549 cells. [0310] (2) A549 cells of different groups in the Step (1) were collected and washed with sterile PBS, centrifuged and resuspended with sterile PBS; [0311] (3) 10M CM-H2DCFDA fluorescent probe (made by Sigma) was added to the resuspended cells prepared in Step (2), incubated at 37 C. for 0.5 h, washed with PBS and resuspended; [0312] (4) The resuspended cells in Step (3) were tested with flow cytometry (Novocyte), and the test results were analyzed by Novoexpress software. [0313] (5) Experimental results:

    [0314] As shown in FIG. 9, compared with the blank control group, the PMVA control group and the DOTAP group, the intracellular ROS level of A549 cells treated with pMVA-1/DOTAP complex increased significantly (*P<0.05); however, when A549 cells were pretreated with 5 mM NAC before they were treated with the pMVA-1/DOTAP complex, the negative control group indicated that the intracellular ROS level decreased significantly; and the positive control group indicated that the ROS level in cells treated with 200 M H.sub.2O.sub.2 increased significantly (*P<0.05).

    [0315] Thus, the pMVA-1/DOTAP complex can synergistically induce a significant increase of ROS level in A549 cells.

    Example 13 Mechanism Study on pMVA-1/DOTAP Complex Synergistically Inducing ROS Increase of Tumor Cells

    [0316] Example 12 proves that the pMVA-1/DOTAP complex can synergistically induce the increase of ROS level in A549 cells. In order to investigate the effect of plasmid oxidation of the pMVA-1/DOTAP complex on tumor cell death, the pMVA-1 plasmid was oxidized by 1000 mJ/cm2 UV irradiation, and then formed a complex with DOTAP cationic lipid to act on A549 cells. As shown in FIG. 10, when A549 cells were treated with the ox-PMVA-1/DOTAP complex for 24 h, the number of A549 cell deaths increased significantly compared with the pMVA-1/DOTAP complex group.

    [0317] The experimental results show that the destruction of the pMVA-1/DOTAP complex on tumor cells is related to the oxidative stress of the pMVA-1 plasmid in tumor cells.

    Example 14 Synergistic Induction of Tumor Cell Death by the pMVA-1/DOTAP Complex is Related to Oxidative Stress of Tumor Cells

    [0318] Example 12 proves that N-Acetyl-L-cysteine (NAC), as an antioxidant, can effectively inhibit the increase of ROS level in tumor cells induced by the pMVA-1/DOTAP complex. In order to further verify whether the synergistic induction of tumor cell death by the pMVA-1/DOTAP complex is related to oxidative stress of tumor cells, the flow cytometry was used to test the death ratio of A549 cells pretreated with NAC before adding pMVA-1/DOTP complex in Example 12. As shown in FIG. 11, A549 cells are pretreated with NAC before they are treated with the pMVA-1/DOTP complex, the death ratio can be significantly reduced, which further proves that the synergistic induction of tumor cell death by the pMVA-1/DOTAP complex is related to the occurrence of oxidative stress in tumor cells.

    Example 15 MVA-1/DOTAP Complex Synergically Induces Lysosomal Rupture of Tumor Cells

    [0319] 1 Test of pMVA-1/DOTAP Complex Entering A549 Cells by YOYO1 Fluorescence Probe Method

    [0320] (1) YOYO1 Dye (Made by Life Technologies) Fluorescently Labeled pMVA-1 Plasmid: [0321] a. Preparation of YOYO1 working fluid: the YOYO1 stock solution was diluted with 1640 serum-free medium at the volume ratio of 1:200; [0322] b. The pMVA-1 plasmid was added to the YOYO1 working fluid prepared in the Step (1) according to a volume ratio of 1:40, and incubated at 37 C. for 1 h.

    [0323] (2) Treatment of A549 Cells with YOYO1 Fluorescent Labeled pMVA-1/DOTAP Complex: [0324] a. The YOYO1 fluorescent labeled pMVA-1 plasmid prepared in Step 1 was mixed with the DOTAP cationic lipid to form a complex; [0325] b. The YOYO1 fluorescently labeled pMVA-1/DOTAP complex prepared in Step a was added to A549 cells, followed by making two control groups i.e. YOYO1 fluorescently labeled pMVA-1 plasmid group (PMVA) and DOTAP cationic lipid group (DOTAP), and blank control group containing cell culture fluid only.

    [0326] 2 Test of Loss of Lysosomal Acidity Gradient Synergistically Induced by the pMVA-1/DOTAP Complex in A549 Cells Based on Lysotracker Red Fluorescence Probe Method

    [0327] (1) Preparation of Lysotracher Red working fluid: the Lysotracher Red stock solution was added to the cell culture fluid at a volume ratio of 1:20000 and incubated at 37 C.

    [0328] (2) Lysotracker Red (made by Beyotime) fluorescently labeled lysosomes in A549 cells: [0329] a. The A549 cell culture fluid in Step 1 was removed, the Lysotracker Red staining working fluid prepared in Step (1) was added to the cells, and incubated at 37 C. for 1 h; [0330] b. the Lysotracker Red staining working fluid in Step a was removed, and fresh cell culture fluid was added to observe and collect fluorescence cell images under a fluorescence microscope at 0.5 h and 3 h respectively; [0331] c. A549 cells in Step b were collected and the number of fluorescent cells were quantitatively tested by flow cytometry.

    [0332] 3 Test of Increased Lysosomal Membrane Permeability of A549 Cells Synergistically Induced by pMVA-1/DOTAP Complex Based on FITC-Dextran Cell Localization Method

    [0333] (1) Inoculation of A549 cells in plates: A549 cells in the logarithmic growth phase were prepared into a cell suspension, inoculated into a 6-well plate as per approximately 110.sup.5 cells/well. Then, 2 ml of medium was added to each well, and cultured overnight in a 5% CO.sub.2 incubator at 37 C.

    [0334] (2) FITC-Dextran (made by Sigma) with a final concentration of 1 mg/ml was added to the cell medium in Step (1), and incubated at 37 C. for 4 h in the dark.

    [0335] (3) The cells in Step (2) were washed twice with sterile PBS, 1640 medium was added, thus allowing A549 cells to be treated with the medium (blank control group), pMVA-1 plasmid (control group PMVA), DOTAP cationic lipid (control group DOTAP) and pMVA-1/DOTAP complex (experimental group PMVA-DOTAP) respectively, and incubated at 37 C. for 3 h in the dark.

    [0336] (4) The cells in Step (3) were washed twice with PBS, stabilized with 4% paraformaldehyde for 10 min, washed twice with PBS, sealed. Fluorecytes were observed under a confocal microscope and the images were saved.

    [0337] 4 Test of Increased Lysosomal Membrane Permeability of A549 Cells Synergistically Induced by pMVA-1/DOTAP Complex Based on CathepsinB Intracellular Localization Method

    [0338] (1) Inoculation of A549 cells in plates: round sterilized cell slides were placed at the bottom of a 6-well plate, inoculated A549 cells into the 6-well plate as per 110.sup.5 cells/well, 2 ml of medium was added to each well, and incubated overnight.

    [0339] (2) The medium (blank control group), pMVA-1 plasmid (control group PMVA), DOTAP cationic lipid (control group DOTAP) and pMVA-1/DOTAP complex (experimental group PMVA-DOTAP) were added to A549 cells cultured in the Step (1), and incubated at 37 C. for 3 h.

    [0340] (3) A549 cells treated by different groups in Step (2) were washed twice with PBS, stabilized with ice methanol for 3 min, washed twice with PBS, and sealed with PBST containing 0.3% Triton of 5% FBS for 20 min.

    [0341] (4) The cells in Step (3) were washed once with PBS, and the human CathepsinB antibody (made by Abcam) was diluted at a ratio of 1:300. Incubating at room temperature for 1 h, washing with PBS three times for 5 minutes each time, adding 1:1000 fluorescent secondary antibody, and incubating at room temperature for 1 h in the dark.

    [0342] (5) The cells in Step (4) were washed with PBS for three times, the films were washed with ultrapure water to remove excess water, and sealed with anti-fluorescence quencher, then cured for 6 h. Fluorescent cells were observed under a confocal microscope and the images were saved.

    [0343] 5 Experimental Results of Lysosomal Rupture of Tumor Cells Synergistically Induced by pMVA-1/DOTAP Complex;

    [0344] (1) pMVA-1/DOTAP Complex Enters A549 Cells and Synergistically Induces Loss of Lysosomal Acidity Gradient in Cells

    [0345] A549 cells were treated with the complex formed by YOYO1 fluorescence probe labeled pMVA-1 plasmid and DOTAP cationic lipid, which could be used as the tracer of pMVA-1/DOTAP complex. Then, lysosomes of A549 cells were labeled with Lysotracker Red, and fluorescence cell images were collected under a fluorescence microscope at 0.5 h and 3 h respectively. As shown in FIG. 12, A549 cells in the blank control group had high Lysotracker Red fluorescence intensity. However, after treated with the pMVA-1/DOTAP complex for 0.5 h, A549 cells began to show YOYO1 labeled pMVA-1 plasmid at the cell membrane and cytoplasmic edge, and lysosomal Lysotracker Red fluorescence intensity slightly decreased. When these cells were treated with the pMVA-1/DOTAP complex for 3 h, large quantities of YOYO1 labeled pMVA-1 plasmid entered the cytoplasm, and the fluorescence intensity of Lysotracker Red in lysosomes decreased significantly, indicating that the pMVA-1/DOTAP complex entered A549 cells and induced acidity gradient changes in lysosomes.

    [0346] (2) Quantitative Test of Lysotracker Red Fluorescence Intensity in Lysosomes of A549 Cells in Different Groups Based on Flow Cytometry

    [0347] As shown in FIG. 13, Lysotracker Red fluorescence intensity did not change significantly after the cells of the blank control group, the pMVA-1 plasmid group and DOTAP cationic lipid group were treated for 1 h, 3 h, 6 h and 9 h respectively. In the pMVA-1/DOTAP complex group, Lysotracker Red fluorescence intensity of 18.49% A549 cells decreased 1 h after treatment, and that of 76.18% A549 cells decreased 3 h after treatment.

