METHODS OF ENHANCING BIOLOGICAL POTENCY OF BACULOVIRUS SYSTEM-PRODUCED RECOMBINANT ADENO-ASSOCIATED VIRUS
20200123572 ยท 2020-04-23
Assignee
Inventors
Cpc classification
C12N2710/14041
CHEMISTRY; METALLURGY
C12N7/00
CHEMISTRY; METALLURGY
C12N2750/14143
CHEMISTRY; METALLURGY
C12N2710/14144
CHEMISTRY; METALLURGY
C12N2750/14151
CHEMISTRY; METALLURGY
C12N5/0601
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
International classification
C12N15/86
CHEMISTRY; METALLURGY
C12N7/00
CHEMISTRY; METALLURGY
Abstract
Provided herein are methods and compositions useful in the production of recombinant AAV (rAAV) in host producer cells, such as insect cells. In some embodiments, methods, uses and compositions are provided that comprise recombinant VP1 genes comprising modified Kozak sequences to express AAV VP1 proteins in amounts that are useful for producing infective rAAV particles. These infective rAAV particles may comprise a gene of interest.
Claims
1. A nucleic acid comprising a nucleotide sequence encoding a modified Kozak sequence and adeno-associated virus (AAV) VP1, VP2, and VP3 capsid proteins, wherein the modified Kozak sequence is selected from SEQ ID NOs: 46-55.
2. The nucleic acid of claim 1, wherein the modified Kozak sequence is SEQ ID NO: 49.
3. The nucleic acid of claim 1, wherein the VP1, VP2, and VP3 capsid proteins are derived from an AAV3 serotype.
4. The nucleic acid of claim 1, further comprising a promoter sequence.
5. The nucleic acid of claim 4, wherein the promoter sequence is a polyhedrin (polh) promoter sequence.
6. The nucleic acid of any one of claims 1-5, wherein the modified Kozak sequence contains an initiation codon for translation of the VP1 capsid protein.
7. The nucleic acid of claim 6, wherein the initiation codon for translation of the VP1 capsid protein is AUG.
8. The nucleic acid of any one of claims 1-7, wherein the nucleic acid is packaged in a viral particle, optionally a baculovirus particle.
9. An insect cell comprising the nucleic acid of any one of claims 1-8.
10. The insect cell of claim 9, wherein the nucleic acid is integrated into the genome of the insect cell.
11. A method of producing recombinant AAV (rAAV) in an insect cell, wherein the rAAV is derived from an AAV3 serotype, the method comprising: a) transfecting an insect cell with: i) a baculovirus comprising the nucleic acid of claim 1; ii) a baculovirus comprising a nucleic acid encoding an AAV Rep protein; iii) a baculovirus comprising a nucleic acid comprising two AAV inverted terminal repeat (ITR) nucleotide sequences flanking a gene of interest operably linked to a promoter sequence; b) culturing the insect cell under conditions suitable to produce rAAV; and c) recovering the rAAV from the insect cell.
12. A method of producing recombinant AAV (rAAV) in an insect cell, wherein the rAAV is derived from an AAV3 serotype, the method comprising: a) transfecting an insect cell of claim 9 or claim 10 with a nucleic acid, optionally in a baculovirus, comprising two AAV inverted terminal repeat (ITR) nucleotide sequences flanking a gene of interest operably linked to a promoter sequence; b) culturing the insect cell under conditions suitable to produce rAAV; and c) recovering the rAAV from the insect cell.
13. The method of claim 11 or claim 12, wherein the insect cell is an Sf9 cell.
14. A nucleic acid comprising a nucleotide sequence encoding a modified Kozak sequence and adeno-associated virus (AAV) VP1, VP2, and VP3 capsid proteins, wherein the modified Kozak sequence is selected from SEQ ID NOs: 56-67.
15. The nucleic acid of claim 14, wherein the modified Kozak sequence is SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, or SEQ ID NO: 63.
16. The nucleic acid of claim 14, wherein the VP1, VP2, and VP3 capsid proteins are derived from an AAV6 serotype.
17. The nucleic acid of claim 14 or claim 16, further comprising a promoter sequence.
18. The nucleic acid of claim 17, wherein the promoter sequence is a polyhedrin (polh) promoter sequence.
19. The nucleic acid of any one of claims 14-18, wherein the modified Kozak sequence contains an initiation codon for translation of the VP1 capsid protein.
20. The nucleic acid of claim 19, wherein the initiation codon for translation of the VP1 capsid protein is AUG.
21. The nucleic acid of any one of claims 14-20, wherein the nucleic acid is packaged in a viral particle, optionally a baculovirus particle.
22. An insect cell comprising the nucleic acid of any one of claims 14-21.
23. The insect cell of claim 22, wherein the nucleic acid is integrated into the genome of the insect cell.
24. A method of producing recombinant AAV (rAAV) in an insect cell, wherein the rAAV is derived from an AAV6 serotype, the method comprising: a) transfecting an insect cell with: i) a baculovirus comprising the nucleic acid of claim 14; ii) a baculovirus comprising a nucleic acid encoding an AAV Rep protein; iii) a baculovirus comprising a nucleic acid comprising two AAV inverted terminal repeat (ITR) nucleotide sequences flanking a gene of interest operably linked to a promoter sequence; b) culturing the insect cell under conditions suitable to produce rAAV; and c) recovering the rAAV from the insect cell.
25. A method of producing recombinant AAV (rAAV) in an insect cell, wherein the rAAV is derived from an AAV6 serotype, the method comprising: a) transfecting an insect cell of claim 22 or claim 23 with a nucleic acid, optionally in a baculovirus, comprising two AAV inverted terminal repeat (ITR) nucleotide sequences flanking a gene of interest operably linked to a promoter sequence; b) culturing the insect cell under conditions suitable to produce rAAV; and c) recovering the rAAV from the insect cell.
26. The method of claim 24 or claim 25, wherein the insect cell is an Sf9 cell.
27. A method of identifying a VP1 translation initiation sequence for producing rAAV particles in a host cell, the method comprising, a) introducing each of a plurality of different recombinant capsid genes into producer cells, wherein each different recombinant capsid gene has a different Kozak sequence surrounding a VP1 translation initiation codon, b) isolating rAAV particles from the producer cells, wherein the rAAV particles contain capsid proteins produced from the recombinant capsid genes, and c) evaluating the rAAV particles produced from the different recombinant capsid genes.
28. The method of claim 27, wherein the producer cell is an insect cell or a mammalian cell.
29. The method of claim 27, wherein the VP1 translation initiation codon is an ATG/AUG codon.
30. The method of claim 27, wherein the rAAV particles are evaluated by assaying their relative VP1/VP2/VP3 content, their yield, their DNA content, their infectivity, or a combination of two or more thereof.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0022] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, which can be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
DETAILED DESCRIPTION
[0042] Aspects of the application provide methods and compositions for producing rAAV particles in host producer cells (e.g., in insect producer cells). In some embodiments, modified translation initiation sequences (TIS, also referred to as Kozak sequences) are associated with a VP1 start codon (e.g., an ATG/AUG start codon for a recombinant gene encoding the VP1 capsid protein) and are incorporated into a recombinant nucleic acid that encodes the VP1, VP2, and VP3 capsid proteins of an AAV serotype of interest. In some embodiments, methods and compositions described in this application can be used to identify VP1 Kozak sequences that are useful to produce effective rAAV particles in host producer cells (e.g., rAAV particles that are produced with a high yield, that are infective, DNA containing, stable, etc., or any combination thereof). In some embodiments, rAAV particles produced using methods and compositions described in this application can contain a gene of interest (e.g., a therapeutic gene) and can be used for therapeutic purposes.
[0043] rAAV is extensively used as a vector for gene therapy/DNA vaccine delivery, but large-scale production of infectious rAAVs for clinical applications remains challenging based on current technology. An AAV capsid consists of three capsid proteins, VP1, VP2, and VP3, derived via alternative splicing and differential codon usage of a single capsid gene in AAV genome. The VP3 sequence is common between all three splice variants, and VP2 and VP1 have longer N-terminal sequences with VP1 being the longest capsid protein (as illustrated for example in
[0044] In some aspects, the application also provides methods and compositions for screening and evaluating AAV capsid gene expression constructs to identify sequences that are useful for producing infective rAAV particles. In some embodiments, a plurality of different rAAV capsid gene expression constructs are evaluated for rAAV particle assembly in a host cell of interest. In some embodiments, the different rAAV capsid gene expression constructs comprise the same promoter, the same AAV capsid coding sequence (e.g., encoding VP1, VP2, and VP3 capsid proteins of any serotype of interest, optionally including one or more capsid mutations) but have different Kozak sequences associated with the translation initiation codon for VP1 (e.g., ATG/AUG). In general, the translation codons and surrounding initiation sequences for VP2 and VP3 are not changed (e.g., they are kept as their natural wild-type sequences). However, in some embodiments, one or more changes could be made in these sequences. In some embodiments, the different Kozak sequences represent sequence variations within the six nucleotides immediately upstream of the translation initiation codon for VP1. In some embodiments, the different Kozak sequences include sequence variations within the two nucleotides immediately downstream from the translation initiation codon for VP1. Accordingly, in some embodiments, the different Kozak sequences are selected from a library of different Kozak sequences that represent nucleotide sequence variations at one or more positions (e.g., 1, 2, 3, 4, 5, or 6 of the positions) within the six nucleotides immediately upstream of the translation initiation codon for VP1 and/or one or more positions (e.g., 1 or 2 of the positions) within the two nucleotides immediately downstream from the translation initiation codon for VP1. In some embodiments, the different Kozak sequences can represent all or a subset of all possible variations of the Kozak sequence for VP1. In some embodiments, the variations are relative to a natural VP1 Kozak sequence for the AAV capsid serotype (e.g., serotype 1, 2, 3, 3B, 4, 5, 6, 7, 8, 9, 10, 11, 12, etc.) gene that is being modified. In some embodiments, different Kozak sequences having a selected percentage translation efficiency (e.g., relative to a reference translation efficiency, for example relative to a translation efficiency associated with a natural or consensus Kozak sequence) are evaluated. In some embodiments, the different Kozak sequences represent translation efficiency ranges between 25% and 50%, for example between 25% and 45%, for example between 30% and 40%, around 25%, around 30%, around 35%, around 40%, around 45%, around 50%, or other values (e.g., intermediate values between any of the foregoing). In some embodiments, all Kozak sequences having a desired translation efficiency or range of translation efficiencies are evaluated. In some embodiments, a subset of Kozak sequences having a translation efficiency within the a desired percent range are evaluated. In some embodiments, Kozak sequences representing percentage increments (e.g., 1-5% increments, for example around 1%, 2%, 3%, 4%, or 5% increments) within a target range of translation efficiencies are evaluated. In some embodiments, the different Kozak sequences are evaluated by introducing recombinant nucleic acids each containing the recombinant capsid gene having a different Kozak sequence (e.g., associated with the VP1 start codon) into host cells that also express other helper genes (e.g., Rep, and other helper genes) and that also contain a recombinant AAV genome of interest having a target gene of interest (e.g., a control gene for example encoding a detectable marker or a therapeutic gene of interest) flanked by ITR sequences (so that the gene of interest flanked by the ITR sequences can be packaged into rAAV particles containing the capsid proteins expressed from the recombinant capsid gene). The host cells can be cells of any type (e.g., mammalian, insect, or other types of host cells). The host cells can express the other helper genes and/or the contain the rAAV genome of interest as a result of plasmid transfection (e.g., using one or more plasmids that express the other helper genes and/or that contain the rAAV genome of interest), viral transduction (e.g., using one or more recombinant viruses, for example a recombinant baculovirus, adenovirus, herpes virus, or other recombinant virus, having recombinant viral genomes that express the other helper genes and/or that contain the rAAV genome of interest), or genomic integration (e.g., with one or more helper genes and/or the rAAV genome of interest). After the different capsid gene constructs are introduced into the host cells, the cells are incubated under conditions to produce rAAV particles, and the rAAV particles are isolated and/or purified, and evaluated. The isolated and/or purified rAAV particles can be evaluated based on one or more factors, including but not limited to one or more of the following: [0045] a) The yield of rAAV particles. In some embodiments, a similar or better yield than for a reference rAAV, for example of the same serotype (e.g., produced using a reference methodology, for example in HEK 293 cells, or Sf9 cells) is selected. [0046] b) The ratio of VP1/VP2/VP3 proteins in the rAAV particles. In some embodiments, a ratio of VP1/VP2/VP3 of >0.5/>0.5/10 is selected. Accordingly, in some embodiments, the ratio of VP1/VP3 is around or >0.5/10, for example around or >0.75/10, for example around or >1/10, for example around or >1.25/10, for example around or >1.5/10, for example around or >1.75/10, or around 2/10, or any intermediate ratio. Similarly, in some embodiments, the ratio of VP2/VP3 is independently around or >0.5/10, for example around or >0.75/10, for example around or >1/10, for example around or >1.25/10, for example around or >1.5/10, for example around or >1.75/10, or around 2/10, or any intermediate ratio. [0047] c) The ratio of full/empty rAAV particles. In some embodiments, a ratio of full/empty particles that is similar or greater than a reference ratio (e.g., the ratio of full/empty for rAAV particles, for example of the same serotype, produced using a reference methodology, for example in HEK 293 cells, or Sf9 cells) is selected. [0048] d) The transduction efficiency of the rAAV particles. In some embodiments, a similar or better transduction efficiency than for a reference rAAV, for example of the same serotype (e.g., produced using a reference methodology, for example in HEK 293 cells, or Sf9 cells) is selected. In some embodiments, the transduction efficiency is evaluated in vitro (e.g., in cells, for example HeLa cells, grown in culture). In some embodiments, the transduction efficiency is evaluated in vivo (e.g., in an animal model, for example a rodent model, such as a mouse model). [0049] e) The precision of DNA packaging in the rAAV particles. In some embodiments, a similar or higher precision of DNA packaging (e.g., of rAAV genomic DNA relative to other DNA, for example host DNA, or DNA flanking the rAAV genome on a plasmid or virus vector in a host cell) than for a reference rAAV is selected. In some embodiments, the reference rAAV can be an rAAV, for example of the same serotype, that is produced using a reference methodology, for example in HEK 293 cells, or Sf9 cells. In some embodiments, the precision of DNA packaging can be evaluated by determining the percentage of non-rAAV genome that is packaged. This can be determined using any suitable method, for example by sequencing the packaged DNA in rAAV particles (e.g., using NGS or other techniques).
