Maize cytoplasmic male sterility (CMS) S-type restorer gene Rf3
10626412 ยท 2020-04-21
Assignee
Inventors
- Ruihua Ren (Carmel, IN)
- Bruce A. Nagel (Beaver Dam, WI, US)
- Liang YE (Carmel, IN, US)
- Yanxin Star Gao (Waunakee, WI, US)
- Ryan Gibson (Carmel, IN, US)
- Sushmitha PAULRAJ (Sao Paulo, BR)
- Tyler MANSFIELD (Indianapolis, IN, US)
- Jafar Mammadov (Carmel, IN, US)
- Siva P. Kumpatla (Carmel, IN)
- Steven A. Thompson (Carmel, IN, US)
Cpc classification
International classification
C12N15/82
CHEMISTRY; METALLURGY
A01H1/02
HUMAN NECESSITIES
Abstract
A newly identified protein that is encoded by a polynucleotide sequence associated with cytoplasmic male sterility restorer activity (Rf3) is described. The cytoplasmic male sterility restorer gene can be inserted through breeding introgression into plant genomes to restore cytoplasmic male sterility in plants. Further applications of the newly identified polynucleotide sequence associated with cytoplasmic male sterility restorer activity include a mutation (rf3) which results in cytoplasmic male sterility. The cytoplasmic male sterility restorer gene can be inserted through breeding introgression into plant genomes to result in cytoplasmic male sterility in plants. Methods for detecting the cytoplasmic male sterility restorer (Rf3) and the cytoplasmic male sterility (rf3) gene sequences are further described.
Claims
1. A synthetic polynucleotide encoding a fusion polypeptide comprising cytoplasmic male sterile activity, wherein the synthetic polynucleotide encodes a fusion polypeptide comprising an amino acid sequence having at least 97.5% sequence identity to the amino acid sequence of SEQ ID NO: 3, and further encoding an amino acid motif comprising the amino acid sequence of SEQ ID NO: 1.
2. The synthetic polynucleotide of claim 1, wherein the synthetic polynucleotide encoding the amino acid motif comprises the nucleotide sequence comprising the sequence of SEQ ID NO: 2.
3. The synthetic polynucleotide of claim 1, wherein the synthetic polynucleotide is operably linked to a promoter, wherein the promoter is functional in plants.
4. The synthetic polynucleotide of claim 3, wherein the promoter is a cytoplasmic male sterile promoter.
5. A cell comprising the synthetic polynucleotide of claim 1.
6. A vector comprising the synthetic nucleic acid sequence polynucleotide of claim 1.
7. A cell comprising the vector of claim 6.
8. A method for restoring fertility to a cytoplasmic male sterile plant, the method comprising the steps of: a) transforming the cytoplasmic male sterile plant with the synthetic polynucleotide of claim 1; b) integrating the synthetic polynucleotide into the genome of the cytoplasmic male sterile plant; and, c) expressing the synthetic polynucleotide, wherein expression of the synthetic polynucleotide restores fertility to the cytoplasmic male sterile plant.
9. A method for altering plant morphology in a cytoplasmic male sterile plant, the method comprising the steps of: a) transforming the cytoplasmic male sterile plant with the synthetic polynucleotide of claim 1; b) integrating the synthetic polynucleotide into the genome of the cytoplasmic male sterile plant; and c) expressing the synthetic polynucleotide, wherein expression of the the synthetic polynucleotide alters plant morphology in the cytoplasmic male sterile plant.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
BRIEF DESCRIPTION OF THE SEQUENCES
(4) SEQ ID NO:1 provides the protein motif (IVFFSS) in which Leu is modified to a Phe (underlined), thereby resulting in the loss of restorer function and gain of cytoplasmic male sterility phenotype of the rf3 allele.
(5) SEQ ID NO:2 provides a polynucleotide sequence that encodes for SEQ ID NO:1.
(6) SEQ ID NO:3 provides the protein sequence for the rf3 allele obtained from the cytoplasmic male sterile corn line, Zea mays c.v. 4XP811.
(7) SEQ ID NO:4 provides the cDNA polynucleotide sequence encoding the rf3 allele obtained from the cytoplasmic male sterile corn line, Zea mays c.v. 4XP811.
(8) SEQ ID NO:5 provides the protein motif (IVLFSS) in which conservation of the Leu (underlined) amino acid residue results in a restorer function, male fertile phenotype of the Rf3 allele.
(9) SEQ ID NO:6 provides a polynucleotide sequence that encodes for SEQ ID NO:5.
(10) SEQ ID NO:7 provides the protein sequence for the Rf3 allele obtained from the restored, fertile corn line, Zea mays c.v. LH60.
(11) SEQ ID NO:8 provides the cDNA polynucleotide sequence encoding the Rf3 allele obtained from the restored, fertile corn line, Zea mays c.v. LH60.
(12) SEQ ID NO:9 provides the protein sequence for the rf3 allele obtained from the cytoplasmic male sterile corn line, Zea mays c.v. 7SH382MS.
(13) SEQ ID NO:10 provides the cDNA polynucleotide sequence encoding the rf3 allele obtained from the cytoplasmic male sterile corn line, Zea mays c.v. 7SH382MS.
(14) SEQ ID NO:11 provides the protein sequence for the Rf3 allele obtained from the restored, fertile corn line, Zea mays c.v. MBB56.
(15) SEQ ID NO:12 provides the cDNA polynucleotide sequence encoding the Rf3 allele obtained from the restored, fertile corn line, Zea mays c.v. MBB56.
(16) SEQ ID NO:13 to SEQ ID NO:18 provide primers and probes used for the detection of the dominant and recessive Rf3 alleles.
DETAILED DESCRIPTION
I. Overview
(17) The present disclosure provides, an isolated polypeptide comprising an amino acid sequence of SEQ ID NO:1. In a further embodiment the isolated polypeptide of SEQ ID NO:1 comprises an amino acid sequence which has at least 85% sequence identity to SEQ ID NO:3. In aspects of an embodiment, the isolated polypeptides of SEQ ID NO:1 and SEQ ID NO:3 have cytoplasmic male sterile activity.
(18) In other aspects, the present disclosure relates to an isolated polypeptide comprising an amino acid sequence of SEQ ID NO:5. In a further embodiment, the isolated polypeptide of SEQ ID NO:5 comprises an amino acid sequence which has at least 85% sequence identity to SEQ ID NO:7. In aspects of an embodiment, the isolated polypeptides of SEQ ID NO:5 and SEQ ID NO:7 have cytoplasmic male sterile restorer activity.
(19) In additional aspects, the subject disclosure relates to a method for producing a progeny cytoplasmic male sterile plant. In other aspects, the subject disclosure provides methods for restoring fertility to a progeny of a cytoplasmic male sterile plant. In a subsequent aspect, the subject disclosure relates to a method of detecting a plant comprising a cytoplasmic male sterile restorer trait. Furthermore, other aspects of the subject disclosure relate to a method of detecting an expression level of a cytoplasmic male sterile restorer trait.
II. Clause List
(20) Provided herein are embodiment of the invention, further described by the following enumerated clauses:
(21) 1. An isolated polypeptide comprising an amino acid sequence of SEQ ID NO: 1.
(22) 2. An isolated polypeptide consisting of an amino acid sequence of SEQ ID NO: 1.
(23) 3. An isolated polypeptide consisting essentially of an amino acid sequence of SEQ ID NO: 1.
(24) 4. The isolated polypeptide of clause 1 comprising an amino acid sequence which has at least 85% sequence identity to SEQ ID NO: 3.
(25) 5. The isolated polypeptide of clause 1 consisting of an amino acid sequence which has at least 85% sequence identity to SEQ ID NO: 3.
(26) 6. The isolated polypeptide of clause 1 consisting essentially of an amino acid sequence which has at least 85% sequence identity to SEQ ID NO: 3.
(27) 7. The isolated polypeptide sequence of clause 1 or clause 4 wherein the polypeptide has cytoplasmic male sterile activity.
(28) 8. A cell comprising the polypeptide of clause 1.
(29) 9. The cell of clause 8, wherein the cell is a plant cell.
(30) 10. A plant comprising the plant cell of clause 9.
(31) 11. The plant of clause 10, wherein the plant is a monocotyledonous plant.
(32) 12. The plant of clause 11, wherein the monocotyledonous plant is a maize plant.
(33) 13. A seed obtained from the plant of clause 10.
(34) 14. A synthetic nucleic acid sequence encoding the polypeptide of clause 1.
(35) 15. The synthetic nucleic acid sequence of clause 14 comprising the sequence of SEQ ID NO:2.
(36) 16. The synthetic nucleic acid sequence of clause 14 consisting of the sequence of SEQ ID NO:2.
(37) 17. The synthetic nucleic acid sequence of clause 14 consisting essentially of the sequence of SEQ ID NO:2.
(38) 18. The synthetic nucleic acid sequence of clause 14 comprising at least 90% sequence identity to the sequence of SEQ ID NO:4.
(39) 19. The synthetic nucleic acid sequence of clause 14 consisting of the sequence of SEQ ID NO:4.
(40) 20. The synthetic nucleic acid sequence of clause 14 consisting essentially of the sequence of SEQ ID NO:4.
(41) 21. A polynucleotide comprising the synthetic nucleic acid sequence of clause 14.
(42) 22. The polynucleotide of clause 21, wherein the polynucleotide is operably linked to a promoter, wherein the promoter is functional in plants.
(43) 23. The polynucleotide of clause 22, wherein the promoter is a plant cytoplasmic male sterile promoter.
(44) 24. A cell comprising the polynucleotide of clause 21.
(45) 25. A vector comprising the synthetic nucleic acid sequence of clause 14.
(46) 26. A cell comprising the vector of clause 25.
(47) 27. The isolated polypeptide of clause 1 comprising an amino acid sequence which has at least 85% sequence identity to SEQ ID NO: 9.
(48) 28. The isolated polypeptide of clause 1 consisting of an amino acid sequence which has at least 85% sequence identity to SEQ ID NO: 9.
(49) 29. The isolated polypeptide of clause 1 consisting essentially of an amino acid sequence which has at least 85% sequence identity to SEQ ID NO: 9.
(50) 30. The isolated polypeptide sequence of clause 27, wherein the polypeptide has cytoplasmic male sterile activity.
(51) 31. A cell comprising the polypeptide of clause 27.
(52) 32. The cell of clause 31, wherein the cell is a plant cell.
(53) 33. A plant comprising the plant cell of clause 32.
(54) 34. The plant of clause 33, wherein the plant is a monocotyledonous plant.
(55) 35. The plant of clause 34, wherein the monocotyledonous plant is a maize plant.
(56) 36. A seed obtained from the plant of clause 33.
(57) 37. A synthetic nucleic acid sequence encoding the polypeptide of clause 27.
(58) 38. The synthetic nucleic acid sequence of clause 37 comprising at least 90% sequence identity to the sequence of SEQ ID NO:10.
(59) 39. The synthetic nucleic acid sequence of clause 37 consisting of the sequence of SEQ ID NO:10.
(60) 40. The synthetic nucleic acid sequence of clause 37 consisting essentially of the sequence of SEQ ID NO:10.
(61) 41. A polynucleotide comprising the synthetic nucleic acid sequence of clause 37.
(62) 42. The polynucleotide of clause 41, wherein the polynucleotide is operably linked to a promoter, wherein the promoter is functional in plants.
(63) 43. The polynucleotide of clause 42, wherein the promoter is a plant cytoplasmic male sterile promoter.
(64) 44. A cell comprising the polynucleotide of clause 41.
(65) 45. A vector comprising the synthetic nucleic acid sequence of clause 37.
(66) 46. A cell comprising the vector of clause 45.
(67) 47. The plant of clause 35, wherein the plant has CMS-S type cytoplasm.
(68) 48. A method for producing a progeny cytoplasmic male sterile plant, the method comprising the steps of: a) crossing a female parent plant with a male parent plant, wherein the female parent plant is a cytoplasmic male sterile parent plant homozygous for SEQ ID NO:4, and wherein the male parent plant is a fertile parent plant; b) harvesting a progeny seed from the cross of step (a), wherein the progeny seed is homozygous for SEQ ID NO:4; c) planting the progeny seed; and, d) growing the progeny seed, wherein the progeny seed produce the progeny cytoplasmic male sterile plant, wherein the progeny cytoplasmic male sterile plant is homozygous for SEQ ID NO:4.
(69) 49. The method for producing a progeny cytoplasmic male sterile plant of clause 48, wherein the female and male parent plants are monocotyledonous plants.
(70) 50. The method for producing a progeny cytoplasmic male sterile plant of clause 49, wherein the monocotyledonous plants are maize plants.
(71) 51. The method for producing a progeny cytoplasmic male sterile plant of clause 48, wherein the male parent plant is isogenic to the female parent plant.
(72) 52. The method for producing a progeny cytoplasmic male sterile plant of clause 48, wherein the male parent plant is homozygous or heterozygous for SEQ ID NO:8.
(73) 53. The method for producing a progeny cytoplasmic male sterile plant of clause 48, the method further comprising introducing a desired trait into the progeny cytoplasmic male sterile plant.
(74) 54. The method for producing a progeny cytoplasmic male sterile plant of clause 48, the method further comprising the steps of: e) crossing the progeny cytoplasmic male sterile plant, with another plant comprising a desired trait to produce F1 progeny plants; f) selecting F1 progeny plants that have the desired trait to produce selected F1 progeny plants; g) crossing the selected F1 progeny plants with the progeny cytoplasmic male sterile plant to produce backcross progeny plants; h) selecting for backcross progeny plants that have the desired trait; and, i) repeating steps (g) and (h) three or more times in succession to produce selected fourth or higher backcross progeny plants that comprise the desired trait.
(75) 55. The method for producing a progeny cytoplasmic male sterile plant of 53, wherein the desired trait is selected from the group consisting of an insecticidal resistance trait, herbicide tolerant trait, disease resistance trait, yield increase trait, nutritional quality trait, agronomic increase trait, and combinations thereof.
(76) 56. A method for producing a progeny cytoplasmic male sterile plant, the method comprising the steps of: a) crossing a female parent plant with a male parent plant, wherein the female parent plant is a cytoplasmic male sterile parent plant homozygous for SEQ ID NO:10, and wherein the male parent plant is a fertile parent plant; b) harvesting a progeny seed from the cross of step (a), wherein the progeny seed is homozygous for SEQ ID NO:10; c) planting the progeny seed; and, d) growing the progeny seed, wherein the progeny seed produce the progeny cytoplasmic male sterile plant, wherein the progeny cytoplasmic male sterile plant is homozygous for SEQ ID NO:10.
(77) 57. The method for producing a progeny cytoplasmic male sterile plant of clause 56, wherein the female and male parent plants are monocotyledonous plants.
(78) 58. The method for producing a progeny cytoplasmic male sterile plant of clause 57, wherein the monocotyledonous plants are maize plants.
(79) 59. The method for producing a progeny cytoplasmic male sterile plant of clause 56, wherein the male parent plant is isogenic to the female parent plant.
(80) 60. The method for producing a progeny cytoplasmic male sterile plant of clause 56, wherein the male parent plant is homozygous or heterozygous for SEQ ID NO:8.
(81) 61. The method for producing a progeny cytoplasmic male sterile plant of clause 56, the method further comprising introducing a desired trait into the progeny cytoplasmic male sterile plant.
(82) 62. The method for producing a progeny cytoplasmic male sterile plant of clause 56, the method further comprising the steps of: e) crossing the progeny cytoplasmic male sterile plant, with another plant comprising a desired trait to produce F1 progeny plants; f) selecting F1 progeny plants that have the desired trait to produce selected F1 progeny plants; g) crossing the selected F1 progeny plants with the progeny cytoplasmic male sterile plant to produce backcross progeny plants; h) selecting for backcross progeny plants that have the desired trait; and, i) repeating steps (g) and (h) three or more times in succession to produce selected fourth or higher backcross progeny plants that comprise the desired trait.
(83) 63. The method for producing a progeny cytoplasmic male sterile plant of 61, wherein the desired trait is selected from the group consisting of an insecticidal resistance trait, herbicide tolerant trait, disease resistance trait, yield increase trait, nutritional quality trait, agronomic increase trait, and combinations thereof.
(84) 64. A method for restoring fertility to a progeny of a cytoplasmic male sterile parent plant, the method comprising: a) crossing a female parent plant with a male parent plant, wherein the female parent plant is a cytoplasmic male sterile parent plant homozygous or heterozygous for SEQ ID NO:8, and wherein the cytoplasmic male sterile plant is a fertile parent plant; b) harvesting a progeny seed from the cross of step (a), wherein the progeny seed is homozygous or heterozygous for SEQ ID NO:8; c) planting the progeny seed; d) growing the progeny seed, wherein the progeny seed produce a progeny cytoplasmic male fertile plant; and, e) restoring fertility to the progeny of the cytoplasmic male sterile parent plant, wherein the progeny cytoplasmic male fertile plant is homozygous or heterozygous for SEQ ID NO:8.
(85) 65. The method for restoring fertility to a progeny of a cytoplasmic male sterile parent plant of clause 64, wherein the female and male parent plants are monocotyledonous plants.
