SFRP5-derived peptide fragment and cosmetic composition for skin whitening containing same

Abstract

Provided is a peptide fragment derived from secreted frizzled protein 5 (Sfrp5), i.e., a peptide fragment selected from the group consisting of the peptides as set forth in SEQ ID NOs: 1 to 9 and a cosmetic composition for skin-whitening and/or inhibiting skin pigmentation comprising the same as an active ingredient. The peptide fragment inhibits melanin formation in melanocytes, thereby having an inhibitory activity against skin pigmentation. Further provided is a reagent for researching or analyzing the inhibition of Wnt signaling pathways comprising the peptide fragment.

Claims

1. A peptide for inhibiting Wnt signaling pathways consisting of the amino acid sequence of SEQ ID NO: 1, 2, 3, 4, or 9.

2. A composition inhibiting Wnt signaling pathways, comprising the peptide of claim 1.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIGS. 1a to 1c show the results obtained by evaluating the effects of the peptides of the present invention on the bindings between MITF or CREB and -catenin in the mouse melanoma cell line.

(2) FIG. 2 shows the results obtained by evaluating the inhibitory effects of the peptide fragment of the present invention on expression and activation of the molecules associated with Wnt signaling pathways in human epidermal melanocytes.

(3) FIG. 3 shows the results obtained by evaluating the inhibitory activity of the peptide fragment of the present invention against the melanin formation in the mouse melanoma cell line.

(4) FIG. 4 shows the results obtained by evaluating the effects of the peptide fragment of the present invention on the tyrosinase activity in the mouse melanoma cell line.

(5) FIG. 5 shows the results obtained by evaluating the effects of the peptide fragment of the present invention on the expressions of melanin-producing enzymes in human epidermal melanocytes.

(6) FIG. 6 shows the results obtained by evaluating the effects of the peptide fragment of the present invention on the gene expressions of melanin-producing enzymes in human epidermal melanocytes.

BEST MODE

(7) The present invention provides a secreted frizzled protein 5 (Sfrp5)-derived peptide fragment selected from the group consisting of the peptides as set forth in SEQ ID NOs: 1 to 9. And also, the present invention provides a cosmetic composition for skin-whitening, comprising a secreted frizzled protein 5 (Sfrp5)-derived peptide fragment selected from the group consisting of the peptides as set forth in SEQ ID NOs: 1 to 9 as an active ingredient.

(8) It has been found by the present invention that the secreted frizzled protein 5 (Sfrp5)-derived peptide fragments, i.e., the peptides as set forth in SEQ ID NOs: 1 to 9, inhibit the melanin production in melanocytes, exhibiting an inhibitory activity against epidermal skin pigmentation. Therefore, the peptide fragments can be usefully applied to a cosmetic composition for skin-whitening, especially for inhibiting skin pigmentation.

(9) In an embodiment, the cosmetic composition of the present invention may be a cosmetic composition for inhibiting skin pigmentation, comprising a secreted frizzled protein 5 (Sfrp5)-derived peptide fragment selected from the group consisting of the peptides as set forth in SEQ ID NOs: 1 to 9 as an active ingredient. The term skin pigmentation refers to excessive pigment accumulation in skin keratinocytes resulting from internal and external causes; and includes preferably a skin pigmentation induced by exposure to ultraviolet radiation.

(10) The cosmetic composition of the present invention may be prepared in various forms according to conventional methods thereof. For example, the cosmetic composition may be prepared in forms of cosmetic products, cosmetic solutions, creams, lotions, etc., which may be diluted with a cleansing water, an astringent solution, or a moisture solution, for the use thereof. And also, the cosmetic composition may include conventional excipients, such as a stabilizer, a solubilizing agent, vitamins, a pigment, a flavoring agent, which are conventionally used in the field of cosmetic composition. In the cosmetic composition, the peptide fragment may be present in an amount enough to provide the skin-whitening effects or the inhibitory effects against skin pigmentation, for example in an amount ranging from 0.001 to 10 weight %, preferably about 0.01 to 1 weight %, based on the total weight of the composition.

(11) The present invention also provide a reagent for researching or analyzing the inhibition of Wnt signaling pathways, comprising a secreted frizzled protein 5 (Sfrp5)-derived peptide fragment selected from the group consisting of the peptides as set forth in SEQ ID NOs: 1 to 9. The reagent of the present invention can be usefully used as a research or analytical reagent in various research fields, e.g., in the biological and/or medical fields. The research or analytical reagent may be in a form of the peptide fragment per se or in a form solubilized or dispersed in an appropriate carrier, e.g., phosphate buffered saline (PBS).

