COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF THE ALAS1 GENE
20230026968 · 2023-01-26
Inventors
- Brian Bettencourt (Groton, MA)
- Kevin Fitzgerald (Brookline, MA)
- William Querbes (Cambridge, MA)
- Robert J. Desnick (New York, NY)
- Makiko Yasuda (New York, NY)
Cpc classification
A61P7/00
HUMAN NECESSITIES
A61P43/00
HUMAN NECESSITIES
A61K9/0019
HUMAN NECESSITIES
C12N2310/345
CHEMISTRY; METALLURGY
C12Q1/6876
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
A61K9/00
HUMAN NECESSITIES
Abstract
The invention relates to double-stranded ribonucleic acid (dsRNA) compositions targeting the ALAS1 gene, and methods of using such dsRNA compositions to alter (e.g., inhibit) expression of ALAS1.
Claims
1. A double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS1 RNA transcript (e.g., SEQ ID NO:1), which antisense strand comprises at least 20 contiguous nucleotides from the antisense sequence of TABLE-US-00045 (SEQ ID NO: 4153) UAAGAUGAGACACUCUUUCUGGU or (SEQ ID NO: 4154) UAAGAUGAGACACUCTUUCUGGU.
2. A double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS1 RNA transcript (e.g., SEQ ID NO:1), which antisense strand comprises at least 20 contiguous nucleotides from (i) an antisense sequence listed in any one of Tables 21 to 40, or (ii) an unmodified version of an antisense sequence listed in any one of Tables 21 to 40 (SEQ ID NOs: 4172 to 5237).
3. The dsRNA of claim 1, wherein said dsRNA comprises at least one modified nucleotide.
4. The dsRNA of claim 1, wherein the dsRNA comprises a duplex region which is 17-23 nucleotide pairs in length.
5. The dsRNA of claim 1, wherein at least one strand comprises a 3′ overhang of at least 2 nucleotides.
6. The dsRNA of claim 1, wherein each strand is no more than 26 nucleotides in length.
7. The dsRNA of claim 3, wherein at least one modified nucleotide is chosen from a 2′-O-methyl, a 2′-fluoro modified nucleotide, and optionally one or more 5′-phosphorothioate groups, or any combination thereof.
8. The dsRNA of claim 1, further comprising a ligand, optionally wherein the ligand is conjugated to the 3′ end of the sense strand of the dsRNA.
9. The dsRNA of claim 8, wherein the ligand comprises a carbohydrate, optionally wherein the ligand is a GalNAc ligand.
10. The dsRNA of claim 9, wherein the ligand is ##STR00033##
11.-17. (canceled)
18. The dsRNA of claim 1, wherein the dsRNA shows improved activity compared with a dsRNA having a sense strand comprising the sequence of SEQ ID NO: 4149 and an antisense strand comprising the sequence of SEQ ID NO: 4150 or a dsRNA having a sense strand comprising the sequence of SEQ ID NO: 4151 and an antisense strand comprising the sequence of SEQ ID NO: 4152, optionally wherein the dsRNA is selected from the dsRNAs listed in Tables 21 to 40.
19. The dsRNA of claim 1, wherein the sense strand comprises or consists of the sequence of CAGAAAGAGUGUCUCAUCUUA (SEQ ID NO: 4155).
20. The dsRNA of claim 1, wherein: (i) the antisense strand comprises the sequence of SEQ ID NO: 4161; (ii) the antisense strand consists of the sequence of SEQ ID NO: 4161; (iii) the sense strand comprises the sequence of SEQ ID NO: 4160; (iv) the sense strand consists of the sequence of SEQ ID NO: 4160; (v) the sense strand comprises the sequence of SEQ ID NO: 4160, and the antisense strand comprises the sequence of SEQ ID NO: 4161; or (vi) the sense strand consists of the sequence of SEQ ID NO: 4160, and the antisense strand consists of the sequence of SEQ ID NO: 4161.
21. The dsRNA of claim 1, wherein: (i) the antisense strand comprises the sequence of SEQ ID NO: 4157, and/or the sense strand comprises the sequence of SEQ ID NO: 4156, or (ii) the antisense strand consists of the sequence of SEQ ID NO: 4157, and/or the sense strand consists of the sequence of SEQ ID NO: 4156.
22. The dsRNA of claim 1, wherein: (i) the antisense strand comprises the sequence of SEQ ID NO: 4165, and/or the sense strand comprises the sequence of SEQ ID NO: 4164, or (ii) the antisense strand consists of the sequence of SEQ ID NO: 4165, and/or the sense strand consists of the sequence of SEQ ID NO: 4164.
23. The dsRNA of claim 2, wherein: (i) the antisense strand comprises the sequence of SEQ ID NO: 4169, the sense strand comprises the sequence of SEQ ID NO: 4168, or (ii) the antisense strand consists of the sequence of SEQ ID NO: 4169, and/or the sense strand consists of the sequence of SEQ ID NO: 4168.
24. A vector encoding at least one strand of a dsRNA of claim 1.
25. A cell comprising the dsRNA of claim 1.
26. A pharmaceutical composition for inhibiting expression of an ALAS1 gene, the composition comprising the dsRNA of claim 1.
27.-28. (canceled)
29. A method of inhibiting ALAS1 expression in a cell, the method comprising: (a) introducing into the cell the dsRNA of claim 1, and (b) maintaining the cell of step (a) for a time sufficient to obtain degradation of the mRNA transcript of an ALAS1 gene, thereby inhibiting expression of the ALAS1 gene in the cell, optionally wherein the expression of ALAS1 is inhibited by at least 20% or at least 30%.
30. A method for decreasing a level of a porphyrin or a porphyrin precursor in a cell, comprising contacting the cell with the dsRNA of of claim 1, in an amount effective to decrease the level of the porphyrin or the porphyrin precursor in the cell.
31. A method of treating a porphyria, the method comprising administering to a subject in need of such treatment a therapeutically effective amount of the dsRNA of claim 1, thereby treating the porphyria, wherein the subject is at risk for developing, or is diagnosed with, a porphyria.
32. (canceled)
33. The method of claim 31, wherein the porphyria is acute intermittent porphyria or ALA-dehydratase deficiency porphyria.
34. The method of claim 31, wherein (i) the dsRNA is administered after an acute attack of porphyria, (ii) the dsRNA is administered during an acute attack of porphyria, or (iii) the dsRNA is administered prophylactically to prevent an acute attack of porphyria.
35. The method of claim 31, wherein the dsRNA is administered at a dose of 0.05 to 50 mg/kg or 0.01 mg/kg to 5 mg/kg bodyweight of the subject, or at a dose of 1 mg/kg, 2.5 mg/kg, or 5 mg/kg bodyweight of the subject.
36. The method of claim 31, wherein the method (i) decreases a level of a porphyrin or a porphyrin precursor in the subject, optionally wherein the level is decreased by at least 30% and/or (ii) inhibits ALAS1 expression in the subject.
37. The method of claim 31, wherein said method (i) ameliorates a symptom associated with an ALAS1 related disorder, (ii) decreases frequency of acute attacks of symptoms associated with a porphyria in the subject, and/or (iii) decreases incidence of acute attacks of symptoms associated with a porphyria in the subject when the subject is exposed to a precipitating factor.
38. The method of claim 31, wherein the dsRNA is administered according to a dosing regimen, e.g., weekly, biweekly, or monthly.
39. (canceled)
40. The method of claim 31, wherein the subject has an elevated level of ALA and/or PBG and optionally wherein the subject suffers from chronic pain.
41. (canceled)
42. The method of claim 31, wherein the method decreases or prevents pain, neuropathy, and/or nerve damage.
43.-47. (canceled)
48. A method for assaying the level of circulating extracellular ALAS1 mRNA in a subject, said method comprising: detecting the level of ALAS1 mRNA in a biological fluid sample from the subject, said biological fluid sample comprising the ALAS1 mRNA, thereby assaying the level of circulating extracellular ALAS1 mRNA in the subject.
49. The method of claim 48 comprising (i) providing RNA from a biological fluid sample from the subject, said biological fluid sample is chosen from a blood sample, a plasma sample, a serum sample, or a urine sample, and comprises the ALAS1 mRNA; (ii) obtaining an ALAS1 cDNA from the ALAS1 mRNA; (iii) contacting the ALAS1 cDNA with a nucleic acid complementary to the ALAS1 cDNA or a portion thereof, thereby producing a reaction mix; and (iv) detecting the level of ALAS1 cDNA in the reaction mix, wherein the ALAS1 cDNA level is indicative of the ALAS1 mRNA level, thereby assaying the level of circulating extracellular ALAS1 mRNA in the subject, optionally wherein (a) the method comprises PCR, qPCR or 5′-RACE, (b) the nucleic acid is a probe or primer, and/or (c) the nucleic acid comprises a detectable moiety and the level of ALAS1 mRNA is determined by detection of the amount of the detectable moiety.
50.-53. (canceled)
54. The pharmaceutical composition of claim 26, comprising about 200 mg/mL of the dsRNA.
55. The pharmaceutical composition of claim 53, wherein the composition has a pH of 6.0-7.5.
56.-59. (canceled)
60. The dsRNA of claim 1, wherein the ALAS1 RNA transcript comprises the sequence of SEQ ID NO: 1.
61. The dsRNA of claim 1, wherein the dsRNA has one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen or all of the following: (i) is chemically synthesized; (ii) all the nucleotides in the dsRNA are modified; (iii) all nucleotides are connected through 3′-5′ phosphodiester linkages; (iv) the sense strand comprises or consists of 21 nucleotides; (v) the antisense sense strand comprises or consists of 23 nucleotides; (vi) has a blunt-end at the 3′-end of sense strand; (vii) has a 3′-overhang; (viii) is covalently attached to a ligand containing three N-acetylgalactosamine (GalNAc) moieties; (ix) the 3′-end of the sense strand is conjugated to the triantennary GalNAc moiety; (x) has an antisense strand that comprises one or more phosphorothioate linkages; (xi) has a sense strand that comprises one or more phosphorothioate linkages; (xii) 21 nucleotides of the sense strand hybridize to the complementary 21 nucleotides of the antisense strand; (xiii) forms 21 nucleotide base pairs and a two-base overhang at the 3′-end of the antisense strand; (xiv) comprises, or consists of, a sense strand having the sequence of SEQ ID NO: 4160 or 4162 and an antisense strand having the sequence of SEQ ID NO: 4161 or 4163; (xv) has a sense strand with 10, 12, 14, 16, 18, 19, 20 or all of the modifications of the sequence of SEQ ID NO: 4160; (xvi) has an antisense strand with 10, 12, 14, 16, 18, 19, 20 or all of the modifications of the sequence of SEQ ID NO: 4161; or (xvii) has a sense strand having the sequence of SEQ ID NO: 4160 and an antisense strand having the sequence of SEQ ID NO: 4161.
Description
DESCRIPTION OF THE DRAWINGS
[0248]
[0249]
[0250]
[0251]
[0252]
[0253]
[0254]
[0255]
[0256]
[0257]
[0258]
[0259]
[0260]
[0261]
[0262]
[0263]
[0264]
[0265]
[0266]
[0267]
[0268]
[0269]
[0270]
[0271]
[0272]
[0273]
[0274]
[0275]
[0276]
[0277]
[0278]
[0279]
[0280]
[0281]
[0282]
[0283]
[0284]
[0285]
[0286]
[0287]
[0288]
[0289]
[0290]
[0291]
[0292]
[0293]
[0294]
[0295]
[0296]
[0297]
[0298]
[0299]
[0300]
[0301]
[0302]
[0303]
[0304]
[0305]
DETAILED DESCRIPTION OF THE INVENTION
[0306] iRNA directs the sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). Described herein are iRNAs and methods of using them for inhibiting the expression of an ALAS1 gene in a cell or a mammal where the iRNA targets an ALAS1 gene. Also provided are compositions and methods for disorders related to ALAS1 expression, such as porphyrias (e.g., ALA deyhdratase deficiency porphyria (ADP or Doss porphyria), acute intermittent porphyria, congenital erythropoietic porphyria, prophyria cutanea tarda, hereditary coproporphyria (coproporphyria), variegate porphyria, erythropoietic protoporphyria (EPP), X-linked sideroblastic anemia (XLSA), and transient erythroporphyria of infancy).
[0307] Porphyrias are inherited or acquired disorders that can be caused by decreased or enhanced activity of specific enzymes in the heme biosynthetic pathway, also referred to herein as the porphyrin pathway (See
[0308] Porphyrias may manifest with neurological complications (“acute”), skin problems (“cutaneous”) or both. Porphyrias may be classified by the primary site of the overproduction and accumulation of porphyrins or their precursors. In hepatic porphyrias, porphyrins and porphyrin precursors are overproduced predominantly in the liver, whereas in erythropoietic porphyrias, porphyrins are overproduced in the erythroid cells in the bone. The acute or hepatic porphyrias lead to dysfunction of the nervous system and neurologic manifestations that can affect both the central and peripheral nervous system, resulting in symptoms such as, for example, pain (e.g., abdominal pain and/or chronic neuropathic pain), vomiting, neuropathy (e.g., acute neuropathy, progressive neuropathy), muscle weakness, seizures, mental disturbances (e.g., hallucinations, depression anxiety, paranoia), cardiac arrhythmias, tachycardia, constipation, and diarrhea. The cutaneous or erythropoietic porphyrias primarily affect the skin, causing symptoms such as photosensitivity that can be painful, blisters, necrosis, itching, swelling, and increased hair growth on areas such as the forehead. Subsequent infection of skin lesions can lead to bone and tissue loss, as well as scarring, disfigurement, and loss of digits (e.g., fingers, toes). Most porphyrias are caused by mutations that encode enzymes in the heme biosynthetic pathway. A summary of porphyrias associated with genetic errors in heme metabolism is provided in
[0309] Not all porphyrias are genetic. For example, patients with liver disease may develop porphyria as a result of liver dysfunction, and a transient form of erythroporphria (transient erythroporphyria of infancy) has been described in infancy (see Crawford, R. I. et al, J Am Acad Dermatol. 1995 August; 33(2 Pt 2):333-6.) Patients with PCT can acquire the deficient activity of uroporphyrinogen decarboxylase (URO-D), due to the formation of a ORO-D enzyme with lower than normal enzymatic activity (see Phillips et al. Blood, 98:3179-3185, 2001.)
[0310] Acute intermittent porphyria (AIP) (also be referred to as porphobilinogen (PBG) deaminase deficiency, or hydroxymethylbilane synthase (HMBS) deficiency), is the most common type of acute hepatic porphyria. Other types of acute hepatic porphyrias include hereditary coproporphyria (HCP), variegate porphyria (VP), and ALA deyhdratase deficiency porphyria (ADP). Acute hepatic porphyrias are described, e.g., in Balwani, M and Desnick, R. J., Blood, 120:4496-4504, 2012.
[0311] AIP is typically an autosomal dominant disease that is characterized by a deficiency of the enzyme porphobilinogen deaminase (PBG deaminase); this enzyme is also known as hydroxymethylbilane synthase (HMB synthase or HMBS). PBG deaminase is the third enzyme of the heme biosynthetic pathway (see
[0312] There are at least two different models of the pathophysiology of AIP and other acute hepatic porphyrias (see, e.g., Lin C S-Y et al., Clinical Neurophysiology, 2011; 122:2336-44). According to one model, the decreased heme production resulting from PBG deaminase deficiency causes energy failure and axonal degeneration. According to the other, currently more favored model, the buildup of porphyrin precursors (e.g., ALA and PBG) results in neurotoxicity.