[0050] As a result of this evaluation, one or more Kozak sequences (and/or Cap expression constructs including the Kozak sequences upstream of the VP1 translation initiation codon) can be selected and used for producing rAAV of interest in a particular cell type.
[0051] Accordingly, aspects of the application relate to methods and compositions useful in the production of rAAV in insect cells. In some aspects, the disclosure provides nucleic acid compositions comprising a nucleotide sequence encoding i) a modified Kozak sequence and ii) AAV VP1, VP2, and VP3 capsid proteins. In some embodiments, the capsid proteins are derived from AAV5 serotype capsid proteins. In some embodiments, the capsid proteins are derived from AAV8 serotype capsid proteins. In some embodiments, the capsid proteins are derived from AAV9 serotype capsid proteins. In some embodiments, the capsid proteins are derived from AAV3 serotype capsid proteins. In some embodiments, the capsid proteins are derived from AAV6 serotype capsid proteins. In some embodiments, the nucleotide sequence further comprises a promoter sequence. In some embodiments, the promoter is operably linked to the sequence encoding the modified Kozak sequence and AAV capsid proteins.
[0052] A non-limiting example of a generic structure comprising a nucleic acid provided herein is depicted in
[0053] A promoter is operably linked to a nucleotide sequence when the promoter sequence controls and/or regulates the transcription of the nucleotide sequence. In some embodiments, it is advantageous to utilize promoters that are active in insect cells. In some embodiments, the promoter is a polyhedrin (polh) promoter. In some embodiments, the promoter is selected from the group consisting of p10, p35, and IE-1. Methods and techniques for expressing foreign genes in insect host cells are known in the art. Methodology for molecular engineering and expression of polypeptides in insect cells is described, for example, in Summers and Smith. 1986. A Manual of Methods for Baculovirus Vectors and Insect Culture Procedures, Texas Agricultural Experimental Station Bull. No. 7555, College Station, Tex.; Luckow. 1991. In Prokop et al., Cloning and Expression of Heterologous Genes in Insect Cells with Baculovirus Vectors' Recombinant DNA Technology and Applications, 97-152; King, L. A. and R. D. Possee, 1992, The baculovirus expression system, Chapman and Hall, United Kingdom; O'Reilly, D. R., L. K. Miller, V. A. Luckow, 1992, Baculovirus Expression Vectors: A Laboratory Manual, New York; W.H. Freeman and Richardson, C. D., 1995, Baculovirus Expression Protocols, Methods in Molecular Biology, volume 39; U.S. Pat. No. 4,745,051; US2003148506; and WO 03/074714. However, any suitable promoter can be used (e.g., any natural, variant, synthetic, chimeric, truncated, constitutive, inducible, tissue-specific, species-specific, etc., promoter or combinations of two or more of the foregoing) depending on the cell type being used as a producer cell (e.g., insect, mammalian, or other).
[0054] In some embodiments, the modified Kozak sequence described herein contains an initiation codon for translation of the VP1 capsid protein. In some embodiments, the initiation codon is AUG. In some embodiments, the nucleic acid described herein further comprises a viral particle. In some embodiments, the nucleic acid is contained within a viral particle (e.g., encapsidated by a viral particle). In some embodiments, the viral particle is an AAV particle. In some embodiments, the viral particle is a baculovirus particle.
[0055] In some aspects, the disclosure provides methods of producing rAAV in an insect cell, comprising steps of (a) transfecting an insect cell with: (i) a baculovirus comprising a nucleic acid comprising a nucleotide sequence encoding a modified Kozak sequence and AAV VP1, VP2, and VP3 capsid proteins, wherein the modified Kozak sequence is selected from SEQ ID NO: 2-11, 13-32, 33-45, 46-55, and 56-67, (ii) a baculovirus comprising a nucleotide sequence encoding an AAV Rep protein, and (iii) a baculovirus comprising two AAV ITR nucleotide sequences flanking a gene of interest operably linked to a promoter sequence; (b) culturing the insect cell under conditions suitable to produce rAAV; and (c) recovering the rAAV from the insect cell.
[0056] In some embodiments, the disclosure provides an insect cell, wherein the insect cell comprises a nucleic acid comprising a nucleotide sequence encoding a modified Kozak sequence and AAV VP1, VP2, and VP3 capsid proteins, wherein the modified Kozak sequence is selected from SEQ ID NO: 2-11, 13-32, 33-45, 46-55, and 56-67. In some embodiments, the nucleic acid is integrated into the insect cell genome. In some embodiments, a gene encoding a Rep protein is integrated into the insect cell genome. Thus, in some embodiments, the disclosure provides a method of producing rAAV in an insect cell, comprising steps of (a) transfecting an insect cell with a baculovirus comprising two AAV ITR nucleotide sequences flanking a gene of interest operably linked to a promoter sequence, wherein the genome of the insect cell comprises a nucleotide described herein; (b) culturing the insect cell under conditions suitable to produce rAAV; and (c) recovering the rAAV from the insect cell.
[0057] The production of rAAV in insect cells has been described previously (see, for example, U.S. Patent Publication Number US20120100606, which is incorporated herein by reference in its entirety). Methods and compositions provided in the present disclosure can be utilized in any insect cell which allows for the replication of AAV and which can be maintained in culture. For example, the cell line used can be from Spodoptera frugiperda, drosophila cell lines, or mosquito cell lines (e.g., Aedes albopictus derived cell lines). In some embodiments, the insect cell is susceptible to baculovirus infection (e.g., Se301, SeIZD2109, SeUCR1, Sf9, Sf900+, Sf21, BTI-TN-5B1-4, MG-1, Tn368, HzAm1, Ha2302, and Hz2E5). Accordingly, methods and compositions provided herein are useful in producing rAAV using baculovirus expression vectors (BEVs).
[0058] BEVs have emerged as one of the most versatile systems for protein production. In addition to basic protein production, BEVs have been utilized for more complicated tasks such as the synthesis of heterologous multiprotein complexes and for the assembly of gene therapy vehicles such as rAAV. In some embodiments, the latter strategy utilizes insect cells co-infected with three BEVs, each providing a helper functionality. For example, insect cells are co-infected with a first baculovirus comprising a gene of interest flanked by AAV inverted terminal repeat (ITR) sequences, a second baculovirus comprising AAV rep, and a third baculovirus comprising AAV cap. The AAV cap encodes the assembly-activating protein (AAP) and the viral capsid proteins VP1, VP2, and VP3. The capsid proteins VP1, VP2, and VP3 are translated from the same mRNA transcript, which can be post-transcriptionally spliced into either of two differently-sized mRNA isoforms. The post-transcriptional splicing in mammalian cells occurs at a rate appropriate to generate a distribution of the mRNA forms that will result in the expression of a proper stoichiometric ratio of VP1:VP2:VP3 capsid proteins. Also, in insect cells the production of some serotypes (e.g., AAV5, AAV8, AAV9, AAV3 and AAV6) results in particles that are inefficient in transducing cells. Accordingly, compositions and methods are useful to modify VP1 expression levels to improve rAAV production in insect cells or in any other host cell types of interest (e.g., mammalian host producer cells or cells of other type).
[0059] In some aspects, the disclosure provides nucleic acid compositions comprising a nucleotide sequence encoding a modified Kozak sequence and AAV VP1, VP2, and VP3 capsid proteins, wherein the capsid proteins are derived from an AAV5 serotype. In some embodiments, the Kozak sequence comprises the initiation codon for translation of the AAV5 VP1 capsid protein and additional nucleotides upstream of the initiation codon. In some embodiments, the Kozak sequence further comprises nucleotides downstream of the initiation codon. In some embodiments, the Kozak sequence comprises a nucleotide of sequence RNXUXU(AUG)NY (SEQ ID NO: 1), wherein (AUG) is the VP1 initiation codon; R is a C or U nucleotide; N is a nucleotide selected from A, U, G, or C; X is a G or U nucleotide; and Y is a nucleotide selected from A, U, or C. In some embodiments, the Kozak sequence comprises a nucleotide sequence listed in Table 1.
TABLE-US-00001 TABLE1 AAV5VP1KozakSequences SEQIDNO: Sequence 2 CAUUGUAUGUC 3 UCGUUUAUGGA 4 CAGUUUAUGGU 5 CAUUGUAUGGU 6 UAGUGUAUGCU 7 CAUUGUAUGCU 8 UCUUUUAUGUC 9 UGUUUUAUGUC 10 UAGUUUAUGUC 11 UAGUGUAUGUC
[0060] In some aspects, the disclosure provides nucleic acid compositions comprising a nucleotide sequence encoding a modified Kozak sequence and AAV VP1, VP2, and VP3 capsid proteins, wherein the capsid proteins are derived from an AAV8 serotype. In some embodiments, the Kozak sequence comprises the initiation codon for translation of the AAV8 VP1 capsid protein and additional nucleotides upstream of the initiation codon. In some embodiments, the Kozak sequence further comprises nucleotides downstream of the initiation codon. In some embodiments, the Kozak sequence comprises a nucleotide of sequence YNXRNR(AUG)XZ (SEQ ID NO: 12), wherein (AUG) is the VP1 initiation codon; Y is a nucleotide selected from A, U, or C; N is a nucleotide selected from A, U, G, or C; X is a G or U nucleotide; R is a C or U nucleotide; and Z is a G or C nucleotide. In some embodiments, the Kozak sequence comprises a nucleotide sequence listed in Table 2.
TABLE-US-00002 TABLE2 AAV8VP1KozakSequences SEQIDNO: Sequence 13 UAGCGCAUGGC 14 UGGUAUAUGGC 15 UAGUUUAUGGC 16 CAGUGUAUGGC 17 UAGUGUAUGGC 18 UAUUGUAUGGC 19 CAUUGUAUGGC 20 CCGUUUAUGGG 21 ACUUGUAUGGG 22 CAUUUUAUGGG 23 UAGUGUAUGUC 24 UAGUUUAUGUC 25 UGUUUUAUGUC 26 UCUUUUAUGUC 27 UAGUGUAUGGG 28 UAGUUUAUGGG 29 UGUUUUAUGGG 30 UCUUUUAUGGG 31 UAGUGUAUGUC 32 UAGUUUAUGUC
[0061] In some aspects, the disclosure provides nucleic acid compositions comprising a nucleotide sequence encoding a modified Kozak sequence and AAV VP1, VP2, and VP3 capsid proteins, wherein the capsid proteins are derived from an AAV9 serotype. In some embodiments, the Kozak sequence comprises the initiation codon for translation of the AAV9 VP1 capsid protein and additional nucleotides upstream of the initiation codon. In some embodiments, the Kozak sequence further comprises nucleotides downstream of the initiation codon. In some embodiments, the Kozak sequence comprises a nucleotide of sequence UNXUXU(AUG)XZ (SEQ ID NO: 33), wherein (AUG) is the VP1 initiation codon; N is a nucleotide selected from A, U, C, or G; X is a G or U nucleotide; and Z is a G or C nucleotide. In some embodiments, the Kozak sequence comprises a nucleotide sequence listed in Table 3.