(12) Hereinafter, the present invention will be described more specifically by the following examples and experimental examples. However, the following examples and experimental examples are provided only for illustrations and thus the present invention is not limited to or by them.

Example 1: Synthesis of Peptide Fragments

(13) The peptide fragments of SEQ ID NOs: 1 to 9 were synthesized with an automatic peptide synthesizer (PeptrEx-R48, Peptron, Daejeon, Korea) using a FMOC solid-phase method. The synthesized peptide fragments were purified and analyzed by reverse-phase high-performance liquid chromatography (reverse-phase HPLC) (Prominence LC-20AB, Shimadzu, Japan) using a C18 analytical RP column (Shiseido capcell pak), and identified using a mass spectrometer (HP 1100 Series LC/MSD, Hewlett-Packard, Roseville, U.S.A.).

(14) TABLE-US-00001 TABLE1 Peptidename SEQIDNO Aminoacidsequence SE215A SEQIDNO:1 Lys-Ile-Gly-Ala-Gln-Lys SE215B SEQIDNO:2 Lys-Ile-Gly-Ala SE215C SEQIDNO:3 Ile-Gly-Ala-Gln SE215D SEQIDNO:4 Gly-Ala-Gln-Lys SE215E SEQIDNO:5 Lys-Ile-Gly SE215F SEQIDNO:6 Ile-Gly-Ala SE215G SEQIDNO:7 Gly-Ala-Gln SE215H SEQIDNO:8 Ala-Gln-Lys SE215I SEQIDNO:9 Cys-Glu-Ala-Val

Example 2: Preparation of the Compositions Containing Peptide Fragments

(15) The peptide fragments of SEQ ID NOs: 1 to 9 were respectively dissolved in phosphate buffered saline (PBS) to a concentration of 1 M. The resultant protein solutions were also used in the following experimental examples.

Experimental Example 1: Evaluation of the Effects of the Peptide Fragments of the Present Invention on Bindings Between CREB or MITF and -Catenin in the Mouse Melanoma Cell Line B16F1

(16) The effects of the peptide fragments of the present invention on the -catenin activation, which plays a critical role in Wnt signaling pathways, were evaluated using an in situ proximity ligation assay. The evaluation was performed with a commercially available kit, i.e., DUOLINK II in situ kit from Olink Bioscience, Sweden.

(17) The mouse melanoma cell line B16F1 cells (Korean Cell Line Bank, Seoul) were added to 1 ml of DMEM in each well of a 24-well plate (510.sup.4 cells per well), each well having a 12 mm glass in the bottom thereof. The cells were then stabilized through incubating in a 5% CO.sub.2 incubator at 37 C. for 24 hours. -MSH (Sigma Co, MO, USA), a melanocyte-stimulating hormone (0.1 M), and the peptide fragments of the present invention (1 M) were treated to each well. The cells were cultured in a 5% CO.sub.2 incubator at 37 C. for 24 hours and then fixed with 4% paraformaldehyde. After a drop of the blocking solution was added to the cells on the 12 mm glass, the cells were then incubated at 37 C. for 30 minutes. Activation of the Wnt receptor increases the interaction between CREB (cyclic AMP response element-binding) and -catenin. For determining the interaction levels thereof, the cells were treated with an anti-CREB polyclonal antibody (Santa Cruz Co., CA, USA) and an anti--catenin mouse monoclonal antibody (Santa Cruz Co., CA, USA) at 37 C. After incubating 30 minutes therefrom, the cells were treated with the PLA probe solution at 37 C. for 1 hour, with the ligation solution for 30 minutes, and then with the amplification solution for 100 minutes. After washing the cells with the washing buffer, the number of the red spots was measured with a confocal microscopy. The results thereof are shown in FIGS. 1a and 1b. In FIGS. 1a and 1b, the control means the group of no treatment and the -MSH means the group treated with only -MSH (i.e., without peptide treatment).

(18) As shown in FIGS. 1a and 1 b, the bindings between CREB and -catenin were significantly decreased by the peptides of SEQ ID NOs: 1 to 8. These results show that the peptide fragments of the present invention effectively inhibit the -catenin activation in melanocytes, thereby inhibiting the Wnt signaling pathways.

(19) And also, according to similar methods in the above, we investigated the inhibitory effects of the peptides of SEQ ID NOs: 5, 8, and 9 on the binding between MITF and -catenin. The bindings between MITF and -catenin were significantly decreased by the treatment of these peptides (see FIG. 1c). These results also show that the peptide fragments of the present invention effectively inhibit the binding between MITF and -catenin in melanocytes, thereby inhibiting the melanin formation.