    [0348] The experimental results show that the pMVA-1/DOTAP complex can enter tumor cells and synergistically induce the imbalance of lysosomal acidity gradient in tumor cells; moreover, as the cells are treated with the complex over time, the loss degree of lysosomal acidity gradient gradually increases and lysosomes is gradually dissolved. Loss of lysosomal acidity gradient in tumor cells occurs 1 h after the complex takes effect, and reaches the maximum when the cells were treated with the complex for 3 h.

    [0349] (3) Experimental Results of Lysosomal Membrane Permeability Changes in A549 Cells Tested by FITC-Dextran Cell Localization Method

    [0350] FITC-Dextran is a 20 kD dextran that can enter lysosomes through endocytosis. A549 cells are exposed to 1 mg/ml of FITC-Dextran for 3 h and treated with different groups of samples, and the fluorescent cells were observed under a confocal microscope. As shown in FIG. 14A, FITC-Dextran of the cytoplasm of A549 cells was distributed in dots in the blank control group (control), pMVA-1 plasmid group (PMVA) and DOTAP cationic lipid group (DOTAP); and FITC-Dextran was distributed dispersedly in the pMVA-1/DOTAP complex group (PMVA-DOTAP), indicating increased lysosomal membrane permeability (LMP).

    [0351] (4) Experimental Results of CathepsinB Released from Lysosomes Due to Changes in Lysosomal Membrane Permeability of A549 Cells Based on CathepsinB Intracellular Localization Method

    [0352] If the lysosomal membrane permeability changes, hydrolase in lysosomes will transfer to cell cytoplasm. Therefore, in order to further prove the increase of lysosomal membrane permeability, Cathepsin B in lysosomes was immunofluorescence stained and traced. As shown in FIG. 14B, Cathepsin B in the cytoplasm of A549 cells was distributed in dots in the blank control group and control groups pMVA-1 plasmid group (PMVA) and DOTAP cationic lipid group (DOTAP), while Cathepsin B in cytoplasm and nucleus was distributed dispersedly in the pMVA-1/DOTAP complex group (PMVA-DOTAP), indicating that the pMVA-1/DOTAP complex can synergistically induce the increased lysosomal membrane permeability of A549 cells and release lysosomal hydrolase into cytoplasm.

    [0353] The experimental results show that after entering the tumor cells, the pMVA-1/DOTAP complex can synergistically induce the increase of lysosomal membrane permeability of cells, promote lysosomal rupture, and release hydrolase in lysosomes into cytoplasm.

    Example 16 MVA-1/DOTAP Complex Synergically Induces the Decrease of Mitochondrial Membrane Potential in Tumor Cells

    [0354] (1) Inoculation of tumor cells in plates: A549 cells and CT26 cells in the logarithmic growth phase were prepared into a cell suspension respectively, inoculated into a 6-well plate as per 110.sup.5 cells/well, 2 ml of medium was added to each well, and cultured overnight in a 5% CO.sub.2 incubator at 37 C.

    [0355] (2) Different samples added to act on tumor cells: the pMVA-1 plasmid, the DOTAP cationic lipid and the pMVA-1/DOTAP complex were added to the tumor cells cultured in Step (1) respectively, and incubated at 37 C. for 15 h, 18 h, 21 h and 24 h.

    [0356] (3) Preparation of TMRM dyeing working fluid (made by Life Technologies): the TMRM mother liquor was diluted with PBS at a ratio of 1:100000 to obtain the TMRM dyeing working fluid.

    [0357] (4) Discarding the cell culture fluid in Step (2), the preheated TMRM staining working fluid prepared in Step (3) was added along the wall of the hole plate, and incubated at 37 C. for 20 min in the dark.

    [0358] (5) The tumor cells in Step (4) were collected and treated with different samples for different times, and the tumor cells with mitochondrial membrane potential changes were analyzed by flow cytometry.

    [0359] As a potentiometric fluorescence probe, tetramethylrhodamine methyl ester (TMRM) entered the cells and was cleaved by cell lactonase to produce tetramethylrhodamine, indicating strong fluorescence after they had entered mitochondria. When the mitochondrial membrane channel pores were open, tetramethylrhodamine was released from mitochondria into cytoplasm, and its fluorescence intensity was also significantly reduced. Therefore, the open state of mitochondrial membrane channel pores can be verified by testing the changes of fluorescence intensity in mitochondria of tumor cells.

    [0360] As shown in FIG. 15A, 31.73%, 41.80%, 51.76% and 55.03% of the A549 cells treated with the pMVA-1/DOTAP complex showed a decrease in mitochondrial membrane potential at 15 h, 18 h, 21 h, 24 h respectively; whereas, the mitochondrial membrane potential of A549 cells in the blank control group as well as the control groups (pMVA-1 plasmid group and DOTAP cationic lipid group) did not change significantly. As shown in FIG. 15B, 15.95%, 35.85%, 50.18% and 52.18% of the CT26 cells treated with the pMVA-1/DOTAP complex showed a decrease in mitochondrial membrane potential at 15 h, 18 h, 21 h and 24 h respectively; whereas, the mitochondrial membrane potential of CT26 cells in blank control group and control group did not change significantly.

    [0361] The experimental results show that the pMVA-1/DOTAP complex can cause depolarization of mitochondrial membrane potential of tumor cells after it synergistically induces lysosomal rupture of tumor cells, thereby opening the mitochondrial membrane channel pores, significantly changing mitochondrial permeability, and releasing mitochondrial contents into cytoplasm.

    Example 17 MVA-1/DOTAP Complex Induces Caspase Protease Activation in Tumor Cells

    [0362] (1) Inoculation of A549 cells in plates: A549 cells in the logarithmic growth phase were prepared into a cell suspension, inoculated into a 6-well plate as per 110.sup.5 cells/well, 2 ml of medium was added to each well, and cultured overnight in a 5% CO2 incubator at 37 C.

    [0363] (2) Sample loading: the pMVA-1/DOTAP complex was added to A549 cells cultured in Step (1) for 12 h and 24 h, and a blank control group was made.

    [0364] (3) Preparation of test sample: pipetting the cell culture fluid obtained in Step (2), collecting A549 cells obtained in Step (2), and suspending the pipetted cell culture fluid. Collecting cells by centrifugation at 600 g and at 4 C. for 5 min, extracting the supernatant, washing the cells once with PBS and extracting the supernatant again, adding lysate, resuspending and precipitation, and lysing in an ice bath for 15 min. Then, transferring the supernatant to a centrifuge tube precooled by an ice bath.

    [0365] (4) Taking a small amount of sample described in Step (3) and measuring the protein concentration by Bradford method.

    [0366] (5) Detection of Caspase 3, caspase8 and caspase9 enzyme activities in the test sample prepared in Step (3) above:

    [0367] a. Taking out a proper amount of substrate and placing on an ice bath for later use.

    [0368] b. Creating the reaction system as shown in Table 8:

    TABLE-US-00008 TABLE 8 Reaction system for Caspase activity assay Blank control Sample Test buffer 40 l 40 l Test sample 0 l 50 l Lysate 50 l 0 l Ac-DEVD-pNA (2 mM)/ 10 l 10 l Ac-IETD-pNA (2 mM)/ Ac-LEHD-pNA (2 mM) Bulk volume 100 l 100 l

    [0369] c. The substrate in Step a was added to the reaction system in Step b, mixed uniformly, incubated at 37 C. for 60-120 min, so as to determine A405 in case of obvious color development.

    [0370] d. The absorbance of pNA catalyzed by Caspase3, Caspase8 and Caspase9 in the sample was obtained by subtracting A405 of the blank control from A405 of the sample. The amount of pNA generated by catalysis in the sample was calculated by comparing the standard curves.

    [0371] e. The protein concentration of the test sample was tested according to Bradford method in Step (3), and the enzyme activity unit of caspase contained in the protein per unit weight of the sample was calculated.

    [0372] Cysteine-requiring Aspartate Protease (Caspase) is a protease family that plays an important role in the process of cell apoptosis. As shown in FIG. 16, compared with the blank control group, Caspase3, Caspase8 and Caspase9 all increased significantly and they were time-dependent after the cells had been treated with the pMVA-1/DOTAP complex for 12 h and 24 h.

    Example 18 MVA-1/DOTAP Complex Synergically Induces Anti-Tumor Innate Immune Response

    [0373] (1) Separation and Culture of Bone Marrow-Derived Dendritic Cells (BMDC) from Mouse Bone Marrow Precursor Cells

    [0374] a. Bone marrow cells were obtained from the femur and tibia of mouse, sieved and collected in a centrifuge tube, centrifuged at 280 g and at room temperature for 5 min, and the supernatant was discarded.

    [0375] b. 10 ml of red cell lysate was added to the cells described in Step a, standing for 3 min at room temperature, centrifuged at 280 g and at room temperature for 5 min, and the supernatant was discarded.

    [0376] c. The bone marrow cells described in Step b were washed twice with PRMI-1640 medium, centrifuged at 280 g and at room temperature for 10 min, live cell count was carried out, the cell concentration was adjusted to 110.sup.6 cells/ml by RPMI-1640 complete medium.

    [0377] d. In Step c, the recombinant mouse GM-CS with a final concentration of 10 ng/ml was added and 4 ml/well cell suspension was inoculated into a 6-well plate, and cultured in a 37 C., 5% CO.sub.2 incubator. When cell colonies grew on the bottom of the plate, the medium was pipetted, washed once with the medium, and 1640 complete medium containing 10 ng/ml of GM-CSF was added to each well.

    [0378] e. The cells separated in Step d, namely BMDC were collected, centrifuged at 280 g and at room temperature for 5 min, the supernatant was discarded, the cells were suspended in 1640 complete culture containing 10 ng/ml of GM-CSF, and the cells were inoculated into a 6 well plate as per 110.sup.6 cells/ml for use.