TABLE-US-00003 TABLE3 AAV9VP1KozakSequences SEQIDNO: Sequence 34 UAGUGUAUGUC 35 UAGUUUAUGUC 36 UGUUUUAUGUC 37 UCUUUUAUGUC 38 UAGUGUAUGGG 39 UAGUUUAUGGG 40 UGUUUUAUGGG 41 UCUUUUAUGGG 42 UAGUGUAUGGC 43 UAGUUUAUGGC 44 UGUUUUAUGGC 45 UCUUUUAUGGC
[0062] In some aspects, the disclosure provides nucleic acid compositions comprising a nucleotide sequence encoding a modified Kozak sequence and AAV VP1, VP2, and VP3 capsid proteins, wherein the capsid proteins are derived from an AAV3 serotype. In some embodiments, the Kozak sequence comprises the initiation codon for translation of the AAV3 VP1 capsid protein and additional nucleotides upstream of the initiation codon. In some embodiments, the Kozak sequence further comprises nucleotides downstream of the initiation codon. In some embodiments, the Kozak sequence comprises a nucleotide of sequence GCGCAGAUCUYMXUXY(AUG)GC (SEQ ID NO: 80), wherein (AUG) is the VP1 initiation codon; N is a nucleotide selected from A, U, C, or G; M is a nucleotide selected from A, G, or C; X is a G or U nucleotide; and Y is a nucleotide selected from A, U, or C. In some embodiments, the Kozak sequence comprises a nucleotide sequence listed in Table 4.
TABLE-US-00004 TABLE4 AAV3VP1KozakSequences SEQIDNO: Sequence 46 GCGCAGAUCUUCUUUUAUGGC 47 GCGCAGAUCUUGUUUUAUGGC 48 GCGCAGAUCUUAGUUUAAUGGC 49 GCGCAGAUCUUAGUGUAUGGC 50 GCGCAGAUCUCAUUGUAUGGC 51 GCGCAGAUCUCAGUUUAUGGC 52 GCGCAGAUCUUAUUGCAUGGC 53 GCGCAGAUCUUAUUGUAUGGC 54 GCGCAGAUCUAAUUGUAAUGGC 55 AUUAAGGAUCCUUAGUGUAUGGC
[0063] In some aspects, the disclosure provides nucleic acid compositions comprising a nucleotide sequence encoding a modified Kozak sequence and AAV VP1, VP2, and VP3 capsid proteins, wherein the capsid proteins are derived from an AAV6 serotype. In some embodiments, the Kozak sequence comprises the initiation codon for translation of the AAV6 VP1 capsid protein and additional nucleotides upstream of the initiation codon. In some embodiments, the Kozak sequence further comprises nucleotides downstream of the initiation codon. In some embodiments, the Kozak sequence comprises a nucleotide of sequence YLXUXR(AUG)XZ (SEQ ID NO: 81), wherein (AUG) is the VP1 initiation codon; X is a G or U nucleotide; Y is a nucleotide selected from A, U, or C; L is an A or G nucleotide; R is a C or U nucleotide; and Z is a G or C nucleotide. In some embodiments, the Kozak sequence comprises a nucleotide sequence listed in Table 5.
TABLE-US-00005 TABLE5 AAV6VP1KozakSequences SEQIDNO: Sequence 56 UAGUUUAUGGC 57 CAGUUUAUGGC 58 UAUUGCAUGGC 59 UAGUGUAUGGC 60 AAUUGUAUGGC 61 UAUUGUAUGGC 62 CAUUGUAUGGC 63 UGUUUUAUGGG 64 UGUUUUAUGUC 65 UAUUUUAUGGG 66 UAGUUUAUGGG 67 UAGUUUAUGUC
[0064] It should be appreciated that a U or a T nucleotide may be referred to depending on whether the nucleic acid that is being referred to is an RNA or DNA molecule, respectively.
[0065] The wild-type AAV genome is a single-stranded deoxyribonucleic acid (ssDNA), either positive- or negative-sensed. The genome comprises two inverted terminal repeats (ITRs), one at each end of the DNA strand, and two open reading frames (ORFs): rep and cap between the ITRs. The rep ORF comprises four overlapping genes encoding Rep proteins required for the AAV life cycle. The cap ORF comprises overlapping genes encoding capsid proteins: VP1, VP2, and VP3, which interact together to form the viral capsid. VP1, VP2, and VP3 are translated from one mRNA transcript, which can be spliced in two different manners: either a longer or shorter intron can be excised resulting in the formation of two isoforms of mRNAs: a 2.3 kb- and a 2.6 kb-long mRNA isoform. The capsid forms a supramolecular assembly of approximately 60 individual capsid protein subunits into a non-enveloped, T-1 icoshedral lattice capable of protecting the AAV genome. The mature capsid is composed of VP1, VP2, and VP3 (molecular masses of approximately 87, 73, and 62 kDa respectively) in an approximate ratio of about 1:1:10. The level of VP1 relative to VP2 and VP3 can be adjusted as described herein in order to obtain efficient production of infectious particles in insect cells. In some embodiments, the VP1:VP2:VP3 ratio is in the range of (0.5-2):(0.5-2):10. In some embodiments, the VP1:VP2:VP3 ratio is in the range of (0.5-1.5):(0.5-1.5):10.
[0066] Recombinant AAV (rAAV) particles may comprise a nucleic acid vector, which may comprise at a minimum: (a) one or more heterologous nucleic acid regions comprising a gene of interest encoding a protein or polypeptide of interest or an RNA of interest (e.g., siRNA or microRNA); and (b) one or more regions comprising inverted terminal repeat (ITR) sequences (e.g., wild-type ITR sequences or engineered ITR sequences) flanking the one or more nucleic acid regions (e.g., heterologous nucleic acid regions). In some embodiments, the nucleic acid vector is between 2 kb-7 kb in size. In some embodiments, the nucleic acid vector is between 4 kb and 5 kb in size (e.g., 4.2 to 4.7 kb in size). In some embodiments, the nucleic acid vector is circular. In some embodiments, the nucleic acid vector is single-stranded. In some embodiments, the nucleic acid vector is double-stranded. In some embodiments, a double-stranded nucleic acid vector may be, for example, a self-complimentary vector that contains a region of the nucleic acid vector that is complementary to another region of the nucleic acid vector, initiating the formation of the double-strandedness of the nucleic acid vector.
[0067] The ITR sequences can be derived from any AAV serotype (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) or can be derived from more than one serotype. ITR sequences and plasmids containing ITR sequences are known in the art and commercially available (see, e.g., products and services available from Vector Biolabs, Philadelphia, Pa.; Cellbiolabs, San Diego, Calif.; Agilent Technologies, Santa Clara, Ca; and Addgene, Cambridge, Mass.; and Gene delivery to skeletal muscle results in sustained expression and systemic delivery of a therapeutic protein. Kessler P D, Podsakoff G M, Chen X, McQuiston S A, Colosi P C, Matelis L A, Kurtzman G J, Byrne B J. Proc Natl Acad Sci USA. 1996 Nov. 26; 93(24):14082-7; and Curtis A. Machida. Methods in Molecular Medicine. Viral Vectors for Gene Therapy Methods and Protocols. 10.1385/1-59259-304-6:201 Humana Press Inc. 2003. Chapter 10. Targeted Integration by Adeno-Associated Virus. Matthew D. Weitzman, Samuel M. Young Jr., Toni Cathomen and Richard Jude Samulski; U.S. Pat. Nos. 5,139,941 and 5,962,313, all of which are incorporated herein by reference).
[0068] In some embodiments, an rAAV particle or particle within an rAAV preparation may be of any AAV serotype, including any derivative or pseudotype (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 2/1, 2/5, 2/8, 2/9, 3/1, 3/5, 3/8, or 3/9). As used herein, the serotype of an rAAV viral vector (e.g., an rAAV particle) refers to the serotype of the capsid proteins of the recombinant virus. Non-limiting examples of derivatives and pseudotypes include rAAV2/1, rAAV2/5, rAAV2/8, rAAV2/9, AAV2-AAV3 hybrid, AAVrh.10, AAVhu.14, AAV3a/3b, AAVrh32.33, AAV-HSC15, AAV-HSC17, AAVhu.37, AAVrh.8, CHt-P6, AAV2.5, AAV6.2, AAV2i8, AAV-HSC15/17, AAVM41, AAV9.45, AAV6(Y445F/Y731F), AAV2.5T, AAV-HAE1/2, AAV clone 32/83, AAVShH10, AAV2 (Y->F), AAV8 (Y733F), AAV2.15, AAV2.4, AAVM41, and AAVr3.45. Such AAV serotypes and derivatives/pseudotypes, and methods of producing such derivatives/pseudotypes are known in the art (see, e.g., Mol Ther. 2012 April; 20(4):699-708. doi: 10.1038/mt.2011.287. Epub 2012 Jan. 24. The AAV vector toolkit: poised at the clinical crossroads. Asokan A I, Schaffer D V, Samulski R J.). In some embodiments, the rAAV particle is a pseudotyped rAAV particle, which comprises (a) a nucleic acid vector comprising ITRs from one serotype (e.g., AAV2, AAV3) and (b) a capsid comprised of capsid proteins derived from another serotype (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or AAV10). In some embodiments, methods described herein may be used for producing AAV of any serotype, or derivative/pseudotype, (e.g., AAV5, AAV8, AAV9, AAV3, AAV6, or other serotype or derivative/pseudotype based thereon) in insect cells. Other methods for producing and using pseudotyped rAAV vectors are known in the art (see, e.g., Duan et al., J. Virol., 75:7662-7671, 2001; Halbert et al., J. Virol., 74:1524-1532, 2000; Zolotukhin et al., Methods, 28:158-167, 2002; and Auricchio et al., Hum. Molec. Genet., 10:3075-3081, 2001). In some embodiments, one or more capsid substitutions (e.g., relative to a corresponding wild-type sequence) may be encoded in a recombinant capsid gene (e.g., recombinant VP1 gene described in this application).
[0069] Methods of producing rAAV particles and nucleic acid vectors are described herein. Other methods are also known in the art and commercially available (see, e.g., Zolotukhin et al. Production and purification of serotype 1, 2, and 5 recombinant adeno-associated viral vectors. Methods 28 (2002) 158-167; and U.S. Patent Publication Numbers US20070015238 and US20120322861, which are incorporated herein by reference; and plasmids and kits available from ATCC and Cell Biolabs, Inc.). For example, a plasmid containing the nucleic acid vector may be combined with one or more helper plasmids, e.g., that contain a rep gene (e.g., encoding Rep78, Rep68, Rep52 and Rep40) and a cap gene (encoding VP1, VP2, and VP3, including a modified VP3 region as described herein), and transfected into a producer cell line such that the rAAV particle can be packaged and subsequently purified.
[0070] In some embodiments, the producer cell line is derived from an insect cell. Examples of insect cells include, but are not limited to Sf9 cells (see, e.g., ATCC CRL-1711). The producer cell may comprise rep and/or cap genes (e.g., a nucleic acid encoding AAV VP1, VP2, and VP3 as described herein) that encode the Rep protein and/or Cap proteins for use in a method described herein. In some embodiments, the packaging is performed in vitro.
[0071] In some embodiments of a method provided herein, a plasmid containing the nucleic acid vector is combined with one or more helper plasmids, e.g., that contain a rep gene of a first serotype and a cap gene of the same serotype or a different serotype, and transfected into a helper cell line such that the rAAV particle is packaged.