Experimental Example 2: Evaluation of the Effects of the Peptide Fragment of the Present Invention on -Catenin Expression and GSK-3 Phosphorylation in Human Epidermal Melanocytes

(20) The effects of the peptide fragment of the present invention on the -catenin expression and the GSK-3 phosphorylation, which plays a critical role in the activation of Wnt signaling pathways, were evaluated using a Western blotting assay. Human epidermal melanocytes (Cascade Biologics, #C-0245C; Portland, Oreg., USA) were added to 2 ml of DMEM in each well of a 6-well microplate (1.510.sup.5 cells per well). The cells were then stabilized through incubating in a 5% CO.sub.2 incubator at 37 C. for 24 hours. -MSH (Sigma Co, MO, USA), a melanocyte-stimulating hormone, was treated to each well, along with the peptide fragment of the present invention (the peptide of SEQ ID NO: 8) in predetermined concentrations. After the cells were cultured for 48 hours, the proteins were extracted therefrom. The obtained extracts were subject to the Western blotting assay using an anti--catenin antibody (Santa Cruz Co., CA, USA) and an anti-pGSK-3 antibody (Cell SignalingTechnology, MA, USA), so as to measure the levels of -catenin expression and GSK-3 phosphorylation changes. The results thereof are shown in FIG. 2. As shown in FIG. 2, the levels of -catenin expression and GSK-3 phosphorylation were decreased by the peptide of SEQ ID NO: 8 in concentration-dependent manner. Therefore, it can be seen that the peptide fragments of the present invention can inhibit the Wnt signaling pathways in melanocytes.

Experimental Example 3: Tests for Inhibitory Activity Against Melanin Formation in the Mouse Melanoma Cell Line B16F10

(21) B16F10 cells (Korean Cell Line Bank, Seoul) were added to each well of a 6-well microplate (1.510.sup.5 cells per well), along with 2 ml of DMEM, and then incubated in a 5% CO.sub.2 incubator at 37 C. for 24 hours. -MSH (Sigma Co, MO, USA) (100 nM) was treated to each well, along with the peptide of SEQ ID NO: 8 in the final concentrations of 0.1, 1, and 10 M. The groups in which -MSH (100 nM) and arbutin (0.01%) were respectively treated were used as positive controls. After additionally incubating the cells for 24 hours, the pictures of each culture ware taken so as to compare the respective levels of melanin formation.

(22) As shown in FIG. 3, in the groups treated with the peptide of SEQ ID NO: 8, the brown colors of each cell culture were decreased according to the concentrations of the peptide, showing colors similar to the positive controls. These results show that the peptide fragments of the present invention inhibit -MSH-stimulated melanin pigment formation in melanocytes.

Experimental Example 4: Tests for Inhibitory Activity Against Tyrosinase Activity in the Mouse Melanoma Cell Line B16F10

(23) We evaluated whether the peptide fragment of the present invention inhibits tyrosinase activity. B16F10 cells (Korean Cell Line Bank, Seoul) were added to each well of a 24-well plate (510.sup.4 cells per well), along with 1 ml of DMEM, and then stabilized through incubating in a 5% CO.sub.2 incubator at 37 C. for 24 hours. -MSH (Sigma Co, MO, USA), a melanocyte-stimulating hormone, was treated to each well, along with the peptide of SEQ ID NO: 8 in predetermined concentrations. After incubating the cells for 72 hours, the proteins were extracted therefrom. The obtained extracts were added to each well of a 96-well plate (30 g per each well) and then treated with a L-dihydroxyphenylalanine (L-DOPA) solution (100 L) at 37 C. for 2 hours. The groups in which -MSH (100 nM) and arbutin (0.01%) were respectively treated were used as positive controls. After 2 hours, the pictures thereof were taken and the tyrosinase activities thereof were measured at 490 nm with a microreader.

(24) As shown in FIG. 4, in the control group treated with only -MSH, the tyrosinase activity thereof was increased. In contrast, in the test groups treated with both -MSH and the peptide of SEQ ID NO: 8, the tyrosinase activities were decreased in concentration-dependent manner. These results show that the peptide fragments of the present invention have an inhibitory activity against tyrosinase activity.