    [0379] (2) FITC-Dextran Uptake Test by BMDC Based on Flow Cytometry

    [0380] a. The BMDC cultured in Step 1 were collected and treated with the medium, pMVA-1 plasmid, DOTAP cationic lipid and pMVA-1/DOTAP complex for 24 h respectively. CT26 cell stimulation DC group (including CT26 cells, CT26 cells treated with pMVA-1 plasmid, CT26 cells treated with DOTAP cationic lipid, CT26 cells treated with pMVA-1/DOTAP complex) was made and incubated for 24 h.

    [0381] b. Cells described in Step a were laid into a 24-well plate as per 110.sup.6 cells/ml per well, FITC-Dextran with a final concentration of 1 mg/ml was added and incubated at 37 C. for 1 h.

    [0382] c. The cells described in Step b were washed once with PBS, anti-CD11b-PE and anti-CD11c-Percp5.5 were added for staining the cells. The cells were washed with PBS, resuspended, and kept at 4 C. in the dark for test.

    [0383] d. Test and analysis of fluorescence intensity of BMDC based on flow cytometry.

    [0384] (3) Test of Cytokines Secreted by BMDC Based on Flow Cytometry

    [0385] a. The BMDC cultured in Step 1 to the 6.sup.th day were collected. The medium, CT26 cells, CT26 cells treated with pMVA-1 plasmid for 3 h, CT26 cells treated with DOTAP lipid for 3 h and CT26 cells treated with pMVA-1/DOTAP complex for 3 h were added and incubated for 24 h.

    [0386] b. The cells described in Step a were collected and washed once with PBS. The anti-CD11b-PE and anti-CD11c-Percp5.5 antibodies were added to the flow tube and incubated at 4 C. for 30 min in the dark.

    [0387] c. The BMDC in Step b was washed twice with PBS, the indirectly labeled intercellular cytokine antibody was stained, 1 l of antibody was added to each tube, and incubated overnight at 4 C.

    [0388] d. The stained and incubated BMDC in Step c was washed twice with PBS, the indirectly labeled fluorescent secondary antibody and directly labeled antibody were stained, incubated at room temperature for 30 min in the dark and washed twice with PBS, the secretion of IFN- and IL-1 of BMDC was tested and analyzed by flow cytometry.

    [0389] DC maturation is positively correlated with the decreased antigen uptake capacity. So, whether DC is induced to mature can be judged by testing its antigen uptake capacity. DC's antigen uptake ability is judged by taking FITC-Dextran as the model antigen of DC phagocytosis, and testing the FITC average fluorescence intensity of CD11c positive DC. As shown in FIG. 17, DC treated only with pMVA-1 plasmid or DOTAP cationic lipid have similar FITC average fluorescence intensity values to that of the blank control group. For DC treated with the pMVA-1/DOTAP complex, DC stimulated by CT26 cells, and DC stimulated by CT26 cells which had been treated with pMVA-1 plasmid, DOTAP cationic lipid and pMVA-1/DOTAP complex respectively, the FITC average fluorescence intensity decreased significantly. The experimental results show that stimulation of the pMVA-1/DOTAP complex and tumor cells can inhibit the antigen uptake of DC and promote the maturation of DC.

    [0390] FIG. 18 provides the experimental results about whether CT26 cells treated with the pMVA-1/DOTAP complex can stimulate BMDC cultured in vitro to secrete cytokines. Based on the comparison of blank control group, pMVA-1 plasmid group and DOTAP cationic lipid group, the secretion of IFN-(3 and IL-10 significantly increased after BMDC was stimulated by CT26 cells treated with the pMVA-1/DOTAP complex. The experimental results show that tumor cells treated with the pMVA-1/DOTAP complex can effectively activate the STING pathway and induce DC to secrete cytokines that kill tumor cells.

    [0391] The experimental data shows that the pMVA-1/DOTAP complex can not only directly induce the maturation of DC, but also the tumor cells treated with the pMVA-1/DOTAP complex can better activate the function of DC secreting anti-tumor cytokines to perform innate immune response.

    Example 19 Experiments on Different Tumor Model of Mice Treated with DNA/Cationic Biomaterial Complex

    [0392] 1 MVA-1/DOTAP complex can inhibit tumor growth of nude mice with abdominal metastasis of cervical cancer

    [0393] Balb/c female nude mice aged 6-8 weeks were raised. Human cervical cancer Hela cells cultured to the logarithmic growth phase were prepared into a cell suspension, and the nude mice with abdominal metastasis of cervical cancer were modeled by intraperitoneal injection. The number of cells injected into each nude mouse was 110.sup.7, and the injection system was 200 l for each nude mouse.

    [0394] The nude mice that had been successfully modeled were randomly divided into 4 groups as described in Table 9, i.e. normal saline group (NS), DOTAP group (empty vector group), pMVA-1 group (empty drug group) and pMVA-1/DOTAP group (treatment group). On the 3.sup.rd day after inoculation of Hela cells, each experimental group was intraperitoneally administrated every 3 days separately according to Table 9, and the body weight of each experimental group was recorded. After intraperitoneal administration for 4 times, that is, on 12 d, one nude mouse in control group (pMVA-1) died, and all the other 3 groups of nude mice except the treatment group existed obvious ascites, and all nude mice were killed. Ascites of nude mice were taken to measure its volume and count the number of cancer cells. The apoptotic cells in ascites were tested by flow cytometry, and ascites cells were observed by Giemsa staining. The tumor was removed and its weight was weighed. Tumor, tissues and organs were fixed with paraformaldehyde and then immunohistochemistry tested.

    TABLE-US-00009 TABLE 9 Grouping and dosage of administration of nude mice with abdominal metastasis of cervical cancer treated with pMVA-1/DOTAP complex Number Dosage of administration of mice pMVA-1 DOTAP Group (Nr.) (g/mouse) (g/mouse) Negative NS 10 control group Lipid material DOTAP 10 100 control group Plasmid DNA pMVA-1 10 10 control group Treatment pMVA-1/DOTAP 10 10 100 group

    [0395] FIG. 19 provides the experimental results as follows: weight (FIG. 19A), ascites volume (FIG. 19B), number of tumor nodules (FIG. 19C) and tumor weight (FIG. 19D) of nude mice in pMVA-1/DOTAP treatment group are significantly lower than those in other control groups (P<0.01). As shown in FIG. 20, the percentage of apoptotic cells in ascites in the treatment group was significantly higher than that in other control groups (p<0.05). In addition, HE staining results of tumor tissue sections showed that there was a large amount of inflammatory cell infiltration in tumor tissue of the treatment group, while there was no or a little inflammatory cell infiltration in other control groups. The Giemsa staining of the cells in ascites revealed that the pMVA-1/DOTAP complex significantly inhibited the generation of tumor cells and red blood cells in abdominal cavity of nude mice, compared with the control group. HE staining of heart, liver, spleen, lung and kidney of nude mice indicated that there was no treatment-related tissue lesion in each group of nude mice. Thus, it can be considered that the pMVA-1/DOTAP complex may have better biological safety.

    [0396] Thus, compared with the control groups, the pMVA-1/DOTAP complex can directly induce apoptosis of cervical cancer cells through innate immune response, and significantly inhibit the growth of cervical cancer cells.

    [0397] 2 Plasmid DNA/DOTAP complex can inhibit tumor growth of nude mice with abdominal metastasis of ovarian cancer.

    [0398] Balb/c nude mice aged 6-8 weeks were raised. The human ovarian cancer cell line SKOV3 cultured to the logarithmic growth phase was prepared into a cell suspension, and the mice with abdominal tumor were modeled by intraperitoneal injection. The number of cells injected into each mouse was 110.sup.7, and the injection system was 200 l for each mouse.

    [0399] The nude mice that had been successfully modeled were randomly divided into 8 groups as described in Table 10. Intraperitoneal administration began 2 days after tumor inoculation as follows: 10 g of plasmid for each mouse in the control group of the plasmid DNA group; 100 g of DOTAP for each mouse in the control group of the DOTAP group; 10 g of DNA and 100 g of DOTAP for each mouse in the treatment group (plasmid DNA/DOTAP complex group), i.e. the mass ratio of plasmid DNA to DOTAP was 1:10. After that, mice were administered every three days. All the mice were killed on the 35.sup.th day after inoculation of the tumor, with a total of 10 times of administration.

    TABLE-US-00010 TABLE 10 Grouping and dosage of administration of nude mice with abdominal metastasis of cervical cancer treated with plasmid DNA/DOTAP complex Dosage of administration Number Plasmid DNA DOTAP Group of mice (g) (g) Negative Normal saline 6 control (NS) group Lipid DOTAP 6 100 material control group Plasmid pMVA-1 5 10 DNA pMVA-2 5 10 control pMVA-3 5 10 group Treatment pMVA-1/DOTAP 6 10 100 group pMVA-2/DOTAP 6 10 100 pMVA-3/DOTAP 6 10 100

    [0400] After intraperitoneal administration for 10 times, only one mouse in negative control group died naturally and all mice in other experimental groups were killed. Ascites of mice were taken to measure its volume and count the amount of cancer cells there.

    [0401] FIG. 21 provides the experimental results as follows: the ascites volume (FIG. 21A), tumor weight (FIG. 21B) and the number of ascites cancer cells (FIG. 21C) of nude mice administrated with plasmid DNA/DOTAP in the three treatment groups were significantly lower than those in other control groups (p<0.01).

    [0402] Therefore, compared with the control groups, the plasmid DNA/DOTAP complex in the treatment group can directly induce ovarian cancer cell apoptosis through innate immune response, and can significantly inhibit the growth of ovarian cancer cells.

    [0403] 3 Plasmid DNA/DOTAP complex can inhibit tumor growth of mice with CT26 abdominal metastasis

    [0404] Balb/c mice aged 6-8 weeks were raised. The mouse colon cancer cell line CT26 cultured to the logarithmic growth phase was prepared into a cell suspension, and the mice with abdominal tumor were modeled by intraperitoneal injection. The number of cells injected into each mouse was 110.sup.6, and the injection system was 100 l for each mouse.