(86) 66. The method for restoring fertility to a progeny of a cytoplasmic male sterile parent plant of clause 65, wherein the monocotyledonous plants are maize plants.
(87) 67. The method for restoring fertility to a progeny of a cytoplasmic male sterile parent plant of clause 64, wherein the male parent plant is isogenic to the female parent plant.
(88) 68. The method for restoring fertility to a progeny of a cytoplasmic male sterile parent plant of clause 64, wherein the male parent plant is homozygous or heterozygous for SEQ ID NO:8.
(89) 69. The method for restoring fertility to a progeny of a cytoplasmic male sterile parent plant of clause 64, the method further comprising introducing a desired trait into the cytoplasmic male sterile plant.
(90) 70. The method for restoring fertility to a progeny of a cytoplasmic male sterile parent plant of clause 64, the method further comprising: f) crossing the progeny cytoplasmic male sterile plant, with another plant comprising a desired trait to produce F1 progeny plants; g) selecting F1 progeny plants that have the desired trait to produce selected F1 progeny plants; h) crossing the selected F1 progeny plants with progeny cytoplasmic male sterile plant to produce backcross progeny plants; i) selecting for backcross progeny plants that have the desired trait; and, j) repeating steps (h) and (i) three or more times in succession to produce selected fourth or higher backcross progeny plants that comprise the desired trait.
(91) 71. The method for restoring fertility to a progeny of a cytoplasmic male sterile parent plant of clause 69, wherein the desired trait is selected from the group consisting of an insecticidal resistance trait, herbicide tolerant trait, disease resistance trait, yield increase trait, nutritional quality trait, agronomic increase trait, and combinations thereof.
(92) 72. An isolated polypeptide comprising an amino acid sequence of SEQ ID NO: 5.
(93) 73. An isolated polypeptide consisting of an amino acid sequence of SEQ ID NO: 5.
(94) 74. An isolated polypeptide consisting essentially of an amino acid sequence of SEQ ID NO: 5.
(95) 75. The isolated polypeptide of clause 72 comprising an amino acid sequence which has at least 85% sequence identity to SEQ ID NO: 7.
(96) 76. The isolated polypeptide of clause 72 consisting of an amino acid sequence which has at least 85% sequence identity to SEQ ID NO: 7.
(97) 77. The isolated polypeptide of clause 72 consisting essentially of an amino acid sequence which has at least 85% sequence identity to SEQ ID NO: 7.
(98) 78. The isolated polypeptide sequence of clause 72 or clause 75, wherein the polypeptide has cytoplasmic male sterile restorer activity.
(99) 79. A cell comprising the polypeptide of clause 72.
(100) 80. The cell of clause 79, wherein the cell is a plant cell.
(101) 81. A plant comprising the plant cell of clause 80.
(102) 82. The plant of clause 81, wherein the plant is a monocotyledonous plant.
(103) 83. The plant of clause 82, wherein the monocotyledonous plant is a maize plant.
(104) 84. The plant of clause 83, wherein the plant has CMS-S type cytoplasm.
(105) 85. A seed obtained from the plant of clause 81.
(106) 86. A synthetic nucleic acid sequence encoding the polypeptide of clause 72.
(107) 87. The synthetic nucleic acid sequence of clause 86 comprising the sequence of SEQ ID NO:8.
(108) 88. The synthetic nucleic acid sequence of clause 86 consisting of the sequence of SEQ ID NO:8.
(109) 89. The synthetic nucleic acid sequence of clause 86 consisting essentially of the sequence of SEQ ID NO:8.
(110) 90. The synthetic nucleic acid sequence of clause 86 comprising the sequence of SEQ ID NO:6.
(111) 91. The synthetic nucleic acid sequence of clause 86 consisting of the sequence of SEQ ID NO:6.
(112) 92. The synthetic nucleic acid sequence of clause 86 consisting essentially of the sequence of SEQ ID NO:6.
(113) 93. A gene expression cassette comprising the synthetic nucleic acid sequence of clause 86.
(114) 94. The gene expression cassette of clause 93, wherein the synthetic nucleic acid sequence is operably linked to a promoter, wherein the promoter is functional in plants.
(115) 95. The gene expression cassette of clause 94, wherein the promoter is a plant cytoplasmic male sterile promoter.
(116) 96. A cell comprising the gene expression cassette of clause 93.
(117) 97. A vector comprising the synthetic nucleic acid sequence of clause 86.
(118) 98. A cell comprising the vector of clause 97.
(119) 99. A method for restoring fertility to a cytoplasmic male sterile plant, the method comprising the steps of; a) transforming the cytoplasmic male sterile plant with the synthetic nucleic acid sequence of clause 86; b) integrating the synthetic nucleic acid sequence into the genome of the cytoplasmic male sterile plant; and, c) expressing the synthetic nucleic acid sequence, wherein expression of the synthetic nucleic acid sequence restores fertility to the cytoplasmic male sterile plant.
(120) 100. A method for altering plant morphology in a cytoplasmic male sterile plant, the method comprising the steps of; a) transforming the cytoplasmic male sterile plant with the synthetic nucleic acid sequence of clause 86; b) integrating the synthetic nucleic acid sequence into the genome of the cytoplasmic male sterile plant; and, c) expressing the synthetic nucleic acid sequence, wherein expression of the synthetic nucleic acid sequence alters plant morphology in the cytoplasmic male sterile plant.
(121) 101. A method of detecting a plant comprising a cytoplasmic male sterile restorer trait, the method comprising the steps of: a) isolating a genomic polynucleotide sample from a plant, plant tissue, plant part, or plant cell; b) adding a set of oligonucleotide primers to the genomic polynucleotide sample; c) subjecting the genomic polynucleotide sample and the set of oligonucleotide primers to an amplification process; and, d) detecting at least one amplified product, wherein the amplified product indicates the presence of the cytoplasmic male sterile restorer trait in the plant.
(122) 102. The method of detecting a plant comprising a cytoplasmic male sterile restorer trait of clause 101, wherein the set of oligonucleotide primers are selected from the group consisting of SEQ ID NO:28, SEQ ID NO:29, and SEQ ID NO:30.
(123) 103. The method of detecting a plant comprising a cytoplasmic male sterile restorer trait of clause 101, wherein the amplified product comprises SEQ ID NO:6.
(124) 104. The method of detecting a plant comprising a cytoplasmic male sterile restorer trait of clause 101, wherein the amplified product consists of SEQ ID NO:6.
(125) 105. The method of detecting a plant comprising a cytoplasmic male sterile restorer trait of clause 101, wherein the amplified product consists essentially of SEQ ID NO:6.
(126) 106. The method of detecting a plant comprising a cytoplasmic male sterile restorer trait of clause 101, wherein the amplified product comprises a fragment of SEQ ID NO:8.
(127) 107. The method of detecting a plant comprising a cytoplasmic male sterile restorer trait of clause 101, wherein the amplified product consists of a fragment of SEQ ID NO:8.
(128) 108. The method of detecting a plant comprising a cytoplasmic male sterile restorer trait of clause 101, wherein the amplified product consists essentially of a fragment of SEQ ID NO:8.
(129) 109. The method of detecting a plant comprising a cytoplasmic male sterile restorer trait of clause 101, wherein the amplified product comprises a fragment of SEQ ID NO:12.
(130) 110. The method of detecting a plant comprising a cytoplasmic male sterile restorer trait of clause 101, wherein the amplified product consists of a fragment of SEQ ID NO:12.
(131) 111. The method of detecting a plant comprising a cytoplasmic male sterile restorer trait of clause 101, wherein the amplified product consists essentially of a fragment of SEQ ID NO:12.
(132) 112. The method of detecting a plant comprising a cytoplasmic male sterile restorer trait of clause 101, wherein the amplified product is quantitated.
(133) 113. The method of detecting an expression level of a cytoplasmic male sterile restorer trait, the method comprising the steps of: a) performing a first amplification process using a cytoplasmic male sterile restorer trait probe (SEQ ID NO:30), a forward cytoplasmic male sterile restorer trait primer (SEQ ID NO:28) and a reverse cytoplasmic male sterile restorer trait primer (SEQ ID NO:29) on a genomic polynucleotide sample, wherein a first fluorescent dye is released from the cytoplasmic male sterile restorer trait probe (SEQ ID NO:30); b) performing a second amplification process using a reference probe (SEQ ID NO:36), a forward reference primer (SEQ ID NO:34) and a reverse reference primer (SEQ ID NO:35) on the genomic polynucleotide sample, wherein a second fluorescent dye is released from the reference probe (SEQ ID NO:36); and, c) quantitating the relative intensity of the first fluorescent dye to the second fluorescent dye to detect the expression level of the cytoplasmic male sterile restorer trait.
(134) 114. The method of detecting an expression level of a cytoplasmic male sterile restorer trait of clause 113, wherein the first and second amplification processes are performed in a single PCR assay tube using probes with different fluorescent dyes.
(135) 115. The method of detecting an expression level of a cytoplasmic male sterile restorer trait of clause 113, the method further comprising the steps of: d) loading a PCR solution in a single PCR assay tube, the PCR solution comprising a polymerase with 5 to 3 nuclease activity, deoxynucleotides, the primers, the probes, a buffer, and the genomic polynucleotide sample; e) amplifying the PCR solution, wherein the PCR solution is treated under amplification conditions such that the 5 to 3 nuclease activity of the polymerase cleaves the probes thereby releasing the fluorescent dye that emits light; and, f) measuring the light emitted from fluorescent dye, during the amplification.
(136) 116. The method of detecting an expression level of a cytoplasmic male sterile restorer trait of clause 113, wherein the cytoplasmic male sterile trait probe comprises the first fluorescent dye and a first quencher.
(137) 117. The method of detecting an expression level of a cytoplasmic male sterile restorer trait of clause 116, wherein the first fluorescent dye is selected from the group consisting of a HEX fluorescent dye, a VIC fluorescent dye, a FAM fluorescent dye, a JOE fluorescent dye, a TET fluorescent dye, a Cy 3 fluorescent dye, a Cy 3.5 fluorescent dye, a Cy 5 fluorescent dye, a Cy 5.5 fluorescent dye, a Cy 7 fluorescent dye, or a ROX fluorescent dye.
(138) 118. The method of detecting an expression level of a cytoplasmic male sterile restorer trait of clause 116, wherein the first quencher is selected from the group consisting of a Dabcyl quencher, a Tamra quencher, a Qxl quencher, an Iowa Black FQ quencher, an Iowa Black RQ quencher, an IR Dye QC-1 quencher, a MGB quencher, or a Blackhole quencher.
(139) 119. The method of detecting an expression level of a cytoplasmic male sterile restorer trait of clause 113, wherein the reference probe comprises the second fluorescent dye and a second quencher.
(140) 120. The method of detecting an expression level of a cytoplasmic male sterile restorer trait of clause 119, wherein the second fluorescent dye is selected from the group consisting of a HEX fluorescent dye, a FAM fluorescent dye, a VIC fluorescent dye, a JOE fluorescent dye, a TET fluorescent dye, a Cy 3 fluorescent dye, a Cy 3.5 fluorescent dye, a Cy 5 fluorescent dye, a Cy 5.5 fluorescent dye, a Cy 7 fluorescent dye, or a ROX fluorescent dye.
(141) 121. The method of detecting an expression level of a cytoplasmic male sterile restorer trait of clause 119, wherein the second quencher is selected from the group consisting of a Dabcyl quencher, a Tamra quencher, a Qxl quencher, an Iowa Black FQ quencher, an Iowa Black RQ quencher, an IR Dye QC-1 quencher, a MGB quencher, or a Blackhole quencher.
(142) 122. The method of detecting an expression level of a cytoplasmic male sterile restorer trait of clause 113 or clause 101, wherein the genomic polynucleotide sample comprises cDNA produced from mRNA isolated from a plant, plant tissue, plant part, or plant cell.
(143) 123. A cell comprising the polypeptide of clause 4.
(144) 124. The cell of clause 123, wherein the cell is a plant cell.
(145) 125. A plant comprising the plant cell of clause 124.
(146) 126. The plant of clause 125, wherein the plant is a monocotyledonous plant.
(147) 127. The plant of clause 126, wherein the monocotyledonous plant is a maize plant.
(148) 128. A seed obtained from the plant of clause 125.
(149) 129. A synthetic nucleic acid sequence encoding the polypeptide of clause 4.
(150) 130. The synthetic nucleic acid sequence of clause 129 comprising a sequence with at least 90% sequence identity to the sequence of SEQ ID NO:4.
(151) 131. The synthetic nucleic acid sequence of clause 129 consisting of the sequence of SEQ ID NO:4.
(152) 132. The synthetic nucleic acid sequence of clause 129 consisting essentially of the sequence of SEQ ID NO:4.
(153) 133. A polynucleotide comprising the synthetic nucleic acid sequence of clause 129.
(154) 134. The polynucleotide of clause 133, wherein the polynucleotide is operably linked to a promoter, wherein the promoter is functional in plants.
(155) 135. The polynucleotide of clause 134, wherein the promoter is a plant cytoplasmic male sterile promoter.
(156) 136. A cell comprising the polynucleotide of clause 133.
(157) 137. A vector comprising the synthetic nucleic acid sequence of clause 129.
(158) 138. A cell comprising the vector of clause 137.
(159) 139. The plant of clause 125, wherein the plant has CMS-S type cytoplasm.
III. Terms
(160) Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure relates. In case of conflict, the present application including the definitions will control. Unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. All publications, patents and other references mentioned herein are incorporated by reference in their entireties for all purposes as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference, unless only specific sections of patents or patent publications are indicated to be incorporated by reference.
(161) In order to further clarify this disclosure, the following terms, abbreviations and definitions are provided.
(162) As used herein, the terms comprises, comprising, includes, including, has, having, contains, or containing, or any other variation thereof, are intended to be non-exclusive or open-ended. For example, a composition, a mixture, a process, a method, an article, or an apparatus that comprises a list of elements is not necessarily limited to only those elements but may include other elements not expressly listed or inherent to such composition, mixture, process, method, article, or apparatus. Further, unless expressly stated to the contrary, or refers to an inclusive or and not to an exclusive or. For example, a condition A or B is satisfied by any one of the following: A is true (or present) and B is false (or not present), A is false (or not present) and B is true (or present), and both A and B are true (or present).
(163) Also, the indefinite articles a and an preceding an element or component of an embodiment of the disclosure are intended to be nonrestrictive regarding the number of instances, i.e., occurrences of the element or component. Therefore a or an should be read to include one or at least one, and the singular word form of the element or component also includes the plural unless the number is obviously meant to be singular.
(164) The term invention or present invention as used herein is a non-limiting term and is not intended to refer to any single embodiment of the particular invention but encompasses all possible embodiments as disclosed in the application.
(165) As used herein, the term plant includes a whole plant and any descendant, cell, tissue, or part of a plant. The term plant parts include any part(s) of a plant, including, for example and without limitation: seed (including mature seed and immature seed); a plant cutting; a plant cell; a plant cell culture; a plant organ (e.g., pollen, embryos, flowers, fruits, shoots, leaves, roots, stems, and explants). A plant tissue or plant organ may be a seed, protoplast, callus, or any other group of plant cells that is organized into a structural or functional unit. A plant cell or tissue culture may be capable of regenerating a plant having the physiological and morphological characteristics of the plant from which the cell or tissue was obtained, and of regenerating a plant having substantially the same genotype as the plant. In contrast, some plant cells are not capable of being regenerated to produce plants. Regenerable cells in a plant cell or tissue culture may be embryos, protoplasts, meristematic cells, callus, pollen, leaves, anthers, roots, root tips, silk, flowers, kernels, ears, cobs, husks, or stalks.
(166) Plant parts include harvestable parts and parts useful for propagation of progeny plants. Plant parts useful for propagation include, for example and without limitation: seed; fruit; a cutting; a seedling; a tuber; and a rootstock. A harvestable part of a plant may be any useful part of a plant, including, for example and without limitation: flower; pollen; seedling; tuber; leaf; stem; fruit; seed; and root.
(167) A plant cell is the structural and physiological unit of the plant, and includes protoplast cells without a cell wall and plant cells with a cell wall. A plant cell may be in the form of an isolated single cell, or an aggregate of cells (e.g., a friable callus and a cultured cell), and may be part of a higher organized unit (e.g., a plant tissue, plant organ, and plant). Thus, a plant cell may be a protoplast, a gamete producing cell, or a cell or collection of cells that can regenerate into a whole plant. As such, a seed, which comprises multiple plant cells and is capable of regenerating into a whole plant, is considered a plant cell in embodiments herein.
(168) As used herein, the term isolated refers to a biological component (including a nucleic acid or protein) that has been separated, produced apart from other biological components in the cell of the organism in which the component naturally occurs (i.e., other chromosomal and extra-chromosomal DNA and RNA, and proteins).
