Method for plant improvement

Abstract

The invention relates to the field of plant improvement, in particular of the improvement of yield for plants, by using a transgene containing an root-specific promoter driving expression of a MYB-related protein.

Claims

1. A nucleic acid construct comprising: a promoter functional in a plant root, which is operably linked to a nucleic acid molecule comprising a nucleic acid sequence encoding a Myb-related transcription factor protein, wherein said MYB-related transcription factor protein comprises an amino acid sequence having at least 99% amino acid sequence identity to the amino acid sequence as set forth in SEQ ID NO: 2, and wherein said promoter is heterologous to said nucleic acid molecule.

2. The nucleic acid construct of claim 1, wherein the Myb-related transcription factor protein is as set forth in SEQ ID NO: 2.

3. The nucleic acid construct of claim 1, wherein said promoter is selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13 and SEQ ID NO: 19.

4. A host cell comprising the nucleic acid construct of claim 1.

5. The host cell of claim 4, wherein said nucleic acid construct is stably integrated within the genome of said host cell.

6. A transgenic plant, or a part of a transgenic plant part thereof transformed with the nucleic acid construct of claim 1.

7. The transgenic plant or part of the transgenic plant of claim 6, which is a cereal plant.

8. The transgenic plant or part of the transgenic plant of claim 7, wherein said cereal plant is selected from the group consisting of maize, wheat, barley, and rice.

9. A method for increasing plant yield, comprising sowing transgenic plant seeds, wherein said transgenic plant seeds are transformed with the nucleic acid construct of claim 1 and growing transgenic plants from said transgenic sowed plant seeds, wherein said Myb-related transcription factor protein is overexpressed in said grown transgenic plants, and wherein the yield obtained from said grown transgenic plants is increased as compared to control plants of the same plant species which do not contain the nucleic acid construct and are grown under identical conditions.

10. A method for increasing plant yield under nitrogen deficiency conditions, comprising sowing transgenic plant seeds, wherein said transgenic plant seeds are transformed with the nucleic acid construct of claim 1 and growing transgenic plants from the transgenic plant sowed seeds under nitrogen deficiency conditions, wherein said Myb-related transcription factor protein is overexpressed in said grown transgenic plants, and wherein the yield of said grown transgenic plants is increased as compared to control plants of the same species which do not contain the nucleic acid construct and are grown under said nitrogen deficiency conditions.

11. The nucleic acid construct of claim 2, wherein said promoter is selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13 and SEQ ID NO: 19.

12. A host cell comprising the nucleic acid construct of claim 11.

13. The nucleic acid construct of claim 1, wherein said Myb-related transcription factor protein comprises an amino acid sequence having at least 99.5% amino acid sequence identity to the amino acid sequence as set forth in SEQ ID NO: 2.

14. The nucleic acid construct of claim 1, wherein said promoter is a root-specific promoter.

Description

DESCRIPTION OF THE FIGURES

(1) FIG. 1 represents the level of expression (CT) for TmMYB gene, as a function of the Nitrogen Nutrional Index (NNI) on Arche genotypes.

(2) FIG. 2 represents the level of expression (CT) for TmMYB gene, as a function of the Nitrogen Nutrional Index (NNI) for leaf samples on Soissons genotypes

(3) FIG. 3 represents the results obtained for different events bearing the MYB related coding sequence operably linked to either a constitutive (Actin promoter+actin intron) or root specific promoter. Promoter: promoter used; Location type: ND: Nitrogen Deficiency; Normal: no Nitrogen Deficiency; Phenotype: phenotype observed for the tested events: Yield after moisture normalization, or moisture. The results (yield and moisture) are presented as percentages of the results observed for the controls.

(4) FIG. 4 represents the alignment of the MYB domains of sequences 2 to 8.

EXAMPLE 1EXPERIMENTAL VALIDATION OF TMMYB GENE FUNCTION IN NITROGEN DEFICIENCY CONDITIONS IN WHEAT

(5) Materials & Methods

(6) Wheat leaf samples were collected on 2 sites (La Minire and Boigneville stationsArvalis Institut du Vgtal; France): one for cultivar Arche grown in field, and samples were harvested for cultivar Soissons grown in greenhouse.

(7) Different nitrogen treatments were applied to lead to samples with a range of Nitrogen Nutrional Index (NNI) from 0.39 to 1.58. During wheat culture, sampling was done at different stages.