    [0405] The mice that had been successfully modeled were divided into groups as described in Table 11. They were intraperitoneally administrated on the 5.sup.th day after inoculation of the tumor as follows: 10 g of DNA for each mouse in the control group of the plasmid DNA group; 100 g of DOTAP for each mouse in the DOTAP control group; 10 g of DNA and 100 g of DOTAP for each mouse in the treatment group of plasmid DNA/DOTAP complex group, i.e. the mass ratio of plasmid DNA to DOTAP was 1:10. After that, they were administrated every three days for a total of 5 times.

    TABLE-US-00011 TABLE 11 Grouping and dosage of administration of model mice with abdominal metastasis of CT26 colon cancer treated with plasmid DNA/DOTAP complex Number Dosage of administration of mice Plasmid DNA DOTAP Group (Nr.) (g) (g) Blank Untreated 22 control group Negative Normal saline 10 control (NS) group Lipid DOTAP 10 100 material control group Plasmid pMVA-1 10 10 DNA pMVA-2 10 10 control pMVA-3 10 10 group Treatment pMVA-1/DOTAP 10 10 100 group pMVA-2/DOTAP 10 10 100 pMVA-3/DOTAP 10 10 100

    [0406] Mice were intraperitoneally administrated for 5 times, and 2 mice in each group were killed on the 2.sup.nd day after the 3.sup.rd administration, i.e. the 13.sup.th day after inoculation of the tumor. On the 1.sup.st day after the fourth administration, that is, on the 15.sup.th day after inoculation of the tumor, 3 mice in each group were killed. On the 4.sup.th day after the fifth administration, i.e. 21 days after inoculation of the tumor, 5 mice in each group were killed. Ascites of mice were taken to measure its volume and count the number of ascites cancer cells. Apoptotic cells in ascites were tested by flow cytometry. The tumor was removed and weighed. Tumors, tissues and organs were fixed with paraformaldehyde and then immunohistochemistry tested. The rest of the mice were allowed to die naturally, and tumor-free statistics were carried out.

    [0407] FIG. 22 provides the experimental results as follows: the number of natural deaths of mice in the three plasmid DNA/DOTAP treatment groups was significantly lower than that in other control groups (p<0.01 or p<0.05) (FIG. 22A); the tumor weight (FIG. 22B), ascites volume (FIG. 22C), number of ascites cancer cells (FIG. 22D), and number of tumor nodules (FIG. 22E) of mice in the pMVA-3/DOTAP treatment group were significantly lower than those in other control groups (p<0.01 or p<0.05).

    [0408] Therefore, compared with the control groups, the plasmid DNA/DOTAP complex in the treatment group inhibits the growth of colorectal cancer CT26 cells.

    [0409] 4 MVA-1/DOTAP complex can inhibit the growth of sarcoma in mice.

    [0410] KM mice aged 6-8 weeks were raised. The mouse sarcoma cell line S180 cultured to the logarithmic growth phase was prepared into a cell suspension, and mouse subcutaneous tumor was modeled by subcutaneous injection in the right axilla of each mouse. The number of cells injected into each mouse was 110.sup.7, and the injection system was 200 l for each mouse.

    [0411] On the 5.sup.th day after inoculation of S180 sarcoma cells, when the tumor could be palpated, 40 tumor-bearing mice were randomly divided into 4 groups according to Table 12: i.e. negative control group (NS), DOTAP control group, pMVA-1 control group, and treatment group pMVA-1/DOTAP group. Then, the mice were subcutaneously administrated according to Table 12: 2.5 g of plasmid pMVA-1 for each mouse in the pMVA-1 control group; 25 g of DOTAP for each mouse in DOTAP control group; 2.5 g of DNA and 25 g of DOTAP for each mouse in the treatment group of the pMVA-1/DOTAP complex group; that is, the mass ratio of plasmid DNA to DOTAP was 1:10. After that, they were administrated every three days for a total of 5 times. The mice were killed and the tumor-free rate of the mice was counted 21 days after inoculation of the tumor.

    TABLE-US-00012 TABLE 12 Grouping and dosage of administration of subcutaneous model of mice with S180 sarcoma cells treated with pMVA-1/DOTAP complex Number Dosage of administration of mice pMVA-1 DOTAP Group (Nr.) (g/mouse) (g/mouse) Negative NS 10 control group Lipid material DOTAP 10 25 control group Plasmid DNA pMVA-1 10 2.5 control group Treatment pMVA-1/DOTAP 10 2.5 25 group

    [0412] As shown in FIG. 23, the experiment results indicate that the tumor-free rate of mice in the pMVA-1/DOTAP treatment group is 90%, which is significantly higher than that of other control groups; the tumor-free rate of NS group is 1%, and that of DOTAP group and pMVA-1 group is 20%.

    [0413] It can be seen that pMVA-1/DOTAP complex could significantly inhibit the growth of sarcoma in mice.

    [0414] 5 MVA-1/DOTAP complex could inhibit the growth of nasopharyngeal carcinoma in mice.

    [0415] Balb/c nude mice aged 6-8 weeks were raised. The human nasopharyngeal carcinoma cell line CNE-2 cultured to the logarithmic growth phase was prepared into a cell suspension. mouse subcutaneous tumor was modeled by subcutaneous injection in the right axilla of each mouse. The number of cells injected into each mouse was 110.sup.7, and the injection system was 200 l for each mouse.

    [0416] The nude mice that had been successfully modeled were randomly divided into 4 groups as described in Table 13. When the tumor could be palpated five days after inoculation of the tumor, mice were subcutaneously administrated as follows: 4 g of plasmid for each mouse in the control group of pMVA-1 group; 40 g of DOTAP for each mouse in the control group of DOTAP group; 4 g of plasmid DNA and 40 g of DOTAP for each mouse in the treatment group of pMVA-1/DOTAP complex group, i.e. the mass ratio of plasmid DNA to DOTAP was 1:10. After that, the mice were administrated every three days, all the mice were killed on the 21st day after inoculation of the tumor, and the tumor volume of the mice in each group was measured after administration for five times.

    TABLE-US-00013 TABLE 13 Grouping and dosage of administration of subcutaneous model mice with CNE-2 cells treated with pMVA-1/DOTAP complex Number Dosage of administration of mice pMVA-1 DOTAP Group (Nr.) (g/mouse) (g/mouse) Negative NS 10 control group Lipid material DOTAP 10 40 control group Plasmid DNA pMVA-1 10 4 control group Treatment pMVA-1/DOTAP 10 4 40 group

    [0417] As shown in FIG. 24, the experimental results show that the tumor volume of mice in the pMVA-1/DOTAP treatment group is significantly lower than that of other control groups, indicating that the pMVA-1/DOTAP complex can significantly inhibit the tumor growth of subcutaneous model mice of human nasopharyngeal carcinoma cells.

    [0418] 6 Long-term immune response of mice with CT26 abdominal metastasis activated by DNA/DOTAP complex

    Experiment (1): Model Mice with Abdominal Metastasis of CT26 Treated with Plasmid DNA/DOTAP Complex

    [0419] Balb/c mice aged 6-8 weeks were raised. The mouse colorectal cancer cell line CT26 cultured to the logarithmic growth phase was prepared into a cell suspension, and mouse abdominal tumor was modeled by intraperitoneal injection. The number of cells injected into each mouse was 210.sup.5, and the injection system was 100 l for each mouse.

    [0420] As described in Table 14, the mice that had been successfully modeled were divided into groups as follows: Normal group was not inoculated with tumor cell nor administrated with drugs; untreated group was intraperitoneally inoculated with CT26 cells instead of drugs; NS group was intraperitoneally inoculated with tumor cells and administrated with normal saline. After inoculation of the tumor, mice were intraperitoneally administrated on the 3.sup.rd day as follows: 15 g of plasmid DNA and 75 g of DOTAP for each mouse in the treatment group of plasmid DNA/DOTAP complex group; i.e. the mass ratio of plasmid DNA to DOTAP was 1:5. After that, they were administrated every three days for a total of 9 times.

    TABLE-US-00014 TABLE 14 Grouping and dosage of administration of model mice with abdominal metastasis of CT26 colorectal cancer treated with plasmid DNA/DOTAP complex Number Dosage of administration of mice Plasmid DNA DOTAP Group (Nr.) (g) (g) Normal control Normal 16 group Negative Normal saline 17 control group (NS) DOTAP control DOTAP 16 75 group Plasmid DNA pMVA-1 16 15 control group Treatment group pMVA-1/DOTAP 37 15 75

    [0421] The mice were administrated for 9 times in total and allowed to die naturally. The natural death dates of the mice in each experimental group were recorded, and the body weight and survival time of the mice in each experimental group were counted. The volume of ascites were counted, tumors were removed and weighed.

    [0422] As shown in FIG. 25, the experimental results show that the weight of mice in the pMVA-1/DOTAP treatment group is not significantly different from that of mice in the normal group, indicating that the pMVA-1/DOTAP complex has no obvious toxicity to mice (FIG. 25a); moreover, the average ascites volume of mice in the pMVA-1/DOTAP group was 0.3 ml, which was significantly lower than the average ascites volume of mice in the negative control group of 1.91 ml, the average ascites volume of mice in the pMVA-1 group of 2.22 ml and the average ascites volume of mice in the DOTAP group of 3.11 ml (FIG. 25B). The negative control group, pMVA-1 group and DOTAP group all died on the 54.sup.th, 57.sup.th and 39.sup.th days after inoculation of the tumor cells, and some of mice in the pMVA-1/DOTAP group still survived on the 78.sup.th day after inoculation of the tumor cells. The survival time of mice in the pMVA-1/DOTAP group was significantly longer than that in other experimental groups (FIG. 25C). Abdominal tumor was taken and weighed after the mice died. The average tumor weight of mice was 2.92 g in the pMVA-1/DOTAP group, 7.91 g in the negative control group, 7.35 g in the pMVA-1 group, and 8.23 g in the DOTAP group. The tumor weight of mice in the pMVA-1/DOTAP group was significantly reduced (FIG. 25 D) compared with the negative control group, pMVA-1 group and DOTAP group.