(169) As used herein, the term purified in reference to nucleic acid molecules does not require absolute purity (such as a homogeneous preparation); instead, it represents an indication that the sequence is relatively more pure than in its native cellular environment (compared to the natural level this level should be at least 2-5 fold greater, e.g., in terms of concentration or gene expression levels). The claimed DNA molecules obtained directly from total DNA or from total RNA. In addition, cDNA clones are not naturally occurring, but rather are preferably obtained via manipulation of a partially purified, naturally occurring substance (messenger RNA). The construction of a cDNA library from mRNA involves the creation of a library. Individual cDNA clones can be produced from the library by clonal selection of the cells carrying the cDNA library. Thus, the process which includes the construction of a cDNA library from mRNA and selection of distinct cDNA clones yields an approximately 10.sup.6-fold purification of the native message. Likewise, a promoter or gene DNA sequence could be cloned into a plasmid. Such a clone is not naturally occurring, but rather is preferably obtained via manipulation of a partially purified, naturally occurring substance such as a genomic DNA library. Thus, purification of at least one order of magnitude, preferably two or three orders, and more preferably four or five orders of magnitude is favored in these techniques.
(170) Similarly, synthetic represents an indication that a chemical or functional change in the component DNA sequence has occurred. Nucleic acid molecules and proteins that have been synthesized include nucleic acid molecules and proteins generated by PCR amplification or by recombinant methods, wherein an isolated polynucleotide is further modified by the incorporation within a plasmid or vector. The term synthetic also embraces nucleic acids and proteins prepared by recombinant DNA methods in a host cell (e.g., plant cells), as well as chemically-synthesized nucleic acid molecules, proteins, and peptides.
(171) In engineering a gene for expression in plants, the codon bias of the prospective host plant(s) may be determined, for example, through use of publicly available DNA sequence databases to find information about the codon distribution of plant genomes or the protein coding regions of various plant genes. Once an optimized (e.g., a plant-optimized) DNA sequence has been designed on paper, or in silico, actual DNA molecules may be synthesized in the laboratory to correspond in sequence precisely to the designed sequence. Such synthetic nucleic acid molecule molecules can be cloned and otherwise manipulated exactly as if they were derived from natural or native sources.
(172) As used herein, the terms polynucleotide, nucleic acid, and nucleic acid molecule are used interchangeably, and may encompass a singular nucleic acid; plural nucleic acids; a nucleic acid fragment, variant, or derivative thereof; and nucleic acid construct (e.g., messenger RNA (mRNA) and plasmid DNA (pDNA)). A polynucleotide or nucleic acid may contain the nucleotide sequence of a full-length cDNA sequence, or a fragment thereof, including untranslated 5 and/or 3 sequences and coding sequence(s). A polynucleotide or nucleic acid may be comprised of any polyribonucleotide or polydeoxyribonucleotide, which may include unmodified ribonucleotides or deoxyribonucleotides or modified ribonucleotides or deoxyribonucleotides. For example, a polynucleotide or nucleic acid may be comprised of single- and double-stranded DNA; DNA that is a mixture of single- and double-stranded regions; single- and double-stranded RNA; and RNA that is mixture of single- and double-stranded regions. Hybrid molecules comprising DNA and RNA may be single-stranded, double-stranded, or a mixture of single- and double-stranded regions. The foregoing terms also include chemically, enzymatically, and metabolically modified forms of a polynucleotide or nucleic acid.
(173) It is understood that a specific DNA refers also to the complement thereof, the sequence of which is determined according to the rules of deoxyribonucleotide base-pairing.
(174) As used herein, the term gene refers to a nucleic acid that encodes a functional product (RNA or polypeptide/protein). A gene may include regulatory sequences preceding (5 non-coding sequences) and/or following (3 non-coding sequences) the sequence encoding the functional product.
(175) As used herein, the term coding sequence refers to a nucleic acid sequence that encodes a specific amino acid sequence. A regulatory sequence refers to a nucleotide sequence located upstream (e.g., 5 non-coding sequences), within, or downstream (e.g., 3 non-coding sequences) of a coding sequence, which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences include, for example and without limitation: promoters; translation leader sequences; introns; polyadenylation recognition sequences; RNA processing sites; effector binding sites; and stem-loop structures.
(176) As used herein, the term polypeptide includes a singular polypeptide, plural polypeptides, and fragments thereof. This term refers to a molecule comprised of monomers (amino acids) linearly linked by amide bonds (also known as peptide bonds). The term polypeptide refers to any chain or chains of two or more amino acids, and does not refer to a specific length or size of the product. Accordingly, peptides, dipeptides, tripeptides, oligopeptides, protein, amino acid chain, and any other term used to refer to a chain or chains of two or more amino acids, are included within the definition of polypeptide, and the foregoing terms are used interchangeably with polypeptide herein. A polypeptide may be isolated from a natural biological source or produced by recombinant technology, but a specific polypeptide is not necessarily translated from a specific nucleic acid. A polypeptide may be generated in any appropriate manner, including for example and without limitation, by chemical synthesis.
(177) As used herein, the term native refers to the form of a polynucleotide, gene or polypeptide that is found in nature with its own regulatory sequences, if present. The term endogenous refers to the native form of the polynucleotide, gene or polypeptide in its natural location in the organism or in the genome of the organism.
(178) In contrast, the term heterologous refers to a polynucleotide, gene or polypeptide that is not normally found at its location in the reference (host) organism. For example, a heterologous nucleic acid may be a nucleic acid that is normally found in the reference organism at a different genomic location. By way of further example, a heterologous nucleic acid may be a nucleic acid that is not normally found in the reference organism. A host organism comprising a hetereologous polynucleotide, gene or polypeptide may be produced by introducing the heterologous polynucleotide, gene or polypeptide into the host organism. In particular examples, a heterologous polynucleotide comprises a native coding sequence, or portion thereof, that is reintroduced into a source organism in a form that is different from the corresponding native polynucleotide. In particular examples, a heterologous gene comprises a native coding sequence, or portion thereof, that is reintroduced into a source organism in a form that is different from the corresponding native gene. For example, a heterologous gene may include a native coding sequence that is a portion of a chimeric gene including non-native regulatory regions that is reintroduced into the native host. In particular examples, a heterologous polypeptide is a native polypeptide that is reintroduced into a source organism in a form that is different from the corresponding native polypeptide.
(179) A heterologous gene or polypeptide may be a gene or polypeptide that comprises a functional polypeptide or nucleic acid sequence encoding a functional polypeptide that is fused to another genes or polypeptide to produce a chimeric or fusion polypeptide, or a gene encoding the same. Genes and proteins of particular embodiments include specifically exemplified full-length sequences and portions, segments, fragments (including contiguous fragments and internal and/or terminal deletions compared to the full-length molecules), variants, mutants, chimerics, and fusions of these sequences.
(180) As used herein, the term modification may refer to a change in a particular reference polynucleotide that results in reduced, substantially eliminated, or eliminated activity of a polypeptide encoded by the reference polynucleotide. A modification may also refer to a change in a reference polypeptide that results in reduced, substantially eliminated, or eliminated activity of the reference polypeptide. Alternatively, the term modification may refer to a change in a reference polynucleotide that results in increased or enhanced activity of a polypeptide encoded by the reference polynucleotide, as well as a change in a reference polypeptide that results in increased or enhanced activity of the reference polypeptide. Changes such as the foregoing may be made by any of several methods well-known in the art including, for example and without limitation: deleting a portion of the reference molecule; mutating the reference molecule (e.g., via spontaneous mutagenesis, via random mutagenesis, via mutagenesis caused by mutator genes, and via transposon mutagenesis); substituting a portion of the reference molecule; inserting an element into the reference molecule; down-regulating expression of the reference molecule; altering the cellular location of the reference molecule; altering the state of the reference molecule (e.g., via methylation of a reference polynucleotide, and via phosphorylation or ubiquitination of a reference polypeptide); removing a cofactor of the reference molecule; introduction of an antisense RNA/DNA targeting the reference molecule; introduction of an interfering RNA/DNA targeting the reference molecule; chemical modification of the reference molecule; covalent modification of the reference molecule; irradiation of the reference molecule with UV radiation or X-rays; homologous recombination that alters the reference molecule; mitotic recombination that alters the reference molecule; replacement of the promoter of the reference molecule; and/or combinations of any of the foregoing.
(181) Guidance in determining which nucleotides or amino acid residues may be modified in a specific example may be found by comparing the sequence of the reference polynucleotide or polypeptide with that of homologous (e.g., homologous yeast or bacterial) polynucleotides or polypeptides, and maximizing the number of modifications made in regions of high homology (conserved regions) or consensus sequences.
(182) The term promoter refers to a DNA sequence capable of controlling the expression of a nucleic acid coding sequence or functional RNA. In examples, the controlled coding sequence is located 3 to a promoter sequence. A promoter may be derived in its entirety from a native gene, a promoter may be comprised of different elements derived from different promoters found in nature, or a promoter may even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters can direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental or physiological conditions. Examples of all of the foregoing promoters are known and used in the art to control the expression of heterologous nucleic acids. Promoters that direct the expression of a gene in most cell types at most times are commonly referred to as constitutive promoters. Furthermore, while those in the art have (in many cases unsuccessfully) attempted to delineate the exact boundaries of regulatory sequences, it has come to be understood that DNA fragments of different lengths may have identical promoter activity. The promoter activity of a particular nucleic acid may be assayed using techniques familiar to those in the art.
(183) The term operably linked refers to an association of nucleic acid sequences on a single nucleic acid, wherein the function of one of the nucleic acid sequences is affected by another. For example, a promoter is operably linked with a coding sequence when the promoter is capable of effecting the expression of that coding sequence (e.g., the coding sequence is under the transcriptional control of the promoter). A coding sequence may be operably linked to a regulatory sequence in a sense or antisense orientation.
(184) The term expression or expressing, as used herein, may refer to the transcription and stable accumulation of sense (mRNA) or antisense RNA derived from a DNA. Expression may also refer to translation of mRNA into a polypeptide. As used herein, the term overexpression refers to expression that is higher than endogenous expression of the same gene or a related gene. Thus, a heterologous gene is overexpressed if its expression is higher than that of a comparable endogenous gene.
(185) As used herein, the term transformation or transforming refers to the transfer and integration of a nucleic acid or fragment thereof into a host organism, resulting in genetically stable inheritance. Host organisms containing a transforming nucleic acid are referred to as transgenic, recombinant, or transformed organisms. Known methods of transformation include, for example: Agrobacterium tumefaciens- or A. rhizogenes-mediated transformation; calcium phosphate transformation; polybrene transformation; protoplast fusion; electroporation; ultrasonic methods (e.g., sonoporation); liposome transformation; microinjection; transformation with naked DNA; transformation with plasmid vectors; transformation with viral vectors; biolistic transformation (microparticle bombardment); silicon carbide WHISKERS-mediated transformation; aerosol beaming; and PEG-mediated transformation.
(186) As used herein, the term introduced (in the context of introducing a nucleic acid into a cell) includes transformation of a cell, as well as crossing a plant comprising the nucleic acid with a second plant, such that the second plant contains the nucleic acid, as may be performed utilizing conventional plant breeding techniques. Such breeding techniques are known in the art. For a discussion of plant breeding techniques, see Poehlman (1995) Breeding Field Crops, 4th Edition, AVI Publication Co., Westport Conn.
(187) Backcrossing methods may be used to introduce a nucleic acid into a plant. This technique has been used for decades to introduce traits into plants. An example of a description of backcrossing (and other plant breeding methodologies) can be found in, for example, Poelman (1995), supra; and Jensen (1988) Plant Breeding Methodology, Wiley, New York, N.Y. In an exemplary backcross protocol, an original plant of interest (the recurrent parent) is crossed to a second plant (the non-recurrent parent) that carries the nucleic acid be introduced. The resulting progeny from this cross are then crossed again to the recurrent parent, and the process is repeated until a converted plant is obtained, wherein essentially all of the desired morphological and physiological characteristics of the recurrent parent are recovered in the converted plant, in addition to the nucleic acid from the non-recurrent parent.
(188) As used herein, the term isogenic refers to two individual plants (or portions thereof e.g., seeds, cells) having a substantially identical genotype (e.g., not more than 1 gene is different between the individuals).
(189) Binding refers to a sequence-specific, non-covalent interaction between macromolecules (e.g., between a protein and a nucleic acid). Not all components of a binding interaction need be sequence-specific (e.g., contacts with phosphate residues in a DNA backbone), as long as the interaction as a whole is sequence-specific. Such interactions are generally characterized by a dissociation constant (K.sub.d) of 10.sup.6 M.sup.1 or lower. Affinity refers to the strength of binding: increased binding affinity being correlated with a lower K.sub.d.
(190) The terms plasmid and vector, as used herein, refer to an extra chromosomal element that may carry one or more gene(s) that are not part of the central metabolism of the cell. Plasmids and vectors typically are circular double-stranded DNA molecules. However, plasmids and vectors may be linear or circular nucleic acids, of a single- or double-stranded DNA or RNA, and may be derived from any source, in which a number of nucleotide sequences have been joined or recombined into a unique construction that is capable of introducing a promoter fragment and a coding DNA sequence along with any appropriate 3 untranslated sequence into a cell. In examples, plasmids and vectors may comprise autonomously replicating sequences, genome integrating sequences, and/or phage or nucleotide sequences.
(191) Polypeptide and protein are used interchangeably herein and include a molecular chain of two or more amino acids linked through peptide bonds. The terms do not refer to a specific length of the product. Thus, peptides, and oligopeptides, are included within the definition of polypeptide. The terms include post-translational modifications of the polypeptide, for example, glycosylations, acetylations, phosphorylations and the like. In addition, protein fragments, analogs, mutated or variant proteins, fusion proteins and the like are included within the meaning of polypeptide. The terms also include molecules in which one or more amino acid analogs or non-canonical or unnatural amino acids are included as can be synthesized, or expressed recombinantly using known protein engineering techniques. In addition, inventive fusion proteins can be derivatized as described herein by well-known organic chemistry techniques.
(192) The term fusion protein indicates that the protein includes polypeptide components derived from more than one parental protein or polypeptide. Typically, a fusion protein is expressed from a fusion gene in which a nucleotide sequence encoding a polypeptide sequence from one protein is appended in frame with, and optionally separated by a linker from, a nucleotide sequence encoding a polypeptide sequence from a different protein. The fusion gene can then be expressed by a recombinant host cell as a single protein.
IV. Embodiments of the Present Invention
(193) In one embodiment, the subject disclosure relates to an isolated polypeptide comprising an amino acid sequence of SEQ ID NO:1. In a further embodiment, the isolated polypeptide of SEQ ID NO:1 comprises an amino acid sequence which has at least 85% sequence identity to SEQ ID NO:3. In aspects of the embodiment, the isolated polypeptides of SEQ ID NO:1 and SEQ ID NO:3 have cytoplasmic male sterile activity.
(194) In another embodiment, the subject disclosure relates to an isolated polypeptide consisting of an amino acid sequence of SEQ ID NO:1. In another embodiment, the subject disclosure relates to an isolated polypeptide consisting essentially of an amino acid sequence of SEQ ID NO:1. In a further embodiment, the isolated polypeptide of SEQ ID NO:1 consists of an amino acid sequence which has at least 85% sequence identity to SEQ ID NO:3. In a further embodiment, the isolated polypeptide of SEQ ID NO:1 consists essentially of an amino acid sequence which has at least 85% sequence identity to SEQ ID NO:3.
(195) In another embodiment, the disclosure relates to a cell comprising the isolated polypeptide of SEQ ID NO:1. In an aspect, the cell comprising the isolated polypeptide of SEQ ID NO:1 can be a plant cell. In further aspects, the subject disclosure relates to a plant comprising the plant cell comprising the isolated polypeptide of SEQ ID NO:1. In another embodiment, the plant is a monocotyledonous plant. In further embodiments, the monocotyledonous plant is a maize plant. In another embodiment, the maize plant has CMS-S type cytoplasm. Further aspects of the subject disclosure relate to seed obtained from the plant comprising the plant cell comprising the isolated polypeptide of SEQ ID NO:1.
(196) In an additional embodiment, the disclosure relates to a synthetic nucleic acid sequence encoding the polypeptide of SEQ ID NO:1. In a further embodiment, the polypeptide of SEQ ID NO:1 is encoded by the sequence of SEQ ID NO:2. In another embodiment, a polynucleotide comprises the sequence of SEQ ID NO:2. In another aspect, a polynucleotide consists of the sequence of SEQ ID NO:2. In a further aspect, a polynucleotide consists essentially of the sequence of SEQ ID NO:2. In a further aspect the polynucleotide comprising the sequence of SEQ ID NO:2 is operably linked to a promoter, wherein the promoter is functional in plants. In yet another aspect, the promoter is a plant cytoplasmic male sterile promoter. In another embodiment, the disclosure relates to a cell comprising the polynucleotide that further comprises the sequence of SEQ ID NO:2. In another embodiment, the disclosure relates to a cell consists of the polynucleotide that further comprises the sequence of SEQ ID NO:2. In another embodiment, the disclosure relates to a cell consists essentially of the polynucleotide that further comprises the sequence of SEQ ID NO:2. In a further embodiment, the disclosure relates to a vector comprising the polynucleotide that further comprises the sequence of SEQ ID NO:2. In a further embodiment, the disclosure relates to a vector consisting of the polynucleotide that further comprises the sequence of SEQ ID NO:2. In a further embodiment, the disclosure relates to a vector consisting essentially of the polynucleotide that further comprises the sequence of SEQ ID NO:2.