[0313] AIP has been found to have a prevalence as high as 1 in 10,000 in certain populations (e.g., in Northern Sweden; see Floderus Y, et al. Clin Genet. 2002; 62:288-97). The prevalence in the general population in United States and Europe, excluding the U.K., is estimated to be about 1 in 10,000 to 1 in 20,000. Clinical disease manifests itself in only approximately 10-15% of individuals who carry mutations that are known to be associated with AIP. However, the penetrance is as high as 40% in individuals with certain mutations (e.g., the W198X mutation). AIP is typically latent prior to puberty. Symptoms are more common in females than in males. The prevalence of the disease is probably underestimated due to its incomplete penetrance and long periods of latency. In the United States, it is estimated that there are about 2000 patients who have suffered at least one attack. It is estimated that there are about 150 active recurrent cases in France, Sweden, the U.K., and Poland; these patients are predominantly young women, with a median age of 30. See, e.g., Elder et al, J Inherit Metab Dis., published online Nov. 1, 2012.
[0314] AIP affects, for example, the visceral, peripheral, autonomic, and central nervous systems. Symptoms of AIP are variable and include gastrointestinal symptoms (e.g., severe and poorly localized abdominal pain, nausea/vomiting, constipation, diarrhea, ileus), urinary symptoms (dysuria, urinary retention/incontinence, or dark urine, e.g., dark red urine), neurologic symptoms (e.g., sensory neuropathy, motor neuropathy (e.g., affecting the cranial nerves and/or leading to weakness in the arms or legs), seizures, neuropathic pain (e.g., pain associated with progressive neuropathy, e.g., chronic neuropathic pain), neuropsychiatric symptoms (e.g., mental confusion, anxiety, agitation, hallucination, hysteria, delirium, apathy, depression, phobias, psychosis, insomnia, somnolence, coma), autonomic nervous system involvement (resulting e.g., in cardiovascular symptoms such as tachycardia, hypertension, and/or arrhythmias, as well as other symptoms, such as, e.g., increased circulating catecholamine levels, sweating, restlessness, and/or tremor), dehydration, and electrolyte abnormalities. The most common symptoms are abdominal pain and tachycardia. Neurological manifestations include motor and autonomic neuropathy and seizures. Patients frequently have chronic neuropathic pain and develop a progressive neuropathy. Patients with recurring attacks often have a prodrome. Permanent paralysis may occur after a severe attack. Recovery from severe attacks that are not promptly treated may take weeks or months. An acute attack may be fatal, for example, due to paralysis of respiratory muscles or cardiovascular failure from electrolyte imbalance. (See, e.g., Thunell S. Hydroxymethylbilane Synthase Deficiency. 2005 Sep. 27 [Updated 2011 Sep. 1]. In: Pagon R A, Bird T D, Dolan C R, et al., editors. GeneReviews™ [Internet]. Seattle (Wash.): University of Washington, Seattle; 1993—(hereinafter Thunell (1993)), which is hereby incorporated by reference in its entirety.) Prior to the availability of Hemin treatments, up to 20% of patients with AIP died from the disease.
[0315] In individuals who carry genes for AIP, the risk of hepatocellular cancer is increased. In those with recurrent attacks, the risk of hepatocellular cancer is particularly grave: after the age of 50, the risk is nearly 100-fold greater than in the general population.
[0316] Attacks of acute porphyria may be precipitated by endogenous or exogenous factors. The mechanisms by which such factors induce attacks may include, for example, increased demand for hepatic P450 enzymes and/or induction of ALAS1 activity in the liver. Increased demand for hepatic P450 enzymes results in decreased hepatic free heme, thereby inducing the synthesis of hepatic ALAS1.
[0317] Precipitating factors include fasting (or other forms of reduced or inadequate caloric intake, due to crash diets, long-distance athletics, etc.), metabolic stresses (e.g., infections, surgery, international air travel, and psychological stress), endogenous hormones (e.g., progesterone), cigarette smoking, lipid-soluble foreign chemicals (including, e.g., chemicals present in tobacco smoke, certain prescription drugs, organic solvents, biocides, components in alcoholic beverages), endocrine factors (e.g., reproductive hormones (women may experience exacerbations during the premenstrual period), synthetic estrogens, progesterones, ovulation stimulants, and hormone replacement therapy). See, for example, Thunell (1993).
[0318] Over 1000 drugs are contraindicated in the acute hepatic porphyrias (e.g., AIP, HCP, ADP, and VP) including, for example, alcohol, barbiturates, Carbamazepine, Carisoprodol, Clonazepam (high doses), Danazol, Diclofenac and possibly other NSAIDS, Ergots, estrogens, Ethyclorvynol, Glutethimide, Griseofulvin, Mephenytoin, Meprobamate (also mebutamate and tybutamate), Methyprylon, Metodopramide, Phenytoin, Primidone, progesterone and synthetic progestins, Pyrazinamide, Pyrazolones (aminopyrine and antipyrine), Rifampin, Succinimides (ethosuximide and methsuximide), sulfonamide antibiotics, and Valproic acid.
[0319] Objective signs of AIP include discoloration of the urine during an acute attack (the urine may appear red or red-brown), and increased concentrations of PBG and ALA in urine during an acute attack. Molecular genetic testing identifies mutations in the PBG deaminase (also known as HMBS) gene in more than 98% of affected individuals. Thunell (1993).
[0320] Diagnosis of porphria can involve assessment of family history, assessment of porphyrin precursor levels in urine, blood, or stool, and/or assessment of enzyme activity and DNA mutation analysis. The differential diagnosis of porphyrias may involve determining the type of porphyria by measuring individual levels of porphyrins or porphyrin precursors (e.g., ALA, PBG) in the urine, feces, and/or plasma (e.g., by chromatography and fluorometry) during an attack. The diagnosis of AIP can be confirmed by establishing that erythrocyte PBG deaminase activity is at 50% or less of the normal level. DNA testing for mutations may be carried out in patients and at-risk family members. The diagnosis of AIP is typically confirmed by DNA testing to identify a specific caustative gene mutation (e.g., an HMBS mutation).
[0321] Current management of acute attacks of AIP involves hospitalization, monitoring of symptoms, and removal of unsafe drugs. Treatment of acute attacks typically requires hospitalization to control and treat acute symptoms, including, e.g., abdominal pain, seizures, dehydration/hyponatremia, nausea/vomiting, tachycardia/hypertension, urinary retention/ileus. For example, abdominal pain may be treated, e.g., with narcotic analgesics, seizures may be treated with seizure precautions and possibly medications (although many anti-seizure medications are contraindicated), nausea/vomiting may be treated, e.g., with phenothiazines, and tachycardia/hypertension may be treated, e.g., with beta blockers. Treatment may include withdrawal of unsafe medications, monitoring of respiratory function, as well as muscle strength and neurological status. Mild attacks (e.g., those with no paresis or hyponatremia) may be treated with at least 300 g intravenous 10% glucose per day, although increasingly hemin is provided immediately. Severe attacks are typically treated as soon as possible with intravenous hemin (3-4 mg/kg daily for 4-14 days) and with IV glucose while waiting for the IV hemin to take effect. Typically, attacks are treated with IV hemin for 4 days and with IV glucose while waiting for administration of the IV hemin. Within 3-4 days following the start of hemin administration, there is usually clinical improvement accompanying by lowering of ALA and PBG levels.
[0322] Hemin (Panhematin® or hemin for injection, previously known as hematin) is the only heme product approved for use in the United States and was the first drug approved under the Orphan Drug Act. Panhematin® is hemin derived from processed red blood cells (PRBCs), and is Protoporphyrin IX containing a ferric iron ion (Heme B) with a chloride ligand. Heme acts to limit the hepatic and/or marrow synthesis of porphyrin. The exact mechanism by which hemin produces symptomatic improvement in patients with acute episodes of the hepatic porphyrias has not been elucidated; however, its action is likely due to the (feedback) inhibition of δ-aminolevulinic acid (ALA) synthase, the enzyme which limits the rate of the porphyrin/heme biosynthetic pathway. See Panhematin® product label, Lundbeck, Inc., October 2010. Inhibition of ALA synthase should result in reduced production of ALA and PBG as well as porphyrins and porphyrin intermediates.
[0323] Drawbacks of heme products (e.g., hemin) include delayed impact on clinical symptoms and failure to prevent the recurrence of attacks. Adverse reactions associated with heme (e.g., hemin) administration may include phlebitis (e.g., thrombophlebitis), difficulty with venous access, anticoagulation (or coagulopathies), thrombocytopenia, renal shut down, or iron overload, which is particularly likely in patients requiring multiple courses of hemin treatment for recurrent attacks. To prevent phlebitis, an indwelling venous catheter is needed for access in patients with recurrent attacks. Renal damage can occur with high doses. Uncommonly reported side effects include fever, aching, malaise, hemolysis, anaphalaxis, and circulatory collapse. See Anderson, K. E., Approaches to Treatment and Prevention of Human Porphyrias, in The Porphyrin Handbook: Medical Aspects of Porphyrins, Edited by Karl M. Kadish, Kevin M. Smith, Roger Guilard (2003) (hereinafter Anderson).
[0324] Heme is difficult to prepare in a stable form for intravenous administration. It is insoluble at neutral pH but can be prepared as heme hydroxide at pH 8 or higher. Anderson. Panhematin is a lyophilized hemin preparation. When lyophilized hemin is solubilized for intravenous administration, degradation products form rapidly; these degradation products are responsible for a transient anticoagulant effect and for phlebitis at the site of infusion. Anderson. Heme albumin and heme arginate (Normosang, the European version of hemin) are more stable and may potentially cause less thrombophlebitis. However, heme arginate is not approved for use in the United States. Panhemin may be stabilized by solubilizing it for infusion in 30% human albumin rather than in sterile water; however, albumin adds intravascular volume-expanding effects and increases the cost of treatment as well as risk of pathogens since it is isolated from human blood. See, e.g., Anderson supra.
[0325] The successful treatment of an acute attack does not prevent or delay recurrence. There is a question of whether hemin itself can trigger recurring attacks due to induction of heme oxygenase. Nonetheless, in some areas (especially France), young women with multiply recurrent attacks are being treated with weekly hemin with the goal of achieving prophylaxis. Limited experience with liver transplantation suggests that if successful, it is an effective treatment for AIP. There have been approximately 12 transplants in Europe in human patients, with curative or varying effects. Liver transplantation can restore normal excretion of ALA and PBG and prevent acute attacks. See, e.g., Dar, F. S. et al. Hepatobiliary Pancreat. Dis. Int., 9(1):93-96 (2010). Furthermore, if the liver of a patient with AIP is transplanted into another patient (“domino transplant”), the patient receiving the transplant may develop AIP. Among the long-term clinical effects of acute porphyrias is chronic neuropathic pain that may result from a progressive neuropathy due to neurotoxic effects, e.g., of elevated porphyrin precursors (e.g., ALA and/or PBG). The neurotoxic effects can be associated with toxic heme intermediate production, for example, altered GABA signaling and/or production of iron-mediated oxidation and reactive oxygen species (ROS). Patients may suffer from neuropathic pain prior to or during an acute attack. Older patients may experience increased neuropathic pain with age for which various narcotic drugs are typically prescribed. Electromyogram abnormalities and decreased conduction times have been documented in patients with acute hepatic porphyrias. Of note, untreated, uninduced mice with AIP (PBG deaminase deficiency) develop a progressive motor neuropathy that has been shown to cause progressive quadriceps nerve axon degeneration and loss presumably due to constitutively elevated porphyrin precursor (ALA & PBG) levels, porphyrins and/or heme deficiency (Lindberg et al., J. Clin. Invest., 103(8): 1127-1134, 1999). In patients with acute porphyria (e.g., ADP, AIP, HCP, or VP), levels of porphyrin precursors (ALA & PBG) are often elevated in asymptomatic patients and in symptomatic patients between attacks. Thus, reduction of the porphyrin precursors and resumption of normal heme biosynthesis by reducing the level of ALAS1 expression and/or activity is expected to prevent and/or minimize development of chronic and progressive neuropathy. Treatment, e.g., chronic treatment (e.g., periodic treatment with iRNA as described herein, e.g., treatment according to a dosing regimen as described herein, e.g., weekly or biweekly treatment) can continuously reduce the ALAS1 expression in acute porphyria patients who have elevated levels of porphyrin precursors, porphyrins, porphyrin products or their metabolites. Such treatment may be provided as needed to prevent or reduce the frequency or severity of an individual patient's symptoms (e.g., pain and/or neuropathy) and/or to reduce a level of a porphyrin precursor, porphyrin, porphyrin product or metabolite.
[0326] The need exists for identifying novel therapeutics that can be used for the treatment of porphyrias. As discussed above, existing treatments such as heme products (e.g., hemin) have numerous drawbacks. For example, the impact of hemin on clinical symptoms is delayed, it is expensive, and it may have side effects (e.g., thrombophlebitis, anticoagulation, thrombocytopenia, iron overload, renal shutdown). Novel therapeutics such as those described herein can address these drawbacks and the unmet needs of patients acting faster, not inducing phlebitis, providing the convenience of subcutaneous administration, successfully preventing recurrent attacks, preventing or ameliorating pain (e.g., chronic neuropathic pain) and/or progressive neuropathy, and/or not causing certain adverse effects associated with hemin (e.g., iron overload, increased risk of hepatocellular cancer).
[0327] Patients with AIA include those who suffer from recurrent attacks and those who suffer from acute, sporadic attacks. In the pateints who suffer from recurrent attacks, about 5-10% have recurrent intermittent attacks (2-3 attacks per year) or recurrent attacks (>4 attacks per year). These patients are most likely to consider liver transplant or to receive prophylactic heme (e.g., hemin) infusions. The recurrent attack patients are likely to have poor quality of life due to long hospital stays, opiate addiction, and/or venous network toxicity. Chronic heme administration can induce heme oxygenase (HO-1). Thus, it can be difficult to wean patients off heme and some require more frequent treatment. Some clinicals are therefore restricting heme use to the most serious attacks. Accordingly, there is an unmet need for convenient, effective prophylaxis and treatments with better tolerability.
For patients who suffer from acute attacks, clinical guidelines suggest administration of heme as early as possible. However, given the challenges of diagnosis and lack of immediate drug availability, administration may be delayed. The slow onset of the effects of heme (e.g., hemin) and its poor tolerability slow the time to improvement. Persistence of severe abdominal pain, even after administration of heme, can require that patients receive opiates for multiple days.