Experimental Example 5: Tests for Inhibitory Activity Against Protein Expressions of the Melanin-Producing Enzymes in Human Epidermal Melanocytes

(25) We evaluated the effects of the peptide fragment of the present invention on the protein expressions of the melanin-producing enzymes in human epidermal melanocytes, using a Western blotting assay. Human epidermal melanocytes (Cascade Biologics, #C-0245C; Portland, Oreg., USA) were added to each well of a 6-well microplate (1.510.sup.5 cells per well), along with 2 ml of DMEM, and then stabilized through incubating in a 5% CO.sub.2 incubator at 37 C. for 24 hours. -MSH (Sigma Co, MO, USA), a melanocyte-stimulating hormone, was treated to each well, along with the peptide fragment of the present invention (the peptide of SEQ ID NO: 8) in predetermined concentrations. After incubating the cells for 24 hours, the proteins were extracted therefrom. The obtained extracts were subject to the Western blotting assay using an anti-MITF antibody (ABcam, Ma, USA), an anti-tyrosinase antibody (Santa Cruz Co., CA, USA), an anti-TRP-1 antibody (Santa Cruz Co., CA, USA), and an anti-TRP-2 antibody (Santa Cruz Co., CA, USA), so as to measure the expression levels of MITF, tyrosinase, TRP-1, and TRP-2. The results thereof are shown in FIG. 5. As shown in FIG. 5, the expression levels of MITF, tyrosinase, TRP-1, and TRP-2 were decreased by the treatment of the peptide of SEQ ID NO: 8 in concentration-dependent manner. Therefore, it can be seen that the peptide fragments of the present invention inhibit the synthesis of MITF, tyrosinase, TRP-1, and TRP-2 in human epidermal melanocytes.

Experimental Example 6: Tests for Inhibitory Activity Against Gene Expressions of the Melanin-Producing Enzymes in Human Epidermal Melanocytes

(26) We evaluated whether the peptide fragment of the present invention inhibits gene expressions of the melanin-producing enzymes. Human epidermal melanocytes were added to each well of a 6-well plate (1.510.sup.5 cells per well), along with 2 ml of DMEM, and then stabilized through incubating in a 5% CO.sub.2 incubator at 37 C. for 24 hours. -MSH (Sigma Co, MO, USA), a melanocyte-stimulating hormone, was treated to each well, along with the peptide of SEQ ID NO: 8 in predetermined concentrations. After incubating the cells for 72 hours, the total RNAs were extracted therefrom and then cDNAs were synthesized. The cDNA syntheses were carried out with a Reverse Transcription Master premix (Elpisbiotech, Daejeon, Korea). Using each synthesized cDNA as a template, reverse transcription polymerase chain reactions (RT-PCR) were carried out with a ROTOR Q GENE apparatus. The primer sets for the RT-PCR were shown in the following table 2. Each RT-PCR solution was prepared by mixing 1 l of cDNA, 10 l of TOPreal qRT-PCR2X premix (Enzynomics, Daejeon, Korea), 2 l of primer set (10 pmol) and 7 l of D.W. The RT-PCR was carried out as follows: initially at 94 C. for 10 minutes; and then at 94 C. for 10 seconds, at 58 C. for 30 seconds, and at 72 C. for 1 minute; 40 cycles.

(27) TABLE-US-00002 TABLE2 SEQIDNO SequenceofPrimer MITF 10 Forward CTCGAGCTCATGGACTTTCC 11 Reverse CCAGTTCCGAGGTTGTTGTT Tyrosinase 12 Forward ATCCAGAAGCTGACAGG 13 Reverse TTTGAGAGGCATCCGCTA TRP-1 14 Forward AGCAGTAGTTGGCGCTTTGT 15 Reverse TCAACCAGGTGGTTTTGTGA TRP-2 16 Forward TGCCACAACATGGATGAACT 17 Reverse TTGTGCCCACCAAACAGTAA GAPDH 18 Forward GCAAATTCCATGGCACCGT 19 Reverse CCAAAATCAAGTGGGGCGA

(28) The results obtained by measuring the gene expressions of MITF, tyrosinase, TRP-1 and TRP-2 through the above RT-PCRs are shown in FIG. 6.

(29) As shown in FIG. 6, the gene expressions of MITF, tyrosinase (TYR), TRP-1 and TRP-2 were increased in the control group treated with only -MSH. In contrast, in the test groups treated with both -MSH and the peptide fragment of the present invention (i.e., the peptide of SEQ ID NO: 8), the gene expressions of MITF, tyrosinase, TRP-1 and TRP-2 were decreased in concentration-dependent manner. These results show that the peptide fragments of the present invention inhibit the gene expressions of MITF, tyrosinase, TRP-1 and TRP-2.