(197) Furthermore, the subject disclosure relates to a method for producing a progeny cytoplasmic male sterile plant, comprising the steps of: a) crossing a female parent plant with a male parent plant, wherein the female parent plant is a cytoplasmic male sterile parent plant homozygous for SEQ ID NO:4, and wherein the male parent plant is a fertile parent plant; b) harvesting a progeny seed from the cross of step (a), wherein the progeny seed is homozygous for SEQ ID NO:4; c) planting the progeny seed; and, d) growing the progeny seed, wherein the progeny seed produce the progeny cytoplasmic male sterile plant, wherein the progeny cytoplasmic male sterile plant is homozygous for SEQ ID NO:4.
In a further aspect, the method relates to producing the progeny cytoplasmic male sterile plant wherein the female and male parent plants are monocotyledonous plants. In another embodiment, the monocotyledonous plants are maize plants. In a further embodiment, the maize plant has CMS-S type cytoplasm. In yet another embodiment, the male parent plant is isogenic to the female parent plant. In a subsequent embodiment, the maize plants are homozygous or heterozygous for SEQ ID NO:8. In another embodiment, the method further comprises introducing a desired trait into the progeny cytoplasmic male sterile plant. In a subsequent embodiment, the desired trait is selected from the group consisting of an insecticidal resistance trait, herbicide tolerant trait, disease resistance trait, yield increase trait, nutritional quality trait, agronomic increase trait, and combinations thereof.
(198) In yet another aspect, the subject disclosure relates to a method for producing a progeny cytoplasmic male sterile plant, the method further comprising the steps of: e) crossing the progeny cytoplasmic male sterile plant, with another plant comprising a desired trait to produce F1 progeny plants; f) selecting F1 progeny plants that have the desired trait to produce selected F1 progeny plants; g) crossing the selected F1 progeny plants with the progeny cytoplasmic male sterile plant to produce backcross progeny plants; h) selecting for backcross progeny plants that have the desired trait; and, i) repeating steps (g) and (h) three or more times in succession to produce selected fourth or higher backcross progeny plants that comprise the desired trait.
(199) Further aspects of the subject disclosure relate to a method for restoring fertility to a progeny of a cytoplasmic male sterile parent plant, the method comprising: a) crossing a female parent plant with a male parent plant, wherein the female parent plant is a cytoplasmic male sterile parent plant homozygous or heterozygous for SEQ ID NO:8, and wherein the cytoplasmic male sterile plant is a fertile parent plant; b) harvesting a progeny seed from the cross of step (a), wherein the progeny seed is homozygous or heterozygous for SEQ ID NO:8; c) planting the progeny seed; d) growing the progeny seed, wherein the progeny seed produce a progeny cytoplasmic male fertile plant; and, e) restoring fertility to the progeny of the cytoplasmic male sterile parent plant, wherein the progeny cytoplasmic male fertile plant is homozygous or heterozygous for SEQ ID NO:8.
In a further aspect, the method relates to producing the progeny cytoplasmic male fertile plant wherein the female and male parent plants are monocotyledonous plants. In another embodiment, the monocotyledonous plants are maize plants. In yet another embodiment, the maize plant has CMS-S type cytoplasm. In a further embodiment, the male parent plant is isogenic to the female parent plant. In a subsequent embodiment, the maize plants are homozygous or heterozygous for SEQ ID NO:8. In another embodiment, the method further comprises introducing a desired trait into the progeny cytoplasmic male sterile plant. In another embodiment, the desired trait is selected from the group consisting of an insecticidal resistance trait, herbicide tolerant trait, disease resistance trait, yield increase trait, nutritional quality trait, agronomic increase trait, and combinations thereof.
(200) In yet another aspect, the subject disclosure relates to a method for producing a progeny of a cytoplasmic male sterile parent plant, the method further comprising the steps of: f) crossing the progeny cytoplasmic male sterile plant, with another plant comprising a desired trait to produce F1 progeny plants; g) selecting F1 progeny plants that have the desired trait to produce selected F1 progeny plants; h) crossing the selected F1 progeny plants with the progeny cytoplasmic male sterile plant to produce backcross progeny plants; i) selecting for backcross progeny plants that have the desired trait; and, j) repeating steps (g) and (h) three or more times in succession to produce selected fourth or higher backcross progeny plants that comprise the desired trait.
(201) In an embodiment, the subject disclosure relates to an isolated polypeptide comprising an amino acid sequence of SEQ ID NO:5. In a further embodiment, the isolated polypeptide of SEQ ID NO:5 comprises an amino acid sequence which has at least 85% sequence identity to SEQ ID NO:7. In aspects of the embodiment, the isolated polypeptides of SEQ ID NO:5 and SEQ ID NO:7 have cytoplasmic male sterile restorer activity.
(202) In an embodiment, the subject disclosure relates to an isolated polypeptide consisting of an amino acid sequence of SEQ ID NO:5. In an embodiment, the subject disclosure relates to an isolated polypeptide consisting essentially of an amino acid sequence of SEQ ID NO:5. In a further embodiment, the isolated polypeptide of SEQ ID NO:5 consisting of an amino acid sequence which has at least 85% sequence identity to SEQ ID NO:7. In a further embodiment, the isolated polypeptide of SEQ ID NO:5 consisting essentially of an amino acid sequence which has at least 85% sequence identity to SEQ ID NO:7.
(203) In another embodiment, the disclosure relates to a cell comprising the isolated polypeptide of SEQ ID NO:5. In an aspect, the cell comprising the isolated polypeptide of SEQ ID NO:5 can be a plant cell. In further aspects, the subject disclosure relates to a plant comprising the plant cell comprising the isolated polypeptide of SEQ ID NO:5. In another embodiment, the plant is a monocotyledonous plant. In further embodiments, the monocotyledonous plant is a maize plant. In another embodiment, the maize plant has CMS-S type cytoplasm. Further aspects of the subject disclosure relate to seed obtained from the plant comprising the plant cell comprising the isolated polypeptide of SEQ ID NO:5.
(204) In an additional embodiment, the disclosure relates to a synthetic nucleic acid sequence encoding the polypeptide of SEQ ID NO:5. In a further embodiment, the synthetic nucleic acid sequence comprises the sequence of SEQ ID NO:5. In another embodiment, the synthetic nucleic acid sequence consists of the sequence of SEQ ID NO:5. In an additional embodiment, the synthetic nucleic acid sequence consists essentially of the sequence of SEQ ID NO:5. In a further embodiment, the synthetic nucleic acid sequence comprises the sequence of SEQ ID NO:8. In another embodiment, the synthetic nucleic acid sequence consists of the sequence of SEQ ID NO:8. In an additional embodiment, the synthetic nucleic acid sequence consists essentially of the sequence of SEQ ID NO:8. In another embodiment, a gene expression cassette comprises the synthetic sequence of SEQ ID NO:8. In a further aspect, the gene expression cassette comprising the sequence of SEQ ID NO:8 is operably linked to a promoter, wherein the promoter is functional in plants. In yet another aspect, the promoter is a plant cytoplasmic male sterile promoter. In another embodiment, the disclosure relates to a cell comprising the gene expression cassette that further comprises the sequence of SEQ ID NO:8. In an embodiment, the disclosure relates to a cell comprising the gene expression cassette that consists of the sequence of SEQ ID NO:8. In an additional embodiment, the disclosure relates to a cell consisting essentially of the gene expression cassette that further comprises the sequence of SEQ ID NO:8. In a further embodiment, the disclosure relates to a gene expression cassette comprising the polynucleotide that further comprises the sequence of SEQ ID NO:8. In a subsequent embodiment, the disclosure relates to a gene expression cassette consisting of the polynucleotide that consists of the sequence of SEQ ID NO:8. In another embodiment, the disclosure relates to a gene expression cassette comprising the polynucleotide that consists essentially of the sequence of SEQ ID NO:8.
(205) Further aspects of the subject disclosure relate to a method for restoring fertility to a cytoplasmic male sterile plant, the method comprising: a) transforming the cytoplasmic male sterile plant with the synthetic nucleic acid sequence encoding the polypeptide of SEQ ID NO:5; b) integrating the synthetic nucleic acid sequence into the genome of the cytoplasmic male sterile plant; and, c) expressing the synthetic nucleic acid sequence, wherein expression of the synthetic nucleic acid sequence restores fertility to the cytoplasmic male sterile plant.
(206) Other aspects of the subject disclosure relate to a method for altering the morphology of a cytoplasmic male sterile plant, the method comprising: a) transforming the cytoplasmic male sterile plant with the synthetic nucleic acid sequence encoding the polypeptide of SEQ ID NO:5; b) integrating the synthetic nucleic acid sequence into the genome of the cytoplasmic male sterile plant; and, c) expressing the synthetic nucleic acid sequence, wherein expression of the synthetic nucleic acid sequence alters the morphology of the cytoplasmic male sterile plant.
(207) In an embodiment, the subject disclosure relates to a method of detecting a plant comprising a cytoplasmic male sterile restorer trait, the method comprising the steps of: a) isolating a genomic polynucleotide sample from a plant, plant tissue, plant part, or plant cell; b) adding a set of oligonucleotide primers to the genomic polynucleotide sample; c) subjecting the genomic polynucleotide sample and the set of oligonucleotide primers to an amplification process; and, d) detecting at least one amplified product, wherein the amplified product indicates the presence of the cytoplasmic male sterile trait in the plant.
(208) Further embodiments relate to a method for detecting a plant comprising a cytoplasmic male sterile restorer trait, include the set of oligonucleotide primers that are selected from the group consisting of SEQ ID NO:28, SEQ ID NO:29, and SEQ ID NO:30. In another embodiment, the amplified product comprises SEQ ID NO:6. In an embodiment, the amplified product consists of SEQ ID NO:6. In a further embodiment, the amplified product consists essentially of SEQ ID NO:6. Further embodiments include the quantitation of the amplified product.
(209) Other aspects of the subject disclosure relate to a method of detecting an expression level of a cytoplasmic male sterile restorer trait, the method comprising the steps of: a) performing a first amplification process using a cytoplasmic male sterile restorer trait probe (SEQ ID NO:30), a forward cytoplasmic male sterile restorer trait primer (SEQ ID NO:28) and a reverse cytoplasmic male sterile restorer trait primer (SEQ ID NO:29) on a genomic polynucleotide sample, wherein a first fluorescent dye is released from the cytoplasmic male sterile restorer trait probe (SEQ ID NO:30); b) performing a second amplification process using a reference probe (SEQ ID NO:36), a forward reference primer (SEQ ID NO:34) and a reverse reference primer (SEQ ID NO:35) on the genomic polynucleotide sample, wherein a second fluorescent dye is released from the reference probe (SEQ ID NO:36); c) quantitating the relative intensity of the first fluorescent dye to the second fluorescent dye to detect the expression level of the cytoplasmic male sterile restorer trait.
Further embodiments relate to the method of detecting an expression level of a cytoplasmic male sterile restorer trait, include where the first and second amplification processes are performed in a single PCR assay tube using probes with different fluorescent dyes.
(210) In a further embodiment, the method of detecting an expression level of a cytoplasmic male sterile restorer trait comprises the steps of; d) loading a PCR solution in a single PCR assay tube, the PCR solution comprising a polymerase with 5 to 3 nuclease activity, deoxynucleotides, the primers, the probes, a buffer, and the genomic polynucleotide sample; e) amplifying the PCR solution, wherein the PCR solution is treated under amplification conditions such that the 5 to 3 nuclease activity of the polymerase cleaves the probes thereby releasing the fluorescent dye that emits light; and, f) measuring the light emitted from fluorescent dye, during the amplification.
Further embodiments relate to the method of detecting an expression level of a cytoplasmic male sterile restorer trait, include the cytoplasmic male sterile restorer trait probe comprising the first fluorescent dye and a first quencher. In a subsequent embodiment, the first fluorescent dye is selected from the group consisting of a HEX fluorescent dye, a VIC fluorescent dye, a FAM fluorescent dye, a JOE fluorescent dye, a TET fluorescent dye, a Cy 3 fluorescent dye, a Cy 3.5 fluorescent dye, a Cy 5 fluorescent dye, a Cy 5.5 fluorescent dye, a Cy 7 fluorescent dye, or a ROX fluorescent dye. In a further embodiment, the first quencher is selected from the group consisting of a Dabcyl quencher, a Tamra quencher, a Qxl quencher, an Iowa Black FQ quencher, an Iowa Black RQ quencher, an IR Dye QC-1 quencher, a MGB quencher, or a Blackhole quencher. In yet another embodiment, the reference probe comprises the second fluorescent dye and a second quencher. In a subsequent embodiment, the second fluorescent dye is selected from the group consisting of a HEX fluorescent dye, a FAM fluorescent dye, a VIC fluorescent dye, a JOE fluorescent dye, a TET fluorescent dye, a Cy 3 fluorescent dye, a Cy 3.5 fluorescent dye, a Cy 5 fluorescent dye, a Cy 5.5 fluorescent dye, a Cy 7 fluorescent dye, or a ROX fluorescent dye. In another embodiment, the second quencher is selected from the group consisting of a Dabcyl quencher, a Tamra quencher, a Qxl quencher, an Iowa Black FQ quencher, an Iowa Black RQ quencher, an IR Dye QC-1 quencher, a MGB quencher, or a Blackhole quencher. In a further embodiment, the genomic polynucleotide sample comprises cDNA produced from mRNA isolated from a plant, plant tissue, plant part, or plant cell.
(211) In one embodiment of the present disclosure, a polynucleotide donor cassette comprising an isolated polypeptide comprising an amino acid sequence of SEQ ID NO: 1 is provided. In a further embodiment, the isolated polypeptide of SEQ ID NO:1 further comprises an amino acid sequence with at least 85% sequence identity to SEQ ID NO:3. In a subsequent embodiment, the isolated polypeptide of SEQ ID NO:1 and a polypeptide with 85% sequence identity to SEQ ID NO:3 have cytoplasmic male sterile activity.
(212) Cytoplasmic male sterile systems have been used to breed hybrids in a number of crop species. The use of such a sterility system can be cost-effective and labor conscious. In maize or corn, for example, the expensive and laborious task of detasselling is avoided when cytoplasmic male sterility is utilized to avoid self-pollinating. The use of the cytoplasmic male sterile system in a breeding program is also advantageous because of its simplicity and cost savings.
(213) Cytoplasmic male sterility, a maternally inherited trait, is most widely used in the hybrid industry to render the male properties of a plant nonfunctional. During fertilization the female contributes a haploid nucleus and virtually all of the cytoplasm from the egg, while the male contributes a haploid nucleus but almost no cytoplasm from the pollen. The result being that the female cytoplasm which confers male sterility is passed from generation to generation. Information carried in the cytoplasm affecting the phenotype, i.e., anther presence or pollen production is contributed exclusively by the female. This type of sterility affects only pollen production; seed set is normal. Generally, all the progeny from a male sterile plant are themselves male sterile. However, in some cases male fertility can be restored. Pearson, O. H. (1981) Hort Sci. 16: 482-487. Fertility can be restored either by cytoplasmic reversion to fertility or by a nuclear restorer gene able to override the effects of cytoplasm. MacKenzie, S. A. et al. (1988) Proc. Natl. Acad. Sci. USA J35: 2714-2717. A specific cytoplasm can be carried along from generation to generation provided the plant possessing the cytoplasm is the maternal parent in each cross.
(214) Typically, upon identification of a source of cytoplasmic male sterility, the rf trait is transferred to a desirable female or A line. A maintenance or B line lacking both the sterility trait and restoration factor is used to perpetuate and increase the female line. A restorer or Rf line, carrying a pollen fertility factor is used as a male to pollinate the cytoplasmic male sterile A line to create a hybrid variety. The cytoplasmic male sterile plant of the A line can be crossed with a plant from a different variety to produce hybrid progeny. This type of breeding program is often referred to as a cytoplasmic male sterile-restorer system.