[0072] In some embodiments, the one or more helper plasmids include a first helper plasmid comprising a rep gene and a cap gene and a second helper plasmid comprising a E1a gene, a E1b gene, a E4 gene, a E2a gene, and a VA gene. In some embodiments, the rep gene is a rep gene derived from AAV2. Helper plasmids, and methods of making such plasmids, are known in the art and commercially available (see, e.g., pDM, pDG, pDP1rs, pDP2rs, pDP3rs, pDP4rs, pDP5rs, pDP6rs, pDG(R484E/R585E), and pDP8.ape plasmids from PlasmidFactory, Bielefeld, Germany; other products and services available from Vector Biolabs, Philadelphia, Pa.; Cellbiolabs, San Diego, Calif.; Agilent Technologies, Santa Clara, Ca; and Addgene, Cambridge, Mass.; pxx6; Grimm et al. (1998), Novel Tools for Production and Purification of Recombinant Adenoassociated Virus Vectors, Human Gene Therapy, Vol. 9, 2745-2760; Kern, A. et al. (2003), Identification of a Heparin-Binding Motif on Adeno-Associated Virus Type 2 Capsids, Journal of Virology, Vol. 77, 11072-11081.; Grimm et al. (2003), Helper Virus-Free, Optically Controllable, and Two-Plasmid-Based Production of Adeno-associated Virus Vectors of Serotypes 1 to 6, Molecular Therapy, Vol. 7, 839-850; Kronenberg et al. (2005), A Conformational Change in the Adeno-Associated Virus Type 2 Capsid Leads to the Exposure of Hidden VP1 N Termini, Journal of Virology, Vol. 79, 5296-5303; and Moullier, P. and Snyder, R. O. (2008), International efforts for recombinant adeno-associated viral vector reference standards, Molecular Therapy, Vol. 16, 1185-1188).
[0073] In some embodiments, one or more host cells (e.g., producer cells) can have one or more helper functions (e.g., encoded by recombinant nucleic acid integrated into the host cell genome, or encoded by a plasmid or viral nucleic acid vector in the host cell). In some embodiments, a recombinant capsid gene (e.g., VP1 gene) comprising a modified Kozak sequence as described in this application can be provided on a plasmid, a viral genome (e.g., a baculovirus, Herpes virus, adenovirus, or other viral genome), or integrated into the genome of a host cell (e.g., a mammalian or insect cell, for example an Sf9 cell).
[0074] In some embodiments, a gene of interest (e.g., a gene that is packaged in an rAAV particle) encodes an enzyme, hormone, antibody, receptor, ligand, or other protein. In some embodiments, a gene of interest encodes a therapeutically useful protein. In some embodiments, a gene of interest encodes a reference or marker protein (e.g., a detectable marker, for example GFP). In some embodiments, a gene of interest encodes an RNA, for example a regulatory RNA such as a siRNA or other regulatory RNA (e.g., a therapeutic RNA). In some embodiments, the therapeutic agent is a polypeptide, a peptide, an antibody or an antigen-binding fragment thereof, a ribozyme, a peptide-nucleic acid, an siRNA, an RNAi, an antisense oligonucleotide, or an antisense polynucleotide. In some embodiments, a gene of interest encodes a therapeutic protein. In some embodiments, a therapeutic gene encodes an antibody, a peptibody, a growth factor, a clotting factor, a hormone, a membrane protein, a cytokine, a chemokine, an activating or inhibitory peptide acting on cell surface receptors or ion channels, a cell-permeant peptide targeting intracellular processes, a thrombolytic, an enzyme, a bone morphogenetic proteins, a nuclease or other protein used for gene editing, an Fc-fusion protein, an anticoagulant, a nuclease, guide RNA or other nucleic acid or protein for gene editing. In some embodiments, a therapeutic protein is therapeutic for a lysosomal storage disease. In some embodiments, a therapeutic protein is therapeutic for a neurological disability, a neuromotor deficit, a neuroskeletal impairment or a neuromuscular disease. In some embodiments, a therapeutic protein is therapeutic for a muscular disability or dystrophy, a myopathy or a cardiomyopathy. In some embodiments, a gene of interest encodes a vaccine (e.g., a nucleic acid or peptide vaccine)
[0075] In some embodiments, a gene of interest (e.g., encoding a therapeutic agent) is operably linked to a promoter. A promoter can be, but is not limited to, a natural promoter, a synthetic or recombinant promoter, a chimeric promoter, a truncated promoter, a constitutive promoter, an inducible promoter, a species-specific promoter, a tissue-specific promoter, or a combination of two or more of the foregoing. In some embodiments, a promoter may be regulatable (e.g., the level of expression from the promoter may be increased or reduced by changing an external condition or by adding or removing a regulatory molecule). In some embodiments, a gene of interest may be operably linker to its natural promoter, or alternatively to a different promoter.
[0076] In some embodiments, a composition comprising an rAAV described herein can be used to treat a mammalian subject (e.g., a human). In some embodiments, the subject has cancer, diabetes, autoimmune disease, kidney disease, cardiovascular disease, pancreatic disease, intestinal disease, liver disease, neurological disease, neuromuscular disease, Bratten's disease, Alzheimer's disease, Huntington disease, Parkinson's disease, pulmonary disease, an -1.alpha.-1 antitrypsin deficiency, neurological disability, neuromotor deficit, neuroskeletal impairment, ischemia, stroke, a lysosomal storage disease, Pompe disease, Duchenne Muscular Dystrophy, Friedreich's Ataxia, Canavan disease, Aromatic L-amino acid decarboxylase deficiency, Hemophilia A/B, or other disease, or any combination thereof.
[0077] Without further elaboration, it is believed that one skilled in the art can, based on the above description, utilize the present disclosure to its fullest extent. The following specific embodiments are, therefore, to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever. All publications cited herein are incorporated by reference for the purposes or subject matter referenced herein.
EXAMPLES
Example 1: Modulating VP1:VP2:VP3 Ratios in Stable Cell Lines Using Attenuated Kozak Sequences
[0078] The biological potency (e.g., infectivity) of rAAV particles partly depends on the virion capsid composition, for example, the stoichiometric ratios of the capsid proteins VP1, VP2, and VP3. Some rAAV serotypes (e.g., AAV5, AAV8, AAV9, AAV3 and AAV6) manufactured in a heterologous system such as insect cells (e.g., Sf9 cells) are characterized by abnormal VP1 expression levels. Upon viral assembly, the abnormal VP1 expression results in the production of viral particles comprised of improper capsid protein ratios, which hinders the ability of the particles to efficiently transduce cells. Methods of obtaining useful stoichiometric ratios of capsid proteins are complicated by results indicating that an overabundance of VP1 can impair the insect cell's ability to efficiently package the viral particle while low levels of VP1 can result in particles with inefficient transduction. Thus, with respect to insect cell rAAV production using current systems, it remains a challenge to find a method of increasing the yield of infective particles without detrimentally affecting particle assembly.
[0079] The current investigation seeks to improve capsid protein ratios by modulating the initiation of the translation rate of VP1 in rAAV expressed in Sf9 insect cells. Specifically, the Kozak sequences of VP1 in AAV5, AAV8, AAV9, AAV3 and AAV6 were attenuated while the canonical ATG start codon was kept constant, and transduction efficiencies were measured to assess the assembled particles.
[0080] A set of attenuated Kozak elements were designed for AAV5, and nucleic acids encoding these elements were generated. The encoded Kozak sequences are shown in Table 6. A subset of four Kozak elements were found to encode for capsid proteins with ratios close to the wild-type AAV5 VP1:VP2:VP3 ratio of 1:1:10, as illustrated by Western blotting analysis depicted in
TABLE-US-00006 TABLE6 AAV5VP1KozakSequences Efficiency Sequence KozakSequence (%) 1 CAUUGUAUGUC(SEQIDNO:2) 32 2 UCGUUUAUGGA(SEQIDNO:3) 30 3 CAGUUUAUGGU(SEQIDNO:4) 20 4 CAUUGUAUGGU(SEQIDNO:5) 16 5 UAGUGUAUGCU(SEQIDNO:6) 14 6 CAUUGUAUGCU(SEQIDNO:7) 12 7 UCUUUUAUGUC(SEQIDNO:8) 43 8 UGUUUUAUGUC(SEQIDNO:9) 40 9 UAGUUUAUGUC(SEQIDNO:10) 37 10 UAGUGUAUGUC(SEQIDNO:11) 33
[0081] AAV5 Kozak sequence 7 generated a respective VP1:VP2:VP3 ratio of 2:1:(8-9). In comparison with AAV5 isolated from HEK 293 cells, sequence 7 particles generated in insect cells displayed 2-fold greater transduction efficiency. AAV5 Kozak sequence 8 generated a respective VP1:VP2:VP3 ratio of (1-1.5):1:10. In comparison with AAV5 isolated from HEK 293 cells, sequence 8 particles displayed 3- to 5-fold greater transduction efficiency. It was noted that the yield of the packaged rAAV5 variant of sequence 8 was approximately 10 times higher than that of sequence 7.
[0082] A set of attenuated Kozak elements were designed for AAV8, and nucleic acids encoding these elements were generated. The encoded Kozak sequences are shown in Table 7.
TABLE-US-00007 TABLE7 AAV8VP1KozakSequences Efficiency Sequence KozakSequence (%) 1 UAGCGCAUGGC(SEQIDNO:13) 70 2 UGGUAUAUGGC(SEQIDNO:14) 60 3 UAGUUUAUGGC(SEQIDNO:15) 50 4 CAGUGUAUGGC(SEQIDNO:16) 46-47 5 UAGUGUAUGGC(SEQIDNO:17) 45 6 UAUUGUAUGGC(SEQIDNO:18) 44 7 CAUUGUAUGGC(SEQIDNO:19) 43 8 CCGUUUAUGGG(SEQIDNO:20) 41-42 9 ACUUGUAUGGG(SEQIDNO:21) 40 10 CAUUUUAUGGG(SEQIDNO:22) 37 11 UAGUGUAUGUC(SEQIDNO:23) 34 12 UAGUUUAUGUC(SEQIDNO:24) 31 13 UGUUUUAUGUC(SEQIDNO:25) 33 14 UCUUUUAUGUC(SEQIDNO:26) 37 15 UAGUGUAUGGG(SEQIDNO:27) 40 16 UAGUUUAUGGG(SEQIDNO:28) 43 17 UGUUUUAUGGG(SEQIDNO:29) 33 18 UCUUUUAUGGG(SEQIDNO:30) 38 19 UAGUGUAUGUC(SEQIDNO:31) 42 20 UAGUUUAUGUC(SEQIDNO:32) 43
[0083] AAV8 Kozak sequences 1-12 demonstrated hyper-expression of VP1 and low expression of VP2 and VP3, as illustrated by Western blotting analysis depicted in
[0084] A set of attenuated Kozak elements were designed for AAV9, and nucleic acids encoding these elements were generated. The encoded Kozak sequences are shown in Table 8.
TABLE-US-00008 TABLE8 AAV9VP1KozakSequences Efficiency Sequence KozakSequence (%) 1 UAGUGUAUGUC(SEQIDNO:34) 33 2 UAGUUUAUGUC(SEQIDNO:35) 37 3 UGUUUUAUGUC(SEQIDNO:36) 40 4 UCUUUUAUGUC(SEQIDNO:37) 43 5 UAGUGUAUGGG(SEQIDNO:38) 33 6 UAGUUUAUGGG(SEQIDNO:39) 38 7 UGUUUUAUGGG(SEQIDNO:40) 42 8 UCUUUUAUGGG(SEQIDNO:41) 43 9 UAGUGUAUGGC(SEQIDNO:42) 45 10 UAGUUUAUGGC(SEQIDNO:43) 50 11 UGUUUUAUGGC(SEQIDNO:44) 54 12 UCUUUUAUGGC(SEQIDNO:45) 57
[0085] AAV9 Kozak sequences 2 (SEQ ID NO: 35), 3 (SEQ ID NO: 36), 5 (SEQ ID NO: 38), and 9 (SEQ ID NO: 42) directed AAV9 capsids with satisfactory VP1:VP2:VP3 ratios, as illustrated by Western blotting analysis depicted in
[0086] A set of attenuated Kozak elements were designed for AAV6, and nucleic acids encoding these elements were generated. The encoded Kozak sequences are shown in Table 9.