    [0423] Thus, it can be seen that the pMVA-1/DOTAP complex can significantly inhibit the growth of tumor cells in vivo.

    Experiment (2): Long-Term Immune Response to Tumor Cell Re-Stimulation of Model Mice with Abdominal Metastasis of CT26 after Treatment with Plasmid DNA/DOTAP Complex

    [0424] For the above experiment (1), abdominal tumors of 27 mice in the treatment group of pMVA-1/DOTAP were completely eliminated after administration for 9 times, and the 27 mice were regrouped as described in Table 15. In addition, 14 mice in the same batch of Normal group were selected and grouped according to Table 15. In the above experiment (1), on the 2.sup.nd day after the 9.sup.th administration, the mice were subcutaneously inoculated with 110.sup.6 of colorectal cancer cells CT26 and 110.sup.6 mice breast cancer cells 4T1 respectively according to the grouping conditions in Table 15. The subcutaneous tumor volume of mice in each group was measured every 3 days. The tumor volume was calculated according to the following formula: V=ab.sup.20.52, wherein, a is the long diameter of the tumor and b is the short diameter of the tumor.

    TABLE-US-00015 TABLE 15 Long-term immune response experiment group and subcutaneous inoculation of tumor cells Immune Number Tumor cells subcutaneously First treatment model of mice inoculated group group (Nr.) CT26 cells 4T1 cells Normal Control 7 1 10.sup.6/mouse group 1 Control 7 1 10.sup.6/mouse group 2 Control 9 group pMVA-1/DOTAP Treatment 9 1 10.sup.6/mouse group 1 Treatment 9 1 10.sup.6/mouse group 2

    [0425] According to the above experiments (1) and (2), the anti-CT26 colorectal cancer effect of the model mice with abdominal metastasis of CT26 was more than 90% after treated with the pMVA-1/DOTAP complex. The mice in the treatment group were subcutaneously inoculated with colon cancer CT26 cells and breast cancer 4T1 cells respectively, so as to observe the growth of CT26 subcutaneous tumor and 4T1 subcutaneous tumor. The same batch of normal mice (Normal group) was divided into two groups, which were inoculated with the same tumor as a control group respectively. The experimental results are shown in FIG. 26.

    [0426] (1) After the mice were treated with the plasmid DNA/DOTAP complex, the growth of CT26 subcutaneous tumor in mice was significantly inhibited, and the mice in CT26 subcutaneous tumor experimental group were almost tumor-free (FIG. 26A), and the survival time of mice in treatment group was significantly prolonged compared with that in the control groups.

    [0427] (2) The 4T1 subcutaneous tumor of the mice treated with the plasmid DNA/DOTAP complex grew more slowly than the 4T1 subcutaneous tumor of the control group (FIG. 26B).

    [0428] In addition, the analysis of tumor tissues showed that there was a large amount of lymphocyte infiltration in CT26 subcutaneous tumor and 4T1 subcutaneous tumor tissues, mainly CD4.sup.+ and CD8.sup.+T lymphocytes, which was less in the control group, indicating that the pMVA-1/DOTAP complex could significantly improve the anti-tumor adaptive immune response of the body. The experiment further indicated that the splenic NK cell activity and CTL tumor killing activity of mice treated with the pMVA-1/DOTAP complex were higher than those of the control group.

    [0429] The above experimental results show that for the model mice with abdominal metastasis of CT26, the pMVA-1/DOTAP complex can result in systemic anti-tumor memory immune response of the treated mice. After re-stimulated by tumor cells, including tumor cells of the same type and different types, it can inhibit the growth of tumor cells through memory T cells and a large amount of immune cytokines secreted by the memory T cells, so as to break the immune tolerance of tumors.

    Example 20 Combined pMVA-1/DOTAP Complex and Chemotherapy for Treating Mice U14 Subcutaneous Model

    [0430] C57 female mice aged 6-8 weeks were raised. The mouse cervical cancer cell line U14 cultured to the logarithmic growth phase was prepared into a cell suspension and the cell density was 210.sup.7/ml. Experimental animals were subcutaneously injected on the right back, with an injection system of 100 l per mouse. When the tumor could be palpated (tumor volume is about 4 mm4 mm3 mm, i.e. the 5.sup.th day after inoculation), the mice were randomly divided into 6 groups, and administrated every 3 days for a total of 8 times according to the grouping and treatment scheme in Table 16. The tumor volume was measured every three days. After administration for 8 times, the mice were killed and subcutaneous tumors were dissected for examination.

    TABLE-US-00016 TABLE 16 Grouping and treatment schemes of mice U14 subcutaneous model treated by combined PMVA-1/DOTAP complex and chemotherapy Number of Route of Course of Group cases Treatment Dose administration treatment 1 11 NS (10% sucrose) 2 11 DOTAP 100 ug/mouse sc 2 11 pMVA-1 10 ug/mouse sc Q3d 8 3 11 DDP 100 ug/mouse ip Q3d 8 4 11 DOTAP + pMVA1 100 ug + 100 ug/mouse sc Q3d 8 5 12 DOTAP/pMVA1 + D 100 ug + 10 ug/mouse + 100 ug/ sc Q3d 8 DP mouse

    [0431] Wherein, the administration volume is 100 l per mouse, DDP is intraperitoneally administrated once a week. DDP is Cisplatin and LP is pMVA-1/DOTAP complex.

    [0432] As shown in FIG. 27, the experimental results show that slow tumor growth is observed in the Cisplatin group, pMVA-1/DOTAP complex group, combined pMVA-1/DOTAP complex and Cisplatin treatment group. In particular, the combined treatment group show the slowest tumor growth, and the tumor volume of the above three groups are significantly lower than NS group, DOTAP group and pMVA-1 group. In addition, the combined pMVA-1/DOTAP complex and Cisplatin treatment group has significantly smaller tumor volume than the Cisplatin group and pMVA-1/DOTAP complex group alone.

    [0433] The analysis of tumor tissue shows that a large number of lymphocyte infiltration is observed in the pMVA-1/DOTAP complex group, and combined pMVA-1/DOTAP complex and Cisplatin treatment group, which is less common in the chemotherapy group, DOTAP group, pMVA-1 group and NS group, indicating that the combined pMVA-1/DOTAP complex and Cisplatin treatment can further enhance the anti-tumor adaptive immune response of the pMVA-1/DOTAP complex.

    [0434] Thus, the pMVA-1/DOTAP complex can significantly improve the anti-tumor immune response of the body and enhance the anti-tumor effect of chemotherapy. Both of them are combined to significantly inhibit the growth of tumor, and the anti-tumor effect of combined treatment is superior to that of Cisplatin alone.

    Example 21 Combined pMVA-1/DOTAP Complex and Radiotherapy for Treating Hela Subcutaneous Model in Nude Mice

    [0435] Nude mice aged 6-8 weeks were raised. The human cervical cancer cell line Hela cultured to the logarithmic growth phase was prepared into a cell suspension, and the cell density was 110.sup.7/ml. Experimental animals were subcutaneously injected on the right back, with an injection system of 100 l per mouse. When the tumor could be palpated (tumor volume is about 5 mm5 mm5 mm, i.e. the 7.sup.th day after inoculation), the mice were randomly divided into 4 groups. See Table 17 for specific dosage regimen. On the 7.sup.th day of inoculation, mice were administrated as follows: the combined treatment group and pMVA-1/DOTAP group were intratumorally injected with 100 l of plasmid pMVA-1/DOTAP complex (the complex formed by 10 g of plasmid pMVA-1 and 100 g of DOTAP) respectively; and NS group was injected with 100 l of normal saline. Both were intratumorally injected at multiple points, twice a week, and a total of 5 times. The radiotherapy group and the combined treatment group received radiotherapy 24 h after the first dose (i.e. the 8.sup.th day after inoculation), with a total dose of 2Gy for each radiotherapy, a frequency of 200 cGy/min, a depth of 2 mm from the skin source, and every 2 days, for a total of 3 times. After intratumoral administration for 5 times, tumor volume was measured, mice were killed, and tumor tissues were taken for examination.

    TABLE-US-00017 TABLE 17 Grouping and therapeutic regimen of Hela subcutaneous model of nude mice treated with pMVA-1/DOTAP complex combined with radiotherapy Therapeutic dose Number Total dose of of mice Plasmid DNA DOTAP radiotherapy Group (Nr.) (g) (g) (Gy) Normal saline (NS) 10 pMVA-1/DOTAP 10 10 100 Radiotherapy 10 2 pMVA-1/DOTAP + 10 10 100 2 radiotherapy

    [0436] As shown in FIG. 28, the experimental results show that the tumor volumes of radiotherapy group, pMVA-1/DOTAP complex group, and combined pMVA-1/DOTAP complex and radiotherapy treatment group are significantly lower than that of NS group. In addition, the tumor volume of combined pMVA-1/DOTAP complex and radiotherapy treatment group is significantly lower than that of the radiotherapy group alone.

    [0437] In addition, the analysis of tumor tissues shows that a large number of lymphocyte infiltration is observed in the pMVA-1/DOTAP complex group, combined pMVA-1/DOTAP complex and radiotherapy treatment group, which is less common in the radiotherapy group and NS group, indicating that the combined pMVA-1/DOTAP complex and radiotherapy treatment can further enhance the anti-tumor specific immune response of the pMVA-1/DOTAP complex.

    [0438] Thus, the pMVA-1/DOTAP complex can significantly improve the anti-tumor immune response of the body and enhance the anti-tumor effect of radiotherapy. Both of them are combined to significantly inhibit the growth of tumor, and the anti-tumor effect of combined treatment is superior to that of radiotherapy alone.