(215) Various Rf alleles have been sequences or cloned, for example, Rf2 from maize (Zea mays) (Cui, X., Wise, R. P., and Schnable, P. S. 1996. The Rf2 nuclear restorer gene of male-sterile T-cytoplasm maize. Science 272:1334-1336), Rf-PPR592 from Petunia (Petunia hybrida) (Bentolila, S., Alfonso, A. A., and Hanson, M. R. 2002. A pentatricopeptide repeat-containing gene restores fertility to male sterile plants. Proc. Natl. Acad. Sci. USA 99:10887-10892), Rfo from radish (Raphanus sativus) (Brown, G. G., Formanova, N., Jin, H., Wargachuk, R., Dendy, C., Patil, P., Laforest, M., Zhang, J. F., Cheung, W. Y., and Landry, B. S. 2003. The radish Rf Restorer gene of Ogura cytoplasmic male sterility encodes a protein with multiple pentatricopeptide repeats. Plant J. 35:262-272; Desloire, S., Gherbi, H., Laloui, W., Marhadour, S., Clouet, V., Cattolico, L., Falentin, C., Giancola, S., Renard, M., Burdar, F., Small, I., Caboche, M., and Bendahmane, A. 2003. Identification of the fertility restorer locus, Rfo, in radish, as a member of the pentatricopeptide-repeat protein family. EMBO Rep. 4:1-7; Koizuka, N., Imai, R., Fujimoto, H., Hayakawa, T., Kimura, Y., Kohno-Murase, J., Sakai, T., Kawasaki, S., Imamura, J. 2003. genetic characterization of a pentatricopeptide repeat protein gene, orf 687, that restores fertility in the cytoplasmic male sterile Kosena radish. Plant J. 34:407-415), Rf1 and Rf2 from sorghum (Sorghum bicolor) (Klein, R. R., Klein, P. E., Mullet, J. E., Minx, P., Rooney, W. L., and Schertz, K. F. 2005. Fertility restorer locus Rf1 of sorghum (Sorghum bicolor L.) encodes a pentatricopeptide repeat protein not present in the collinear region of rice chromosome 12. Theor. A. l. Genet. 111:994-1012), Rf1a and Rflb from rice (Oryza sativa) for BT-type CMS (Kazama, T., and Toriyama, K. 2003. A pentatricopeptide repeat-containing gene that promotes the processing of aberrant atp6 RNA of cytoplasmic male-sterile rice. FEBS Lett. 544:99-102; Akagi, H., Nakamura, A., Yokozeki-Misono, Y., Inagaki, A., Takahashi, H., Mori, K., and Fujimura, T. 2004. Position cloning of the rice Rf-1 gene, a restorer of BT-type cytoplasmic male sterility that encodes a mitochondria-targeting PPR protein. Theor. Appl. Genet. 108:1449-1457; Komori, T., Ohta, /s., Murai, N., Takakura, Y., Kuraya, Y., Suzuki, S., Hiei, Y., Imaseki, H., and Nitta, N. 2004. Map-based cloning of a fertility restorer gene, Rf-1 in rice (Oryza sativa L.). Plant J. 37:315-325; and, Wang, Z., Zou, Y., Li, X., Zhang, Q., Chen, L., Wu, H., Su, D., Chen, Y., Guo, J., Luo, D., Long, Y., Zhong, Y., and Liu, Y. G. 2006b. Cytoplasmic male sterility of rice with Boro II cytoplasm is caused by a cytotoxic peptide and is restored by two related PPR motif genes via distinct modes of mRNA silencing. Plant Cell 18:676-687), Rf17 (RMS) from rice (Oryza sativa) for CW-type CMS (Fujii S. & Toriyama K. 2009. Suppressed expression of RETROGRADE-REGULATED MALE STERILITY restores pollen fertility in cytoplasmic male sterile rice plants. PNAS 106:9513-9518), Rf1 & Rf2 from monkey flower (Mimulus guttatus) (Barr, C. M., & Fishman L. 2010. The Nuclear component of a cytonuclear hybrid incompatibility in Mimulus maps to a cluster of pentatricopeptide repeat genes. Genetics 184:455-465), Rf2 for Lead Rice-type CMS from rice (Oryza sativa) (Itabashi, E., Iwata, N., Fujii, S., Kazama, T. and Toriyama, K. 2011. The Fertility restorer gene, Rf2 for lead Rice-type cytoplasmic male sterility of rice encodes a mitochondrial glycine-rich protein. The plant Journal (2011) 65:359-367), Rf5 for Hong-Lian CMS from rice (Oryza sativa) (Hu, J., Wang, K., Huang, W., Liu, G., Wang, J., Huang, Q., Ji, Y., Qin, X., Wan, L., Zhu, R., Li, S., Yang, D. and Zhu, Y. 2012. The Rice Pentatricopeptide Repeat Protein Rf5 Restores Fertility in Hong-Lian Cytoplasmic Male-Sterile Lines via a Complex with the Glycine-Rich Protein GRP162. The plant cell advance online publication 2012), and Rf4 for CMS C-type of maize (Zea mays) (U.S. Patent Pub. No. 2012/0090047 A1).
(216) In other embodiments the isolated polypeptide of SEQ ID NO:1 further comprises an amino acid sequence with at least 85%, 87.5%, 90%, 92.5%, 95%, 97.5%, or 99% sequence identity to SEQ ID NO:3. In a subsequent embodiment, the isolated polypeptide of SEQ ID NO:1 and a polypeptide with 85%, 87.5%, 90%, 92.5%, 95%, 97.5% or 99% sequence identity to SEQ ID NO:3 have cytoplasmic male sterile activity.
(217) The term percent identity (or % identity), as known in the art, is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as determined by comparing the sequences. In the art, identity also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as the case may be, as determined by the match between strings of such sequences. Identity and similarity can be readily calculated by known methods, including but not limited to those disclosed in: 1.) Computational Molecular Biology (Lesk, A. M., Ed.) Oxford University: NY (1988); 2.) Biocomputing: Informatics and Genome Projects (Smith, D. W., Ed.) Academic: NY (1993); 3.) Computer Analysis of Sequence Data, Part I (Griffin, A. M., and Griffin, H. G., Eds.) Humania: NJ (1994); 4.) Sequence Analysis in Molecular Biology (von Heinje, G., Ed.) Academic (1987); and 5.) Sequence Analysis Primer (Gribskov, M. and Devereux, J., Eds.) Stockton: NY (1991).
(218) Techniques for determining nucleic acid and amino acid sequence identity are known in the art. Typically, such techniques include determining the nucleotide sequence of the mRNA for a gene and/or determining the amino acid sequence encoded thereby, and comparing these sequences to a second nucleotide or amino acid sequence. Genomic sequences can also be determined and compared in this fashion. In general, identity refers to an exact nucleotide-to-nucleotide or amino acid-to-amino acid correspondence of two polynucleotides or polypeptide sequences, respectively. Two or more sequences (polynucleotide or amino acid) can be compared by determining their percent identity. The percent identity of two sequences, whether nucleic acid or amino acid sequences, is the number of exact matches between two aligned sequences divided by the length of the shorter sequences and multiplied by 100. See Russell, R., and Barton, G., Structural Features can be Unconserved in Proteins with Similar Folds, J. Mol. Biol. 244, 332-350 (1994), at p. 337, which is incorporated herein by reference in its entirety.
(219) In addition, methods to determine identity and similarity are codified in publicly available computer programs. Sequence alignments and percent identity calculations can be performed, for example, using the AlignX program of the Vector NTI suite (Invitrogen, Carlsbad, Calif.) or MegAlign program of the LASERGENE bioinformatics computing suite (DNASTAR Inc., Madison, Wis.). Multiple alignment of the sequences is performed using the Clustal method of alignment which encompasses several varieties of the algorithm including the Clustal V method of alignment corresponding to the alignment method labeled Clustal V (disclosed by Higgins and Sharp, CABIOS. 5:151-153 (1989); Higgins, D. G. et al., Comput. Appl. Biosci., 8:189-191 (1992)) and found in the MegAlign program of the LASERGENE bioinformatics computing suite (DNASTAR Inc.). For multiple alignments, the default values correspond to GAP PENALTY=10 and GAP LENGTH PENALTY=10. Default parameters for pairwise alignments and calculation of percent identity of protein sequences using the Clustal method are KTUPLE=1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5. For nucleic acids these parameters are KTUPLE=2, GAP PENALTY=5, WINDOW=4 and DIAGONALS SAVED=4. After alignment of the sequences using the Clustal V program, it is possible to obtain a percent identity by viewing the sequence distances table in the same program. Additionally the Clustal W method of alignment is available and corresponds to the alignment method labeled Clustal W (described by Higgins and Sharp, CABIOS. 5:151-153 (1989); Higgins, D. G. et al., Comput. Appl. Biosci. 8:189-191 (1992)) and found in the MegAlign v6.1 program of the LASERGENE bioinformatics computing suite (DNASTAR Inc.). Default parameters for multiple alignment (GAP PENALTY=10, GAP LENGTH PENALTY=0.2, Delay Divergen Seqs (%)=30, DNA Transition Weight=0.5, Protein Weight Matrix=Gonnet Series, DNA Weight Matrix=IUB). After alignment of the sequences using the Clustal W program, it is possible to obtain a percent identity by viewing the sequence distances table in the same program.
(220) It is well understood by one skilled in the art that many levels of sequence identity are useful in identifying polypeptides, from other species, wherein such polypeptides have the same or similar function or activity. Useful examples of percent identities include, but are not limited to: 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or any integer percentage from 55% to 100% may be useful in describing embodiments of the present disclosure, such as 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%. Suitable nucleic acid fragments not only have the above homologies but typically encode a polypeptide having at least 50 amino acids, preferably at least 100 amino acids, more preferably at least 150 amino acids, still more preferably at least 200 amino acids, and most preferably at least 250 amino acids.
(221) The term sequence analysis software refers to any computer algorithm or software program that is useful for the analysis of nucleotide or amino acid sequences. Sequence analysis software may be commercially available or independently developed. Typical sequence analysis software will include, but is not limited to: 1.) the GCG suite of programs (Wisconsin Package Version 9.0, Genetics Computer Group (GCG), Madison, Wis.); 2.) BLASTP, BLASTN, BLASTX (Altschul et al., J. Mol. Biol., 215:403-410 (1990)); 3.) DNASTAR (DNASTAR, Inc. Madison, Wis.); 4.) Sequencher (Gene Codes Corporation, Ann Arbor, Mich.); and 5.) the FASTA program incorporating the Smith-Waterman algorithm (W. R. Pearson, Comput. Methods Genome Res., [Proc. Int. Symp.] (1994), Meeting Date 1992, 111-20. Editor(s): Suhai, Sandor. Plenum: New York, N.Y.). Within the context of this application it will be understood that where sequence analysis software is used for analysis, that the results of the analysis will be based on the default values of the program referenced, unless otherwise specified. As used herein default values will mean any set of values or parameters that originally load with the software when first initialized.
(222) When referring to hybridization techniques, all or part of a known nucleotide sequence can be used as a probe that selectively hybridizes to other corresponding nucleotide sequences present in a population of cloned genomic DNA fragments or cDNA fragments (i.e., genomic or cDNA libraries) from a chosen organism. The hybridization probes may be genomic DNA fragments, plasmid DNA fragments, cDNA fragments, RNA fragments, PCR amplified DNA fragments, oligonucleotides, or other polynucleotides, and may be labeled with a detectable group such as .sup.32P, or any other detectable marker. Thus, for example, probes for hybridization can be made by labeling synthetic oligonucleotides based on the DNA sequences of embodiments of the disclosure. Methods for preparation of probes for hybridization and for construction of cDNA and genomic libraries are generally known in the art and are disclosed (Sambrook et al., 1989).
(223) The nucleic acid probes and primers of embodiments of the present disclosure hybridize under stringent conditions to a target DNA sequence. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of DNA from a transgenic event in a sample. Nucleic acid molecules or fragments thereof are capable of specifically hybridizing to other nucleic acid molecules under certain circumstances. As used herein, two nucleic acid molecules are said to be capable of specifically hybridizing to one another if the two molecules are capable of forming an anti-parallel, double-stranded nucleic acid structure. A nucleic acid molecule is said to be the complement of another nucleic acid molecule if the two nucleic acid molecules exhibit complete complementarity. As used herein, molecules are said to exhibit complete complementarity when every nucleotide of one of the molecules is complementary to a nucleotide of the other. Molecules that exhibit complete complementarity will generally hybridize to one another with sufficient stability to permit them to remain annealed to one another under conventional high-stringency conditions. Conventional high-stringency conditions are described by Sambrook et al., 1989.
(224) Two molecules are said to exhibit minimal complementarity if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under at least conventional low-stringency conditions. Conventional low-stringency conditions are described by Sambrook et al., 1989. In order for a nucleic acid molecule to serve as a primer or probe, it need only exhibit the minimal complementarity of sequence to be able to form a stable double-stranded structure under the particular solvent and salt concentrations employed.
(225) Factors that affect the stringency of hybridization are well-known to those of skill in the art and include, but are not limited to, temperature, pH, ionic strength, and concentration of organic solvents such as, for example, formamide and dimethylsulfoxide. As is known to those of skill in the art, hybridization stringency is increased by higher temperatures, lower ionic strength and lower solvent concentrations.
(226) The term stringent condition or stringency conditions is functionally defined with regard to the hybridization of a nucleic-acid probe to a target nucleic acid (i.e., to a particular nucleic-acid sequence of interest) by the specific hybridization procedure discussed in Sambrook et al., 1989, at 9.52-9.55. See also, Sambrook et al., 1989 at 9.47-9.52 and 9.56-9.58.
(227) Typically, stringent conditions will be those in which the salt concentration is less than about 1.5 M Na.sup.+ ion, typically about 0.01 to 1.0 M Na.sup.+ ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30 C. for short probes (e.g., 10 to 50 nucleotides) and at least about 60 C. for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, 1.0 M NaCl, 0.1% SDS (sodium dodecyl sulfate) at 37 C., and a wash in 1 to 2SSC (20SSC=3.0 M NaCl/0.3 M trisodium citrate) at 50 to 55 C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1.0 M NaCl, 0.1% SDS at 37 C., and a wash in 0.5 to 1SSC at 55 to 60 C. Exemplary high stringency conditions include hybridization in 50% formamide, 1.0 M NaCl, 0.1% SDS at 37 C., and a wash in 0.1SSC at 60 to 65 C.
(228) Specificity is typically a function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution. For DNA-DNA hybrids, the T.sub.m can be approximated from the equation T.sub.m=81.5 C.+16.6 (log M)+0.41(% GC)0.61(% form.)500/L, where M is the molarity of monovalent cations, % GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form. is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs (Meinkoth and Wahl, 1984). The T.sub.m is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. T.sub.m is reduced by about 1 C. for each 1% of mismatching; thus, T.sub.m, hybridization, and/or wash conditions can be adjusted for sequences of the desired identity to hybridize. For example, if sequences with 90% identity are sought, the T.sub.m can be decreased 10 C. Generally, stringent conditions are selected to be about 5 C. lower than the thermal melting point (T.sub.m) for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3, or 4 C. lower than the thermal melting point (T.sub.m); moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9, or 10 C. lower than the thermal melting point (T.sub.m); low stringency conditions can utilize a hybridization and/or wash at 11 to 20 C. lower than the thermal melting point (T.sub.m). Using the equation, hybridization and wash compositions, and desired T.sub.m, those of ordinary skill will understand that variations in the stringency of hybridization and/or wash solutions are inherently described. If the desired degree of mismatching results in a T.sub.m of less than 45 C. (aqueous solution) or 32 C. (formamide solution), it is preferred to increase the SSC concentration so that a higher temperature can be used. An extensive guide to the hybridization of nucleic acids is found (1997) Ausubel et al, Short Protocols in Molecular Biology, pages 2-40, Third Edit. (1997) and Sambrook et al. (1989).
(229) In other embodiments, the subject disclosure provides a cell comprising the polypeptide of SEQ ID NO:1 or SEQ ID NO:3. The term cell as referred to herein encompasses a living organism capable of self replication, and may be a eukaryotic or prokaryotic cell. In some embodiments the cell is a plant cell. In some embodiments, the plant cell can be but is not limited to any higher plant, including both dicotyledonous and monocotyledonous plants, and consumable plants, including crop plants and plants used for their oils. Thus, any plant species or plant cell can be selected as described further below.
(230) In some embodiments, plant cells in accordance with the present disclosure includes, but is not limited to, any higher plants, including both dicotyledonous and monocotyledonous plants, and particularly consumable plants, including crop plants. Such plants can include, but are not limited to, for example: alfalfa, soybeans, cotton, rapeseed (also described as canola), linseed, corn, rice, brachiaria, wheat, safflowers, sorghum, sugarbeet, sunflowers, tobacco and turf grasses. Thus, any plant species or plant cell can be selected. In embodiments, plant cells used herein, and plants grown or derived therefrom, include, but are not limited to, cells obtainable from rapeseed (Brassica napus); indian mustard (Brassica juncea); Ethiopian mustard (Brassica carinata); turnip (Brassica rapa); cabbage (Brassica oleracea); soybean (Glycine max); linseed/flax (Linum usitatissimum); maize (also described as corn) (Zea mays); safflower (Carthamus tinctorius); sunflower (Helianthus annuus); tobacco (Nicotiana tabacum); Arabidopsis thaliana; Brazil nut (Betholettia excelsa); castor bean (Ricinus communis); coconut (Cocus nucifera); coriander (Coriandrum sativum); cotton (Gossypium spp.); groundnut (Arachis hypogaea); jojoba (Simmondsia chinensis); oil palm (Elaeis guineeis); olive (Olea eurpaea); rice (Oryza sativa); squash (Cucurbita maxima); barley (Hordeum vulgare); sugarcane (Saccharum officinarum); rice (Oryza sativa); wheat (Triticum spp. including Triticum durum and Triticum aestivum); and duckweed (Lemnaceae sp.). In some embodiments, the genetic background within a plant species may vary.