TABLE-US-00009 TABLE9 AAV6VP1KozakSequences Efficiency Sequence KozakSequence (%) 1 UAGUUUAUGGC(SEQIDNO:56) 50 2 CAGUUUAUGGC(SEQIDNO:57) 50 3 UAUUGCAUGGC(SEQIDNO:58) 47 4 UAGUGUAUGGC(SEQIDNO:59) 45 5 AAUUGUAUGGC(SEQIDNO:60) 45 6 UAUUGUAUGGC(SEQIDNO:61) 44 7 CAUUGUAUGGC(SEQIDNO:62) 43 8 UGUUUUAUGGG(SEQIDNO:63) 42 9 UGUUUUAUGUC(SEQIDNO:64) 40 10 UAUUUUAUGGG(SEQIDNO:65) 39 11 UAGUUUAUGGG(SEQIDNO:66) 38 12 UAGUUUAUGUC(SEQIDNO:67) 37
Example 2: Evaluating rAAV
[0087] The major drawback of the Baculovirus/Sf9 system for rAAV manufacturing is that most of the Bac-derived rAAV vector serotypes, with few exceptions, demonstrate altered capsid compositions and lower biological potencies. A new insect cell-based production platform utilizing attenuated Kozak sequence and a leaky ribosome scanning to achieve a serotype-specific modulation of AAV capsid proteins stoichiometry is described. By way of example, rAAV5 and rAAV9 were produced and comprehensively characterized, side-by-side with HEK 293 derived vectors. A mass spectrometry analysis documented a three-fold increase in both VP1 and VP2 capsid protein content compared to human cells-derived vectors. Furthermore, an extensive analysis of encapsidated single-stranded viral DNA was conducted using Next-Generation Sequencing and showed a six-fold reduction in collaterally packaged contaminating DNA for rAAV5 produced in insect cells. Consequently, the re-designed rAAVs demonstrated significantly higher biological potencies, even in a comparison to HEK 293-manufactured rAAVs mediating, in case of rAAV5, four-fold higher transduction of brain tissues in mice. Thus, the described system yields rAAV vectors of superior infectivity and exceptional purity providing a scalable platform for GMP grade vector production.
[0088] rAAV is extensively used as a vector for gene therapy/DNA vaccine delivery, but a scale-up production of a highly infectious rAAVs for clinical trials remains a challenging proposition. AAV capsid consists of three capsid proteins, VP1, VP2, and VP3, derived via alternative splicing and differential codon usage of a single capsid gene in AAV genome. The VP3 sequence is common between all three splice variants, and VP2 and VP1 have N-terminal longer sequences, with unique region of VP1 containing a phospholipase domain A2 critical for virus infection.sup.1. The exact amounts of VP1/VP2/VP3 in the capsid are unknown but estimated to be 1/1/10, based on densitometry analyses of the capsid proteins resolved on SDS-PAGE.sup.2-4. Moreover, it appears that there is no defined VP1/VP2/VP3 stoichiometry and that the assembly is stochastic such that the relative amoun37t of VP1/VP2/VP3 that is incorporated in the capsid depends mainly on their relative expression levels.sup.5. Therefore, the design of capsid proteins expression unit in a given rAAV production system is essential for the assembly of biologically potent gene therapy vectors.
[0089] Towards this goal, one of the original scalable systems utilized a suspension culture of Sf9 insect cells co-infected with three recombinant baculoviruses derived from A. californica multicapsid nucleopolyhedrovirus (AcMNPV) encoding, respectively, rAAV transgene cassette, AAV rep, and cap helper genes.sup.6. Most of the AAV serotypes produced in this system, however, were characterized by low transduction efficiencies compared to HEK 293-derived vectors due to an inappropriate content of VP1 capsid protein and its phospholipase A2 activity.sup.7-10. This shortcoming resulted from the capsid gene helper vector design utilizing a non-canonical ACG initiation codon for VP1 to induce a leaky ribosome scanning. Even though other groups resolved the problem to some extent utilizing a different initiation codon CUG.sup.11 or artificial intron.sup.12, the solutions appeared to lack the flexibility necessary for a serotype-specific sequence adjustment. A novel system of regulation of a relative VP1/VP2/VP3 composition via adjustable leaky ribosome scanning is introduced.
[0090] In cells of mammalian origin, a P40-driven transcript in AAV undergoes splicing to produce two spliced mRNA variants encoding VP1, or VP2/VP3 capsid proteins, respectively. Because in the baculovirus/Sf9 system the polh promoter is substituted for the P40/intron sequence, the regulation by splicing is not available and alternative regulation of the VP1 expression via leaky ribosome scanning is used. A consensus sequence GCCRCCAUGGC (SEQ ID NO: 71) (R=A or G) is considered to be an effective mammalian translation initiation site (TIS), also known as Kozak sequence.sup.13. Any deviation from this sequence would increase leaky scanning of the VP1 AUG and initiation of translation from the in-frame downstream VP2 ACG or VP3 AUG codons thus changing the VP1/VP2/VP3 stoichiometry. In the current work, an approach for rationally modulating the ratios of VP1/VP2/VP3 capsid composition in a Baculovirus/Sf9 system to derive particles with a higher VP1/VP2 content resulting in significantly greater biological potency even compared to HEK 293-derived vectors is described.
[0091] To characterize this advanced production platform in its entirety, a Next-generation sequence (NGS) analysis of encapsidated DNA manufactured was conducted by two methods: a conventional triple plasmid co-transfection of HEK 293 and single BEV infection of Sf9 cell line incorporating stably integrated rep/cap helper genes. Direct side-by-side NGS analysis of the rAAV cassettes manufactured by two platforms revealed higher precision of viral DNA packaging in insect cells encapsidating significantly less contaminating DNA.
[0092] Design of AAV5 and rAAV9 Capsid Genes.
[0093] To increase a leaky ribosome scanning a canonical AUG codon preceded by attenuated Kozak sequences was used. Randomly modifying nucleotides up- or downstream of the AUG would not be a realistic approach because the complexity of the possible TIS sequences spanning the relevant stretch of eight residues is 65,536 possible permutations. Moreover, the consensus Kozak sequence appears to be different for yeast.sup.14, higher plants.sup.15, invertebrates.sup.16, or vertebrates.sup.17. Therefore, one way to rationalize the screening of attenuated TISs was to utilize the empirical heat map of all possible mammalian TIS permutations derived by Noderer et al..sup.18 whereby all possible combinations of TISs were assigned initiation efficiency values relative to the consensus Kozak sequence.
[0094] A range of 12-43% initiation efficiency was selected and tested for ten mutants differing by 2-4% increments. All ten AAV5 VP1 tested TISs are shown in Table 10 and were used in the context of cap-expressing helper plasmids (
[0095] Characterization of the Rep2/Cap5 Stable Cell Line.
[0096] Individual cell lines were derived using Rep2- and Cap5-expressing plasmids devoid of Rep-binding elements (RBE).sup.8. Cap5 helper contained the following attenuated TIS: UGUUUUAUGUC (SEQ ID NO: 9). Five individual cell lines were propagated and tested as described earlier.sup.7. One cell line, dubbed B8, showing the highest yield of rAAV5-UF26 was chosen for further characterization. The following parameters were investigated.
TABLE-US-00010 TABLE10 WTandattenuatedTISstestedfortheexpression ofAAV5andAAV9capsidgenes. Sequence Efficiency(%)* AAV5KozVP1 wtAAV5 GUAGUCAUGUC 91 (SEQIDNO:68) 1 UCUUUUAUGUC 43 (SEQIDNO:8) 2 UGUUUUAUGUC 40 (SEQIDNO:9) 3 UAGUUUAUGUC 37 (SEQIDNO:10) 4 UAGUGUAUGUC 33 (SEQIDNO:11) 5 CAUUGUAUGUC 32 (SEQIDNO:2) 6 UCGUUUAUGGA 30 (SEQIDNO:3) 7 CAGUUUAUGGU 20 (SEQIDNO:4) 8 CAUUGUAUGGU 16 (SEQIDNO:5) 9 UAGUGUAUGCU 14 (SEQIDNO:6) 10 CAUUGUAUGCU 12 (SEQIDNO:7) AAV9KozVP1 wtAAV9 CCAGGUAUGGC 130 (SEQIDNO:69) 1 UCUUUUAUGGC 57 (SEQIDNO:45) 2 UGUUUUAUGGC 54 (SEQIDNO:44) 3 UAGUUUAUGGC 50 (SEQIDNO:43) 4 UAGUGUAUGGC 45 (SEQIDNO:42) 5 UCUUUUAUGGG 43 (SEQIDNO:41) 6 UCUUUUAUGUC 43 (SEQIDNO:37) 7 UGUUUUAUGGG 42 (SEQIDNO:40) 8 UGUUUUAUGUC 40 (SEQIDNO:36) 9 UAGUUUAUGGG 38 (SEQIDNO:39) 10 UAGUUUAUGUC 37 (SEQIDNO:35) 11 UAGUGUAUGGG 33 (SEQIDNO:38) 12 UAGUGUAUGUC 33 (SEQIDNO:34) *Estimated relative TIS efficiencies.sup.18 Selected sequences for each serotype are highlighted in bold. Underline indicates the VP1 start codon.
[0097] VP1/VP2/VP3 Stoichiometry.
[0098] The capsid composition of rAAV5-GFP purified from HEK 293 cells by sequential double iodixanol gradient deviated from the theoretical value of 1/1/10 for VP1/VP2/VP3 in that it contained a lower VP1 content (
[0099] To quantify the exact numerical values, the densities of the respective capsid bands for rAAV5 were plotted as areas under the curves (AUCs) (
[0100] MALDI-TOF.
[0101] AAV VPs constituting the virion shell share their VP3 C-termini (FIG. 5A, shown in black). VP1 (dashed), and VP2 (dot-dashed) unique N-termini are relatively small compared to the common shared VP3 domain creating a challenge to decipher relative stoichiometry by analyzing their unique tryptic peptides. Therefore, a differential 160/180 labeling approach was used to discriminate identical peptides but derived from VP1, VP2 or VP3. When heavy-oxygen stable isotope water H.sub.2.sup.18O is used during the trypsin digestion, two .sup.18O atoms are exchanged at the C-terminal carboxyl group of the tryptic peptides shifting the mass by 4 Da.sup.20, 21. This shift between the identical peptides derived from two different proteins (e.g., VP1 or VP3) allows for the identification and quantitation of the proteins.
[0102] After conducting the pilot digestion, three peptides (
[0103] Three unique peptides (
TABLE-US-00011 TABLE 11 VP1/VP3 ions, intensities and ratios. Ion, HEK, VP1/VP3 B8, VP1/VP3 M/Z* I II III Average I II III Average 1464 0.029 0.031 0.022 0.027 0.101 0.13446 0.101408 0.11228932 1677 0.057 0.059 0.018 0.045 0.1123019 0.1475244 0.123 0.12760876 2051 0.04 0.038 0.026 0.035 0.178 0.1548061 0.09411 0.14230537 Total Average: 0.036 Total Average: 0.127 *M/Z represents mass divided by charge number.
TABLE-US-00012 TABLE 12 VP2/VP3 ions, intensities and ratios. Ion, HEK, VP2/VP3 B8, VP2/VP3 M/Z* I II III Average I II III Average 1464 0.046521 0.045163 0.037953 0.043 0.177247 0.203963 0.218152 0.1997873 1677 0.045479 0.044517 0.027105 0.039 0.162602 0.178148 0.150699 0.1638163 2051 0.040742 0.031026 0.031464 0.034 0.22123 0.137658 0.165207 0.1746982 Total Average: 0.039 Total Average: 0.179 *M/Z represents mass divided by charge number.
[0104] Full/Empty Particles Ratios.
[0105] This parameter was investigated to determine whether either of the two manufacturing platforms produces higher ratios of empty particles, a potential source of untoward immune response and a technical challenge during vector purification. rAAV5 and rAAV9 were purified by one-step chromatography over monospecific antibody affinity resins, AVB for rAAV5, and POROS CaptureSelect for rAAV9. After purification, the vector genome particle titers were assayed using QC PCR. The total particle titers of rAAV5, and rAAV9 vectors were assayed using Nanoparticle Tracking Analysis (NTA) of rAAV capsids decorated with gold nanoparticles. This approach utilizes the electrostatic attraction between a highly scattering material such as gold nanoparticles and the viral capsid. The resulting gold-labeled virus particles scatter enough light to be visualized and tracked by the optical system (
[0106] After calculating the ratio of total-to-full particles, these values for HEK 293-derived rAAV9 were 2.8, and for Sf9-derived rAAV93.1 (
[0107] Transduction Efficiency In Vitro.
[0108] An rAAV transgene cassette incorporating luciferase and mApple reporter genes (
[0109] In addition, rAAV3-Luc-mApple vectors, purified and titered side-by-side, were used to infect HEK 293 and Sf9 cells. FACS analysis (
[0110] Transduction efficiency in vivo (
[0111] Next-Generation Sequencing (NGS) Analysis of rAAV5 Vectors Produced in HEK 293 and Sf9 Cells.
[0112] Having established an improved OneBac system for the production of higher potency rAAV5-based vectors, a comparative NGS analysis was conducted of the encapsidated ssDNA (pTR-Bac-UF26,
Collateral Packaging of Contaminating DNA Sequences.
[0113] After filtering, the total numbers of reads assigned to an index was 757,433,116. After the alignment of reads to the referenced sequences, the coverage for rAAV cassette reached as high as 2,260,074 reads/nt (nt position 2,000). For collaterally packaged sequences the coverage was significantly lower: 10,781 reads/nt (nt position 1,299, vector backbone), or 6,424 reads/nt (nt position 200, AcMNPV genome).