[0328] Delayed administration of heme or continued exposure to precipitating factors can lead to more serious complications, including motor neuropathy and accompanying symptoms (e.g., weakness, paresis). Respiratory failure and paralysis can occur in severe cases. Recovery from neurological symptoms can take much longer to resolve. Accordingly, in the context of acute attacks, treatments that have a faster onset of action and better tolerability are needed. Pharmacological validation of ALAS1 as a target for mRNA silencing is supported by at least the following findings: ALAS1 mRNA is strongly upregulated during an attack; panhematin down modulates ALAS-1; and addition of heme to liver cells in culture leads to reduced ALAS-1 mRNA. Several findings also indicate that suppression of ALAS1 mRNA can be achieved by targeting the liver. For example, liver transplant has been shown to be curative; and liver derived metabolites drive attacks (see e.g., Dar et al. Hepatobiliary Pancreat Dis Int. 9:93-6 (2010); Dowman et al. Ann Intern Med 154:571-2 (2011); and Wu et al. Genes Dev 23:2201-2209 (2009). Thus, reducing expression of ALAS1, e.g., in the liver, using iRNA compositions can be used to treat a porphyria. In certain embodiments, iRNA compositions can be used for prophylaxis and acute treatment of porphyrias. For example, iRNA compositions can be used prophylactically in a recurrent attack setting to induce long-term or chronic suppression of ALAS1 expression (leading to long-term or chronic suppression of ALA/PBG), and thus blunting the recurrent ALAS1 upregulation that drives the attacks. Such prophylactic treatment can reduce the number and the severity of the attacks. During an acute attack setting, administration of an iRNA composition can treat an acute attack, e.g., by reducing the levels of ALA/PBG.
[0329] The present disclosure provides methods and iRNA compositions for modulating the expression of an ALAS1 gene. In certain embodiments, expression of ALAS1 is reduced or inhibited using an ALAS1-specific iRNA, thereby leading to a decreased expression of an ALAS1 gene. Reduced expression of an ALAS1 gene may reduce the level of one or more porphyrin precursors, porphyrins, or porphyrin products or metabolites. Decreased expression of an ALAS1 gene, as well as related decreases in the level of one or more porphyrin precursors and/or porphyrins, can be useful in treating disorders related to ALAS1 expression, e.g., porphyrias.
[0330] The iRNAs of the compositions featured herein include an RNA strand (the antisense strand) having a region which is 30 nucleotides or less in length, i.e., 15-30 nucleotides in length, generally 19-24 nucleotides in length, which region is substantially complementary to at least part of an mRNA transcript of an ALAS1 gene (also referred to herein as an “ALAS1-specific iRNA”). The use of such an iRNA enables the targeted degradation of mRNAs of genes that are implicated in pathologies associated with ALAS1 expression in mammals, e.g., porphyrias such as ALA dehydratase deficiency porphyria (also known as Doss porphyria or plumboporphyria) or acute intermittent porphyria. Very low dosages of ALAS1-specific iRNAs can specifically and efficiently mediate RNAi, resulting in significant inhibition of expression of an ALAS1 gene. iRNAs targeting ALAS1 can specifically and efficiently mediate RNAi, resulting in significant inhibition of expression of an ALAS1 gene, e.g., in cell based assays. Thus, methods and compositions including these iRNAs are useful for treating pathological processes related to ALAS1 expression, such as porphyrias (e.g., X-linked sideroblastic anemia (XLSA), ALA deyhdratase deficiency porphyria (Doss porphyria), acute intermittent porphyria (AIP), congenital erythropoietic porphyria, prophyria cutanea tarda, hereditary coproporphyria (coproporphyria), variegate porphyria, erythropoietic protoporphyria (EPP), and transient erythroporphyria of infancy).
[0331] The following description discloses how to make and use compositions containing iRNAs to inhibit the expression of an ALAS1 gene, as well as compositions and methods for treating diseases and disorders caused by or modulated by the expression of this gene. Embodiments of the pharmaceutical compositions featured in the invention include an iRNA having an antisense strand comprising a region which is 30 nucleotides or less in length, generally 19-24 nucleotides in length, which region is substantially complementary to at least part of an RNA transcript of an ALAS1 gene, together with a pharmaceutically acceptable carrier. Embodiments of compositions featured in the invention also include an iRNA having an antisense strand having a region of complementarity which is 30 nucleotides or less in length, generally 19-24 nucleotides in length, and is substantially complementary to at least part of an RNA transcript of an ALAS1 gene.
[0332] Accordingly, in some aspects, pharmaceutical compositions containing an ALAS1 iRNA and a pharmaceutically acceptable carrier, methods of using the compositions to inhibit expression of an ALAS1 gene, and methods of using the pharmaceutical compositions to treat disorders related to ALAS1 expression are featured in the invention.
I. Definitions
[0333] For convenience, the meaning of certain terms and phrases used in the specification, examples, and appended claims, are provided below. If there is an apparent discrepancy between the usage of a term in other parts of this specification and its definition provided in this section, the definition in this section shall prevail.
[0334] “G,” “C,” “A,” “T” and “U” each generally stand for a nucleotide that contains guanine, cytosine, adenine, thymidine and uracil as a base, respectively. However, it will be understood that the term “ribonucleotide” or “nucleotide” can also refer to a modified nucleotide, as further detailed below, or a surrogate replacement moiety. The skilled person is well aware that guanine, cytosine, adenine, and uracil may be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety. For example, without limitation, a nucleotide comprising inosine as its base may base pair with nucleotides containing adenine, cytosine, or uracil. Hence, nucleotides containing uracil, guanine, or adenine may be replaced in the nucleotide sequences of dsRNA featured in the invention by a nucleotide containing, for example, inosine. In another example, adenine and cytosine anywhere in the oligonucleotide can be replaced with guanine and uracil, respectively to form G-U Wobble base pairing with the target mRNA. Sequences containing such replacement moieties are suitable for the compositions and methods featured in the invention.
[0335] As used herein, “ALAS1” (also known as ALAS-1; δ-aminolevulinate synthase 1; δ-ALA synthase 1; 5′-aminolevulinic acid synthase 1; ALAS-H; ALASH; ALAS-N; ALAS3; EC2.3.1.37; 5-aminolevulinate synthase, nonspecific, mitochondrial; ALAS; MIG4; OTTHUMP00000212619; OTTHUMP00000212620; OTTHUMP00000212621; OTTHUMP00000212622; migration-inducing protein 4; EC 2.3.1) refers to a nuclear-encoded mitochondrial enzyme that is the first and typically rate-limiting enzyme in the mammalian heme biosynthetic pathway. ALAS1 catalyzes the condensation of glycine with succinyl-CoA to form δ-aminolevulinic acid (ALA). The human ALAS1 gene is expressed ubiquitously, is found on chromosome 3p21.1 and typically encodes a sequence of 640 amino acids. In contrast, the ALAS-2 gene, which encodes an isozyme, is expressed only in erythrocytes, is found on chromoxome Xp11.21, and typically encodes a sequence of 550 amino acids. As used herein an “ALAS1 protein” means any protein variant of ALAS1 from any species (e.g., human, mouse, non-human primate), as well as any mutants and fragments thereof that retain an ALAS1 activity. Similarly, an “ALAS1 transcript” refers to any transcript variant of ALAS1, from any species (e.g., human, mouse, non-human primate). A sequence of a human ALAS1 mRNA transcript can be found at NM_000688.4 (
[0336] As used herein, the term “iRNA,” “RNAi”, “iRNA agent,” or “RNAi agent” refers to an agent that contains RNA as that term is defined herein, and which mediates the targeted cleavage of an RNA transcript, e.g., via an RNA-induced silencing complex (RISC) pathway. In one embodiment, an iRNA as described herein effects inhibition of ALAS1 expression. Inhibition of ALAS1 expression may be assessed based on a reduction in the level of ALAS1 mRNA or a reduction in the level of the ALAS1 protein. As used herein, “target sequence” refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of an ALAS1 gene, including mRNA that is a product of RNA processing of a primary transcription product. The target portion of the sequence will be at least long enough to serve as a substrate for iRNA-directed cleavage at or near that portion. For example, the target sequence will generally be from 9-36 nucleotides in length, e.g., 15-30 nucleotides in length, including all sub-ranges therebetween. As non-limiting examples, the target sequence can be from 15-30 nucleotides, 15-26 nucleotides, 15-23 nucleotides, 15-22 nucleotides, 15-21 nucleotides, 15-20 nucleotides, 15-19 nucleotides, 15-18 nucleotides, 15-17 nucleotides, 18-30 nucleotides, 18-26 nucleotides, 18-23 nucleotides, 18-22 nucleotides, 18-21 nucleotides, 18-20 nucleotides, 19-30 nucleotides, 19-26 nucleotides, 19-23 nucleotides, 19-22 nucleotides, 19-21 nucleotides, 19-20 nucleotides, 20-30 nucleotides, 20-26 nucleotides, 20-25 nucleotides, 20-24 nucleotides, 20-23 nucleotides, 20-22 nucleotides, 20-21 nucleotides, 21-30 nucleotides, 21-26 nucleotides, 21-25 nucleotides, 21-24 nucleotides, 21-23 nucleotides, or 21-22 nucleotides.
[0337] As used herein, the term “strand comprising a sequence” refers to an oligonucleotide comprising a chain of nucleotides that is described by the sequence referred to using the standard nucleotide nomenclature.
[0338] As used herein, and unless otherwise indicated, the term “complementary,” when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence, as will be understood by the skilled person. Such conditions can, for example, be stringent conditions, where stringent conditions may include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50° C. or 70° C. for 12-16 hours followed by washing. Other conditions, such as physiologically relevant conditions as may be encountered inside an organism, can apply. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides.
[0339] Complementary sequences within an iRNA, e.g., within a dsRNA as described herein, include base-pairing of the oligonucleotide or polynucleotide comprising a first nucleotide sequence to an oligonucleotide or polynucleotide comprising a second nucleotide sequence over the entire length of one or both nucleotide sequences. Such sequences can be referred to as “fully complementary” with respect to each other herein. However, where a first sequence is referred to as “substantially complementary” with respect to a second sequence herein, the two sequences can be fully complementary, or they may form one or more, but generally not more than 5, 4, 3 or 2 mismatched base pairs upon hybridization for a duplex up to 30 base pairs, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., inhibition of gene expression via a RISC pathway. However, where two oligonucleotides are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs shall not be regarded as mismatches with regard to the determination of complementarity. For example, a dsRNA comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 21 nucleotides that is fully complementary to the shorter oligonucleotide, may yet be referred to as “fully complementary” for the purposes described herein.
[0340] “Complementary” sequences, as used herein, may also include, or be formed entirely from, non-Watson-Crick base pairs and/or base pairs formed from non-natural and modified nucleotides, in as far as the above requirements with respect to their ability to hybridize are fulfilled. Such non-Watson-Crick base pairs includes, but are not limited to, G:U Wobble or Hoogstein base pairing.
[0341] The terms “complementary,” “fully complementary” and “substantially complementary” herein may be used with respect to the base matching between the sense strand and the antisense strand of a dsRNA, or between the antisense strand of an iRNA agent and a target sequence, as will be understood from the context of their use.
[0342] As used herein, a polynucleotide that is “substantially complementary to at least part of” a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e.g., an mRNA encoding an ALAS1 protein). For example, a polynucleotide is complementary to at least a part of an ALAS1 mRNA if the sequence is substantially complementary to a non-interrupted portion of an mRNA encoding ALAS1. As another example, a polynucleotide is complementary to at least a part of an ALAS1 mRNA if the sequence is substantially complementary to a non-interrupted portion of an mRNA encoding ALAS1.
[0343] The term “double-stranded RNA” or “dsRNA,” as used herein, refers to an iRNA that includes an RNA molecule or complex of molecules having a hybridized duplex region that comprises two anti-parallel and substantially complementary nucleic acid strands, which will be referred to as having “sense” and “antisense” orientations with respect to a target RNA. The duplex region can be of any length that permits specific degradation of a desired target RNA, e.g., through a RISC pathway, but will typically range from 9 to 36 base pairs in length, e.g., 15-30 base pairs in length. Considering a duplex between 9 and 36 base pairs, the duplex can be any length in this range, for example, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 and any sub-range therein between, including, but not limited to 15-30 base pairs, 15-26 base pairs, 15-23 base pairs, 15-22 base pairs, 15-21 base pairs, 15-20 base pairs, 15-19 base pairs, 15-18 base pairs, 15-17 base pairs, 18-30 base pairs, 18-26 base pairs, 18-23 base pairs, 18-22 base pairs, 18-21 base pairs, 18-20 base pairs, 19-30 base pairs, 19-26 base pairs, 19-23 base pairs, 19-22 base pairs, 19-21 base pairs, 19-20 base pairs, 20-30 base pairs, 20-26 base pairs, 20-25 base pairs, 20-24 base pairs, 20-23 base pairs, 20-22 base pairs, 20-21 base pairs, 21-30 base pairs, 21-26 base pairs, 21-25 base pairs, 21-24 base pairs, 21-23 base pairs, or 21-22 base pairs. dsRNAs generated in the cell by processing with Dicer and similar enzymes are generally in the range of 19-22 base pairs in length. One strand of the duplex region of a dsDNA comprises a sequence that is substantially complementary to a region of a target RNA. The two strands forming the duplex structure can be from a single RNA molecule having at least one self-complementary region, or can be formed from two or more separate RNA molecules. Where the duplex region is formed from two strands of a single molecule, the molecule can have a duplex region separated by a single stranded chain of nucleotides (herein referred to as a “hairpin loop”) between the 3′-end of one strand and the 5′-end of the respective other strand forming the duplex structure. The hairpin loop can comprise at least one unpaired nucleotide; in some embodiments the hairpin loop can comprise at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 23 or more unpaired nucleotides. Where the two substantially complementary strands of a dsRNA are comprised by separate RNA molecules, those molecules need not, but can be covalently connected. Where the two strands are connected covalently by means other than a hairpin loop, the connecting structure is referred to as a “linker.” The term “siRNA” is also used herein to refer to a dsRNA as described above.
[0344] In another embodiment, the iRNA agent may be a “single-stranded siRNA” that is introduced into a cell or organism to inhibit a target mRNA. Single-stranded RNAi agents bind to the RISC endonuclease Argonaute 2, which then cleaves the target mRNA. The single-stranded siRNAs are generally 15-30 nucleotides and are chemically modified. The design and testing of single-stranded siRNAs are described in U.S. Pat. No. 8,101,348 and in Lima et al., (2012) Cell 150: 883-894, the entire contents of each of which are hereby incorporated herein by reference. Any of the antisense nucleotide sequences described herein (e.g., sequences provided in Tables 2, 3, 6, 7, 8, 9, 14, 15, 18 and 20 or in Tables 21-40) may be used as a single-stranded siRNA as described herein or as chemically modified by the methods described in Lima et al., (2012) Cell 150:883-894.
[0345] In another aspect, the RNA agent is a “single-stranded antisense RNA molecule”. A single-stranded antisense RNA molecule is complementary to a sequence within the target mRNA. Single-stranded antisense RNA molecules can inhibit translation in a stoichiometric manner by base pairing to the mRNA and physically obstructing the translation machinery, see Dias, N. et al., (2002) Mol Cancer Ther 1:347-355. Alternatively, the single-stranded antisense molecules inhibit a target mRNA by hydridizing to the target and cleaving the target through an RNaseH cleavage event. The single-stranded antisense RNA molecule may be about 10 to about 30 nucleotides in length and have a sequence that is complementary to a target sequence. For example, the single-stranded antisense RNA molecule may comprise a sequence that is at least about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more contiguous nucleotides from any one of the antisense nucleotide sequences described herein, e.g., sequences provided in any one of Tables 2, 3, 6, 7, 8, 9, 14, 15, 18 and 20 or in Tables 21-40.