(231) In a further embodiment, the subject disclosure provides a seed comprising the polypeptide of SEQ ID NO:1 or SEQ ID NO:3. In subsequent embodiments a seed from maize is provided. A maize seed may be described or referred to as a kernel, and is composed of four structural parts: (1) the pericarp, which is a protective outer covering (also known as bran or hull); (2) the germ (also known as an embryo); (3) the endosperm; and, (4) the tip cap, which is the point of attachment to the cob. Another aspect of the present disclosure is one or more parts of corn seed, such as the pericarp of the corn seed or the germ and/or the endosperm of the corn seed which remain upon removal of the pericarp and adhering remnants of the seed coat.
(232) The subject disclosure also relates to one or more corn plant parts of an rf3 or Rf3 corn line. Corn plant parts include plant cells, plant protoplasts, plant cell tissue cultures from which corn plants can be regenerated, plant DNA, plant calli, plant clumps, and plant cells that are intact in plants or parts of plants, such as embryos, pollen, ovules, flowers, seeds, kernels, ears, cobs, leaves, husks, stalks, roots, root tips, brace roots, lateral tassel branches, anthers, tassels, glumes, silks, tillers, and the like.
(233) In subsequent embodiments, the subject disclosure relates to a cell comprising SEQ ID NO:5. In other embodiments, the cell is a plant cell. Further embodiments include a plant comprising the plant cell. In some embodiments the plant may be a monocotyledonous or dicotyledonous plant. In other embodiments, the monocotyledonous plant is a maize plant. Further embodiments include a maize plant with CMS-S type cytoplasm. Additional embodiments include a plant part, plant tissue, or plant seed.
V. Polynucleotide Sequences Encoding the Isolated Protein
(234) The subject disclosure further provides a synthetic nucleic acid sequence encoding the polypeptide of SEQ ID NO:1 or SEQ ID NO:3. In an embodiment, the synthetic nucleic acid sequence comprising the polypeptide of SEQ ID NO:1 is encoded by SEQ ID NO:2. In further embodiments, the synthetic nucleic acid sequence comprising the polypeptide of SEQ ID NO:3 is encoded by SEQ ID NO:4. In subsequent embodiments, a sequence with 85%, 87.5%, 90%, 92.5%, 95%, 97.5%, or 99% sequence identify of SEQ ID NO:4 is provided. In other embodiments, a polynucleotide comprising the synthetic nucleic acid sequence of SEQ ID NO:2. In an embodiment, the polynucleotide sequences that comprise the synthetic nucleic acid sequence of SEQ ID NO:2, may include a gene expression cassette, a vector, a plasmid, a bacterial artificial chromosome, a DNA fragment, an oligonucleotide, a primer, or a probe.
(235) In further embodiments, the synthetic nucleic acid sequence of SEQ ID NO:2 is operably linked to a promoter, wherein the promoter is functional in plants. In an aspect of the embodiment, the promoter is a plant cytoplasmic male sterile promoter
(236) In an embodiment the synthetic nucleic acid sequence of SEQ ID NO:2 is operably linked to a promoter. The promoter used to direct expression of a peptide encoding nucleic acid depends on the particular application. For example, a number of promoters that direct expression of a gene in a plant can be employed. Such promoters can be selected from constitutive, chemically-regulated, inducible, tissue-specific, and seed-preferred promoters.
(237) The range of available plant compatible promoters includes tissue specific and inducible promoters. An inducible regulatory element is one that is capable of directly or indirectly activating transcription of one or more DNA sequences or genes in response to an inducer. In the absence of an inducer the DNA sequences or genes will not be transcribed. Typically the protein factor that binds specifically to an inducible regulatory element to activate transcription is present in an inactive form which is then directly or indirectly converted to the active form by the inducer. The inducer can be a chemical agent such as a protein, metabolite, growth regulator, herbicide or phenolic compound or a physiological stress imposed directly by heat, cold, salt, or toxic elements or indirectly through the action of a pathogen or disease agent such as a virus. Typically the protein factor that binds specifically to an inducible regulatory element to activate transcription is present in an inactive form which is then directly or indirectly converted to the active form by the inducer. The inducer can be a chemical agent such as a protein, metabolite, growth regulator, herbicide or phenolic compound or a physiological stress imposed directly by heat, cold, salt, or toxic elements or indirectly through the action of a pathogen or disease agent such as a virus. A plant cell containing an inducible regulatory element may be exposed to an inducer by externally applying the inducer to the cell or plant such as by spraying, watering, heating or similar methods. In some embodiments the synthetic nucleic acid sequence that is operably linked to a promoter may further comprise a coding sequence for a transit peptide. Examples of transit peptides are known in the art and include mitochondrial or chloroplast targeting transit peptides.
(238) Subsequent embodiments of the subject disclosure relate to a cell comprising the synthetic nucleic acid sequence of SEQ ID NO:2. Additional embodiments of the subject disclosure relate to a cell comprising the synthetic nucleic acid sequence of SEQ ID NO:4. Further embodiments of the subject disclosure relate to a vector comprising the synthetic nucleic acid sequence of SEQ ID NO:2. Additional embodiments of the subject disclosure relate to a cell comprising the synthetic nucleic acid sequence of SEQ ID NO:4. In other embodiments the subject disclosure provides a cell comprising any previous embodiment of said vector.
(239) In other embodiments the vector comprises a plasmid. A plasmid or vector can be described or referred to as prokaryotic vectors, shuttle vectors, insect vectors, or eukaryotic vectors. Typically, plasmids are extra-chromosomal elements, often circular DNA, that are comprised of an origin of replication and a selectable marker gene. At times, it may be preferable to have a plasmid that is functional in E. coli (e.g., DNA sequence analysis, construction of inserts, obtaining quantities of nucleic acids). The particular plasmid can be selected with regard to the intended use (e.g., expression in plants, animals, bacteria, fungus, and protozoa). Standard bacterial, plant, and animal expression plasmids are known in the art and are described in detail, for example, U.S. Patent Publication 20050064474A1 and International Patent Publications WO 05/084190, WO05/014791 and WO03/080809. Examples of a plasmid include a pUC19 plasmid. pUC19 is a small double stranded DNA circle. The plasmid contains high copy number origin of replication that is capable of bacterial replication and contains a multiple cloning site. See Yanisch-Perron, C., Vieira, J. and Messing, J. (1985). Gene. 33, 103-119. Other plasmids are known and commonly used in the art. For example, pUC18, pBR322, pBR325, pBR328, pACYC184, pAT153, pUC118, and pUC119 are plasmids commonly known in the art.
(240) In further embodiments of the subject disclosure, an isolated polypeptide comprising an amino acid sequence of SEQ ID NO: 5 is provided. In a further embodiment, the isolated polypeptide of SEQ ID NO:5 further comprises an amino acid sequence with at least 85% sequence identity to SEQ ID NO:7. In a subsequent embodiment, the isolated polypeptide of SEQ ID NO:5 and a polypeptide with 85% sequence identity to SEQ ID NO:7 have cytoplasmic male sterile activity.
(241) The subject disclosure further provides a synthetic nucleic acid sequence encoding the polypeptide of SEQ ID NO:5 or SEQ ID NO:7. In an embodiment, the synthetic nucleic acid sequence comprising the polypeptide of SEQ ID NO:5 is encoded by SEQ ID NO:6. In further embodiments, the synthetic nucleic acid sequence comprising the polypeptide of SEQ ID NO:7 is encoded by SEQ ID NO:8. In subsequent embodiments, a sequence with 85%, 87.5%, 90%, 92.5%, 95%, 97.5%, or 99% sequence identify of SEQ ID NO:8 is provided. In other embodiments, a polynucleotide comprising the synthetic nucleic acid sequence of SEQ ID NO:8. In an embodiment, the polynucleotide sequences that comprise the synthetic nucleic acid sequence of SEQ ID NO:8, may include a gene expression cassette, a vector, a plasmid, a bacterial artificial chromosome, a DNA fragment, an oligonucleotide, a primer, or a probe.
(242) In other embodiments, the subject disclosure relates to a synthetic nucleic acid sequence encoding the polypeptide of SEQ ID NO:5. In further embodiments, the synthetic nucleic acid sequence has the sequence of SEQ ID NO:8. In additional embodiments, a gene expression cassette comprising the synthetic nucleic acid sequence of SEQ ID NO:8 is provided. Further embodiments include the gene expression cassette comprising the synthetic nucleic acid sequence of SEQ ID NO:8 operably linked to a promoter, wherein the promoter is functional in plants. In additional embodiments the promoter is a cytoplasmic male sterile promoter. Additional embodiments include a cell comprising the gene expression cassette comprising the synthetic nucleic acid sequence of SEQ ID NO:8. Further embodiments of the subject disclosure relate to a vector comprising the synthetic nucleic acid sequence of SEQ ID NO:8. In other embodiments the subject disclosure provides a cell comprising said vector.
VI. Introgression of RF3 Alleles into Progeny Plants
(243) An embodiment of the subject disclosure provides a method for producing a progeny cytoplasmic male sterile plant, the method comprising the steps of: a) crossing a female parent plant with a male parent plant, wherein the female parent plant is a cytoplasmic male sterile parent plant homozygous for SEQ ID NO:4, and wherein the male parent plant is a fertile parent plant; b) harvesting a progeny seed from the cross of (a), wherein the progeny seed is homozygous for SEQ ID NO:4; c) planting the progeny seed; and, d) growing the progeny seed, wherein the progeny seed produce the progeny cytoplasmic male sterile plant, wherein the progeny cytoplasmic male sterile plant is homozygous for SEQ ID NO:4.
(244) In additional embodiments, the subject disclosure relates to female and male parent plants that are monocotyledonous plants. In other embodiments, the monocotyledonous plants are maize plants. In further embodiments the male parent plant is isogenic to the female parent plant. In an aspect of the embodiment, the male parent plant is homozygous or heterozygous for SEQ ID NO:8.
(245) In yet another aspect of the subject disclosure, processes are provided for producing progeny plants, which processes generally comprise crossing a first parent corn plant with a second parent corn plant wherein at least one of the first parent corn plant or the second parent corn plant is a cytoplasmic male sterile plant having CMS-S type cytoplasm. In some embodiments of the present disclosure, the cytoplasmic male sterile plant is a female and in other embodiments the cytoplasmic male restorer plant is a male. These processes may be further exemplified as processes for producing progeny seed or plants, wherein a first corn plant is crossed with a second corn plant.
(246) Any time the cytoplasmic male sterile plant or the cytoplasmic male restorer plant is crossed with another, different corn inbred, a progeny or first generation (F.sub.1) corn hybrid plant is produced. As such, a progeny or F.sub.1 hybrid corn plant may be produced by crossing the cytoplasmic male sterile plant or the cytoplasmic male restorer plant with any second inbred corn plant. Therefore, any progeny or F.sub.1 hybrid corn plant or corn seed which is produced with the cytoplasmic male sterile plant or the cytoplasmic male restorer plant as a parent is an embodiment of the subject disclosure.
(247) When the cytoplasmic male sterile plant or the cytoplasmic male restorer plant is crossed with another inbred plant to yield a progeny or hybrid, the original parent can serve as either the maternal or paternal plant with basically, the same characteristics in the hybrids. Occasionally, maternally inherited characteristics may express differently depending on the decision of which parent to use as the female. However, often one of the parental plants is preferred as the maternal plant because of increased seed yield and preferred production characteristics, such as optimal seed size and quality or ease of tassel removal. Some plants produce tighter ear husks leading to more loss, for example due to rot, or the ear husk may be so tight that the silk cannot completely push out of the tip preventing complete pollination resulting in lower seed yields. There can be delays in silk formation which deleteriously affect timing of the reproductive cycle for a pair of parental inbreds. Seed coat characteristics can be preferable in one plant which may affect shelf life of the hybrid seed product. Pollen can shed better by one plant, thus rendering that plant as the preferred male parent.
(248) In embodiments of the present disclosure, the first step of crossing the cytoplasmic male sterile plant or the cytoplasmic male restorer plant comprises planting, preferably in pollinating proximity, seeds of a first inbred corn plant and a second, distinct inbred corn plant.
(249) A further step comprises cultivating or growing the seeds of the cytoplasmic male sterile plant or the cytoplasmic male restorer plant that bear flowers. If the parental plants differ in timing of sexual maturity, techniques may be employed to obtain an appropriate nick, i.e., to ensure the availability of pollen from the parent corn plant designated the male during the time at which silks on the parent corn plant designated the female are receptive to the pollen. Methods that may be employed to obtain the desired nick include delaying the flowering of the faster maturing plant, such as, but not limited to delaying the planting of the faster maturing seed, cutting or burning the top leaves of the faster maturing plant (without killing the plant) or speeding up the flowering of the slower maturing plant, such as by covering the slower maturing plant with film designed to speed germination and growth or by cutting the tip of a young ear shoot to expose silk.
(250) In an embodiment, the male sterile plant or the cytoplasmic male restorer plant are treated with one or more agricultural chemicals as considered appropriate by the grower.
(251) A further step comprises harvesting the seeds, near or at maturity, from the ear of the plant that received the pollen. In a particular embodiment, seed is harvested from the female parent plant, and when desired, the harvested seed can be grown to produce a progeny or first generation (F.sub.1) hybrid corn plant.
(252) Yet another step comprises drying and conditioning the seeds, including the treating, sizing (or grading) of seeds, and packaging for sale to growers for the production of grain or forage. As with inbred seed, it may be desirable to treat hybrid seeds with compositions that render the seeds and seedlings grown therefrom more hardy when exposed to adverse conditions. Mention should be made that resulting progeny or hybrid seed may be sold to growers for the production of grain and forage and not for breeding or seed production.
(253) Still further, the subject disclosure provides a progeny corn plant produced by growing the harvested seeds produced on the cytoplasmic male-sterile or restorer plant as well as grain produced by the progeny corn plant.
(254) In a subsequent embodiment, the disclosure related to introducing a desired trait into the progeny cytoplasmic male sterile plant. In an aspect of the embodiment, the desired trait is selected from the group consisting of an insecticidal resistance trait, herbicide tolerant trait, disease resistance trait, yield increase trait, nutritional quality trait, agronomic increase trait, and combinations thereof. Other examples of a desired trait include modified fatty acid metabolism, for example, by transforming a plant with an antisense gene of stearoyl-ACP desaturase to increase stearic acid content of the plant. See Knultzon et al., Proc. Natl. Acad. Sci. USA 89: 2624 (1992). Decreased phytate content: (i) Introduction of a phytase-encoding gene would enhance breakdown of phytate, adding more free phosphate to the transformed plant. For example, see Van Hartingsveldt et al., Gene 127: 87 (1993), for a disclosure of the nucleotide sequence of an Aspergillus niger phytase gene. (ii) A gene could be introduced that reduces phytate content. In corn, this, for example, could be accomplished, by cloning and then reintroducing DNA associated with the single allele which is responsible for corn mutants characterized by low levels of phytic acid. See Raboy et al., Maydica 35: 383 (1990). (iii) Modified carbohydrate composition effected, for example, by transforming plants with a gene coding for an enzyme that alters the branching pattern of starch. See Shiroza et al., J. Bacteriol. 170: 810 (1988) (nucleotide sequence of Streptococcus mutans fructosyltransferase gene), Steinmetz et al., Mol. Gen. Genet. 200: 220 (1985) (nucleotide sequence of Bacillus subtillus levansucrase gene), Pen et al., Bio/Technology 10: 292 (1992) (production of transgenic plants that express Bacillus licheniformis -amylase), Elliot et al., Plant Molec. Biol. 21: 515 (1993) (nucleotide sequences of tomato invertase genes), Sogaard et al., J. Biol. Chem. 268: 22480 (1993) (site-directed mutagenesis of barley -amylase gene), and Fisher et al., Plant Physiol. 102: 1045 (1993) (corn endosperm starch branching enzyme II). Further examples of potentially desired characteristics include greater yield, better stalks, better roots, reduced time to crop maturity, better agronomic quality, higher nutritional value, higher starch extractability or starch fermentability, resistance and/or tolerance to insecticides, herbicides, pests, heat and drought, and disease, and uniformity in germination times, stand establishment, growth rate, maturity and kernel size.
(255) In an additional embodiment, the subject disclosure relates to a method for producing a progeny cytoplasmic male sterile plant, the method further comprising the steps of: e) crossing the progeny cytoplasmic male sterile plant, with another plant comprising a desired trait to produce F1 progeny plants; f) selecting F1 progeny plants that have the desired trait to produce selected F1 progeny plants; g) crossing the selected F1 progeny plants with the progeny cytoplasmic male sterile plant to produce backcross progeny plants; h) selecting for backcross progeny plants that have the desired trait; and, i) repeating steps (g) and (h) three or more times in succession to produce selected fourth or higher backcross progeny plants that comprise the desired trait.
(256) Various breeding schemes may be used to produce progeny plants. In one method, generally referred to as the pedigree method, the parent may be crossed with another different plant such as a second inbred parent corn plant, which either itself exhibits one or more selected desirable characteristic(s) or imparts selected desirable characteristic(s) to a hybrid combination. If the two original parent corn plants do not provide all the desired characteristics, then other sources can be included in the breeding population. Progeny plants, that is, pure breeding, homozygous inbred lines, can also be used as starting materials for breeding or source populations from which to develop progeny plants.