[0114] For both production protocols, the majority of reads were the rAAV-Bac-UF26 cassette which accounted for 96.5% (HEK 293) and 99.4% (Sf9) of all encapsidated DNA sequences (Table 13,
[0115] The collaterally packaged sequences were more abundantly represented by the immediate junctions of the rAAV cassette and its respective backbones: bacterial plasmid for HEK 293 cells and baculovirus genome for Sf9 cells. Notably, there was a significant difference, at least ten-fold, in the junction reads coverage between two systems whereby HEK 293 cells appear to encapsidate, at much higher frequencies, bacterial plasmid backbone sequences which are more distant from both the left and right AAV terminal repeats (
TABLE-US-00013 TABLE 13 Analysis of specific and collateral packaging of rAAV5-UF26 in HEK 293 and Sf9 cells* HEK 293 Sf9 Reference NGS library Reference NGS library genome PCR free PCR genome PCR free PCR UF26cassette 96.50 95.24 UF26 99.44 99.25 96.59 95.38 cassette 99.45 99.29 Vector 2.58 3.49 Vector 0.30 0.42 backbones 2.52 3.39 backbone 0.30 0.42 pHelper 0.04 0.04 AcMNPV 0.22 0.29 0.04 0.04 0.21 0.25 rep2cap5 0.71 1.00 cap5 0.009 0.002 0.68 0.97 0.009 0.002 rep2 0.005 0.001 0.006 0.001 H. sapiens 0.17 0.22 S. frugiperda 0.026 0.040 0.17 0.22 0.025 0.041 *Relative content of DNA in purified virions is shown as percentage of total sequences identified by NGS analysis. All NGS analyses were conducted in duplicates shown for each reference genome in two parallel rows.
[0116] rAAV Genome Coverage.
[0117] Using a standard protocol, which included only eight cycles of PCR amplification step to generate NGS libraries, several sequences were identified within the CBA promoter and the downstream intron displaying at least ten-fold lower sequencing coverage compared to the rest of the rAAV cassette. Close examination revealed that these sequences are extremely GC-rich (
[0118] Genomic Identity of rAAV-Bac-UF26 Cassette.
[0119] The high sequencing depth of AAV cassette allowed for the detailed analysis of the packaged DNA sequence identity and correlation to its respective parent bacterial plasmid. To reduce the probability of false calls and to increase the confidence of single nucleotide polymorphism (SNP) analysis, only PCR-free samples NGS data were utilized. SNP variants for DNAs from both viral samples, as well as positive control plasmid sample, displayed very similar profiles of substitutions (correlation coefficient of 0.75-0.77) (
[0120] The relatively inferior potency of insect cells-manufactured rAAV vectors of AAV5 and AAV8 serotypes was previously documented by Urabe et al..sup.10 and Kohlbrenner et al..sup.9 Subsequently, it was shown that many other OneBac-derived AAV serotypes were characterized by lower infectivity compared to 293-derived AAVs.sup.27. The unifying cause for all affected serotypes was the modified sequence of a capsid helper gene resulted in lower content of VP1 capsid protein incorporating phospholipase A2 activity. As expected, the recommended solutions were aimed at alleviating this problem by using a different initiation codon CUG.sup.11 or artificial intron.sup.8,12. Even though new designs helped to increase the infectivity for some vectors, the solutions appeared to lack flexibility necessary for a serotype-specific sequence adjustment.
[0121] A new approach is described herein to increase relative VP1/VP2 content of a capsid. This is accomplished by modifying a canonical Kozak sequence preceding VP1 AUG start codon. As a proof of principle, a range of Kozak sequences were tested for AAV5 and AAV9 serotypes showing that the most favorable translation initiation sites were serotype-specific producing rAAV vectors which exceeded transduction efficiencies of HEK 293-derived counterparts. The described approach, however, requires fine adjustment of VP1 Kozak sequence in the narrow window of relative TIS efficiencies which also varies for different serotypes. One of the reasons for this variation is that the VP1:VP2:VP3 ratios depend not only on VP1 TIS relative efficiency, but also on the ones of VP2 and VP3 TISs which are also different for all serotypes (Table 14). Moreover, intentionally increasing VP1 content above certain threshold (e.g.,
TABLE-US-00014 TABLE14 TranslationinitiationsequencessurroundingVP1,VP2,andVP3start codonsinAAVserotypes VP1ORF VP2ORF VP3ORF AAV Kozak Kozak Kozak serotype up TIS,% down up TIS,% down up TIS,% down 1 CCAGGT ATG(130) GC GCTAAG ACG GC ACTACA ATG(115) GC 2 TCAGGT ATG(133) GC GTTAAG ACG GC AATACG ATG(114) GC 3 CCAGGT ATG(130) GC GCTAAA ACG GC AATACA ATG(108) GC 4 CCAGAT ATG(99) AC GGTGAG ACG GC AGTGAG ATG(80) CG 5 GTAGTC ATG(91) TC GCTAAG ACG GC GATACA ATG(114) TC 6 TTTAAA ATG(126) GC GCTAAG ACG GC ACTACA ATG(115) GC 7 CCAGGT ATG(130) GC GCTAAG ACG GC GGTACA GTG* GC 8 CCAGGT ATG(130) GC GCTAAG ACG GC AATACA ATG(108) GC 9 TCAGGT ATG(133) GC GCTAAG ACG GC CTTACA ATG(129) GC 10 CCAGGT ATG(130) GC GCTAAG ACG GC GGTACA ATG(113) GC 11 CCAGGT ATG(130) GC GCTAAA ACG GC ATTGAA ATG(81) CG *designates a putative alternative initiation codon VP3 in AAV7 deduced by sequences alignment of AAV serotypes capsid genes. The relative strength of Kozak TIS is expressed in % next to the initiation codon.sup.18
[0122] In the rAAV5 construct selected for the analysis, the numerical value of the relative VP1 content was increased from 0.2-0.4 in HEK 293-derived vector (by two independent assays) to 0.7-1.1 in Sf9 cells (i.e., increased by 3 fold on average). For VP2, these values increased from 0.5 to 1.7, a similar 3-fold increase. A concurrent increase of VP2 was one of the unpredicted effects of the relative increase of rAAV5 VP1. The N-termini of both VP1 and VP2 incorporate the so-called basic region 3 (BR3, PKRKKART (SEQ ID NO: 73)) representing conservative nuclear localization sequence (NLS) motif which is useful for AAV to deliver its genome within the nucleus and subsequently transduce the cells.sup.28-30. It is thus not surprising that a 3-fold increase of each VP1 and VP2 increases the yield of a more infectious virus.
[0123] The data provided above does not include direct comparison of rAAV5 and rAAV9 manufactured in recently described OneBac2.0.sup.8 and the current system. However, one can relate the respective capsid ratios and conclude that for these serotypes, the newly designed cap helper genes significantly improved both AAV5 and AAV9 capsid stoichiometry, which translate into higher potency viral vectors.
[0124] Another unexpected finding was the similarity of packaging efficiencies displayed by HEK 293 and Sf9 cells which were assessed by a surrogate parameter of full-to-empty particles ratios. Using the previously identified ratio of rep/cap expression cassettes of 1:2.5 to construct a stable producer cell line.sup.7, similar to HEK 293 packaging efficiency was achieved.
[0125] With many clinical trials under way, assessing the genetic identity of rAAV stocks manufactured by different protocols becomes a pressing regulatory issue. Many groups have reported a collateral encapsidation of sequences derived from packaging host cells 26, 31, 32, bacterial helper plasmid backbones.sup.26, 33, helper viruses.sup.8, 32, and wt AAV rep/cap sequences.sup.26, 34. To evaluate the genetic identity of the packaged rAAV cassette NGS analysis of encapsidated single-stranded viral DNA was conducted. The pilot analysis showed uneven sequence coverage of the cassettes in the GC-enriched sequences which were almost identical for both platforms. Utilizing PCR-free protocol, it was shown that the drop of coverage apparently resulted from the PCR-induced artifacts during libraries preparation and not from packaging of the truncated rAAV genomes.sup.35, 36. The accuracy of PCR-based methods for NGS libraries preparations were questioned by several groups as not appropriate for AAV-related analysis.sup.37 especially in GC-rich palindromes such as inverted terminal repeats (ITRs), or applied for any GC-enriched sequence.sup.38. Consequently, NGS analysis of rAAV vector preparations should be carried using adequate protocols.
[0126] Analysis of the genetic identity of the viral DNA derived from both platforms showed no significant differences between the encapsidated rAAV DNA in insect vs human cells. Of note, however, is a fact of a documented here deviation of the sequence of the pTR-Bac-UF26 plasmid DNA pool used to transfect HEK 293 cells, from the sequence of this plasmid in the database. The fact of such genetic drift of a plasmid DNA, while surprising, can be explained by the following mechanism. rAAV cassettes-containing plasmids are propagated in recombination-deficient strains of E. coli to maintain the integrity of AAV ITRs. These strains lack components of pathways (endA, recB recJ) that catalyze rearrangement and deletion of nonstandard secondary and tertiary structures. As a result, plasmid DNA accumulates mismatched bases and point mutations which otherwise would be restored by the mismatch repair system. Mismatches in DNA, if not repaired, result in a high spontaneous mutation frequency. Therefore, during transfection, mutated plasmid DNA carries its heteroduplex imprinted structure over into host HEK 293 cell nuclei, where it is either repaired.sup.39 or replicated copying the mutation. Thus, the plasmid DNA pool in a co-transfection protocol carries over some of the mutagenesis burden of E. coli into encapsidated AAV cassettes which could be substantial for some GC-rich sequences. Interestingly, the GFP reporter cDNA appears to have a minimal number of mutations (
[0127] Direct side-by-side NGS analysis of rAAV cassettes manufactured by the two platforms revealed, unexpectedly, higher precision of viral DNA packaging in insect cells, encapsidating considerably less contaminating DNA (0.6% vs 3.5%). This 6-fold reduction appears to be significant if one takes into account that FDA guidelines state that the level of residual cell-substrate DNA should be 10 ng per dose (fda.gov/downloads/AdvisoryCommittees/CommitteesMeetingMaterials/BloodVaccinesandOtherBiologics/VaccinesandRelatedBiologicalProductsAdvisoryCommittee/UCM319573.pdf).
[0128] Considering current clinical trials with rAAV whereupon the doses reached as high as 610.sup.13 vg/kg.sup.42,43 the vector, if produced in HEK 293 cells, would incorporate amounts of contaminating DNA that would exceed FDA guidelines. Here, it was shown that rAAV5 vectors produced using the OneBac system are significantly more infectious and, at the same time, encapsidate less amount of foreign DNA. Therefore, this method of production improves the potential therapeutic outcome of the vector administration by reducing its effective dose and advancing safety.
Materials and Methods
[0129] The following non-limiting materials and methods were used in connection with certain experiments described in this application. These or other materials and methods can be used in connection with embodiments described in this application.
rAAV5 and rAAV9 Production in HEK 293 Cells
[0130] Both rAAV5 and rAAV9 vectors were produced by a triple co-transfection procedure as described previously.sup.44. Plasmids harboring rAAV cassettes (rAAV5-Bac-UF26, or rAAV5-UF50-BC, as well as rAAV9-Bac-UF26,
rAAV5 and rAAV9 Production in Sf9 Cells
[0131] Bac-UF26, or UF50-BC rAAV cassettes were inserted into pFastBac backbone and the respective BEVs were derived following Bac-to-Bac system guidelines. Plaque-purified BEVs were propagated to P3, titered by a plaque assay, and used to infect Sf9-based stable cell lines harboring rep2cap5, or rep2cap9 inducible helper genes, as described previously.sup.7. Upon harvesting, freeze-thaw lysates were treated with benzonase and clarified by a high-speed centrifugation at 20,000 g for 30 min. Supernatants were purified as described above for 293 HEK-manufactured AAV.
[0132] One Step Purification of rAAV5 and rAAV9.