    [0439] In the in vivo experiment of the tumor treatment through combined pMVA-1/DOTAP complex and immune response regulator, we found the experimental results similar to those of Examples 20 and 21: the pMVA-1/DOTAP complex can significantly improve the immune response of the body against tumor, and strengthen the anti-tumor effect of immune response regulators (e.g., cytokines, class II HLA protein binding helper molecules, CD40 agonists, checkpoint receptor antagonists (e.g., CTLA-4, PD-1, Stat3), B7 costimulatory molecules, FLt3 agonists, CD40L agonists, etc.). Both of them are combined to significantly inhibit tumor growth, and the anti-tumor effect of the combined treatment is superior to that of the treatment with the immune response regulators alone.

    Example 22 Anti-Tumor Effect of Tumor Cell Vaccine Prepared by Taking DNA/Cationic Biomaterial Complex as Adjuvant

    [0440] (1) Preparation of CT26 Colon Cancer Cell In Situ Vaccine:

    [0441] a. Preparation of pVAX1/DOTAP Complex: Refer to Example 3

    [0442] b. Preparation of Apoptosis and Necrosis CT26 Colon Cancer Cells:

    [0443] The CT26 colon cancer cells cultured to the logarithmic growth phase were inoculated into a 6-well plate as per 110.sup.6 cells/well and cultured at 37 C. and 5% CO.sub.2 until the cells were adhered to the wall. Then, the actinomycin D medium containing 200 ng/ml was added and cultured for 12 h to induce apoptosis. After the apoptosis cell suspension was collected, 5 l of Annexin V-FITC and 10 l of propidium iodide (PI, made by Sigma) were added, mixed, incubated at room temperature for 15 min in the dark, tested for the apoptosis by a flow cytometer, enriched and diluted for later use.

    [0444] In addition, CT26 cells in the logarithmic growth phase were prepared into necrotic tumor cells by the heating method, i.e. water bath at 56 C. for 1 h. The necrotic morphology of the cells was observed under a microscope. The cell death rate was tested by the trypan blue exclusion. The suspension of necrotic tumor cells was collected, mixed with 0.4% trypan blue in equal volume, and left for 5-15 min.

    [0445] c. Preparation of CT26 Colon Cancer Cell Vaccine:

    [0446] The pVAX1/DOTAP complex was used as vaccine and mixed with necrotic or apoptotic CT26 colon cancer cells to prepare CT26 cell vaccine.

    [0447] (2) Evaluation of Anti-Tumor Effect of CT26 Colon Cancer Cell Vaccine in Mouse Colon Cancer CT26 Abdominal Model

    [0448] Mice were injected intraperitoneally as per 110.sup.6 CT26 cells/mouse. From the 3.sup.rd day after injection, they were intraperitoneally administrated and divided into a normal saline group (NS), a pVAX1/DOTAP necrotic cell vaccine group (NECRO) and a pVAX1/DOTAP apoptotic cell vaccine group (APOP). The mice were intraperitoneally administrated once a week. The survival time of mice was recorded.

    [0449] As shown in FIG. 29, the survival time of mice in the vaccine groups (including NECRO and APOP) significantly prolonged compared with that in the normal saline group (NS). In particular, the survival rate of the NS group on 30 d was 0, while that of the NECRO group and APOP group at 80 d was 40% and 80% respectively. The pVAX1/DOTAP complex can significantly improve the immunogenicity of necrotic or apoptotic tumor cells, and the tumor cell vaccine prepared by mixing them has good anti-tumor effect.

    [0450] The above experimental results show that the DNA/cationic biomaterial complex can be used as adjuvant for tumor cell vaccine, and can significantly improve the immune response of necrosis/apoptosis cell vaccine to activate the anti-tumor of the body and achieve the purpose of effectively inhibiting tumor growth and prolonging the survival time.

    [0451] The above examples show that the DNA/cationic biomaterial complex formed by the replicable DNA that does not express exogenous genes and cationic biomaterials of the present invention, or the oxidized DNA/cationic biomaterial complex formed by oxidized DNA and cationic biomaterials formed by the oxidation of these DNA in vitro, can play a synergistic role in directly killing tumors as an adjuvant of tumor vaccines or tumor cell vaccines, and can also synergistically activate the anti-tumor effects of innate immune response and adaptive reactions of the body, induce the body to generate anti-tumor long-term memory immunity and break tumor immune tolerance. Therefore, the DNA/cationic biomaterial composite of the present invention can be used as a tumor vaccine alone or in combination with other tumor treatment methods for treating different types of tumor.

    [0452] The above embodiments are the preferred embodiments of the present invention, but the embodiments of the present invention are not limited by the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principles of the present invention shall be equivalent replacement methods, and shall be included in the scope of protection of the present invention.