(257) Thereafter, resulting seed is harvested and resulting superior progeny plants are selected and selfed or sib-mated in succeeding generations, such as for about 5 to about 7 or more generations, until a generation is produced that no longer segregates for substantially all factors for which the inbred parents differ, thereby providing a large number of distinct, pure-breeding inbred lines.
(258) In another embodiment for generating progeny plants, generally referred to as backcrossing, one or more desired traits may be introduced into the cytoplasmic male sterile parent or restored fertile parent by crossing the parent plants with another corn plant (referred to as the donor or non-recurrent parent) which carries the gene(s) encoding the particular trait(s) of interest to produce F.sub.1 progeny plants. Both dominant and recessive alleles may be transferred by backcrossing. The donor plant may also be an inbred, but in the broadest sense can be a member of any plant variety or population cross-fertile with the recurrent parent. Next, F.sub.1 progeny plants that have the desired trait are selected. Then, the selected progeny plants are crossed with the cytoplasmic male sterile parent or restored fertile parent to produce backcross progeny plants. Thereafter, backcross progeny plants comprising the desired trait and the physiological and morphological characteristics of the cytoplasmic male sterile parent or restored fertile parent are selected. This cycle is repeated for about one to about eight cycles, preferably for about 3 or more times in succession to produce selected higher backcross progeny plants that comprise the desired trait and all of the physiological and morphological characteristics of the cytoplasmic male sterile parent or restored fertile parent when grown in the same environmental conditions. Exemplary desired trait(s) include insect resistance, enhanced nutritional quality, waxy starch, herbicide resistance, yield stability, yield enhancement and resistance to bacterial, fungal and viral disease. One of ordinary skill in the art of plant breeding would appreciate that a breeder uses various methods to help determine which plants should be selected from the segregating populations and ultimately which inbred lines will be used to develop hybrids for commercialization. In addition to the knowledge of the germplasm and other skills the breeder uses, a part of the selection process is dependent on experimental design coupled with the use of statistical analysis. Experimental design and statistical analysis are used to help determine which plants, which family of plants, and finally which inbred lines and hybrid combinations are significantly better or different for one or more traits of interest. Experimental design methods are used to assess error so that differences between two inbred lines or two hybrid lines can be more accurately determined. Statistical analysis includes the calculation of mean values, determination of the statistical significance of the sources of variation, and the calculation of the appropriate variance components. Either a five or a one percent significance level is customarily used to determine whether a difference that occurs for a given trait is real or due to the environment or experimental error. One of ordinary skill in the art of plant breeding would know how to evaluate the traits of two plant varieties to determine if there is no significant difference between the two traits expressed by those varieties. For example, see Fehr, Walt, Principles of Cultivar Development, p. 261-286 (1987) which is incorporated herein by reference. Mean trait values may be used to determine whether trait differences are significant, and preferably the traits are measured on plants grown under the same environmental conditions.
(259) This method results in the generation of progeny inbred plants with substantially all of the desired morphological and physiological characteristics of the recurrent parent and the particular transferred trait(s) of interest. Because such progeny inbred plants are heterozygous for loci controlling the transferred trait(s) of interest, the last backcross generation would subsequently be selfed to provide pure breeding progeny for the transferred trait(s).
(260) Backcrossing may be accelerated by the use of genetic markers such as SSR, RFLP, SNP or AFLP markers to identify plants with the greatest genetic complement from the recurrent parent.
(261) Direct selection may be applied where a single locus acts as a dominant trait, such as the herbicide resistance trait. For this selection process, the progeny of the initial cross are sprayed with the herbicide before the backcrossing. The spraying eliminates any plants which do not have the desired herbicide resistance characteristic, and only those plants which have the herbicide resistance gene are used in the subsequent backcross. In the instance where the characteristic being transferred is a recessive allele, it may be necessary to introduce a test of the progeny to determine if the desired characteristic has been successfully transferred. The process of selection, whether direct or indirect, is then repeated for all additional backcross generations.
(262) It should be appreciated by those having ordinary skill in the art that backcrossing can be combined with pedigree breeding as where the cytoplasmic male sterile parent or restored fertile parent is crossed with another corn plant, the resultant progeny are crossed back to the cytoplasmic male sterile parent or restored fertile parent and thereafter, the resulting progeny of this single backcross are subsequently inbred to develop new inbred lines. This combination of backcrossing and pedigree breeding is useful as when recovery of fewer than all of the cytoplasmic male sterile parent or restored fertile parent characteristics than would be obtained by a conventional backcross are desired.
(263) In an additional embodiment, the subject disclosure relates to a method for restoring fertility to a progeny of a cytoplasmic male sterile parent plant, the method comprising: a) crossing a female parent plant with a male parent plant, wherein the female parent plant is a cytoplasmic male sterile parent plant homozygous or heterozygous for SEQ ID NO:8, and wherein the cytoplasmic male sterile plant is a fertile parent plant; b) harvesting a progeny seed from the cross of (a), wherein the progeny seed is homozygous or heterozygous for SEQ ID NO:8; c) planting the progeny seed; d) growing the progeny seed, wherein the progeny seed produce a progeny cytoplasmic male fertile plant; and, e) restoring fertility to the progeny of the cytoplasmic male sterile parent plant, wherein the progeny cytoplasmic male fertile plant is homozygous or heterozygous for SEQ ID NO:8.
Additional embodiments to the method include. f) crossing the progeny cytoplasmic male sterile plant, with another plant comprising a desired trait to produce F1 progeny plants; g) selecting F1 progeny plants that have the desired trait to produce selected F1 progeny plants; h) crossing the selected F1 progeny plants with progeny cytoplasmic male sterile plant to produce backcross progeny plants; i) selecting for backcross progeny plants that have the desired trait; and, j) repeating steps (h) and (i) three or more times in succession to produce selected fourth or higher backcross progeny plants that comprise the desired trait.
(264) In additional embodiments, the subject disclosure relates to female and male parent plants that are monocotyledonous plants. In other embodiments, the monocotyledonous plants are maize plants. In further embodiments the male parent plant is isogenic to the female parent plant. In an aspect of the embodiment, the male parent plant is homozygous or heterozygous for SEQ ID NO:8. In a subsequent embodiment, the disclosure related to introducing a desired trait into the progeny cytoplasmic male sterile plant. In an aspect of the embodiment, the desired trait is selected from the group consisting of an insecticidal resistance trait, herbicide tolerant trait, disease resistance trait, yield increase trait, nutritional quality trait, agronomic increase trait, and combinations thereof.
VII. Assays for Detection of the Rf3 and Rf3 Alleles
(265) Various assays can be employed to detect the polynucleotides that encode the Rf3 and rf3 alleles that are described in certain embodiments of the disclosure. The following techniques are useful in a variety of situations, and in one embodiment, are useful in detecting the presence of a nucleic acid molecule and/or the polypeptide encoding an Rf3 or rf3 allele in a plant cell. For example, the presence of the molecule can be determined in a variety of ways, including using a primer or probe of the sequence, ELISA assay to detect the encoded protein, a Western blot to detect the protein, or a Northern or Southern blot to detect RNA or DNA. Enzymatic assays for detecting the polynucleotides that encode the Rf3 and rf3 allele can be employed. Further, an antibody which can detect the presence of the Rf3 or rf3 protein can be generated using art recognized procedures. Additional techniques, such as in situ hybridization, enzyme staining, and immunostaining, also may be used to detect the presence or expression of the polynucleotides that encode the Rf3 and rf3 alleles in specific plant organs and tissues. The polynucleotides that encode the Rf3 and rf3 alleles may be selectively expressed in some tissues of the plant or at some developmental stages, or the polynucleotides that encode the Rf3 and rf3 alleles may be expressed in substantially all plant tissues, substantially along its entire life cycle. However, any combinatorial expression mode is also applicable.
(266) In an embodiment the disclosure relates method of detecting a plant comprising a cytoplasmic male sterile restorer trait via an amplification reaction in which an amplified product or amplicon is generated. The detection of the absence of the amplicon is an indication of whether the plant contains an Rf3 or rf3 allele of gene sequence, respectively.
(267) Various assays can be employed in connection with the amplification reaction and are considered as embodiments of the disclosure. The following techniques are useful in a variety of situations, and in one embodiment, are useful in detecting the presence of the nucleic acid molecule and/or the polypeptide encoded in a plant cell. For example, the presence of the molecule can be determined in a variety of ways, including using a primer or probe of the sequence. The Rf3 or rf3 alleles may be selectively expressed in some tissues of the plant or at some developmental stages, or the Rf3 or rf3 alleles may be expressed in substantially all plant tissues, throughout the entire life cycle of the plant. However, any combinatorial expression mode is also applicable.
(268) Amplification of a nucleic acid sequence may be carried out by any suitable means. See generally, Kwoh et al., Am. Biotechnol. Lab. 8, 14-25 (1990). Examples of suitable amplification techniques include, but are not limited to, polymerase chain reaction, ligase chain reaction, strand displacement amplification (see generally G. Walker et al., Proc. Natl. Acad. Sci. USA 89, 392-396 (1992); G. Walker et al., Nucleic Acids Res. 20, 1691-1696 (1992)), transcription-based amplification (see D. Kwoh et al., Proc. Natl. Acad Sci. USA 86, 1173-1177 (1989)), self-sustained sequence replication (or 35R) (see J. Guatelli et al., Proc. Natl. Acad. Sci. USA 87, 1874-1878 (1990)), the Q replicase system (see P. Lizardi et al., BioTechnology 6, 1197-1202 (1988)), nucleic acid sequence-based amplification (or NASBA) (see R. Lewis, Genetic Engineering News 12 (9), 1 (1992)), the repair chain reaction (or RCR) (see R. Lewis, supra), and boomerang DNA amplification (or BDA) (see R. Lewis, supra). Polymerase chain reaction is generally preferred.
(269) Amplification is a special case of nucleic acid replication involving template specificity. It is to be contrasted with non-specific template replication (i.e., replication that is template-dependent but not dependent on a specific template). Template specificity is here distinguished from fidelity of replication (i.e., synthesis of the proper polynucleotide sequence) and nucleotide (ribo- or deoxyribo-) specificity. Template specificity is frequently described in terms of target specificity. Target sequences are targets in the sense that they are sought to be sorted out from other nucleic acid. Amplification techniques were designed primarily for this sorting out.
(270) As used herein, the term polymerase chain reaction and PCR generally refers to the method for increasing the concentration of a segment of a target sequence in a mixture of genomic DNA without cloning or purification (U.S. Pat. Nos. 4,683,195; 4,683,202; and 4,965,188; herein incorporated by reference). This process for amplifying the target sequence comprises introducing an excess of two oligonucleotide primers to the DNA mixture containing the desired target sequence, followed by a precise sequence of thermal cycling in the presence of a DNA polymerase. The two primers are complementary to their respective strands of the double stranded target sequence. To effect amplification, the mixture is denatured and the primers then annealed to their complementary sequences within the target molecule. Following annealing, the primers are extended with a polymerase so as to form a new pair of complementary strands. The steps of denaturation, primer annealing and polymerase extension can be repeated many times (i.e., denaturation, annealing and extension constitute one cycle; there can be numerous cycles) to obtain a high concentration of an amplified segment of the desired target sequence. The length of the amplified segment of the desired target sequence is determined by the relative positions of the primers with respect to each other, and therefore, this length is a controllable parameter. By virtue of the repeating aspect of the process, the method is referred to as the polymerase chain reaction (hereinafter PCR). Because the desired amplified segments of the target sequence become the predominant sequences (in terms of concentration) in the mixture, they are said to be PCR amplified.
(271) The term plurality is used herein to mean two or more, for example, three, four, five or more, including ten, twenty, fifty or more polynucleotides, nucleic acid probes, and the like.
(272) The term reverse-transcriptase or RT-PCR refers to a type of PCR where the starting material is mRNA. The starting mRNA is enzymatically converted to complementary DNA or cDNA using a reverse transcriptase enzyme. The cDNA is then used as a template for a PCR reaction.
(273) In an embodiment, the amplification reaction is quantified. In other embodiments, the amplification reaction is quantitated using a signature profile, in which the signature profile is selected from the group consisting of a melting temperature or a fluorescence signature profile. In further embodiments the amplification reaction is quantitated the Delta Delta ct method.
(274) The polynucleotides that encode the Rf3 and rf3 genes, or segments thereof, can be used as primers for PCR amplification. In performing PCR amplification, a certain degree of mismatch can be tolerated between primer and template. Therefore, mutations, deletions, and insertions (especially additions of nucleotides to the 5 end) of the exemplified primers fall within the scope of the subject disclosure. Mutations, insertions, and deletions can be produced in a given primer by methods known to an ordinarily skilled artisan.
(275) Another example of method detection is the pyrosequencing technique as described by Winge (Innov. Pharma. Tech. 00:18-24, 2000). In this method an oligonucleotide is designed that overlaps the adjacent genomic DNA and insert DNA junction. The oligonucleotide is hybridized to single-stranded PCR product from the region of interest and incubated in the presence of a DNA polymerase, ATP, sulfurylase, luciferase, apyrase, adenosine 5 phosphosulfate and luciferin. DNTPs are added individually and the incorporation results in a light signal that is measured. A light signal indicates the presence of the transgene insert/flanking sequence due to successful amplification, hybridization, and single or multi-base extension (this technique is used for initial sequencing, not for detection of a specific gene when it is known).
(276) Molecular Beacons have been described for use in sequence detection. Briefly, a FRET oligonucleotide probe is designed that overlaps the flanking genomic and insert DNA junction. The unique structure of the FRET probe results in it containing a secondary structure that keeps the fluorescent and quenching moieties in close proximity. The FRET probe and PCR primers are cycled in the presence of a thermostable polymerase and dNTPs. Following successful PCR amplification, hybridization of the FRET probe(s) to the target sequence results in the removal of the probe secondary structure and spatial separation of the fluorescent and quenching moieties. A fluorescent signal indicates the presence of the flanking genomic/transgene insert sequence due to successful amplification and hybridization.
(277) Hydrolysis probe assay, otherwise known as Taqman (Life Technologies, Foster City, Calif.), is a method of detecting and quantifying the presence of a DNA sequence. Briefly, a FRET oligonucleotide probe is designed with one oligo within the transgene and one in the flanking genomic sequence for event-specific detection. The FRET probe and PCR primers (one primer in the insert DNA sequence and one in the flanking genomic sequence) are cycled in the presence of a thermostable polymerase and dNTPs. Hybridization of the FRET probe results in cleavage and release of the fluorescent moiety away from the quenching moiety on the FRET probe. A fluorescent signal indicates the presence of the flanking/transgene insert sequence due to successful amplification and hybridization.
(278) The ELISA or enzyme linked immunoassay has been known since 1971. In general, antigens solubilised in a buffer are coated on a plastic surface. When serum is added, antibodies can attach to the antigen on the solid phase. The presence or absence of these antibodies can be demonstrated when conjugated to an enzyme. Adding the appropriate substrate will detect the amount of bound conjugate which can be quantified. A common ELISA assay is one which uses biotinylated anti-(protein) polyclonal antibodies and an alkaline phosphatase conjugate. For example, an ELISA used for quantitative determination of laccase levels can be an antibody sandwich assay, which utilizes polyclonal rabbit antibodies obtained commercially. The antibody is conjugated to alkaline phosphatases for detection. In another example, an ELISA assay to detect trypsin or trypsinogen uses biotinylated anti-trypsin or anti-trypsinogen polyclonal antibodies and a streptavidin-alkaline phosphatase conjugate.
(279) KASPar assays are a method of detecting and quantifying the presence of a DNA sequence. Briefly, the genomic DNA sample comprising the targeted genomic locus is screened using a polymerase chain reaction (PCR) based assay known as a KASPar assay system. The KASPar assay used in the practice of the subject disclosure can utilize a KASPar PCR assay mixture which contains multiple primers. The primers used in the PCR assay mixture can comprise at least one forward primers and at least one reverse primer. The forward primer contains a sequence corresponding to a specific region of the DNA polynucleotide sequence, and the reverse primer contains a sequence corresponding to a specific region of a second DNA polynucleotide sequence. In addition, the primers used in the PCR assay mixture can comprise at least one forward primers and at least one reverse primer. For example, the KASPar PCR assay mixture can use two forward primers corresponding to two different alleles and one reverse primer. One of the forward primers contains a sequence corresponding to specific region of the endogenous genomic sequence. The second forward primer contains a sequence corresponding to a specific region of the donor DNA polynucleotide. The reverse primer contains a sequence corresponding to a specific region of the genomic sequence. Such a KASPar assay for detection of an amplification reaction is an embodiment of the subject disclosure.
(280) In some embodiments the fluorescent signal or fluorescent dye is selected from the group consisting of a HEX fluorescent dye, a FAM fluorescent dye, a JOE fluorescent dye, a TET fluorescent dye, a Cy 3 fluorescent dye, a Cy 3.5 fluorescent dye, a Cy 5 fluorescent dye, a Cy 5.5 fluorescent dye, a Cy 7 fluorescent dye, and a ROX fluorescent dye.