[0133] rAAV5 was purified from clarified crude lysate using AVB Sepharose High Performance affinity chromatography resin (GE Healthcare), as described previously.sup.45. rAAV9 was purified by one step affinity chromatography using POROS CAPTURESELECT AAV9 resin (Thermo Fisher) from a crude lysate. Specifically, a clarified crude lysate was applied under gravity to a column containing 0.5 ml resin, the column was then washed with 10 column volumes of 1PBS, followed by 1 ml elution buffer: 50 mM citrate buffer pH 3.0-1 M NaCl. The eluted rAAV9 was immediately neutralized by 0.1 ml 1 M TrisHCl pH 8.4.
rAAV Titering
[0134] Direct comparative analysis of rAAV vectors requires an accurate estimate of the respective viral titers. Four independent assays were used to titer rAAV derived from HEK 293 or Sf9 cells: 1) Droplet Digital PCR (ddPCR).sup.46to establish a reference standard, using BioRad QX200 Digital PCR System; 2) quantitative competitive PCR (QC-PCR) using iTaq Universal SYBR Green Supermix kit (BioRad, 1725121) and qPCR BioRad CFX Connect RealTime System; 3) a picogreen-based protocol.sup.47, and 4) Nanoparticle Tracking Analysis (NTA) using NanoSight 300 (NS-300, Malvern Instruments, Malvern, UK)to quantify the titer and the size of rAAV particles. After establishing the conditions of each protocol, and using a reference standard derived by ddPCR, the calculated titers from protocols 2) and 3) were always within a factor of 2, and were averaged to derive the working titers. Briefly, the following procedures were followed.
[0135] ddPCR. A set of dilutions, in triplicates, in the range of 1-10.sup.3 viral genome copies per reaction was prepared using 1Lactate Ringer (LR) solution supplemented with 0.05% Pluronic F-68. DdPCR was carried out using the following primers: TM_CMV_F 5-ATAGGGACTTTCCATTGACGTC-3 (SEQ ID NO: 74), TM_CMV_R 5-TGATACACTTGATGTACTGCCAAG-3 (SEQ ID NO: 75), TM_CMV_Probe FAM 5-TGGGTGGACTATTTACGGTAAACTGCC-3 BHQ (SEQ ID NO: 76).
[0136] QC-PCR.
[0137] To derive a standard curve, rAAV-UF26 transgene cassette was gel-purified after SmaI digestion of the respective plasmid pTR-Bac-UF26. The recovered DNA was diluted to the approximate concentration of 1 ng/l and the precise concentration was determined by QUBIT dsDNA assay. Direct QC-PCR titering of highly purified Sf9- or HEK 29-produced rAAV were performed with the same primers set and using the standard curve prepared by 10-fold serial dilutions of a reference rAAV sample (ddPCR), and the gel-purified rAAV cassette (QC-PCR).
[0138] PicoGreen-based assay was conducted by Quanti-iT PicoGreen dsDNA Assay kit (Life Technology, P7589), using Lambda DNA standard to calibrate the standard curve as described.sup.47. Optical density was measured by Perkin Elmer 1420 Multilabel Counter Victor V.
[0139] NTA.
[0140] Prior to the NTA analysis, the titers of the viral stocks were assessed by PAAG gel electrophoresis. Knowing approximate titers, 50 l of AAV stock diluted in LR buffer were added to a labeling mix containing labeling buffer (20 mM Citric acid, pH 3.5, 0.1% Pluronic F68, 1 mM NaCl) and gold nano-particles (Sigma, Cat. #741949). After 30 min incubation at RT, gold-labeled AAV was diluted by the labeling buffer to a final concentration of 510.sup.8-310.sup.9 particles/mL. Labeling mix without AAV and AAV in the labeling buffer without gold was used as a negative control. Measurements were carried out using an NS-300 instrument with the following settings: Laser TypeBlue488, camera level15, number of frames749, time of recording30 sec, number of records3 per each data point. At least four data points generated by NS-300 were used to calculate an AAV titer.
[0141] MALDI-TOF.
[0142] VP1, VP2, and VP3 bands were cut out from SDS-PAGE and prepared for trypsin digestion. Capsid proteins were digested in gel slices with sequencing grade trypsin from Promega (Madison Wis.) using a manufacturer recommended protocol. Briefly, bands were trimmed as close as possible to minimize background polyacrylamide material. Gel pieces were then washed in nanopure H.sub.2O for 5 min. The wash step was repeated twice followed by two cycles of de-staining with 1:1 v/v methanol:50 mM ammonium bicarbonate for 10 min each cycle. The gel pieces were dehydrated with 1:1 v/v acetonitrile:50 mM ammonium bicarbonate. The gel slices were rehydrated and incubated with dithiothreitol (DTT) solution (25 mM in 100 mM ammonium bicarbonate) for 30 min prior to the addition of 55 mM Iodoacetamide in 100 mM ammonium bicarbonate solution. Iodoacetamide was incubated with the gel slices in darkness for 30 min. Gel slices were washed again with two cycles of H.sub.2O and dehydrated with 1:1 v/v acetonitrile:50 mM ammonium bicarbonate. The protease was driven into the gel pieces by rehydrating them in 12 ng/ml trypsin in 0.01% ProteaseMAX Surfactant for 5 min. The gel piece was then overlaid with 40 L of 0.01% ProteaseMAX surfactant:50 mM ammonium bicarbonate and gently mixed on a shaker for 1 hr. The digestion was stopped by addition of 0.5% TFA. MS analysis was either immediately performed to ensure high quality tryptic peptides with minimal non-specific cleavage or samples were frozen at 80 C. until they could be analyzed. The .sup.18O-labeled digest was performed the same way except the ProteaseMAX Surfactant, and trypsin was prepared in H.sub.2.sup.18O. In order to prevent back exchange, trypsin was inactivated by incubation at 100 C. for 15 min. VP3 was digested using H.sub.2.sup.18O while VP1 was digested in regular H.sub.2.sup.16O; the digestion products mixed 1:1 and analyzed by MALDI-TOF. A similar analysis was conducted for VP2/VP3 as well.
[0143] MALDI-TOF was performed on a Bruker Daltonics Microflex LRF mass spectrometer (Bruker Daltonics, Breman, Germany) operated in reflectron, positive ion mode with a N2 laser. Laser power was used at the threshold level required to generate signal. The instrument was calibrated with Peptide Calibration Standard II (Bruker Daltonics) which is a mixture of Angiotensin II, Angiotensin I, Substance P, Bombesin, ACTH clip 1-17, ACTH clip 18-39, Somatostatin 28, Bradykinin Fragment 1-7, Renin Substrate Tetradecapeptide porcine with a covered mass range 700 Da-3200 Da. -cyano-4-hydroxycinnamic acid was used as the matrix and prepared as a saturated solutions in 50% ACN/0.1% TFA (in H.sub.2O). Allotments of 1 L of matrix and 1 L of sample were thoroughly mixed together; 0.5 L of this was spotted on the target plate and allowed to dry.
[0144] In Vitro Transduction Assay.
[0145] rAAV5-Bac-UF26 and rAAV9-Bac-UF26 were assayed using C12 cells.sup.24 infected with rAAVs at an MOI of 2,000 and co-infected with Ad5 at an MOI of 5. Forty eight hours after infection, cells, positive for mApple fluorescence, were scored by Fluorescence-activated cell sorting (FACS).
AAV Injections
[0146] All animal procedures were approved by the University of Florida Institutional Animal Care and Use Committee. Four-five week old female BALB/c (The Jackson Laboratory, Bar Harbor, Me. USA) mice were used for the experiments. All surgical procedures were performed using aseptic techniques and isoflurane gas anesthesia. Brain surgeries were performed as previously described.sup.23. Briefly, once anesthetized, mice were placed in the stereotactic frame (Kopf Instruments, Tujunga, Calif.), and 2 l of either HEK- or 8B-derived rAAV5-UF50-BC vectors (4.751011 vg/ml) were injected into the right striatum (coordinates: anterior-posterior0.3 mm, lateral2.0 mm, dorsoventral3.0 mm), through a glass micropipette with an inner diameter of 30-40 m at a rate of 0.5 l/minute. The needle was left in place for 5 min prior to withdrawal from the brain.
Bioluminescence Imaging
[0147] Mice were imaged as previously described.sup.23. Twelve minutes after intraperitoneal injection of D-luciferin (15 mg/mL in PBS, 126 mg luciferin/kg body weight), bioluminescence measurements were obtained from region-of-interest analysis using a Xenogen IVIS Lumia in vivo imaging system (PerkinElmer, Waltman, Mass.). Three mice were imaged at the same time with a field of view of 25 cm. An imaging time of 60 sec with medium binning and an f-stop of 1 were used for the camera settings. The images displayed in each data set were normalized to the appropriate color intensity scale. The BLI data are reported as raw data, as the total number of counts reaching the charge-coupled device detector.
Brain Tissue Preparation and Fluorescence Imaging
[0148] Mice were deeply anesthetized with pentobarbital (Beuthanasia-D) and perfused through the ascending aorta with 10 ml of saline solution, followed by 10 ml of ice-cold 4% paraformaldehyde (PFA) in 0.1 M phosphate buffer, pH 7.4. Brains were removed and post-fixed overnight at 4 C. in 4% PFA. Sixty micrometer-thick coronal sections were cut on a vibratome stage VT1000 S (Leica Microsystems, Wetzlar, Germany). mApple fluorescence was analyzed by a variable mode laser scanner (Typhoon 9200, GE Amersham, Pittsburgh, Pa., USA) or using inverted microscope DMI4000 B (Leica Microsystems, Wetzlar, Germany).
NGS Analysis
[0149] NGS was performed by UF ICBR Core using HiSeq 3000 instrument (Illumina, San Diego, Calif.) and paired-ended sequencing. To demonstrate the reproducibility of selected NGS protocols, all DNA samples were prepared in duplicates. Similarly, all steps of NGS library synthesis, sequencing, and bioinformatics were conducted in parallel and in duplicates.
[0150] The referenced DNA for HEK 293-based production included all DNA sequences which could potentially contaminate rAAV stock: H. sapiens genome sequence (HEK 293, GRCh38.p9, ncbi.nlm.nih.gov/assembly/GCF_000001405.35 or RefSeq assembly accession: GCF_000001405.35); Adenovirus helper plasmid (pHelper, GenBank: AF369965.1); pACGr2c5 encoding AAV2 Rep and AAV5 VP proteins (rep2cap5), and the respective plasmid backbones. For Sf9-based production, the following sequences were analyzed: S. frugiperda genome (JQCY02.1.fsa_nt.gz, GenBank: JQCY00000000.2); AcMNPV genome (GenBank NC_001623.1); S. frugiperda rhabdovirus isolate Sf (GenBank KF947078.1); FastBac shuttle plasmid backbone, and sequences encoding AAV2 Rep and AAV5 VP.