    TABLE-US-00018 Sequencetable <210> 1 <211> 1978 <212> DNA <213> ArtificialSequence <220> <223> nucleotidesequenceofpMVA <400> 1 gactcttcgcgatgtacgggccagatatacgccttctactgggcggttttatggacagca60 agcgaaccggaattgccagctggggcgccctctggtaaggttgggaagccctgcaaagta120 aactggatggctttctcgccgccaaggatctgatggcgcaggggatcaagctctgatcaa180 gagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccg240 gccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctct300 gatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgac360 ctgtccggtgccctgaatgaactgcaagacgaggcagcgcggctatcgtggctggccacg420 acgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctg480 ctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaa540 gtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgccca600 ttcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtctt660 gtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgcc720 aggctcaaggcgagcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgc780 ttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctg840 ggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagctt900 ggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcag960 cgcatcgccttctatcgccttcttgacgagttcttctgaattattaacgcttacaatttc1020 ctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatacaggtggca1080 cttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaata1140 tgtatccgctcatgagacaataaccctgataaatgcttcaataatagcacgtgctaaaac1200 ttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaa1260 tcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggat1320 cttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgc1380 taccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactg1440 gcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccacc1500 acttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtgg1560 ctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccgg1620 ataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaa1680 cgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccg1740 aagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacga1800 gggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctct1860 gacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgcca1920 gcaacgcggcctttttacggttcctgggcttttgctggccttttgctcacatgactt1978 <210> 2 <211> 1977 <212> DNA <213> ArtificialSequence <220> <223> nucleotidesequenceofpMVA-1 <400> 2 gctgcttcgcgatgtacgggccagatatacgccttctactgggcggttttatggacagca60 agcgaaccggaattgccagctggggcgccctctggtaaggttgggaagccctgcaaagta120 aactggatggctttcttgccgccaaggatctgatggcgcaggggatcaagctctgatcaa180 gagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccg240 gccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctct300 gatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgac360 ctgtccggtgccctgaatgaactgcaagacgaggcagcgcggctatcgtggctggccacg420 acgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctg480 ctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaa540 gtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgccca600 ttcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtctt660 gtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgcc720 aggctcaaggcgagcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgc780 ttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctg840 ggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagctt900 ggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcag960 cgcatcgccttctatcgccttcttgacgagttcttctgaattattaacgcttacaatttc1020 ctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatcaggtggcac1080 ttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatat1140 gtatccgctcatgagacaataaccctgataaatgcttcaataatagcacgtgctaaaact1200 tcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaat1260 cccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatc1320 ttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgct1380 accagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactgg1440 cttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccacca1500 cttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggc1560 tgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccgga1620 taaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaac1680 gacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccga1740 agggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgag1800 ggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctg1860 acttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccag1920 caacgcggcctttttacggttcctggccttttgctggccttttgctcacatgactt1977 <210> 3 <211> 120 <212> DNA <213> ArtificialSequence <220> <223> nucleotidesequence1ofmtDNA <400> 3 cccattattcctagaaccaggegacctgcgactccttgacgttgacaatcgagtagtact60 cccgattgaagcceccattcgtataataattacatcacaagacgtcttgcactcatgagc120 <210> 4 <211> 600 <212> DNA <213> ArtificialSequence <220> <223> nucleotidesequence2ofmtDNA <400> 4 ctgaactatcctgcccgccatcatcctagtcctcatcgccctcccatccctacgcatcct60 ttacataacagacgaggtcaacgatccctcccttaccatcaaatcaattggccaccaatg120 gtactgaacctacgagtacaccgactacggcggactaatcttcaactcctacatacttcc180 cccattattcctagaaccaggcgacctgcgactccttgacgttgacaatcgagtagtact240 cccgattgaagcccccattcgtataataattacatcacaagacgtcttgcactcatgagc300 tgtccccacattaggcttaaaaacagatgcaattcccggacgtctaaaccaaaccacttt360 caccgctacacgaccgggggtatactacggtcaatgctctgaaatctgtggagcaaacca420 cagtttcatgcccatcgtcctagaattaattcccctaaaaatctttgaaatagggcccgt480 atttaccctatagcaccccctctaccccctctagagcccactgtaaagctaacttagcat540 taaccttttaagttaaagattaagagaaccaacacctctttacagtgaaatgccccaact600 <210> 5 <211> 2000 <212> DNA <213> ArtificialSequence <220> <223> nucleotidesequence3ofmtDNA <400> 5 tacgttgtagctcacttccactatgtcctatcaataggagctgtatttgccatcatagga60 ggcttcattcactgatttcccctattctcaggctacaccctagaccaaacctacgccaaa120 atccatttcactatcatattcatcggcgtaaatctaactttcttcccacaacactttctc180 ggcctatccggaatgccccgacgttactcggactaccccgatgcatacaccacatgaaac240 atcctatcatctgtaggctcattcatttctctaacagcagtaatattaataattttcatg300 atttgagaagccttcgcttcgaagcgaaaagtcctaatagtagaagaaccctccataaac360 ctggagtgactatatggatgccccccaccctaccacacattcgaagaacccgtatacata420 aaatctagacaaaaaaggaaggaatcgaaccccccaaagctggtttcaagccaaccccat480 ggcctccatgactttttcaaaaaggtattagaaaaaccatttcataactttgtcaaagtt540 aaattataggctaaatcctatatatcttaatggcacatgcagcgcaagtaggtctacaag600 acgctacttcccctatcatagaagagcttatcacctttcatgatcacgccctcataatca660 ttttccttatctgcttcctagtcctgtatgcccttttcctaacactcacaacaaaactaa720 ctaatactaacatctcagacgctcaggaaatagaaaccgtctgaactatcctgcccgcca780 tcatcctagtcctcatcgccctcccatccctacgcatcctttacataacagacgaggtca840 acgatccctcccttaccatcaaatcaattggccaccaatggtactgaacctacgagtaca900 ccgactacggcggactaatcttcaactcctacatacttcccccattattcctagaaccag960 gcgacctgcgactccttgacgttgacaatcgagtagtactcccgattgaagcccccattc1020 gtataataattacatcacaagacgtcttgcactcatgagctgtccccacattaggcttaa1080 aaacagatgcaattcccggacgtctaaaccaaaccactttcaccgctacacgaccggggg1140 tatactacggtcaatgctctgaaatctgtggagcaaaccacagtttcatgcccatcgtcc1200 tagaattaattcccctaaaaatctttgaaatagggcccgtatttaccctatagcaccccc1260 tctaccccctctagagcccactgtaaagctaacttagcattaaccttttaagttaaagat1320 taagagaaccaacacctctttacagtgaaatgccccaactaaatactaccgtatggccca1380 ccataattacccccatactccttacactattcctcatcacccaactaaaaatattaaaca1440 caaactaccacctacctccctcaccaaagcccataaaaataaaaaattataacaaaccct1500 gagaaccaaaatgaacgaaaatctgttcgcttcattcattgcccccacaatcctaggcct1560 acccgccgcagtactgatcattctatttccccctctattgatccccacctccaaatatct1620 catcaacaaccgactaatcaccacccaacaatgactaatcaaactaacctcaaaacaaat1680 gataaccatacacaacactaaaggacgaacctgatctcttatactagtatccttaatcat1740 ttttattgccacaactaacctcctcggactcctgcctcactcatttacaccaaccaccca1800 actatctataaacctagccatggccatccccttatgagcgggcgcagtgattataggctt1860 tcgctctaagattaaaaatgccctagcccacttcttaccacaaggcacacctacacccct1920 tatccccatactagttattatcgaaaccatcagcctactcattcaaccaatagccctggc1980 cgtacgcctaaccgctaaca2000 <210> 6 <211> 2098 <212> DNA <213> ArtificialSequence <220> <223> nucleotidesequenceofpMVA-2 <400> 6 gactcttcgcgatgtacgggccagatatacgccccattattcctagaaccaggcgacctg60 cgactccttgacgttgacaatcgagtagtactcccgattgaagcccccattcgtataata120 attacatcacaagacgtcttgcactcatgagccttctactgggcggttttatggacagca180 agcgaaccggaattgccagctggggcgccctctggtaaggttgggaagccctgcaaagta240 aactggatggctttctcgccgccaaggatctgatggcgcaggggatcaagctctgatcaa300 gagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggctctccg360 gccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctct420 gatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgac480 ctgtccggtgccctgaatgaactgcaagacgaggcagcgcggctatcgtggctggccacg540 acgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctg600 ctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaa660 gtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgccca720 ttcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtctt780 gtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgcc840 aggctcaaggcgagcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgc900 ttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctg960 ggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagctt1020 ggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcag1080 cgcatcgccttctatcgccttcttgacgagttcttctgaattattaacgcttacaatttc1140 ctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatacaggtggca1200 cttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaata1260 tgtatccgctcatgagacaataaccctgataaatgcttcaataatagcacgtgctaaaac1320 ttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaa1380 tcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggat1440 cttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgc1500 taccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactg1560 gcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccacc1620 acttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtgg1680 ctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccgg1740 ataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaa1800 cgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccg1860 aagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacga1920 gggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctct1980 gacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgcca2040 gcaacgcggcctttttacggttcctgggcttttgctggccttttgctcacatgactt2098 <210> 7 <211> 2578 <212> DNA <213> ArtificialSequence <220> <223> nucleotidesequenceofpMVA-3 <400> 7 gactcttcgcgatgtacgggccagatatacgcctgaactatcctgcccgccatcatccta60 gtcctcatcgccctcccatccctacgcatcctttacataacagacgaggtcaacgatccc120 tcccttaccatcaaatcaattggccaccaatggtactgaacctacgagtacaccgactac180 ggcggactaatcttcaactcctacatacttcccccattattcctagaaccaggcgacctg240 cgactccttgacgttgacaatcgagtagtactcccgattgaagcccccattcgtataata300 attacatcacaagacgtcttgcactcatgagctgtccccacattaggcttaaaaacagat360 gcaattcccggacgtctaaaccaaaccactttcaccgctacacgaccgggggtatactac420 ggtcaatgctctgaaatctgtggagcaaaccacagtttcatgcccatcgtcctagaatta480 attcccctaaaaatctttgaaatagggcccgtatttaccctatagcaccccctctacccc540 ctctagagcccactgtaaagctaacttagcattaaccttttaagttaaagattaagagaa600 ccaacacctctttacagtgaaatgccccaactcttctactgggcggttttatggacagca660 agcgaaccggaattgccagctggggcgccctctggtaaggttgggaagccctgcaaagta720 aactggatggctttctcgccgccaaggatctgatggcgcaggggatcaagctctgatcaa780 gagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccg840 gccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctct900 gatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgac960 ctgtccggtgccctgaatgaactgcaagacgaggcagcgcggctatcgtggctggccacg1020 acgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctg1080 ctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaa1140 gtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgccca1200 ttcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtctt1260 gtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgcc1320 aggctcaaggcgagcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgc1380 ttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctg1440 ggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagctt1500 ggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcag1560 cgcatcgccttctatcgccttcttgacgagttcttctgaattattaacgcttacaatttc1620 ctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatacaggtggca1680 cttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaata1740 tgtatccgctcatgagacaataaccctgataaatgcttcaataatagcacgtgctaaaac1800 ttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaa1860 tcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggat1920 cttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgc1980 taccagcggtggtttgtttgccggatcaagagctaccaactatttttccgaaggtaactg2040 gcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccacc2100 acttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtgg2160 ctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccgg2220 ataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaa2280 cgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccg2340 aagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacga2400 gggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctct2460 gacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgcca2520 gcaacgcggcctttttacggttcctgggcttttgctggccttttgctcacatgactt2578 <210> 8 <211> 3978 <212> DNA <213> ArtificialSequence <220> <223> nucleotidesequenceofpMVA-4 <400> 8 gactcttcgcgatgtacgggccagatatacgctacgttgtagctcacttccactatgtcc60 tatcaataggagctgtatttgccatcataggaggcttcattcactgatttcccctattct120 caggctacaccctagaccaaacctacgccaaaatccatttcactatcatattcatcggcg180 taaatctaactttcttcccacaacactttctcggcctatctggaatgccccgacgttact240 cggactaccccgatgcatacaccacatgaaacatcctatcatctgtaggctcattcattt300 ctctaacagcagtaatattaataattttcatgatttgagaagccttcgcttcgaagcgaa360 aagtcctaatagtagaagaacctaccataaacctggagtgactatatggatgccccccac420 