[0346] The skilled artisan will recognize that the term “RNA molecule” or “ribonucleic acid molecule” encompasses not only RNA molecules as expressed or found in nature, but also analogs and derivatives of RNA comprising one or more ribonucleotide/ribonucleoside analogs or derivatives as described herein or as known in the art. Strictly speaking, a “ribonucleoside” includes a nucleoside base and a ribose sugar, and a “ribonucleotide” is a ribonucleoside with one, two or three phosphate moieties. However, the terms “ribonucleoside” and “ribonucleotide” can be considered to be equivalent as used herein. The RNA can be modified in the nucleobase structure, in the ribose structure, or in the ribose-phosphate backbone structure, e.g., as described herein below. However, the molecules comprising ribonucleoside analogs or derivatives must retain the ability to form a duplex. As non-limiting examples, an RNA molecule can also include at least one modified ribonucleoside including but not limited to a 2′-O-methyl modified nucleostide, a nucleoside comprising a 5′ phosphorothioate group, a terminal nucleoside linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group, a locked nucleoside, an abasic nucleoside, an acyclic nucleoside, a 2′-deoxy-2′-fluoro modified nucleoside, a 2′-amino-modified nucleoside, 2′-alkyl-modified nucleoside, morpholino nucleoside, a phosphoramidate or a non-natural base comprising nucleoside, or any combination thereof. Alternatively, an RNA molecule can comprise at least two modified ribonucleosides, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20 or more, up to the entire length of the dsRNA molecule. The modifications need not be the same for each of such a plurality of modified ribonucleosides in an RNA molecule. In one embodiment, modified RNAs contemplated for use in methods and compositions described herein are peptide nucleic acids (PNAs) that have the ability to form the required duplex structure and that permit or mediate the specific degradation of a target RNA, e.g., via a RISC pathway.
[0347] In one aspect, a modified ribonucleoside includes a deoxyribonucleoside. In such an instance, an iRNA agent can comprise one or more deoxynucleosides, including, for example, a deoxynucleoside overhang(s), or one or more deoxynucleosides within the double stranded portion of a dsRNA. In certain embodiments, the RNA molecule comprises a percentage of deoxyribonucleoses of at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95% or higher (but not 100%) deoxyribonucleosides, e.g., in one or both strands. In other embodiments, the term “iRNA” does not encompass a double stranded DNA molecule (e.g., a naturally-occurring double stranded DNA molecule or a 100% deoxynucleoside-containing DNA molecule). In one aspect, an RNA interference agent includes a single stranded RNA that interacts with a target RNA sequence to direct the cleavage of the target RNA. Without wishing to be bound by theory, long double stranded RNA introduced into cells is broken down into siRNA by a Type III endonuclease known as Dicer (Sharp et al., Genes Dev. 2001, 15:485). Dicer, a ribonuclease-III-like enzyme, processes the dsRNA into 19-23 base pair short interfering RNAs with characteristic two base 3′ overhangs (Bernstein, et al., (2001) Nature 409:363). The siRNAs are then incorporated into an RNA-induced silencing complex (RISC) where one or more helicases unwind the siRNA duplex, enabling the complementary antisense strand to guide target recognition (Nykanen, et al., (2001) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases within the RISC cleaves the target to induce silencing (Elbashir, et al., (2001) Genes Dev. 15:188). Thus, in one aspect the invention relates to a single stranded RNA that promotes the formation of a RISC complex to effect silencing of the target gene.
[0348] As used herein, the term “nucleotide overhang” refers to at least one unpaired nucleotide that protrudes from the duplex structure of an iRNA, e.g., a dsRNA. For example, when a 3′-end of one strand of a dsRNA extends beyond the 5′-end of the other strand, or vice versa, there is a nucleotide overhang. A dsRNA can comprise an overhang of at least one nucleotide; alternatively the overhang can comprise at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides or more. A nucleotide overhang can comprise or consist of a nucleotide/nucleoside analog, including a deoxynucleotide/nucleoside. The overhang(s) may be on the sense strand, the antisense strand or any combination thereof. Furthermore, the nucleotide(s) of an overhang can be present on the 5′ end, 3′ end or both ends of either an antisense or sense strand of a dsRNA.
[0349] In one embodiment, the antisense strand of a dsRNA has a 1-10 nucleotide overhang at the 3′ end and/or the 5′ end. In one embodiment, the sense strand of a dsRNA has a 1-10 nucleotide overhang at the 3′ end and/or the 5′ end. In another embodiment, one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate.
[0350] The terms “blunt” or “blunt ended” as used herein in reference to a dsRNA mean that there are no unpaired nucleotides or nucleotide analogs at a given terminal end of a dsRNA, i.e., no nucleotide overhang. One or both ends of a dsRNA can be blunt. Where both ends of a dsRNA are blunt, the dsRNA is said to be blunt ended. To be clear, a “blunt ended” dsRNA is a dsRNA that is blunt at both ends, i.e., no nucleotide overhang at either end of the molecule. Most often such a molecule will be double-stranded over its entire length.
[0351] The term “anti sense strand” or “guide strand” refers to the strand of an iRNA, e.g., a dsRNA, which includes a region that is substantially complementary to a target sequence. As used herein, the term “region of complementarity” refers to the region on the antisense strand that is substantially complementary to a sequence, for example a target sequence, as defined herein. Where the region of complementarity is not fully complementary to the target sequence, the mismatches may be in the internal or terminal regions of the molecule. Generally, the most tolerated mismatches are in the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides of the 5′ and/or 3′ terminus.
[0352] The term “sense strand,” or “passenger strand” as used herein, refers to the strand of an iRNA that includes a region that is substantially complementary to a region of the antisense strand as that term is defined herein.
[0353] As used herein, the term “SNALP” refers to a stable nucleic acid-lipid particle. A SNALP represents a vesicle of lipids coating a reduced aqueous interior comprising a nucleic acid such as an iRNA or a plasmid from which an iRNA is transcribed. SNALPs are described, e.g., in U.S. Patent Application Publication Nos. 20060240093, 20070135372, and in International Application No. WO 2009082817. These applications are incorporated herein by reference in their entirety.
[0354] “Introducing into a cell,” when referring to an iRNA, means facilitating or effecting uptake or absorption into the cell, as is understood by those skilled in the art. Absorption or uptake of an iRNA can occur through unaided diffusive or active cellular processes, or by auxiliary agents or devices. The meaning of this term is not limited to cells in vitro; an iRNA may also be “introduced into a cell,” wherein the cell is part of a living organism. In such an instance, introduction into the cell will include the delivery to the organism. For example, for in vivo delivery, iRNA can be injected into a tissue site or administered systemically. In vivo delivery can also be by a β-glucan delivery system, such as those described in U.S. Pat. Nos. 5,032,401 and 5,607,677, and U.S. Publication No. 2005/0281781, which are hereby incorporated by reference in their entirety. In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection. Further approaches are described herein below or known in the art.
[0355] As used herein, the term “modulate the expression of,” refers to at an least partial “inhibition” or partial “activation” of an ALAS1 gene expression in a cell treated with an iRNA composition as described herein compared to the expression of ALAS1 in a control cell. A control cell includes an untreated cell, or a cell treated with a non-targeting control iRNA.
[0356] The terms “activate,” “enhance,” “up-regulate the expression of,” “increase the expression of,” and the like, in so far as they refer to an ALAS1 gene, herein refer to the at least partial activation of the expression of an ALAS1 gene, as manifested by an increase in the amount of ALAS1 mRNA, which may be isolated from or detected in a first cell or group of cells in which an ALAS1 gene is transcribed and which has or have been treated such that the expression of an ALAS1 gene is increased, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has or have not been so treated (control cells).
[0357] In one embodiment, expression of an ALAS1 gene is activated by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% by administration of an iRNA as described herein. In some embodiments, an ALAS1 gene is activated by at least about 60%, 70%, or 80% by administration of an iRNA featured in the invention. In some embodiments, expression of an ALAS1 gene is activated by at least about 85%, 90%, or 95% or more by administration of an iRNA as described herein. In some embodiments, the ALAS1 gene expression is increased by at least 1-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 50-fold, at least 100-fold, at least 500-fold, at least 1000 fold or more in cells treated with an iRNA as described herein compared to the expression in an untreated cell. Activation of expression by small dsRNAs is described, for example, in Li et al., 2006 Proc. Natl. Acad. Sci. U.S.A. 103:17337-42, and in US20070111963 and US2005226848, each of which is incorporated herein by reference.
[0358] The terms “silence,” “inhibit expression of,” “down-regulate expression of,” “suppress expression of,” and the like, in so far as they refer to an ALAS1 gene, herein refer to the at least partial suppression of the expression of an ALAS1 gene, as assessed, e.g., based on on ALAS1 mRNA expression, ALAS1 protein expression, or another parameter functionally linked to ALAS1 gene expression (e.g., ALA or PBG concentrations in plasma or urine). For example, inhibition of ALAS1 expression may be manifested by a reduction of the amount of ALAS1 mRNA which may be isolated from or detected in a first cell or group of cells in which an ALAS1 gene is transcribed and which has or have been treated such that the expression of an ALAS1 gene is inhibited, as compared to a control. The control may be a second cell or group of cells substantially identical to the first cell or group of cells, except that the second cell or group of cells have not been so treated (control cells). The degree of inhibition is usually expressed as a percentage of a control level, e.g.,
[0359] Alternatively, the degree of inhibition may be given in terms of a reduction of a parameter that is functionally linked to ALAS1 gene expression, e.g., the amount of protein encoded by an ALAS1 gene, or the level of one or more porphyrins. The reduction of a parameter functionally linked to ALAS1 gene expression may similarly be expressed as a percentage of a control level. In principle, ALAS1 gene silencing may be determined in any cell expressing ALAS1, either constitutively or by genomic engineering, and by any appropriate assay. However, when a reference is needed in order to determine whether a given iRNA inhibits the expression of the ALAS1 gene by a certain degree and therefore is encompassed by the instant invention, the assays provided in the Examples below shall serve as such reference.
[0360] For example, in certain instances, expression of an ALAS1 gene is suppressed by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% by administration of an iRNA featured in the invention. In some embodiments, an ALAS1 gene is suppressed by at least about 60%, 65%, 70%, 75%, or 80% by administration of an iRNA featured in the invention. In some embodiments, an ALAS1 gene is suppressed by at least about 85%, 90%, 95%, 98%, 99%, or more by administration of an iRNA as described herein.
[0361] As used herein in the context of ALAS1 expression, the terms “treat,” “treating,” “treatment,” and the like, refer to relief from or alleviation of pathological processes related to ALAS1 expression (e.g., pathological processes involving porphyrins or defects in the porphyrin pathway, such as, for example, porphyrias). In the context of the present invention insofar as it relates to any of the other conditions recited herein below (other than pathological processes related to ALAS1 expression), the terms “treat,” “treatment,” and the like mean to prevent, relieve or alleviate at least one symptom associated with such condition, or to slow or reverse the progression or anticipated progression of such condition. For example, the methods featured herein, when employed to treat porphyria, may serve to reduce or prevent one or more symptoms associated with porphyria (e.g., pain), to reduce the severity or frequency of attacks associated with porphyria, to reduce the likelihood that an attack of one or more symptoms associated with porphyria will occur upon exposure to a precipitating condition, to shorten an attack associated with porphyria, and/or to reduce the risk of developing conditions associated with porphyria (e.g., hepatocellular cancer or neuropathy (e.g., progressive neuropathy),). Thus, unless the context clearly indicates otherwise, the terms “treat,” “treatment,” and the like are intended to encompass prophylaxis, e.g., prevention of disorders and/or symptoms of disorders related to ALAS1 expression.
[0362] By “lower” in the context of a disease marker or symptom is meant a statistically or clinically significant decrease in such level. The decrease can be, for example, at least 10%, at least 20%, at least 30%, at least 40% or more, and is typically down to a level accepted as within the range of normal for an individual without such disorder.
[0363] As used herein, the phrases “therapeutically effective amount” and “prophylactically effective amount” refer to an amount that provides a therapeutic benefit in the treatment, prevention, or management of pathological processes related to ALAS1 expression. The specific amount that is therapeutically effective can be readily determined by an ordinary medical practitioner, and may vary depending on factors known in the art, such as, for example, the type of pathological process, the patient's history and age, the stage of pathological process, and the administration of other agents.
[0364] As used herein, a “pharmaceutical composition” comprises a pharmacologically effective amount of an iRNA and a pharmaceutically acceptable carrier. As used herein, “pharmacologically effective amount,” “therapeutically effective amount” or simply “effective amount” refers to that amount of an iRNA effective to produce the intended pharmacological, therapeutic or preventive result. For example, in a method of treating a disorder related to ALAS1 expression (e.g., in a method of treating a porphyria), an effective amount includes an amount effective to reduce one or more symptoms associated with a porphyria, an amount effective to reduce the frequency of attacks, an amount effective to reduce the likelihood that an attack of one or more symptoms associated with porphyria will occur upon exposure to a precipitating factor, or an amount effective to reduce the risk of developing conditions associated with porphyria (e.g., neuropathy (e.g., progressive neuropathy), hepatocellular cancer). For example, if a given clinical treatment is considered effective when there is at least a 10% reduction in a measurable parameter associated with a disease or disorder, a therapeutically effective amount of a drug for the treatment of that disease or disorder is the amount necessary to effect at least a 10% reduction in that parameter. For example, a therapeutically effective amount of an iRNA targeting ALAS1 can reduce ALAS1 protein levels by any measurable amount, e.g., by at least 10%, 20%, 30%, 40% or 50%.
[0365] The term “pharmaceutically acceptable carrier” refers to a carrier for administration of a therapeutic agent. Such carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The term specifically excludes cell culture medium. For drugs administered orally, pharmaceutically acceptable carriers include, but are not limited to pharmaceutically acceptable excipients such as inert diluents, disintegrating agents, binding agents, lubricating agents, sweetening agents, flavoring agents, coloring agents and preservatives. Suitable inert diluents include sodium and calcium carbonate, sodium and calcium phosphate, and lactose, while corn starch and alginic acid are suitable disintegrating agents. Binding agents may include starch and gelatin, while the lubricating agent, if present, will generally be magnesium stearate, stearic acid or talc. If desired, the tablets may be coated with a material such as glyceryl monostearate or glyceryl distearate, to delay absorption in the gastrointestinal tract. Agents included in drug formulations are described further herein below.
[0366] The term “about” when referring to a number or a numerical range means that the number or numerical range referred to is an approximation within experimental variability (or within statistical experimental error), and thus the number or numerical range may vary from, for example, between 1% and 15% of the stated number or numerical range.