(8) Total RNAs were extracted from all the samples with the SV96 Total RNA Isolation System (Promega) according to the manufacturer recommendations. RNA integrity was verified on the Agilent Bioanalyzer and presence of potential genomic DNA was checked by QPCR on RNA. In the absence of genomic DNA no amplification is expected from RNA.

(9) For each sample 2 g of total RNA were reverse transcribed using the High capacity reverse transcription kit (Applied Biosystems) and random primers in 100 l. RT reaction was then 1/10th diluted and 2 l of cDNA used for the amplification. Each RNA sample was submitted to 2 independent RT reactions for technical reproducibility evaluation.

(10) Quantitative PCR was performed on a AB17900 machine (Applied Biosystems), using Applied Biosystems reagents. The PCR reactions consisted of a hot-start Taq Polymerase activation step of 95 C. for 5 minutes, followed by 2 steps amplification cycles (denaturation 95, 30 sec, annealing/elongation 60, 1 min).

(11) Expression levels of mRNA for the Triticum monoccocum MYB (TmMYB) gene were calculated using the Ct estimated by the SDS software (Applied Biosystems) and normalized across samples using 4 control genes. Relative expression was then considered as the Ct between TmMYB gene and the average of controls.

(12) Results

(13) In order to validate the role of the TmMYB gene in Nitrogen Deficiency conditions an experiment on two bread wheat genotypes, Arche and Soissons, was conducted on leaf collected at different stages under different nitrogen constraints. The N nutrition index (NNI) value was calculated for each sample.

(14) Moreover, for the same samples, RNA was extracted and the expression pattern of TmMYB was analysed through qPCR using sequence specific primers (forward: TTTTCTCCCCCTGCCGAC (SEQ ID NO: 25); reverse: GTCATACCGTTCGTCGTCCA (SEQ ID NO: 26)). The results are shown in FIGS. 1 and 2.

(15) A significant correlation of R.sup.2=0.32 and 0.49 was found between the expression (CT values) of the TmMYB gene and the NNI score of the samples for both the Arche and Soissons genotypes, respectively. These results confirm that the TmMYB gene is a candidate gene for increasing yield under Nitrogen Deficiency conditions.

EXAMPLE 2: CLONING OF TMMYB DOWNSTREAM A ROOT AND CONSTITUVE PROMOTER AND TRANSFORMATION

(16) TmMYB sequence (depicted as SEQ ID NO:1 (cDNA) and SEQ ID NO:2 (protein)) was cloned via a GATEWAY LR reaction, between the constitutive Oryza sativa Actin promoter (proOsActin, SEQ ID NO: 16) (McElroy et al. 1990) with the Oryza sativa Actin intron (intOsActin, exemplified in SEQ ID NO: 17) (McElroy et al. 1990), and a 3 Arabidospis thaliana Nopaline synthase (Nos) termination sequence (tAtNos, depicted in SEQ ID NO: 18) (Depicker et al. 1982), into the destination binary plasmid pSC4Act-R1R2-SCV forming pBIOS1776.

(17) The binary vector pSC4Act-R1R2-SCV is a derivative of the binary vector pSCV nos nptII which is a derivative of pSCV1 (Firek et al. 1993) which contains a nos promoter driving a Kanamycin resistance gene, cloned between the EcoRV and EcoRI sites of pSCV1.

(18) The TmMYB sequence was cloned via a GATEWAY LR reaction, between Avaena strigosa Sad1 promoter (SEQ ID NO: 19, Haralampidis et al. 2001 and Qi et al, 2006) and a Arabidopsis thaliana Sac66 termination sequence (terAtSac66, depicted in SEQ ID NO:15)(Jenkins et al. 1999)). In the same way, constructs were made using promoters proZmTIP2_3, proOsRCG2 and proHvIDS2 with the TmMYB sequence as depicted by SEQ ID NO: 20 to SEQ ID NO: 22 respectively. The Otyza sativa RCC3 promoter was also used (pro0110) (SEQ ID NO: 13, 1.sup.st sequence of WO 2004/070039) and completed with the Zea mays shunkren intron (intSh1, exemplified in SEQ ID NO: 14) (Werr et al. 1985), and terAtSac66 (SEQ ID NO: 15) and led to the construct depicted as SEQ ID NO:23. All constructs were cloned into a destination binary plasmid pBIOS-type.