cctaccacacattcgaagaacccgtatacataaaatctagacaaaaaaggaaggaatcga480 accccccaaagctggtttcaagccaaccccatggcctccatgactttttcaaaaaggtat540 tagaaaaaccatttcataactttgtcaaagttaaattataggctaaatcctatatatctt600 aatggcacatgcagcgcaagtaggtctacaagacgctacttcccctatcatagaagagct660 tatcacctttcatgatcacgccctcataatcattttccttatctgcttcctagtcctgta720 tgcccttttcctaacactcacaacaaaactaactaatactaacatctcagacgctcagga780 aatagaaaccgtctgaactatcctgcccgccatcatcctagtcctcatcgccctcccatc840 cctacgcatcctttacataacagacgaggtcaacgatccctcccttaccatcaaatcaat900 tggccaccaatggtactgaacctacgagtacaccgactacggcggactaatcttcaactc960 ctacatacttcccccattattcctagaaccaggcgacctgcgactccttgacgttgacaa1020 tcgagtagtactcccgattgaagcccccattcgtataataattacatcacaagacgtctt1080 gcactcatgagctgtccccacattaggcttaaaaacagatgcaattcccggacgtctaaa1140 ccaaaccactttcaccgctacacgaccgggggtatactacggtcaatgctctgaaatctg1200 tggagcaaaccacagtttcatgcccatcgtcctagaattaattcccctaaaaatctttga1260 aatagggcccgtatttaccctatagcaccccctctaccccctctagagcccactgtaaag1320 ctaacttagcattaaccttttaagttaaagattaagagaaccaacacctctttacagtga1380 aatgccccaactaaatactaccgtatggcccaccataattacccccatactccttacact1440 attcctcatcacccaactaaaaatattaaacacaaactaccacctacctccctcaccaaa1500 gcccataaaaataaaaaattataacaaaccctgagaaccaaaatgaacgaaaatctgttc1560 gcttcattcattgcccccacaatcctaggcctacccgccgcagtactgatcattctattt1620 ccccctctattgatccccacctccaaatatctcatcaacaaccgactaatcaccacccaa1680 caatgactaatcaaactaacctcaaaacaaatgataaccatacacaacactaaaggacga1740 acctgatctcttatactagtatccttaatcatttttattgccacaactaacctcctcgga1800 ctcctgcctcactcatttacaccaaccacccaactatctataaacctagccatggccatc1860 cccttatgagcgggcgcagtgattataggctttcgctctaagattaaaaatgccctagcc1920 cacttcttaccacaaggcacacctacaccccttatccccatactagttattatcgaaacc1980 atcagcctactcattcaaccaatagccctggccgtacgcctaaccgctaacacttctact2040 gggcggttttatggacagcaagcgaaccggaattgccagctggggcgccctctggtaagg2100 ttgggaagccctgcaaagtaaactggatggctttctcgccgccaaggatctgatggcgca2160 ggggatcaagctctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatg2220 gattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcac2280 aacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccgg2340 ttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaagacgaggcagcgc2400 ggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactg2460 aagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctc2520 accttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgc2580 ttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgta2640 ctcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcg2700 cgccagccgaactgttcgccaggctcaaggcgagcatgcccgacggcgaggatctcgtcg2760 tgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggat2820 tcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctaccc2880 gtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggta2940 tcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgaa3000 ttattaacgcttacaatttcctgatgcggtattttctccttacgcatctgtgcggtattt3060 cacaccgcatacaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatt3120 tttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttca3180 ataatagcacgtgctaaaacttcatttttaatttaaaaggatctaggtgaagatcctttt3240 tgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccc3300 cgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgctt3360 gcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaac3420 tctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagt3480 gtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctct3540 gctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttgga3600 ctcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcac3660 acagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatg3720 agaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggt3780 cggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcc3840 tgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcg3900 gagcctatggaaaaacgccagcaacgcggcctttttacggttcctgggcttttgctggcc3960 ttttgctcacatgactt3978 <210> 9 <211> 2097 <212> DNA <213> ArtificialSequence <220> <223> nucleotidesequenceofpMVA-5 <400> 9 gctgcttcgcgatgtacgggccagatatacgccccattattcctagaaccaggcgacctg60 cgactccttgacgttgacaatcgagtagtactcccgattgaagcccccattcgtataata120 attacatcacaagacgtcttgcactcatgagccttctactgggcggttttatggacagca180 agcgaaccggaattgccagctggggcgccctctggtaaggttgggaagccctgcaaagta240 aactggatggctttcttgccgccaaggatctgatggcgcaggggatcaagctctgatcaa300 gagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccg360 gccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctct420 gatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgac480 ctgtccggtgccctgaatgaactgcaagacgaggcagcgcggctatcgtggctggccacg540 acgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctg600 ctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaa660 gtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgccca720 ttcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtctt780 gtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgcc840 aggctcaaggcgagcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgc900 ttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctg960 ggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagctt1020 ggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcag1080 cgcatcgccttctatcgccttcttgacgagttcttctgaattattaacgcttacaatttc1140 ctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatcaggtggcac1200 ttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatat1260 gtatccgctcatgagacaataaccctgataaatgcttcaataatagcacgtgctaaaact1320 tcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaat1380 cccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatc1440 ttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgct1500 accagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactgg1560 cttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccacca1620 cttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggc1680 tgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccgga1740 taaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaac1800 gacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccga1860 agggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgag1920 ggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctg1980 acttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccag2040 caacgcggcctttttacggttcctggccttttgctggccttttgctcacatgactt2097 <210> 10 <211> 2577 <212> DNA <213> ArtificialSequence <220> <223> nucleotidesequenceofpMVA-6 <400> 10 gctgcttcgcgatgtacgggccagatatacgcctgaactatcctgcccgccatcatccta60 gtcctcatcgccctcccatccctacgcatcccttacataacagacgaggtcaacgattcc120 tcccttaccatcaaatcaattggccaccaatggtactgaacctacgagtacaccgactac180 ggcggactaatcttcaactcctacatacttcccccattattcctagaaccaggcgacctg240 cgactccttgacgttgacaatcgagtagtactcccgattgaagcccccattcgtataata300 attacatcacaagacgtcttgcactcatgagctgtccccacattaggcttaaaaacagat360 gcaattcccggacgtctaaaccaaaccactttcaccgctacacgaccgggggtatactac420 ggtcaatgctctgaaatctgtggagcaaaccacagtttcatgcccatcgtcctagaatta480 attcccctaaaaatctttgaaatagggcccgtatttaccctatagcaccccctctaccct540 ctctagagcccactgtaaagctaacttagcattaaccttttaagttaaagattaagagaa600 ccaacacctctttacagtgaaatgccccaactcttctactgggcggttttatggacagca660 agcgaaccggaattgccagctggggcgccctctggtaaggttgggaagccctgcaaagta720 aactggatggccttcttgccgccaaggatctgatggcgcaggggatcaagctctgatcaa780 gagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttcttcg840 gccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctct900 gatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgac960 ctgtccggtgccctgaatgaactgcaagacgaggcagcgcggctatcgtggctggccacg1020 acgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctg1080 ctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaa1140 gtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgccca1200 ttcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtctt1260 gtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgcc1320 aggctcaaggcgagcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgc1380 ttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctg1440 ggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagctt1500 ggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcag1560 cgcatcgccttctatcgccttcttgacgagttcttctgaattattaacgcttacaatttc1620 ctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatcaggtggcac1680 ttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatat1740 gtatccgctcatgagacaataaccctgataaatgcttcaataatagcacgtgctaaaact1800 tcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaat1860 cccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatc1920 ttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgct1980 accagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactgg2040 cttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccacca2100 cttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggc2160 tgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccgga2220 taaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaac2280 gacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccga2340 agggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgag2400 ggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctg2460 acttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccag2520 caacgcggcctttttacggttcctggccttttgctggccttttgctcacatgactt2577 <210> 11 <211> 3977 <212> DNA <213> ArtificialSequence <220> <223> nucleotidesequenceofpMVA-7 <400> 11 gctgcttcgcgatgtacgggccagatatacgctacgttgtagctcacttccactatgtcc60 tatcaataggagctgtatttgccatcataggaggcttcattcactgatttcccctattct120 caggctacaccctagaccaaacctacgccaaaatccatttcactatcatattcatcggcg180 taaatctaactttcttcccacaacactttctcggcctatccggaatgccccgacgttact240 cggactaccccgatgcatacaccacatgaaacatcctatcatctgtaggctcattcattt300 ctctaacagcagtaatattaataattttcatgatttgagaagccttcgcttcgaagcgaa360 aagtcctaatagtagaagaaccctccataaacctggagtgactatatggatgccccccac420 cctaccacacattcgaagaacccgtatacataaaatctagacaaaaaaggaaggaatcga480 accccccaaagctggtttcaagccaaccccatggcctccatgactttttcaaaaaggtat540 tagaaaaaccatttcataactttgtcaaagttaaattataggctaaatcctatatatctt600 aatggcacatgcagcgcaagtaggtctacaagacgctacttcccctatcatagaagagct660 tatcacctttcatgatcacgccctcataatcattttccttatctgcttcctagtcctgta720 tgcccttttcctaacactcacaacaaaactaactaatactaacatctcagacgctcagga780 aatagaaaccgtctgaactatcctgcccgccatcatcctagtcctcatcgccctcccatc840 cctacgcatcctttacataacagacgaggtcaacgatccctcccttaccatcaaatcaat900 tggccaccaatggtactgaacctacgagtacaccgactacggcggactaatcttcaactc960 ctacatacttcccccattattcctagaaccaggcgacctgcgactccttgacgttgacaa1020 tcgagtagtactcccgattgaagcccccattcgtataataattacatcacaagacgtctt1080 gcactcatgagctgtccccacattaggcttaaaaacagatgcaattcccggacgtctaaa1140 ccaaaccactttcaccgctacacgaccgggggtatactacggtcaatgctctgaaatctg1200 tggagcaaaccacagtttcatgcccatcgtcctagaattaattcccctaaaaatctttga1260 aatagggcccgtatttaccctatagcaccccctttaccccctctagagcccactgtaaag1320 ctaacttagcattaaccttttaagttaaagattaagagaaccaacacctctttacagtga1380 aatgccccaactaaatactaccgtatggcccaccataattacccccatactccttacact1440 attcctcatcacccaactaaaaatattaaacacaaactaccacctacctccctcaccaaa1500 gcccataaaaataaaaaattataacaaaccctgagaaccaaaatgaacgaaaatctgttc1560 gcttcattcattgcccccacaatcctaggcctacccgccgcagtactgatcattctattt1620 ccccctctattgatccccacctccaaatatctcatcaacaaccgactaatcaccacccaa1680 caatgactaatcaaactaacctcaaaacaaatgataaccatacacaacactaaaggacga1740 acctgatctcttatactagtatccttaatcatttttattgccacaactaacctcctcgga1800 ctcctgcctcactcatttacaccaaccacccaactatctataaacctagccatggccatc1860 cccttatgagcgggcgcagtgattataggctttcgctttaagattaaaaatgccctagcc1920 cacttcttaccacaaggcacacctacaccccttatccccatactagttattatcgaaacc1980 atcagcctactcattcaaccaatagccctggccgtacgcctaaccgctaacacttctact2040 gggcggttttatggacagcaagcgaaccggaattgccagctggggcgccctctggtaagg2100 ttgggaagccctgcaaagtaaactggatggctttcttgccgccaaggatctgatggcgca2160 ggggatcaagctctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatg2220 gattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcac2280 aacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccgg2340 ttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaagacgaggcagcgc2400 ggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactg2460 aagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctc2520 accttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgc2580 ttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgta2640 ctcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcg2700 cgccagccgaactgttcgccaggctcaaggcgagcatgcccgacggcgaggatctcgtcg2760 tgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggat2820 tcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctaccc2880 gtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggta2940 tcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgaa3000 ttattaacgcttacaatttcctgatgcggtattttctccttacgcatctgtgcggtattt3060 cacaccgcatcaggtggcacttttcggggaaatgtgcgcggaacctctatttgtttattt3120 ttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaa3180 taatagcacgtgctaaaacttcatttttaatttaaaaggatctaggtgaagatccttttt3240 gataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagacccc3300 gtagaaaagatcaaaggatcttcttgagatcttttttttctgcgcgtaatctgctgcttg3360 caaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaact3420 ctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtg3480 tagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctg3540 ctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggac3600 tcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcaca3660 cagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatga3720 gaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtc3780 ggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcct3840 gtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcgg3900 agcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggcct3960 tttgctcacatgactt3977