II. iRNA Agents
[0367] Described herein are iRNA agents that inhibit the expression of an ALAS1 gene. In one embodiment, the iRNA agent includes double-stranded ribonucleic acid (dsRNA) molecules for inhibiting the expression of an ALAS1 gene in a cell or in a subject (e.g., in a mammal, e.g., in a human having a porphyria), where the dsRNA includes an antisense strand having a region of complementarity which is complementary to at least a part of an mRNA formed in the expression of an ALAS1 gene, and where the region of complementarity is 30 nucleotides or less in length, generally 19-24 nucleotides in length, and where the dsRNA, upon contact with a cell expressing the ALAS1 gene, inhibits the expression of the ALAS1 gene by at least 10% as assayed by, for example, a PCR or branched DNA (bDNA)-based method, or by a protein-based method, such as by Western blot. In one embodiment, the iRNA agent activates the expression of an ALAS1 gene in a cell or mammal. Expression of an ALAS1 gene in cell culture, such as in COS cells, HeLa cells, primary hepatocytes, HepG2 cells, primary cultured cells or in a biological sample from a subject can be assayed by measuring ALAS1 mRNA levels, such as by bDNA or TaqMan assay, or by measuring protein levels, such as by immunofluorescence analysis, using, for example, Western Blotting or flow cytometric techniques.
[0368] A dsRNA includes two RNA strands that are sufficiently complementary to hybridize to form a duplex structure under conditions in which the dsRNA will be used. One strand of a dsRNA (the antisense strand) includes a region of complementarity that is substantially complementary, and generally fully complementary, to a target sequence, derived from the sequence of an mRNA formed during the expression of an ALAS1 gene. The other strand (the sense strand) includes a region that is complementary to the antisense strand, such that the two strands hybridize and form a duplex structure when combined under suitable conditions. Generally, the duplex structure is between 15 and 30 inclusive, more generally between 18 and 25 inclusive, yet more generally between 19 and 24 inclusive, and most generally between 19 and 21 base pairs in length, inclusive. Similarly, the region of complementarity to the target sequence is between 15 and 30 inclusive, more generally between 18 and 25 inclusive, yet more generally between 19 and 24 inclusive, and most generally between 19 and 21 nucleotides in length, inclusive. In some embodiments, the dsRNA is between 15 and 20 nucleotides in length, inclusive, and in other embodiments, the dsRNA is between 25 and 30 nucleotides in length, inclusive. As the ordinarily skilled person will recognize, the targeted region of an RNA targeted for cleavage will most often be part of a larger RNA molecule, often an mRNA molecule. Where relevant, a “part” of an mRNA target is a contiguous sequence of an mRNA target of sufficient length to be a substrate for RNAi-directed cleavage (i.e., cleavage through a RISC pathway). dsRNAs having duplexes as short as 9 base pairs can, under some circumstances, mediate RNAi-directed RNA cleavage. Most often a target will be at least 15 nucleotides in length, e.g., 15-30 nucleotides in length.
[0369] One of skill in the art will also recognize that the duplex region is a primary functional portion of a dsRNA, e.g., a duplex region of 9 to 36, e.g., 15-30 base pairs. Thus, in one embodiment, to the extent that it becomes processed to a functional duplex of e.g., 15-30 base pairs that targets a desired RNA for cleavage, an RNA molecule or complex of RNA molecules having a duplex region greater than 30 base pairs is a dsRNA. Thus, an ordinarily skilled artisan will recognize that in one embodiment, then, an miRNA is a dsRNA. In another embodiment, a dsRNA is not a naturally occurring miRNA. In another embodiment, an iRNA agent useful to target ALAS1 expression is not generated in the target cell by cleavage of a larger dsRNA.
[0370] A dsRNA as described herein may further include one or more single-stranded nucleotide overhangs. The dsRNA can be synthesized by standard methods known in the art as further discussed below, e.g., by use of an automated DNA synthesizer, such as are commercially available from, for example, Biosearch, Applied Biosystems, Inc. In one embodiment, an ALAS1 gene is a human ALAS1 gene. In another embodiment the ALAS1 gene is a mouse or a rat ALAS1 gene.
[0371] In specific embodiments, the first sequence is a sense strand of a dsRNA that includes a sense sequence disclosed herein, e.g., in Tables 21-40, and the second sequence is an antisense strand of a dsRNA that includes an antisense sequence disclosed herein, e.g., in Tables 21-40.
[0372] In specific embodiments, the first sequence is a sense strand of a dsRNA that includes a sense sequence from Table 2 or Table 3, and the second sequence is an antisense strand of a dsRNA that includes an antisense sequence from Table 2 or Table 3. In embodiments, the first sequence is a sense strand of a dsRNA that includes a sense sequence from Table 2, 3, 6, 7, 8, 9, 14, or 15, and the second sequence is an antisense strand of a dsRNA that includes an antisense sequence from Table 2, 3, 6, 7, 8, 9, 14, or 15. In embodiments, the first sequence is a sense strand of a dsRNA that includes a sense sequence from Table 2, 3, 6, 7, 8, 9, 14, 15, 18 or 20, and the second sequence is an antisense strand of a dsRNA that includes an antisense sequence from Table 2, 3, 6, 7, 8, 9, 14, 15, 18 or 20.
[0373] In one aspect, a dsRNA can include at least sense and antisense nucleotide sequences, whereby the sense strand is selected from the sense sequences provided herein, e.g., in Tables 21-40, and the corresponding antisense strand of the sense strand is selected from the antisense sequences provided herein, e.g., in Tables 21-40.
[0374] In one aspect, a dsRNA can include at least sense and antisense nucleotide sequences, whereby the sense strand is selected from the groups of sequences provided in Tables 2 and 3, and the corresponding antisense strand of the sense strand is selected from Tables 2 and 3. In a further aspect, a dsRNA can include at least sense and antisense nucleotide sequences, whereby the sense strand is selected from the groups of sequences provided in Tables 2, 3, 6, 7, 8, 9, 14, and 15, and the corresponding antisense strand of the sense strand is selected from Tables 2, 3, 6, 7, 8, 9, 14, and 15. In a further aspect, a dsRNA can include at least sense and antisense nucleotide sequences, whereby the sense strand is selected from the groups of sequences provided in Tables 2, 3, 6, 7, 8, 9, 14, 15, 18 and 20, and the corresponding antisense strand of the sense strand is selected from Tables 2, 3, 6, 7, 8, 9, 14, 15, 18 and 20.
[0375] In embodiments, the iRNA is AD-60501, AD-60519, AD-60901, AD-60495, AD-60900, AD-60935, AD-60879, AD-61190, AD-61191, AD-60865, AD-60861, AD-60876, AD-61193, AD-60519, AD-60519, AD-60901, AD-60405, AD-60887, AD-60923, AD-60434, AD-60892, AD-60419, AD-60924, AD-60445, AD-60925, AD-60926, AD-60820, AD-60843, AD-60819, AD-61140, AD-61141, AD-61142, AD-60835, AD-60839, AD-61143, AD-61144, AD-61145, AD-61146, AD-60892, or AD-60419 (e.g., including the nucleotide sequence and/or one or more (e.g., all) of the modifications of the aforesaid dsRNAs). In embodiments, the iRNA comprises an antisense strand that comprises, or consists of, an antisense sequence (including one or more (e.g., all the modifications)) selected from the antisense sequence of AD-60501, AD-60519, AD-60901, AD-60495, AD-60900, AD-60935, AD-60879, AD-61190, AD-61191, AD-60865, AD-60861, AD-60876, AD-61193, AD-60519, AD-60519, AD-60901, AD-60405, AD-60887, AD-60923, AD-60434, AD-60892, AD-60419, AD-60924, AD-60445, AD-60925, AD-60926, AD-60820, AD-60843, AD-60819, AD-61140, AD-61141, AD-61142, AD-60835, AD-60839, AD-61143, AD-61144, AD-61145, AD-61146, AD-60892, or AD-60419. In embodiments, the iRNA comprises a sense strand that comprises, or consists of, a sense sequence (and/or one or more (e.g., all) of the modifications)) selected from AD-60501, AD-60519, AD-60901, AD-60495, AD-60900, AD-60935, AD-60879, AD-61190, AD-61191, AD-60865, AD-60861, AD-60876, AD-61193, AD-60519, AD-60519, AD-60901, AD-60405, AD-60887, AD-60923, AD-60434, AD-60892, AD-60419, AD-60924, AD-60445, AD-60925, AD-60926, AD-60820, AD-60843, AD-60819, AD-61140, AD-61141, AD-61142, AD-60835, AD-60839, AD-61143, AD-61144, AD-61145, AD-61146, AD-60892, or AD-60419.
[0376] In embodiments, the iRNA comprises (i) an antisense strand that comprises, or consists of, the sequence of UAAGAUGAGACACUCUUUCUGGU or UAAGAUGAGACACUCTUUCUGGU and/or (ii) a sense strand that comprises, or consists of, the sequence of CAGAAAGAGUGUCUCAUCUUA. In embodiments, one or more nucleotides of the antisense strand and/or sense strand are modified as described herein.
[0377] In embodiments, the iRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-60489 and/or (ii) a sense strand that comprises, or consists of, the sense sequence of AD-60489 (and/or one or more (e.g., all) of the modifications of the sense strand and/or antisense strand of AD-60489).
[0378] In embodiments, the iRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-60519 and/or (ii) a sense strand that comprises, or consists of, the sense sequence of AD-60519 (and/or one or more (e.g., all) of the modifications of the sense strand and/or antisense strand of AD-60489).
[0379] In embodiments, the iRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-61193 and/or (ii) a sense strand that comprises, or consists of, the sense sequence of AD-61193 (and/or one or more (e.g., all) of the modifications of the sense strand and/or antisense strand of AD-60489).
[0380] In embodiments, the iRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-60819 and/or (ii) a sense sequence that comprises, or consists of, the sense sequence of AD-60819 (and/or one or more (e.g., all) of the modifications of the sense strand and/or anti sense strand of AD-60489).
[0381] In embodiments, the iRNA for inhibiting expression of ALAS1 is provided, wherein the dsRNA comprises (i) an antisense strand that comprises, or consists of, the antisense sequence of AD-60489, AD-60519, AD-61193, or AD-60819 (or a corresponding unmodified antisense sequence) and/or (ii) a sense strand that comprises, or consists of, the sense sequence of AD-60489, AD-60519, AD-61193, or AD-60819 (or a corresponding unmodified antisense sequence). In embodiments, the iRNA comprises (i) an antisense strand that consists of the antisense sequence of AD-60489, AD-60519, AD-61193, or AD-60819 and/or (ii) a sense strand that consists of the sense sequence of AD-60489, AD-60519, AD-61193, or AD-60819, except that the antisense strand and/or sense strand of the dsRNA differs by 1, 2, or 3 nucleotides from the corresponding antisense and/or sense sequence of AD-60489, AD-60519, AD-61193, or AD-60819.
[0382] The sequences and modifications of AD-60489, AD-60519, AD-61193, and AD-60819 are shown in Table 44 disclosed herein.
[0383] In one embodiment, the iRNA is ALN-60519. ALN-60519 is a chemically synthesized double stranded oligonucleotide covalently linked to a ligand containing three N-acetylgalactosamine (GalNAc) residues (depicted in
[0384] In these aspects, one of the two sequences is complementary to the other of the two sequences, with one of the sequences being substantially complementary to a sequence of an mRNA generated by the expression of an ALAS1 gene gene. As such, a dsRNA will include two oligonucleotides, where one oligonucleotide is described herein as the sense strand, and the second oligonucleotide is described as the corresponding antisense strand. As described elsewhere herein and as known in the art, the complementary sequences of a dsRNA can also be contained as self-complementary regions of a single nucleic acid molecule, as opposed to being on separate oligonucleotides.
[0385] The skilled person is well aware that dsRNAs having a duplex structure of between 20 and 23, but specifically 21, base pairs have been hailed as particularly effective in inducing RNA interference (Elbashir et al., EMBO 2001, 20:6877-6888). However, others have found that shorter or longer RNA duplex structures can be effective as well. In the embodiments described above, by virtue of the nature of the oligonucleotide sequences provided in the tables herein, dsRNAs described herein can include at least one strand of a length of minimally 21 nucleotides. It can be reasonably expected that shorter duplexes having one of the sequences of disclosed herein minus only a few nucleotides on one or both ends may be similarly effective as compared to the dsRNAs described above. Hence, dsRNAs having a partial sequence of at least 15, 16, 17, 18, 19, 20, or more contiguous nucleotides from one of the sequences disclosed herein, and differing in their ability to inhibit the expression of an ALAS1 gene by not more than 5, 10, 15, 20, 25, or 30% inhibition from a dsRNA comprising the full sequence, are contemplated according to the invention.
[0386] In addition, the RNAs provided in the tables herein, identify a site in an ALAS1 transcript that is susceptible to RISC-mediated cleavage. As such, the present invention further features iRNAs that target within one of such sequences. As used herein, an iRNA is said to target within a particular site of an RNA transcript if the iRNA promotes cleavage of the transcript anywhere within that particular site. Such an iRNA will generally include at least 15 contiguous nucleotides from one of the sequences provided herein, e.g., in Tables 2, 3, 6, 7, 8, 9, 14, 15, 18, 20, and in Tables 21-40, coupled to additional nucleotide sequences taken from the region contiguous to the selected sequence in an ALAS1 gene.
[0387] While a target sequence is generally 15-30 nucleotides in length, there is wide variation in the suitability of particular sequences in this range for directing cleavage of any given target RNA. Various software packages and the guidelines set out herein provide guidance for the identification of optimal target sequences for any given gene target, but an empirical approach can also be taken in which a “window” or “mask” of a given size (as a non-limiting example, 21 nucleotides) is literally or figuratively (including, e.g., in silico) placed on the target RNA sequence to identify sequences in the size range that may serve as target sequences. By moving the sequence “window” progressively one nucleotide upstream or downstream of an initial target sequence location, the next potential target sequence can be identified, until the complete set of possible sequences is identified for any given target size selected. This process, coupled with systematic synthesis and testing of the identified sequences (using assays as described herein or as known in the art) to identify those sequences that perform optimally can identify those RNA sequences that, when targeted with an iRNA agent, mediate the best inhibition of target gene expression. Thus, while the sequences identified, for example, in the tables herein, represent effective target sequences, it is contemplated that further optimization of inhibition efficiency can be achieved by progressively “walking the window” one nucleotide upstream or downstream of the given sequences to identify sequences with equal or better inhibition characteristics.
[0388] Further, it is contemplated that for any sequence identified, e.g., in the tables herein, further optimization can be achieved by systematically either adding or removing nucleotides to generate longer or shorter sequences and testing those and sequences generated by walking a window of the longer or shorter size up or down the target RNA from that point. Again, coupling this approach to generating new candidate targets with testing for effectiveness of iRNAs based on those target sequences in an inhibition assay as known in the art or as described herein can lead to further improvements in the efficiency of inhibition. Further still, such optimized sequences can be adjusted by, e.g., the introduction of modified nucleotides as described herein or as known in the art, addition or changes in overhang, or other modifications as known in the art and/or discussed herein to further optimize the molecule (e.g., increasing serum stability or circulating half-life, increasing thermal stability, enhancing transmembrane delivery, targeting to a particular location or cell type, increasing interaction with silencing pathway enzymes, increasing release from endosomes, etc.) as an expression inhibitor.