(19) The binary vector pBIOS is a derivative of the binary vector pSCV nos nptII which is a derivative of pSCV1 (Firek et al. 1993) which contains a nos promoter driving a Kanamycin resistance gene, cloned between the EcoRV and EcoRI sites of pSCV1.

(20) The binary plasmids were transferred into agrobacteria EHA105 according to Komari et al. (1996). Maize and wheat were transformed

(21) Wheat cultivar (NB01) was transformed with these agrobacterial strains essentially as described by WO 2000/063398. Wheat transgenic events were generated for each construct described above.

EXAMPLE 3: WHEAT FIELD TRIALS

(22) Field trials show that seed yield and nitrogen yield efficiency under both optimal and nitrogen deficient conditions are improved when MYB is overexpressed.

(23) 1) Field Trials:

(24) Homozygous transgenic lines were self-pollinized for seed increase.

(25) T4 (root promoter-intshr-TmMYB-terSac66) homozygous plants were used for field trials.

(26) Controls are obtained by bulking null segregant siblings isolated from T1 segregation. The null segregants are used as a reference for statistical analysis. They thus differ from the tested lines at very few loci, and for the presence of the transgene. These controls are thus quasi-isogenic to the tested lines. Improved yield was observed for wheat plants containing the TmMYB construct as compared to the controls, as can be seen in FIG. 3.

(27) Field evaluation was performed under two Nitrogen conditions: In normal (optimal) growing condition with an optimal Nitrogen fertilization. The applied Nitrogen rate was calculated using local guideline. In nitrogen stress condition, the applied Nitrogen rate was between 0 and 50% of the optimal Nitrogen rate.

(28) After harvest, the Nitrogen stress condition was eventually verified and characterized when a statistically significant seed yield loss (i.e. generally a seed loss between 5% and 30%) is observed, as compared to the seed yield observed under the normal condition.

(29) Yield was calculated as follows:

(30) During harvest, grain weight and grain moisture are measured using on-board equipment on the combine harvester.

(31) Grain weight is then normalized to moisture at 15%, using the following formula:
Normalized grain weight=measured grain weight(100measured moisture(as a percentage))/85(which is 100normalized moisture at 15%)

(32) As an example, if the measured grain moisture is 25%, the normalized grain weight will be: normalized grain weight=measured grain weight75/85.

(33) Yield is then expressed in a conventional unit (such as quintal per hectare).

(34) 2) Experimental Design:

(35) Field trials were conducted in 2013 (2 N stress locations) and 2014 (1 N stress location, 1 N stress and yield (normal) location, 1 yield (normal) location)

(36) In 2013, plants were sown between April 23 (location 1) and May 11th (location 2).

(37) In 2014, plants were sown between April 16 and May 17th.

(38) The experimental design was randomized complete block or Lattice with 4 replicate seeded at 360 seeds/m.sup.2.

(39) A bulk of null segregant of the construct was used as control in these experiments. 4 transgenic events of the construct T01822 were used for the field trials in 4 replicates.

(40) Results are represented in FIG. 3 with the yield expressed in percentage compared to the control.

(41) In nitrogen deficiency (ND) conditions, in 2013 the observed yield ranged from 100.7% to 108% of the mean of the yield of the controls with a global average of 104.35%. No effect on seed moisture content was observed.

(42) In nitrogen deficiency (ND) conditions, in 2014 the observed yield ranged from 102.6% to 105.1% of the mean of the yield of the controls with a global average of 103.85%. No effect on seed moisture content was observed.

(43) In standard condition, in 2014 the yield observed ranged from 103.6% to 106.5% of the mean of the yield of the controls with a global average of 105.5%. No effect on seed moisture content was observed.

(44) This figure demonstrates that the transgenic plants expressing TmMYB protein under a root promoter present an increased yield stability (normalized for moisture) in normal and ND conditions. No other phenotypes were observed for these plants.

(45) Decrease of yield is observed when the TmMYB protein is expressed under a constitutive promoter. In standard condition, in 2014 the yield observed ranged from 91.5% to 97% of the mean of the yield of the controls with a global average of 94.4%. The seed moisture content is observed with a global average of 96.6%.