(281) In other embodiments the quencher is selected from the group consisting of a Dabcyl quencher, a Tamra quencher, a Qxl quencher, an Iowa Black FQ quencher, an Iowa Black RQ quencher, an IR Dye QC-1 quencher, a MGB quencher, or a Blackhole quencher.
(282) In other embodiments the amplification reaction is run using suitable second fluorescent DNA dyes that are capable of staining cellular DNA at a concentration range detectable by flow cytometry, and have a fluorescent emission spectrum which is detectable by a real time thermocycler. It should be appreciated by those of ordinary skill in the art that other nucleic acid dyes are known and are continually being identified. Any suitable nucleic acid dye with appropriate excitation and emission spectra can be employed, such as YO-PRO-1, SYTOX Green, SYBR Green I, SYTO11, SYTO12, SYTO13, BOBO, YOYO, and TOTO. in one embodiment, a second fluorescent DNA dye is SYTO13 used at less than 10 M, less than 4 M, or less than 2.7 M.
(283) In various embodiments, other known detection methods are performed to detect the Rf3 or rf3 alleles.
(284) Southern analysis is a commonly used detection method, wherein DNA is cut with restriction endonucleases and fractionated on an agarose gel to separate the DNA by molecular weight and then transferring to nylon membranes. It is then hybridized with the probe fragment which was radioactively labeled with 32P (or other probe labels) and washed in an SDS solution.
(285) Likewise, Northern analysis deploys a similar protocol, wherein RNA is cut with restriction endonucleases and fractionated on an agarose gel to separate the RNA by molecular weight and then transferring to nylon membranes. It is then hybridized with the probe fragment which was radioactively labeled with 32P (or other probe labels) and washed in an SDS solution. Analysis of the RNA (e.g., mRNA) isolated from the tissues of interest can indicate relative expression levels. Typically, if the mRNA is present or the amount of mRNA has increased, it can be assumed that the corresponding transgene is being expressed. Northern analysis, or other mRNA analytical protocols, can be used to determine expression levels of an introduced transgene or native gene.
(286) In the Western analysis, instead of isolating DNA/RNA, the protein of interest is extracted and placed on an acrylamide gel. The protein is then blotted onto a membrane and contacted with a labeling substance. See e.g., Hood et al., Commercial Production of Avidin from Transgenic Maize; Characterization of Transformants, Production, Processing, Extraction and Purification Molecular Breeding 3:291-306 (1997); Towbin et al, (1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications Proc Natl Acad Sci USA 76(9): 4350-4354; Renart et al. Transfer of proteins from gels to diazobenzyloxymethyl-paper and detection with antisera: a method for studying antibody specificity and antigen structure Proc Natl Acad Sci USA 76(7): 3116-3120.
(287) Embodiments of the subject disclosure are further exemplified in the following Examples. It should be understood that these Examples are given by way of illustration only. From the above embodiments and the following Examples, one skilled in the art can ascertain the essential characteristics of this disclosure, and without departing from the spirit and scope thereof, can make various changes and modifications of the embodiments of the disclosure to adapt it to various usages and conditions. Thus, various modifications of the embodiments of the disclosure, in addition to those shown and described herein, will be apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. The following is provided by way of illustration and not intended to limit the scope of the invention.
EXAMPLES
Example 1: Development of a Backcross 1 Population for Mapping and Fine Resolution of the Rf3 Alleles
(288) A backcross 1 (BC1) population was produced and utilized via linkage map analysis with developed molecular markers to map the Rf3 coding sequence. The mapping population was created by crossing a maize cytoplasmic male sterile line, Zea mays c.v. 4XP811 (U.S. Pat. No. 7,135,629; that contained homozygous recessive rf3 alleles) with a maize restoring line Zea mays c.v. MBB56 (that contained at least one dominant Rf3 allele), and then backcrossing progeny with the maize cytoplasmic male sterile line, Zea mays c.v. 4XP811. The resultant population of maize progeny contained 275 individuals with varying degrees of zygosity for the Rf3 (dominant) and rf3 (recessive) alleles.
(289) Resulting maize plants were phenotypically classified according to two methods. The first method involved observation of the shedding pollen from the maize plants in the field. Fertile plants were observed for the growth and development of anthers that were physically exposed before silk development and the start of pollen shedding. Cytoplasmic male sterile plants were observed for delayed growth and development of anthers. By the middle of silk development (e.g., around 7 days after the silks begin to develop) the anthers were not physically exposed.
(290) The second method involved determination of the vitality of pollen grain by using 1% KI-I.sub.2 stain. When the pollen of fertile plants was stained with a KI-I.sub.2 stain, the pollen absorbed the KI-I.sub.2 stain thereby resulting in uniformly stained pollen. It is well known that the pollen from fertile plants is filled with starch to which the KI-I.sub.2 stain adheres. When the pollen from cytoplasmic male sterile plants was stained, the pollen did not absorb the KI-I.sub.2 stain thereby resulting in unstained pollen. The pollen of the cytoplasmic male sterile plants contain collapsed pollen that contains low levels of starch, and the KI-I.sub.2 stain cannot bind to the minimal amounts of starch present in the pollen. Table 1 provides the detailed segregation information from the BC1 mapping population.
(291) TABLE-US-00001 TABLE 1 Phenotype data of the BC1 mapping population. Sterile (homozygous Fertile recessive, rf3/rf3) (heterozygous) cytoplasmic male sterile Broken BC1 Population restorer plants plants plants 4XP811 BMM56 139 120 16
(292) The resulting data indicated that fertility segregation of the BC1 population fit a theoretical 1:1 ratio of fertile plants:sterile plants using the one-gene segregation model (X.sup.2=1.39 [ (0.05)=3.84]). The data further suggested that the germplasm of the MBB56 line carried one restorer gene, Rf3, and the germplasm of the 4XP811 was homozygous for the rf3 gene.
Example 2: Marker Assisted Genome Mapping of RF3
(293) The BC1 populations were screened with molecular markers to identify the locus corresponding with the RF3 allele to high resolution. A panel of 482 SNP markers (evenly distributed on the whole genome) was selected to genotype the BC1 mapping population. From this assay, 437 SNP markers (including four PCR-based markers from PPR2, 432 SNP based markers from across the genome, and one marker based on sterile-fertile phenotype of the BC1 mapping population) were used to create a genetic linkage with JoinMap 4.0 Software (Van Ooijen J W: JoinMap 4. Software for the calculation of genetic linkage maps in experimental populations Kyazma BV. Netherlands: Wageningen; 2006). Utilizing the genetic linkage map, the phenotypic data, and the genotypic data, a whole genome QTL analysis was performed using Map QTL 6.0 software (Van Ooijen J W: MapQTL 6. Wageningen, Netherlands: Software for the mapping of quantitative trait loci in experimental populations of diploid species Kyazma BV; 2009). The results showed that all the PPR2 gene specific markers co-segregated with the RF3 locus. The genomic location of RF3 locus was determined to lie on chromosome 2 in a 1.3 Mb genomic interval of the corn genome (see
Example 3: Whole Genome Sequencing to Identify the RF3 Gene Sequence
(294) To further identify the specific Rf3 restorer gene sequence and the gene sequence of the rf3 modification which results in cytoplasmic male sterility, Next Generation Sequencing (NGS) technology was utilized to further investigate the Rf3 locus. The genomic sequences of two maize CMS-S lines and two maize restorer lines were determined using NGS sequencing. The two CMS-S lines (4XP811 and 7SH382 ms) and the two restorer lines (LH60 and MBB56) were used for whole genome sequencing analysis.
(295) A total of 10 PPR genes (annotated sequentially as PPR 1-10) were identified on chromosome 2 within a 1.3 Mb genomic interval after comparison of the sequenced genomic regions with annotated sequence of the reference genome from Zea mays c.v. B73 (available at www.maizegdb.org). A full length coding sequence that corresponds with PPR2 did not exist in the annotated Zea mays c.v. B73 genome and could not be predicted as a full length, functional gene. As a result, the full gene sequence for PPR2 was obtained from a sequence comparison to the reference genome of Zea mays c.v. Mo17 (available at www.maizegdb.org). The resulting sequences for the 10 PPR genes (PPR2 had two sequences, the first sequence from line Zea mays c.v. B73 and the second sequence from line Zea mays c.v. Mo17) were assembled for reference sequence information based on whole genome sequencing data of the two CMS-S lines and two restorer lines.
(296) Next, the sequences were aligned between CMS-S lines, restorer lines, and the reference genomic sequences for all of the PPR genes. Coding sequence prediction (e.g., cDNA wherein the intron sequences were removed) of the PPR genomic sequences was completed using Softberry software (Softberry Inc., Mount Kisco, N.Y.), and the predicted cDNA and corresponding protein sequences were obtained and aligned. Genomic sequence variations were identified from the aligned genomic sequences of the PPR genes and noted. When the cDNA and the protein sequences were aligned between CMS-S and restorer lines with reference sequences, it was observed that the majority of the variations within the PPR2 sequences resulted in silent mutations (see
(297) The results of the genetic linkage mapping and NGS indicated that the Rf3 allele and the subsequent CMS phenotype was the result of a single gene located on chromosome 2. Like the majority of the cloned Rf genes, Rf3 is most likely a PPR gene. The restorer Rf3-PPR gene from Zea mays c.v. LH60 (SEQ ID NO:8) was identified to be present in restorer, fertile plant phenotypes and encodes an 814-amino acid protein (SEQ ID NO: 7). In addition, a partial polynucleotide fragment of the restorer Rf3-PPR gene from Zea mays c.v. MBB56 (SEQ ID NO:12) was identified to be present in restorer, fertile plant phenotypes and encodes the amino acid protein fragment (SEQ ID NO: 11). An amino acid motif, SEQ ID NO:5 (IVLFSS), which is encoded by SEQ ID NO:6 (5-ATTGTTTTATTCAGT-3), was found to be common for both of the wild type Rf3-PPR genes from Zea mays c.v. LH60 and Zea mays c.v. MBB56.
(298) The mutated, cytoplasmic male sterile rf3-PPR gene from Zea mays c.v. 4XP811 (SEQ ID NO:4) was identified to be present in cytoplasmic male sterile plant phenotypes and encodes an 814-amino acid protein (SEQ ID NO:3). In addition, a cytoplasmic male sterile rf3-PPR gene from Zea mays c.v. 7SH382 ms (SEQ ID NO:10) was identified to be present in cytoplasmic male sterile plant phenotypes and encodes an 814-amino acid protein (SEQ ID NO:9). An amino acid motif, SEQ ID NO:1 (IVFFSS), which is encoded by SEQ ID NO:2 (5-ATTGTTTTCTTCAGT-3), was found to be common for both of the Rf3-PPR genes from Zea mays c.v. 4XP811 and Zea mays c.v. 7SH382 ms.
Example 4: Expression Analysis of RF3-PPR2 by Real-Time PCR
(299) To validate whether the expression of the Rf3-PPR2 protein correlated with fertility restoration of S-CMS maize, a real-time PCR (RT-PCR) assay was performed to quantitatively determine the expression pattern of the Rf3-PPR2 gene in fertile plants and the rf3-PPR2 gene in CMS plants. Several specific primer pairs and probes were designed based on portions of the polynucleotide sequences that contained amino acids with variations in the Rf3-PPR2 protein coding gene (Table 2). Total RNA was extracted from the various plant lines. These samples were extracted from two lines; 4XP811 (cytoplasmic male sterile) and LH60 (restorer lines), F3 individuals derived from an F2 ear segregating for the 1.3-Mb region of long arm chromosome 2, and three commercial maize lines. Taqman assays to quantitate the expression of the Rf3-PPR2 gene were completed. The expression levels were quantitated by comparison to a maize internal control gene, E F 1. (Czechowski T, et al., Plant Physiol., September; 139(1):5-17, 2005).
(300) TABLE-US-00002 TABLE2 PrimersandprobesusedforRT-PCRoftheRF3maizeplants. Primer Reaction Name PrimerSequence SEQIDNO: CMS-S1 Forward GATTGATCAAGGAGTAGCACCTGA 13 Primer Reverse CTTGGCTTTCAGTAAACTACCATGAGT 14 Primer Probe CATACCATTGCCTGATTC 15 CMS-S2 Forward GGTAGTTTACTGAAAGCCAAGGAATT 16 Primer Reverse TTGCAAAGGTTGTTAATTATCGAACT 17 Primer Probe ATGGCATGCATCTTGACAT 18 CMS-S3 Forward GGGTACTGTCTTGTTGGCAAGAT 19 Primer Reverse TGGTTCAATGCCAGCTGACA 20 Primer Probe AGAATGCATTAAGAGTATTTGATGC 21 CMS-S7 Forward GGACAGTGGAAGGAGGCAGTTA 22 Primer Reverse CCATACTTGCAAAGGGAACCC 23 Primer Probe CCAGATGTTGTTACTTTTAACATG 24 CMS-S8 Forward GAATAATGGCATGCGTCTTGATATT 25 Primer Reverse GTAGGATGCAGACCAACATTTACAGT 26 Primer Probe CCTTTGCAAATTGGGAAG 27 RF3allele Forward GTACTCATGGTAGTTTACTGAAAGCCA 28 specific: Primer CMS-S9 Reverse GCATCCATTACCCTTCCCAAT 29 Primer Probe ATCTTGACATTGTTTTATTCAGTTCG 30 CMS-S10 Forward GTTCCTGCAAAGGTGAAATTCC 31 Primer Reverse GAAAGATTGCTTCATCAAAGCATC 32 Primer Probe GGTATCGCTATGTACATATG 33 Internal Forward ATAACGTGCCTTGGAGTATTTGG 34 Control: Primer Elongation Reverse TGGAGTGAAGCAGATGATTTGC 35 Factor-1 Primer Probe TTGCATCCATCTTGTTGC 36
(301) The plants to be analyzed via the Taqman assay were grown in a greenhouse. Leaf tissues were collected from 7-week old (just before tasselling) and 10-week old plants (after pollination). Tassel tissues with developing anthers/pollens and shed pollens (in fertile plants) were also collected. Total RNA was extracted using Qiagen RNeasy Plant Mini Kit and cDNA was synthesized using Qiagen QuantiTect Reverse Transcription Kit (Qiagen, Carlsbad, Calif.). For RT-PCR, the expression of elongation factor -1 (EF 1) of maize was used as an internal control. Primers for Rf3-PPR2 and EF 1 and dual labeled probes with FAM or VIC dyes and Minor Groove Binding Non Fluorescence Quencher I (MGBNFQ) quencher were synthesized by Applied Biosystems (Foster City, Calif.). Taqman genotyping master mix (Applied Biosystems, Foster City, Calif.) was used to set up 10 l PCR reactions and the PCR was performed on Roche LightCycler 480 thermocycler (Roche, Indianapolis, Ind.). The PCR program was initiated with 10 minutes activation of the Taq enzyme at 95 C., followed by 50 cycles of 95 C. for 10 seconds and 58 C. for 38 seconds. Fluorescence signals were recorded at the end of each cycle. Relative expression levels of Rf3-PPR2 to EF 1 was calculated using the Delta Delta CT method.
(302) Seven Taqman assays were designed based on modifications that resulted in amino acid changes within the Rf3-PPR2 gene (see Table 2). Surprisingly, only the CMS-S9 assay amplified an amplicon that corresponded with the presence of Rf3 or rf3 gene sequence in the fertile restorer lines and cytoplasmic male sterile lines, respectively. This assay was able to identify a single base pair modification (e.g., mutation) that resulted in the rf3 cytoplasmic male sterile phenotype. As such, this single base pair modification could be used to discern between the rf3 cytoplasmic male sterile and the Rf3 restored fertile plants. Despite the numerous amino acid mutation present in the rf3 lines, only plants containing the SEQ ID NO:1 motif resulted in the observation of rf3 cytoplasmic male sterile plants.
(303) The results of the quantitative RT-PCR showed that plants containing the SEQ ID NO:5 motif expressed in Rf3 the restorer parent LH60 and F3 plants that were homozygous or heterozygous for the restorer allele in all tested growing stages. However, Rf3 did not express in CMS-S parents, F3s homozygous for the rf3 allele and the commercial maize lines. Notably, Rf3 expression levels were distinguishable between Rf3 homozygous (Rf3/Rf3) and heterozygous (Rf3/rf3) F3 individuals, which could explain why homozygous (Rf3/Rf3) plants shed 100% starched-filled fertile pollen while heterozygous (Rf3/rf3) plants shed approximately 50% starch-filled fertile pollen. Finally, the Rf3-PPR2 gene, which restores S-type CMS cytoplasm, expressed in both tassel tissue containing immature pollen, and leaf tissue.
(304) While aspects of this invention have been described in certain embodiments, they can be further modified within the spirit and scope of this disclosure. This application is therefore intended to cover any variations, uses, or adaptations of embodiments of the invention using its general principles. Further, this application is intended to cover such departures from the present disclosure as come within known or customary practice in the art to which these embodiments pertains and which fall within the limits of the appended claims.