[0389] An iRNA as described herein can contain one or more mismatches to the target sequence. In one embodiment, an iRNA as described herein contains no more than 3 mismatches. If the antisense strand of the iRNA contains mismatches to a target sequence, it is preferable that the area of mismatch not be located in the center of the region of complementarity. If the antisense strand of the iRNA contains mismatches to the target sequence, it is preferable that the mismatch be restricted to be within the last 5 nucleotides from either the 5′ or 3′ end of the region of complementarity. For example, for a 23 nucleotide iRNA agent RNA strand which is complementary to a region of an ALAS1 gene, the RNA strand generally does not contain any mismatch within the central 13 nucleotides. The methods described herein or methods known in the art can be used to determine whether an iRNA containing a mismatch to a target sequence is effective in inhibiting the expression of an ALAS1 gene. Consideration of the efficacy of iRNAs with mismatches in inhibiting expression of an ALAS1 gene is important, especially if the particular region of complementarity in an ALAS1 gene is known to have polymorphic sequence variation within the population.
[0390] In one embodiment, at least one end of a dsRNA has a single-stranded nucleotide overhang of 1 to 4, generally 1 or 2 nucleotides. dsRNAs having at least one nucleotide overhang have unexpectedly superior inhibitory properties relative to their blunt-ended counterparts. In yet another embodiment, the RNA of an iRNA, e.g., a dsRNA, is chemically modified to enhance stability or other beneficial characteristics. The nucleic acids featured in the invention may be synthesized and/or modified by methods well established in the art, such as those described in “Current protocols in nucleic acid chemistry,” Beaucage, S. L. et al. (Edrs.), John Wiley & Sons, Inc., New York, N.Y., USA, which is hereby incorporated herein by reference. Modifications include, for example, (a) end modifications, e.g., 5′ end modifications (phosphorylation, conjugation, inverted linkages, etc.) 3′ end modifications (conjugation, DNA nucleotides, inverted linkages, etc.), (b) base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases, (c) sugar modifications (e.g., at the 2′ position or 4′ position, or having an acyclic sugar) or replacement of the sugar, as well as (d) backbone modifications, including modification or replacement of the phosphodiester linkages. Specific examples of RNA compounds useful in this invention include, but are not limited to RNAs containing modified backbones or no natural internucleoside linkages. RNAs having modified backbones include, among others, those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified RNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides. In particular embodiments, the modified RNA will have a phosphorus atom in its internucleoside backbone.
[0391] Modified RNA backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3′-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3′-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3′-5′ linkages, 2′-5′ linked analogs of these, and those) having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3′-5′ to 5′-3′ or 2′-5′ to 5′-2′. Various salts, mixed salts and free acid forms are also included.
[0392] Representative U.S. patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,316; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,625,050; 6,028,188; 6,124,445; 6,160,109; 6,169,170; 6,172,209; 6,239,265; 6,277,603; 6,326,199; 6,346,614; 6,444,423; 6,531,590; 6,534,639; 6,608,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029; and U.S. Pat. RE39464, each of which is herein incorporated by reference.
[0393] Modified RNA backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH.sub.2 component parts.
[0394] Representative U.S. patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and, 5,677,439, each of which is herein incorporated by reference.
[0395] In other RNA mimetics suitable or contemplated for use in iRNAs, both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an RNA mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of an RNA is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.
[0396] Some embodiments featured in the invention include RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular —CH.sub.2—NH—CH.sub.2—, —CH.sub.2—N(CH.sub.3)—O—CH.sub.2—[known as a methylene (methylimino) or MMI backbone], —CH.sub.2—O—N(CH.sub.3)—CH.sub.2—, —CH.sub.2—N(CH.sub.3)—N(CH.sub.3)—CH.sub.2— and —N(CH.sub.3)—CH.sub.2—CH.sub.2—[wherein the native phosphodiester backbone is represented as —O—P—O—CH.sub.2—] of the above-referenced U.S. Pat. No. 5,489,677, and the amide backbones of the above-referenced U.S. Pat. No. 5,602,240. In some embodiments, the RNAs featured herein have morpholino backbone structures of the above-referenced U.S. Pat. No. 5,034,506.
[0397] Modified RNAs may also contain one or more substituted sugar moieties. The iRNAs, e.g., dsRNAs, featured herein can include one of the following at the 2′ position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C.sub.1 to C.sub.10 alkyl or C.sub.2 to C.sub.10 alkenyl and alkynyl. Exemplary suitable modifications include O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2).sub.nOCH.sub.3, O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3, O(CH.sub.2).sub.nONH.sub.2, and O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.sub.3)].sub.2, where n and m are from 1 to about 10. In other embodiments, dsRNAs include one of the following at the 2′ position: C.sub.1 to C.sub.10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3, OCF.sub.3, SOCH.sub.3, SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2, N.sub.3, NH.sub.2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an iRNA, or a group for improving the pharmacodynamic properties of an iRNA, and other substituents having similar properties. In some embodiments, the modification includes a 2′-methoxyethoxy (2′-O—CH.sub.2CH.sub.2OCH.sub.3, also known as 2′-O-(2-methoxyethyl) or 2′-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504) i.e., an alkoxy-alkoxy group. Another exemplary modification is 2′-dimethylaminooxyethoxy, i.e., a O(CH.sub.2).sub.2ON(CH.sub.3).sub.2 group, also known as 2′-DMAOE, as described in examples herein below, and 2′-dimethylaminoethoxyethoxy (also known in the art as 2′-O-dimethylaminoethoxyethyl or 2′-DMAEOE), i.e., 2′-O—CH.sub.2—O—CH.sub.2—N(CH.sub.2).sub.2, also described in examples herein below.
[0398] In other embodiments, an iRNA agent comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) acyclic nucleotides (or nucleosides). In certain embodiments, the sense strand or the antisense strand, or both sense strand and antisense strand, include less than five acyclic nucleotides per strand (e.g., four, three, two or one acyclic nucleotides per strand). The one or more acyclic nucleotides can be found, for example, in the double-stranded region, of the sense or antisense strand, or both strands; at the 5′-end, the 3′-end, both of the 5′ and 3′-ends of the sense or antisense strand, or both strands, of the iRNA agent. In one embodiment, one or more acyclic nucleotides are present at positions 1 to 8 of the sense or antisense strand, or both. In one embodiment, one or more acyclic nucleotides are found in the antisense strand at positions 4 to 10 (e.g., positions 6-8) from the 5′-end of the antisense strand. In another embodiment, the one or more acyclic nucleotides are found at one or both 3′-terminal overhangs of the iRNA agent.
[0399] The term “acyclic nucleotide” or “acyclic nucleoside” as used herein refers to any nucleotide or nucleoside having an acyclic sugar, e.g., an acyclic ribose. An exemplary acyclic nucleotide or nucleoside can include a nucleobase, e.g., a naturally-occurring or a modified nucleobase (e.g., a nucleobase as described herein). In certain embodiments, a bond between any of the ribose carbons (C1, C2, C3, C4, or C5), is independently or in combination absent from the nucleotide. In one embodiment, the bond between C2-C3 carbons of the ribose ring is absent, e.g., an acyclic 2′-3′-seco-nucleotide monomer. In other embodiments, the bond between C1-C2, C3-C4, or C4-05 is absent (e.g., a 1′-2′, 3′-4′ or 4′-5′-seco nucleotide monomer). Exemplary acyclic nucleotides are disclosed in U.S. Pat. No. 8,314,227, incorporated herein by reference in its entirely. For example, an acyclic nucleotide can include any of monomers D-J in FIGS. 1-2 of U.S. Pat. No. 8,314,227. In one embodiment, the acyclic nucleotide includes the following monomer:
##STR00007##
[0400] wherein Base is a nucleobase, e.g., a naturally-occurring or a modified nucleobase (e.g., a nucleobase as described herein).
[0401] In certain embodiments, the acyclic nucleotide can be modified or derivatized, e.g., by coupling the acyclic nucleotide to another moiety, e.g., a ligand (e.g., a GalNAc, a cholesterol ligand), an alkyl, a polyamine, a sugar, a polypeptide, among others.
[0402] In other embodiments, the iRNA agent includes one or more acyclic nucleotides and one or more LNAs (e.g., an LNA as described herein). For example, one or more acyclic nucleotides and/or one or more LNAs can be present in the sense strand, the antisense strand, or both. The number of acyclic nucleotides in one strand can be the same or different from the number of LNAs in the opposing strand. In certain embodiments, the sense strand and/or the antisense strand comprises less than five LNAs (e.g., four, three, two or one LNAs) located in the double-stranded region or a 3′-overhang. In other embodiments, one or two LNAs are located in the double stranded region or the 3′-overhang of the sense strand. Alternatively, or in combination, the sense strand and/or antisense strand comprises less than five acyclic nucleotides (e.g., four, three, two or one acyclic nucleotides) in the double-stranded region or a 3′-overhang. In one embodiment, the sense strand of the iRNA agent comprises one or two LNAs in the 3′-overhang of the sense strand, and one or two acyclic nucleotides in the double-stranded region of the antisense strand (e.g., at positions 4 to 10 (e.g., positions 6-8) from the 5′-end of the antisense strand) of the iRNA agent.
[0403] In other embodiments, inclusion of one or more acyclic nucleotides (alone or in addition to one or more LNAs) in the iRNA agent results in one or more (or all) of: (i) a reduction in an off-target effect; (ii) a reduction in passenger strand participation in RNAi; (iii) an increase in specificity of the guide strand for its target mRNA; (iv) a reduction in a microRNA off-target effect; (v) an increase in stability; or (vi) an increase in resistance to degradation, of the iRNA molecule.
[0404] Other modifications include 2′-methoxy (2′-OCH.sub.3), 2′-aminopropoxy (2′-OCH.sub.2CH.sub.2CH.sub.2NH.sub.2) and 2′-fluoro (2′-F). Similar modifications may also be made at other positions on the RNA of an iRNA, particularly the 3′ position of the sugar on the 3′ terminal nucleotide or in 2′-5′ linked dsRNAs and the 5′ position of 5′ terminal nucleotide. iRNAs may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative U.S. patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference.
[0405] An iRNA may also include nucleobase (often referred to in the art simply as “base”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl anal other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-daazaadenine and 3-deazaguanine and 3-deazaadenine. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008; those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990, these disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds featured in the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2° C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., dsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are exemplary base substitutions, even more particularly when combined with 2′-O-methoxyethyl sugar modifications.
[0406] Representative U.S. patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, the above noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos. 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,681,941; 6,015,886; 6,147,200; 6,166,197; 6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672; and 7,495,088, each of which is herein incorporated by reference, and U.S. Pat. No. 5,750,692, also herein incorporated by reference.
[0407] The RNA of an iRNA can also be modified to include one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) locked nucleic acids (LNA), (also referred to herein as “locked nucleotides”). In one embodiment, a locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting, e.g., the 2′ and 4′ carbons. This structure effectively “locks” the ribose in the 3′-endo structural conformation. The addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, increase thermal stability, and to reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, O R. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193).
[0408] Representative U.S. patents that teach the preparation of locked nucleic acid nucleotides include, but are not limited to, the following: U.S. Pat. Nos. 6,268,490; 6,670,461; 6,794,499; 6,998,484; 7,053,207; 7,084,125; 7,399,845; and 8,314,227, each of which is herein incorporated by reference in its entirety. Exemplary LNAs include but are not limited to, a 2′, 4′-C methylene bicyclo nucleotide (see for example Wengel et al., International PCT Publication No. WO 00/66604 and WO 99/14226).
[0409] In other embodiments, the iRNA agents include one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) G-clamp nucleotides. A G-clamp nucleotide is a modified cytosine analog wherein the modifications confer the ability to hydrogen bond both Watson-Crick and Hoogsteen faces of a complementary guanine within a duplex, see for example Lin and Matteucci, 1998, J. Am. Chem. Soc., 120, 8531-8532. A single G-clamp analog substitution within an oligonucleotide can result in substantially enhanced helical thermal stability and mismatch discrimination when hybridized to complementary oligonucleotides. The inclusion of such nucleotides in the iRNA molecules can result in enhanced affinity and specificity to nucleic acid targets, complementary sequences, or template strands.
[0410] Potentially stabilizing modifications to the ends of RNA molecules can include N-(acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2′-O-deoxythymidine (ether), N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3″-phosphate, inverted base dT(idT) and others. Disclosure of this modification can be found in PCT Publication No. WO 2011/005861.
IRNA Motifs
[0411] In one embodiment, the sense strand sequence may be represented by formula (I):
5′ n.sub.p-N.sub.a-(XXX).sub.i-N.sub.b-YYY-N.sub.b-(ZZZ).sub.j-N.sub.a-n.sub.q 3′ (I)
[0412] wherein:
[0413] i and j are each independently 0 or 1;
[0414] p and q are each independently 0-6;
[0415] each N.sub.a independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides;
[0416] each N.sub.b independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides;
[0417] each n.sub.p and n.sub.q independently represent an overhang nucleotide;
[0418] wherein N.sub.b and Y do not have the same modification; and
[0419] XXX, YYY and ZZZ each independently represent one motif of three identical modifications on three consecutive nucleotides. Preferably YYY is all 2′-F modified nucleotides.
[0420] In one embodiment, the N.sub.a and/or N.sub.b comprise modifications of alternating pattern.
[0421] In one embodiment, the YYY motif occurs at or near the cleavage site of the sense strand. For example, when the RNAi agent has a duplex region of 17-23 nucleotides in length, the YYY motif can occur at or the vicinity of the cleavage site (e.g.: can occur at positions 6, 7, 8; 7, 8, 9; 8, 9, 10; 9, 10, 11; 10, 11, 12 or 11, 12, 13) of—the sense strand, the count starting from the 1.sup.st nucleotide, from the 5′-end; or optionally, the count starting at the 1.sup.st paired nucleotide within the duplex region, from the 5′-end.
[0422] In one embodiment, i is 1 and j is 0, or i is 0 and j is 1, or both i and j are 1. The sense strand can therefore be represented by the following formulas:
5′ n.sub.p-N.sub.a-YYY-N.sub.b-ZZZ-N.sub.a-n.sub.q 3′ (Ib);
5′ n.sub.p-N.sub.a-XXX-N.sub.b-YYY-N.sub.a-n.sub.q 3′ (Ic); or
5′ n.sub.p-N.sub.a-XXX-N.sub.b-YYY-N.sub.b-ZZZ-N.sub.a-n.sub.q 3′ (Id).
[0423] When the sense strand is represented by formula (Ib), N.sub.b represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a independently can represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
[0424] When the sense strand is represented as formula (Ic), N.sub.b represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a can independently represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
[0425] When the sense strand is represented as formula (Id), each N.sub.b independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Preferably, N.sub.b is 0, 1, 2, 3, 4, 5 or 6. Each N.sub.a can independently represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
[0426] Each of X, Y and Z may be the same or different from each other.
[0427] In other embodiments, i is 0 and j is 0, and the sense strand may be represented by the formula:
5′ n.sub.p-N.sub.a-YYY-N.sub.a-n.sub.q 3′ (Ia).