[0151] ACCEL-NGS 2S PCR-Free DNA Library Kit (Swift Biosciences, Ann Arbor, Mich.) containing both PCR-free and PCR-enrichment options was utilized to produce NGS libraries. Deep DNAse treatment of purified rAAV particles and double-stranded (ds) DNA synthesis were performed following the protocol described by Lecomte et al..sup.26 with minor modifications. Briefly, 410.sup.11 vector genomes (vg)-containing particles were extensively treated by Baseline ZERO and Plasmid-Safe exonucleases, followed by Proteinase K and RNAseA treatment. DNA was purified using Mag-Bind RxnPure Plus Kit (Omega Bio-Tek, Norcross, Ga.) using beads:DNA ratio of 2:1. After second strand synthesis with DNApolI, DNA was sonicated using a Covaris instrument. The following settings for DNA shearing were used: target size 400 bp, peak increment power175 W, duty factor10%, cycles per burst200; time38 sec, water level15, water temperature7.6-7.8 C., and the reaction volume47 L. Profiles of sheared input dsDNA and synthesized NGS libraries are presented in
Bioinformatics Analysis
[0152] The flowchart of the bioinformatics workflow is depicted in
REFERENCES
[0153] 1. Girod, A, Wobus, C E, Zadori, Z, Ried, M, Leike, K, Tijssen, P et al. (2002). The VP1 capsid protein of adeno-associated virus type 2 is carrying a phospholipase A2 domain required for virus infectivity. J Gen Virol 83: 973-978. [0154] 2. Rose, J A, Maizel, J V, Jr., Inman, J K & Shatkin, A J. (1971). Structural proteins of adenovirus-associated viruses. J Virol 8: 766-770. [0155] 3. Johnson, F B, Ozer, H L & Hoggan, M D. (1971). Structural proteins of adenovirus-associated virus type 3. J Virol 8: 860-863. [0156] 4. Buller, R M & Rose, J A. (1978). Characterization of adenovirus-associated virus-induced polypeptides in KB cells. J Virol 25: 331-338. [0157] 5. Snijder, J, van de Waterbeemd, M, Damoc, E, Denisov, E, Grinfeld, D, Bennett, A et al. (2014). Defining the stoichiometry and cargo load of viral and bacterial nanoparticles by Orbitrap mass spectrometry. J Am Chem Soc 136: 7295-7299. [0158] 6. Urabe, M, Ding, C & Kotin, R M. (2002). Insect cells as a factory to produce adeno-associated virus type 2 vectors. Hum Gene Ther 13: 1935-1943. [0159] 7. Aslanidi, G, Lamb, K & Zolotukhin, S. (2009). An inducible system for highly efficient production of recombinant adeno-associated virus (rAAV) vectors in insect Sf9 cells. Proc Natl Acad Sci USA 106: 5059-5064. [0160] 8. Mietzsch, M, Casteleyn, V, Weger, S, Zolotukhin, S & Heilbronn, R. (2015). OneBac 2.0: Sf9 Cell Lines for Production of AAV5 Vectors with Enhanced Infectivity and Minimal Encapsidation of Foreign DNA. Hum Gene Ther 26: 688-697. [0161] 9. Kohlbrenner, E, Aslanidi, G, Nash, K, Shklyaev, S, Campbell-Thompson, M, Byrne, B J et al. (2005). Successful production of pseudotyped rAAV vectors using a modified baculovirus expression system. Mol Ther 12: 1217-1225. [0162] 10. Urabe, M, Nakakura, T, Xin, K Q, Obara, Y, Mizukami, H, Kume, A et al. (2006). Scalable generation of high-titer recombinant adeno-associated virus type 5 in insect cells. J Virol 80: 1874-1885. [0163] 11. Urabe, M, Ozawa, K, Haast, S & Hermens, Win E P 2311967 A2 20110420 (EN) (Amsterdam Molecular Therapeutics (AMT) B.V., 2015). [0164] 12. Chen, H. (2008). Intron splicing-mediated expression of AAV Rep and Cap genes and production of AAV vectors in insect cells. Mol Ther 16: 924-930. [0165] 13. Kozak, M. (1999). Initiation of translation in prokaryotes and eukaryotes. Gene 234: 187-208. [0166] 14. Cigan, A M & Donahue, T F. (1987). Sequence and structural features associated with translational initiator regions in yeasta review. Gene 59: 1-18. [0167] 15. Joshi, C P, Zhou, H, Huang, X & Chiang, V L. (1997). Context sequences of translation initiation codon in plants. Plant Mol Biol 35: 993-1001. [0168] 16. Pesole, G, Gissi, C, Grillo, G, Licciulli, F, Liuni, S & Saccone, C. (2000). Analysis of oligonucleotide AUG start codon context in eukariotic mRNAs. Gene 261: 85-91. [0169] 17. Kozak, M. (1987). An analysis of 5-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Res 15: 8125-8148. [0170] 18. Noderer, W L, Flockhart, R J, Bhaduri, A, Diaz de Arce, A J, Zhang, J, Khavari, P A et al. (2014). Quantitative analysis of mammalian translation initiation sites by FACS-seq. Mol Syst Biol 10: 748. [0171] 19. Salganik, M, Venkatakrishnan, B, Bennett, A, Lins, B, Yarbrough, J, Muzyczka, N et al. (2012). Evidence for pH-dependent protease activity in the adeno-associated virus capsid. J Virol 86: 11877-11885. [0172] 20. Storms, H F, van der Heijden, R, Tjaden, U R & van der Greef, J. (2006). Considerations for proteolytic labeling-optimization of 180 incorporation and prohibition of back-exchange. Rapid Commun Mass Spectrom 20: 3491-3497. [0173] 21. Ye, X, Luke, B, Andresson, T & Blonder, J. (2009). 180 stable isotope labeling in MS-based proteomics. Brief Funct Genomic Proteomic 8: 136-144. [0174] 22. Qian, W J, Liu, T, Petyuk, V A, Gritsenko, M A, Petritis, B O, Polpitiya, A D et al. (2009). Large-scale multiplexed quantitative discovery proteomics enabled by the use of an (18)O-labeled universal reference sample. J Proteome Res 8: 290-299. [0175] 23. Marsic, D, Mendez-Gomez, H R & Zolotukhin, S. (2015). High-accuracy biodistribution analysis of adeno-associated virus variants by double barcode sequencing. Mol Ther Methods Clin Dev 2: 15041. [0176] 24. Clark, K R, Voulgaropoulou, F & Johnson, P R. (1996). A stable cell line carrying adenovirus-inducible rep and cap genes allows for infectivity titration of adeno-associated virus vectors. Gene Ther 3: 1124-1132. [0177] 25. Ma, H, Galvin, T A, Glasner, D R, Shaheduzzaman, S & Khan, A S. (2014). Identification of a novel rhabdovirus in Spodoptera frugiperda cell lines. J Virol 88: 6576-6585. [0178] 26. Lecomte, E, Tournaire, B, Cogne, B, Dupont, J B, Lindenbaum, P, Martin-Fontaine, M et al. (2015). Advanced Characterization of DNA Molecules in rAAV Vector Preparations by Single-stranded Virus Next-generation Sequencing. Mol Ther Nucleic Acids 4: e260. [0179] 27. Mietzsch, M, Grasse, S, Zurawski, C, Weger, S, Bennett, A, Agbandje-McKenna, M et al. (2014). OneBac: platform for scalable and high-titer production of adeno-associated virus serotype 1-12 vectors for gene therapy. Hum Gene Ther 25: 212-222. [0180] 28. Grieger, J C, Snowdy, S & Samulski, R J. (2006). Separate basic region motifs within the adeno-associated virus capsid proteins are essential for infectivity and assembly. J Virol 80: 5199-5210. [0181] 29. Sonntag, F, Bleker, S, Leuchs, B, Fischer, R & Kleinschmidt, J A. (2006). Adeno-associated virus type 2 capsids with externalized VP1/VP2 trafficking domains are generated prior to passage through the cytoplasm and are maintained until uncoating occurs in the nucleus. J Virol 80: 11040-11054. [0182] 30. Popa-Wagner, R, Sonntag, F, Schmidt, K, King, J & Kleinschmidt, J A. (2012). Nuclear translocation of adeno-associated virus type 2 capsid proteins for virion assembly. J Gen Virol 93: 1887-1898. [0183] 31. Allay, J A, Sleep, S, Long, S, Tillman, D M, Clark, R, Carney, G et al. (2011). Good manufacturing practice production of self-complementary serotype 8 adeno-associated viral vector for a hemophilia B clinical trial. Hum Gene Ther 22: 595-604. [0184] 32. Ye, G J, Scotti, M M, Liu, J, Wang, L, Knop, D R & Veres, G. (2011). Clearance and characterization of residual HSV DNA in recombinant adeno-associated virus produced by an HSV complementation system. Gene Ther 18: 135-144. [0185] 33. Chadeuf, G, Ciron, C, Moullier, P & Salvetti, A. (2005). Evidence for encapsidation of prokaryotic sequences during recombinant adeno-associated virus production and their in vivo persistence after vector delivery. Mol Ther 12: 744-753. [0186] 34. Nony, P, Chadeuf, G, Tessier, J, Moullier, P & Salvetti, A. (2003). Evidence for packaging of rep-cap sequences into adeno-associated virus (AAV) type 2 capsids in the absence of inverted terminal repeats: a model for generation of rep-positive AAV particles. J Virol 77: 776-781. [0187] 35. Kapranov, P, Chen, L, Dederich, D, Dong, B, He, J, Steinmann, K E et al. (2012). Native molecular state of adeno-associated viral vectors revealed by single-molecule sequencing. Hum Gene Ther 23: 46-55. [0188] 36. Wang, Y, Ling, C, Song, L, Wang, L, Aslanidi, G V, Tan, M et al. (2012). Limitations of encapsidation of recombinant self-complementary adeno-associated viral genomes in different serotype capsids and their quantitation. Hum Gene Ther Methods 23: 225-233. [0189] 37. Cogne, B, Snyder, R, Lindenbaum, P, Dupont, J B, Redon, R, Moullier, P et al. (2014). NGS library preparation may generate artifactual integration sites of AAV vectors. Nat Med 20: 577-578. [0190] 38. Kozarewa, I, Ning, Z, Quail, M A, Sanders, M J, Berriman, M & Turner, D J. (2009). Amplification-free Illumina sequencing-library preparation facilitates improved mapping and assembly of (G+C)-biased genomes. Nat Methods 6: 291-295. [0191] 39. Folger, K R, Thomas, K & Capecchi, M R. (1985). Efficient correction of mismatched bases in plasmid heteroduplexes injected into cultured mammalian cell nuclei. Mol Cell Biol 5: 70-74. [0192] 40. Zolotukhin, S, Potter, M, Hauswirth, W W, Guy, J & Muzyczka, N. (1996). A humanized green fluorescent protein cDNA adapted for high-level expression in mammalian cells. J Virol 70: 4646-4654. [0193] 41. Faust, S M, Bell, P, Cutler, B J, Ashley, S N, Zhu, Y, Rabinowitz, J E et al. (2013). CpG-depleted adeno-associated virus vectors evade immune detection. J Clin Invest 123: 2994-3001. [0194] 42. Herzog, R W. (2016). A Cure For Hemophilia: the Promise Becomes a Reality. Mol Ther 24: 1503-1504. [0195] 43. Dolgin, E. (2016). Early clinical data raise the bar for hemophilia gene therapies. Nat Biotechnol 34: 999-1001. [0196] 44. Zolotukhin, S, Byrne, B J, Mason, E, Zolotukhin, I, Potter, M, Chesnut, K et al. (1999). Recombinant adeno-associated virus purification using novel methods improves infectious titer and yield. Gene Ther 6: 973-985. [0197] 45. Smith, R H, Levy, J R & Kotin, R M. (2009). A simplified baculovirus-AAV expression vector system coupled with one-step affinity purification yields high-titer rAAV stocks from insect cells. Mol Ther 17: 1888-1896. [0198] 46. Lock, M, Alvira, M R, Chen, S J & Wilson, J M. (2014). Absolute determination of single-stranded and self-complementary adeno-associated viral vector genome titers by droplet digital PCR. Hum Gene Ther Methods 25: 115-125. [0199] 47. Piedra, J, Ontiveros, M, Miravet, S, Penalva, C, Monfar, M & Chillon, M. (2015). Development of a rapid, robust, and universal picogreen-based method to titer adeno-associated vectors. Hum Gene Ther Methods 26: 35-42.
Other Embodiments
[0200] All of the features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features.
[0201] From the above description, one skilled in the art can easily ascertain the essential characteristics of the present disclosure, and without departing from the spirit and scope thereof, can make various changes and modifications of the disclosure to adapt it to various usages and conditions. Thus, other embodiments are also within the claims.
EQUIVALENTS
[0202] While several inventive embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and/or structures for performing the function and/or obtaining the results and/or one or more of the advantages described herein, and each of such variations and/or modifications is deemed to be within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be non-limiting and that the actual parameters, dimensions, materials, and/or configurations will depend upon the specific application or applications for which the inventive teachings is/are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed. Inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and/or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and/or methods, if such features, systems, articles, materials, kits, and/or methods are not mutually inconsistent, is included within the inventive scope of the present disclosure.
[0203] All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and/or ordinary meanings of the defined terms.
[0204] All references, patents and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document.
[0205] The indefinite articles a and an, as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean at least one.
[0206] The phrase and/or, as used herein in the specification and in the claims, should be understood to mean either or both of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with and/or should be construed in the same fashion, i.e., one or more of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the and/or clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to A and/or B, when used in conjunction with open-ended language such as comprising can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.
[0207] As used herein in the specification and in the claims, or should be understood to have the same meaning as and/or as defined above. For example, when separating items in a list, or or and/or shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as only one of or exactly one of, or, when used in the claims, consisting of, will refer to the inclusion of exactly one element of a number or list of elements. In general, the term or as used herein shall only be interpreted as indicating exclusive alternatives (i.e., one or the other but not both) when preceded by terms of exclusivity, such as either, one of, only one of, or exactly one of. Consisting essentially of, when used in the claims, shall have its ordinary meaning as used in the field of patent law.
[0208] As used herein in the specification and in the claims, the phrase at least one, in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase at least one refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, at least one of A and B (or, equivalently, at least one of A or B, or, equivalently at least one of A and/or B) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.
[0209] It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.
[0210] In the claims, as well as in the specification above, all transitional phrases such as comprising, including, carrying, having, containing, involving, holding, composed of, and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases consisting of and consisting essentially of shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03. It should be appreciated that embodiments described in this document using an open-ended transitional phrase (e.g., comprising) are also contemplated, in alternative embodiments, as consisting of and consisting essentially of the feature described by the open-ended transitional phrase. For example, if the disclosure describes a composition comprising A and B, the disclosure also contemplates the alternative embodiments a composition consisting of A and B and a composition consisting essentially of A and B.