[0428] When the sense strand is represented by formula (Ia), each N.sub.a independently can represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
[0429] In one embodiment, the antisense strand sequence of the RNAi may be represented by formula (II):
5′ n.sub.q′-N.sub.a′-(Z′Z′Z′).sub.k-N.sub.b′-Y′Y′Y′-N.sub.b′-(X′X′X′).sub.l-N′.sub.a-n.sub.p′ 3′ (II)
[0430] wherein:
[0431] k and l are each independently 0 or 1;
[0432] p′ and q′ are each independently 0-6;
[0433] each N.sub.a′ independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides;
[0434] each N.sub.b′ independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides;
[0435] each n.sub.p′ and n.sub.q′ independently represent an overhang nucleotide;
[0436] wherein N.sub.b′ and Y′ do not have the same modification;
[0437] and
[0438] X′X′X′, Y′Y′Y′ and Z′Z′Z′ each independently represent one motif of three identical modifications on three consecutive nucleotides.
[0439] In one embodiment, the N.sub.a′ and/or N.sub.b′ comprise modifications of alternating pattern.
[0440] The Y′Y′Y′ motif occurs at or near the cleavage site of the antisense strand. For example, when the RNAi agent has a duplex region of 17-23 nucleotide in length, the Y′Y′Y′ motif can occur at positions 9, 10, 11; 10, 11, 12; 11, 12, 13; 12, 13, 14; or 13, 14, 15 of the antisense strand, with the count starting from the 1.sup.st nucleotide, from the 5′-end; or optionally, the count starting at the 1.sup.st paired nucleotide within the duplex region, from the 5′-end. Preferably, the Y′Y′Y′ motif occurs at positions 11, 12, 13.
[0441] In one embodiment, Y′Y′Y′ motif is all 2′-OMe modified nucleotides.
[0442] In one embodiment, k is 1 and l is 0, or k is 0 and l is 1, or both k and l are 1.
[0443] The antisense strand can therefore be represented by the following formulas:
5′ n.sub.q′-N.sub.a′-Z′Z′Z′—N.sub.b′-Y′Y′Y′-N.sub.a′-n.sub.p′ 3′ (11b);
5′ n.sub.q′-N.sub.a′-Y′Y′Y′-N.sub.b′-X′X′X′-n.sub.p′ 3 (IIc); or
5′ n.sub.q′-N.sub.a′-Z′Z′Z′-N.sub.b′-Y′Y′Y′-N.sub.b′-X′X′X′-N.sub.a′-n.sub.p′ 3′ (IId).
[0444] When the antisense strand is represented by formula (IIb), N.sub.b′ represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a′ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
[0445] When the antisense strand is represented as formula (IIC), N.sub.b′ represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a′ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
[0446] When the antisense strand is represented as formula (IId), each N.sub.b′ independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a′ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides. Preferably, N.sub.b is 0, 1, 2, 3, 4, 5 or 6.
[0447] In other embodiments, k is 0 and l is 0 and the antisense strand may be represented by the formula:
5′ n.sub.p′-N.sub.a′-Y′Y′Y′-N.sub.a′-n.sub.q′ 3′ (Ia).
[0448] When the antisense strand is represented as formula (IIa), each N.sub.a′ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
[0449] Each of X′, Y′ and Z′ may be the same or different from each other.
[0450] Each nucleotide of the sense strand and antisense strand may be independently modified with LNA, HNA, CeNA, 2′-methoxyethyl, 2′-O-methyl, 2′-O-allyl, 2′-C-allyl, 2′-hydroxyl, or 2′-fluoro. For example, each nucleotide of the sense strand and antisense strand is independently modified with 2′-O-methyl or 2′-fluoro. Each X, Y, Z, X′, Y′ and Z′, in particular, may represent a 2′-O-methyl modification or a 2′-fluoro modification.
[0451] In one embodiment, the sense strand of the RNAi agent may contain YYY motif occurring at 9, 10 and 11 positions of the strand when the duplex region is 21 nt, the count starting from the 1.sup.st nucleotide from the 5′-end, or optionally, the count starting at the 1.sup.st paired nucleotide within the duplex region, from the 5′-end; and Y represents 2′-F modification. The sense strand may additionally contain XXX motif or ZZZ motifs as wing modifications at the opposite end of the duplex region; and XXX and ZZZ each independently represents a 2′-OMe modification or 2′-F modification.
[0452] In one embodiment the antisense strand may contain Y′Y′Y′ motif occurring at positions 11, 12, 13 of the strand, the count starting from the 1.sup.st nucleotide from the 5′-end, or optionally, the count starting at the 1.sup.st paired nucleotide within the duplex region, from the 5′-end; and Y′ represents 2′-O-methyl modification. The antisense strand may additionally contain X′X′X′ motif or Z′Z′Z′ motifs as wing modifications at the opposite end of the duplex region; and X′X′X′ and Z′Z′Z′ each independently represents a 2′-OMe modification or 2′-F modification.
[0453] The sense strand represented by any one of the above formulas (Ia), (Ib), (Ic), and (Id) forms a duplex with a antisense strand being represented by any one of formulas (IIa), (IIb), (IIc), and (IId), respectively.
[0454] Accordingly, the RNAi agents for use in the methods of the invention may comprise a sense strand and an antisense strand, each strand having 14 to 30 nucleotides, the RNAi duplex represented by formula (III):
sense: 5′ n.sub.p-N.sub.a-(XXX).sub.i-N.sub.b-YYY-N.sub.b-(ZZZ).sub.j-N.sub.a-n.sub.q 3′
antisense: 3′ n.sub.p′-N.sub.a′-(X′X′X′).sub.k-N.sub.b′-Y′Y′Y′-N.sub.b′-(Z′Z′Z′).sub.l—N.sub.a′-n.sub.q′ 5′ (III)
[0455] wherein:
[0456] j, k, and l are each independently 0 or 1;
[0457] p, p′, q, and q′ are each independently 0-6;
[0458] each N.sub.a and N.sub.a′ independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides;
[0459] each N.sub.b and N.sub.b′ independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides;
[0460] wherein
[0461] each n.sub.p′, n.sub.p, n.sub.q′, and n.sub.q, each of which may or may not be present, independently represents an overhang nucleotide; and
[0462] XXX, YYY, ZZZ, X′X′X′, Y′Y′Y′, and Z′Z′Z′ each independently represent one motif of three identical modifications on three consecutive nucleotides.
[0463] In one embodiment, i is 0 and j is 0; or i is 1 and j is 0; or i is 0 and j is 1; or both i and j are 0; or both i and j are 1. In another embodiment, k is 0 and l is 0; or k is 1 and l is 0; k is 0 and l is 1; or both k and l are 0; or both k and l are 1.
[0464] Exemplary combinations of the sense strand and antisense strand forming a RNAi duplex include the formulas below:
5′ n.sub.p-N.sub.a-YYY-N.sub.a-n.sub.q 3′
3′ n.sub.p′-N.sub.a′-Y′Y′Y′-N.sub.a′n.sub.q′ 5 (IIIa)
5′ n.sub.p-N.sub.a-YYY-N.sub.b-ZZZ-N.sub.a-n.sub.q 3′
3′ n.sub.p′-N.sub.a′-Y′Y′Y′-N.sub.b′-Z′Z′Z′—N.sub.a′n.sub.q′ 5′ (IIIb)
5′ n.sub.p-N.sub.a-XXX-N.sub.b-YYY-N.sub.a-n.sub.q 3
3′ n.sub.p′-N.sub.a′-X′X′X′-N.sub.b′-Y′Y′Y′-N.sub.a′-n.sub.q′ 5′ (IIIc)
5′ n.sub.p-N.sub.a-XXX-N.sub.b-YYY-N.sub.b-ZZZ-N.sub.a-n.sub.q3′
3′ n.sub.p′-N.sub.a′-X′X′X′-N.sub.b′-Y′Y′Y′-N.sub.b′-Z′Z′Z′—N.sub.a-n.sub.q′ 5′ (IIId)
[0465] When the RNAi agent is represented by formula (IIIa), each N.sub.a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
[0466] When the RNAi agent is represented by formula (IIIb), each N.sub.b independently represents an oligonucleotide sequence comprising 1-10, 1-7, 1-5 or 1-4 modified nucleotides. Each N.sub.a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
[0467] When the RNAi agent is represented as formula (IIIc), each N.sub.b, N.sub.b′ independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
[0468] When the RNAi agent is represented as formula (IIId), each N.sub.b, N.sub.b′ independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a, N.sub.a′ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides. Each of N.sub.a, N.sub.a′, N.sub.b and N.sub.b′, independently comprises modifications of alternating pattern.
[0469] Each of X, Y and Z in formulas (III), (IIIa), (IIIb), (IIIc), and (IIId) may be the same or different from each other.
[0470] When the RNAi agent is represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId), at least one of the Y nucleotides may form a base pair with one of the Y′ nucleotides. Alternatively, at least two of the Y nucleotides form base pairs with the corresponding Y′ nucleotides; or all three of the Y nucleotides all form base pairs with the corresponding Y′ nucleotides.
[0471] When the RNAi agent is represented by formula (IIIb) or (IIId), at least one of the Z nucleotides may form a base pair with one of the Z′ nucleotides. Alternatively, at least two of the Z nucleotides form base pairs with the corresponding Z′ nucleotides; or all three of the Z nucleotides all form base pairs with the corresponding Z′ nucleotides.
[0472] When the RNAi agent is represented as formula (IIIc) or (IIId), at least one of the X nucleotides may form a base pair with one of the X′ nucleotides. Alternatively, at least two of the X nucleotides form base pairs with the corresponding X′ nucleotides; or all three of the X nucleotides all form base pairs with the corresponding X′ nucleotides.
[0473] In one embodiment, the modification on the Y nucleotide is different than the modification on the Y′ nucleotide, the modification on the Z nucleotide is different than the modification on the Z′ nucleotide, and/or the modification on the X nucleotide is different than the modification on the X′ nucleotide.
[0474] In one embodiment, when the RNAi agent is represented by formula (IIId), the N.sub.a modifications are 2′-O-methyl or 2′-fluoro modifications. In another embodiment, when the RNAi agent is represented by formula (IIId), the N.sub.a modifications are 2′-O-methyl or 2′-fluoro modifications and n.sub.p′>0 and at least one n.sub.p′ is linked to a neighboring nucleotide a via phosphorothioate linkage. In yet another embodiment, when the RNAi agent is represented by formula (IIId), the N.sub.a modifications are 2′-O-methyl or 2′-fluoro modifications, n.sub.p′>0 and at least one n.sub.p′ is linked to a neighboring nucleotide via phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached through a bivalent or trivalent branched linker. In another embodiment, when the RNAi agent is represented by formula (IIId), the N.sub.a modifications are 2′-O-methyl or 2′-fluoro modifications, n.sub.p′>0 and at least one n.sub.p′ is linked to a neighboring nucleotide via phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.
[0475] In one embodiment, when the RNAi agent is represented by formula (IIIa), the N.sub.a modifications are 2′-O-methyl or 2′-fluoro modifications, n.sub.p′>0 and at least one n.sub.p′ is linked to a neighboring nucleotide via phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.
[0476] In one embodiment, the RNAi agent is a multimer containing at least two duplexes represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId), wherein the duplexes are connected by a linker. The linker can be cleavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two different target sites.
[0477] In one embodiment, the RNAi agent is a multimer containing three, four, five, six or more duplexes represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId), wherein the duplexes are connected by a linker. The linker can be cleavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two different target sites.
[0478] In one embodiment, two RNAi agents represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId) are linked to each other at the 5′ end, and one or both of the 3′ ends and are optionally conjugated to a ligand. Each of the agents can target the same gene or two different genes; or each of the agents can target same gene at two different target sites.
iRNA Conjugates
[0479] The iRNA agents disclosed herein can be in the form of conjugates. The conjugate may be attached at any suitable location in the iRNA molecule, e.g., at the 3′ end or the 5′ end of the sense or the antisense strand. The conjugates are optionally attached via a linker.
[0480] In some embodiments, an iRNA agent described herein is chemically linked to one or more ligands, moieties or conjugates, which may confer functionality, e.g., by affecting (e.g., enhancing) the activity, cellular distribution or cellular uptake of the iRNA. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86: 6553-6556), cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060), a thioether, e.g., beryl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al., Biochimie, 1993, 75:49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654; Shea et al., Nucl. Acids Res., 1990, 18:3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), or an octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923-937).
[0481] In one embodiment, a ligand alters the distribution, targeting or lifetime of an iRNA agent into which it is incorporated. In some embodiments, a ligand provides an enhanced affinity for a selected target, e.g, molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ or region of the body, as, e.g., compared to a species absent such a ligand. Typical ligands will not take part in duplex pairing in a duplexed nucleic acid.
[0482] Ligands can include a naturally occurring substance, such as a protein (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin); carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid); or a lipid. The ligand may also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid. Examples of polyamino acids include polyamino acid is a polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacryllic acid), N-isopropylacrylamide polymers, or polyphosphazine. Example of polyamines include: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an a helical peptide.
[0483] Ligands can also include targeting groups, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a kidney cell. A targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-gulucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, biotin, or an RGD peptide or RGD peptide mimetic.
[0484] In some embodiments, the ligand is a GalNAc ligand that comprises one or more N-acetylgalactosamine (GalNAc) derivatives. Additional description of GalNAc ligands is provided in the section titled Carbohydrate Conjugates.
[0485] Other examples of ligands include dyes, intercalating agents (e.g. acridines), cross-linkers (e.g. psoralene, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g. EDTA), lipophilic molecules, e.g, cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-Bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g. biotin), transport/absorption facilitators (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP, or AP.
[0486] Ligands can be proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as a cancer cell, endothelial cell, or bone cell. Ligands may also include hormones and hormone receptors. They can also include non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-gulucosamine multivalent mannose, or multivalent fucose. The ligand can be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF-κB.
[0487] The ligand can be a substance, e.g, a drug, which can increase the uptake of the iRNA agent into the cell, for example, by disrupting the cell's cytoskeleton, e.g., by disrupting the cell's microtubules, microfilaments, and/or intermediate filaments. The drug can be, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin.
[0488] In some embodiments, a ligand attached to an iRNA as described herein acts as a pharmacokinetic modulator (PK modulator). PK modulators include lipophiles, bile acids, steroids, phospholipid analogues, peptides, protein binding agents, PEG, vitamins etc. Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglyceride, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin etc. Oligonucleotides that comprise a number of phosphorothioate linkages are also known to bind to serum protein, thus short oligonucleotides, e.g., oligonucleotides of about 5 bases, 10 bases, 15 bases or 20 bases, comprising multiple of phosphorothioate linkages in the backbone are also amenable to the present invention as ligands (e.g. as PK modulating ligands). In addition, aptamers that bind serum components (e.g. serum proteins) are also suitable for use as PK modulating ligands in the embodiments described herein.
[0489] Ligand-conjugated oligonucleotides of the invention may be synthesized by the use of an oligonucleotide that bears a pendant reactive functionality, such as that derived from the attachment of a linking molecule onto the oligonucleotide (described below). This reactive oligonucleotide may be reacted directly with commercially-available ligands, ligands that are synthesized bearing any of a variety of protecting groups, or ligands that have a linking moiety attached thereto.
[0490] The oligonucleotides used in the conjugates of the present invention may be conveniently and routinely made through the well-known technique of solid-phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is also known to use similar techniques to prepare other oligonucleotides, such as the phosphorothioates and alkylated derivatives.
[0491] In the ligand-conjugated oligonucleotides and ligand-molecule bearing sequence-specific linked nucleosides of the present invention, the oligonucleotides and oligonucleosides may be assembled on a suitable DNA synthesizer utilizing standard nucleotide or nucleoside precursors, or nucleotide or nucleoside conjugate precursors that already bear the linking moiety, ligand-nucleotide or nucleoside-conjugate precursors that already bear the ligand molecule, or non-nucleoside ligand-bearing building blocks.
[0492] When using nucleotide-conjugate precursors that already bear a linking moiety, the synthesis of the sequence-specific linked nucleosides is typically completed, and the ligand molecule is then reacted with the linking moiety to form the ligand-conjugated oligonucleotide. In some embodiments, the oligonucleotides or linked nucleosides of the present invention are synthesized by an automated synthesizer using phosphoramidites derived from ligand-nucleoside conjugates in addition to the standard phosphoramidites and non-standard phosphoramidites that are commercially available and routinely used in oligonucleotide synthesis.
[0493] Lipid Conjugates
[0494] In one embodiment, the ligand is a lipid or lipid-based molecule. Such a lipid or lipid-based molecule can typically bind a serum protein, such as human serum albumin (HSA). An HSA binding ligand allows for distribution of the conjugate to a target tissue, e.g., a non-kidney target tissue of the body. For example, the target tissue can be the liver, including parenchymal cells of the liver. Other molecules that can bind HSA can also be used as ligands. For example, neproxin or aspirin can be used. A lipid or lipid-based ligand can (a) increase resistance to degradation of the conjugate, (b) increase targeting or transport into a target cell or cell membrane, and/or (c) can be used to adjust binding to a serum protein, e.g., HSA. A lipid based ligand can be used to modulate, e.g., control (e.g., inhibit) the binding of the conjugate to a target tissue. For example, a lipid or lipid-based ligand that binds to HSA more strongly will be less likely to be targeted to the kidney and therefore less likely to be cleared from the body. A lipid or lipid-based ligand that binds to HSA less strongly can be used to target the conjugate to the kidney.
[0495] In one embodiment, the lipid based ligand binds HSA. For example, the ligand can bind HSA with a sufficient affinity such that distribution of the conjugate to a non-kidney tissue is enhanced. However, the affinity is typically not so strong that the HSA-ligand binding cannot be reversed.
[0496] In another embodiment, the lipid based ligand binds HSA weakly or not at all, such that distribution of the conjugate to the kidney is enhanced. Other moieties that target to kidney cells can also be used in place of or in addition to the lipid based ligand.
[0497] In another aspect, the ligand is a moiety, e.g., a vitamin, which is taken up by a target cell, e.g., a proliferating cell. These are particularly useful for treating disorders characterized by unwanted cell proliferation, e.g., of the malignant or non-malignant type, e.g., cancer cells. Exemplary vitamins include vitamin A, E, and K. Other exemplary vitamins include are B vitamin, e.g., folic acid, B12, riboflavin, biotin, pyridoxal or other vitamins or nutrients taken up by cancer cells. Also included are HSA and low density lipoprotein (LDL).
[0498] Cell Permeation Agents
[0499] In another aspect, the ligand is a cell-permeation agent, such as a helical cell-permeation agent. In one embodiment, the agent is amphipathic. An exemplary agent is a peptide such as tat or antennopedia. If the agent is a peptide, it can be modified, including a peptidylmimetic, invertomers, non-peptide or pseudo-peptide linkages, and use of D-amino acids. The helical agent is typically an α-helical agent, and can have a lipophilic and a lipophobic phase.
[0500] The ligand can be a peptide or peptidomimetic. A peptidomimetic (also referred to herein as an oligopeptidomimetic) is a molecule capable of folding into a defined three-dimensional structure similar to a natural peptide. The attachment of peptide and peptidomimetics to iRNA agents can affect pharmacokinetic distribution of the iRNA, such as by enhancing cellular recognition and absorption. The peptide or peptidomimetic moiety can be about 5-50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.
[0501] A peptide or peptidomimetic can be, for example, a cell permeation peptide, cationic peptide, amphipathic peptide, or hydrophobic peptide (e.g., consisting primarily of Tyr, Trp or Phe). The peptide moiety can be a dendrimer peptide, constrained peptide or crosslinked peptide. In another alternative, the peptide moiety can include a hydrophobic membrane translocation sequence (MTS). An exemplary hydrophobic MTS-containing peptide is RFGF having the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO:3367). An RFGF analogue (e.g., amino acid sequence AALLPVLLAAP (SEQ ID NO:3368)) containing a hydrophobic MTS can also be a targeting moiety. The peptide moiety can be a “delivery” peptide, which can carry large polar molecules including peptides, oligonucleotides, and protein across cell membranes. For example, sequences from the HIV Tat protein (GRKKRRQRRRPPQ (SEQ ID NO:3369)) and the Drosophila antennapedia protein (RQIKIWFQNRRMKWKK (SEQ ID NO: 3370)) have been found to be capable of functioning as delivery peptides. A peptide or peptidomimetic can be encoded by a random sequence of DNA, such as a peptide identified from a phage-display library, or one-bead-one-compound (OBOC) combinatorial library (Lam et al., Nature, 354:82-84, 1991). Typically, the peptide or peptidomimetic tethered to a dsRNA agent via an incorporated monomer unit is a cell targeting peptide such as an arginine-glycine-aspartic acid (RGD)-peptide, or RGD mimic. A peptide moiety can range in length from about 5 amino acids to about 40 amino acids. The peptide moieties can have a structural modification, such as to increase stability or direct conformational properties. Any of the structural modifications described below can be utilized.
[0502] An RGD peptide for use in the compositions and methods of the invention may be linear or cyclic, and may be modified, e.g., glycosylated or methylated, to facilitate targeting to a specific tissue(s). RGD-containing peptides and peptidiomimemtics may include D-amino acids, as well as synthetic RGD mimics. In addition to RGD, one can use other moieties that target the integrin ligand. Preferred conjugates of this ligand target PECAM-1 or VEGF.
[0503] An RGD peptide moiety can be used to target a particular cell type, e.g., a tumor cell, such as an endothelial tumor cell or a breast cancer tumor cell (Zitzmann et al., Cancer Res., 62:5139-43, 2002). An RGD peptide can facilitate targeting of an dsRNA agent to tumors of a variety of other tissues, including the lung, kidney, spleen, or liver (Aoki et al., Cancer Gene Therapy 8:783-787, 2001). Typically, the RGD peptide will facilitate targeting of an iRNA agent to the kidney. The RGD peptide can be linear or cyclic, and can be modified, e.g., glycosylated or methylated to facilitate targeting to specific tissues. For example, a glycosylated RGD peptide can deliver a iRNA agent to a tumor cell expressing α.sub.Vβ.sub.3 (Haubner et al., Jour. Nucl. Med., 42:326-336, 2001).
[0504] A “cell permeation peptide” is capable of permeating a cell, e.g., a microbial cell, such as a bacterial or fungal cell, or a mammalian cell, such as a human cell. A microbial cell-permeating peptide can be, for example, an α-helical linear peptide (e.g., LL-37 or Ceropin P1), a disulfide bond-containing peptide (e.g., α-defensin, β-defensin or bactenecin), or a peptide containing only one or two dominating amino acids (e.g., PR-39 or indolicidin). A cell permeation peptide can also include a nuclear localization signal (NLS). For example, a cell permeation peptide can be a bipartite amphipathic peptide, such as MPG, which is derived from the fusion peptide domain of HIV-1 gp41 and the NLS of SV40 large T antigen (Simeoni et al., Nucl. Acids Res. 31:2717-2724, 2003).
[0505] Carbohydrate Conjugates
[0506] In some embodiments of the compositions and methods of the invention, an iRNA oligonucleotide further comprises a carbohydrate. The carbohydrate conjugated iRNA are advantageous for the in vivo delivery of nucleic acids, as well as compositions suitable for in vivo therapeutic use, as described herein. As used herein, “carbohydrate” refers to a compound which is either a carbohydrate per se made up of one or more monosaccharide units having at least 6 carbon atoms (which can be linear, branched or cyclic) with an oxygen, nitrogen or sulfur atom bonded to each carbon atom; or a compound having as a part thereof a carbohydrate moiety made up of one or more monosaccharide units each having at least six carbon atoms (which can be linear, branched or cyclic), with an oxygen, nitrogen or sulfur atom bonded to each carbon atom. Representative carbohydrates include the sugars (mono-, di-, tri- and oligosaccharides containing from about 4, 5, 6, 7, 8, or 9 monosaccharide units), and polysaccharides such as starches, glycogen, cellulose and polysaccharide gums. Specific monosaccharides include C5 and above (e.g., C5, C6, C7, or C8) sugars; di- and trisaccharides include sugars having two or three monosaccharide units (e.g., C5, C6, C7, or C8).
[0507] In one embodiment, a carbohydrate conjugate comprises a monosaccharide. In one embodiment, the monosaccharide is an N-acetylgalactosamine (GalNAc). GalNAc conjugates are described, for example, in U.S. Pat. No. 8,106,022, the entire content of which is hereby incorporated herein by reference. In some embodiments, the GalNAc conjugate serves as a ligand that targets the iRNA to particular cells. In some embodiments, the GalNAc conjugate targets the iRNA to liver cells, e.g., by serving as a ligand for the asialoglycoprotein receptor of liver cells (e.g., hepatocytes).
[0508] In some embodiments, the carbohydrate conjugate comprises one or more GalNAc derivatives. The GalNAc derivatives may be attached via a linker, e.g., a bivalent or trivalent branched linker. In some embodiments the GalNAc conjugate is conjugated to the 3′ end of the sense strand. In some embodiments, the GalNAc conjugate is conjugated to the iRNA agent (e.g., to the 3′ end of the sense strand) via a linker, e.g., a linker as described herein.
[0509] In some embodiments, the GalNAc conjugate is
##STR00008##
[0510] In some embodiments, the RNAi agent is attached to the carbohydrate conjugate via a linker as shown in the following schematic, wherein X is O or S
##STR00009##
[0511] In some embodiments, the RNAi agent is conjugated to L96 as defined in Table 1 and shown below
##STR00010##
[0512] In some embodiments, a carbohydrate conjugate for use in the compositions and methods of the invention is selected from the group consisting of:
##STR00011## ##STR00012## ##STR00013## ##STR00014## ##STR00015##
[0513] Another representative carbohydrate conjugate for use in the embodiments described herein includes, but is not limited to,
##STR00016##
[0514] (Formula XXIII), when one of X or Y is an oligonucleotide, the other is a hydrogen.
[0515] In some embodiments, the carbohydrate conjugate further comprises one or more additional ligands as described above, such as, but not limited to, a PK modulator and/or a cell permeation peptide.
[0516] In one embodiment, an iRNA of the invention is conjugated to a carbohydrate through a linker. Non-limiting examples of iRNA carbohydrate conjugates with linkers of the compositions and methods of the invention include, but are not limited to,
##STR00017## ##STR00018## ##STR00019## ##STR00020## ##STR00021## ##STR00022## ##STR00023##
when one of X or Y is an oligonucleotide, the other is a hydrogen.
[0517] Linkers
[0518] In some embodiments, the conjugate or ligand described herein can be attached to an iRNA oligonucleotide with various linkers that can be cleavable or non-cleavable.
[0519] The term “linker” or “linking group” means an organic moiety that connects two parts of a compound, e.g., covalently attaches two parts of a compound. Linkers typically comprise a direct bond or an atom such as oxygen or sulfur, a unit such as NR8, C(O), C(O)NH, SO, SO.sub.2, SO.sub.2NH or a chain of atoms, such as, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkynylheteroarylalkyl, alkynylheteroarylalkenyl, alkynylheteroarylalkynyl, alkylheterocyclylalkyl, alkylheterocyclylalkenyl, alkylhererocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl, alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylhereroaryl, which one or more methylenes can be interrupted or terminated by O, S, S(O), SO.sub.2, N(R8), C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocyclic; where R8 is hydrogen, acyl, aliphatic or substituted aliphatic. In one embodiment, the linker is between about 1-24 atoms, 2-24, 3-24, 4-24, 5-24, 6-24, 6-18, 7-18, 8-18 atoms, 7-17, 8-17, 6-16, 7-16, or 8-16 atoms.
[0520] In one embodiment, a dsRNA of the invention is conjugated to a bivalent or trivalent branched linker selected from the group of structures shown in any of formula (XXXI)-(XXXIV):
##STR00024##
wherein:
q2A, q2B, q3A, q3B, q4A, q4B, q5A, q5B and q5C represent independently for each occurrence 0-20 and wherein the repeating unit can be the same or different;
P.sup.2A, P.sup.2B, P.sup.3A, P.sup.3B, P.sup.4A, P.sup.4B, P.sup.5A, P.sup.5B, P.sup.5C, T.sup.2A, T.sup.2B, T.sup.3A, T.sup.3B, T.sup.4A, T.sup.4B, T.sup.4A, T.sup.5B, T.sup.5C are each independently for each occurrence absent, CO, NH, O, S, OC(O), NHC(O), CH.sub.2, CH.sub.2NH or CH.sub.2O;
Q.sup.2A, Q.sup.2B, Q.sup.3A, Q.sup.3B, Q.sup.4A, Q.sup.4B, Q.sup.5A, Q.sup.5B, Q.sup.5C are independently for each occurrence absent, alkylene, substituted alkylene wherein one or more methylenes can be interrupted or terminated by one or more of O, S, S(O), SO.sub.2, N(R.sup.N), C(R′)═C(R″), CC or C(O);
R.sup.2A, R.sup.2B, R.sup.3A, R.sup.3B, R.sup.4A, R.sup.4B, R.sup.5A, R.sup.5B, R.sup.5C are each independently for each occurrence absent, NH, O, S, CH.sub.2, C(O)O, C(O)NH, NHCH(R.sup.a)C(O), —C(O)—CH(R.sup.a)—NH—, CO, CH═N—O,
##STR00025##
heterocyclyl;
[0521] L.sup.2A, L.sup.2B, L.sup.3A, L.sup.3B, L.sup.4A, L.sup.4B, L.sup.5A, L.sup.5B and L.sup.5C represent the ligand; i.e. each independently for each occurrence a monosaccharide (such as GalNAc), disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide; and R.sup.a is H or amino acid side chain. Trivalent conjugating GalNAc derivatives are particularly useful for use with RNAi agents for inhibiting the expression of a target gene, such as those of formula (XXXV):
##STR00026## [0522] wherein L.sup.5A, L.sup.5B and L.sup.5C represent a monosaccharide, such as GalNAc derivative.
[0523] Examples of suitable bivalent and trivalent branched linker groups conjugating GalNAc derivatives include, but are not limited to, the structures recited above as formulas II, VII, XI, X, and XIII.
[0524] A cleavable linking group is one which is sufficiently stable outside the cell, but which upon entry into a target cell is cleaved to release the two parts the linker is holding together. In a preferred embodiment, the cleavable linking group is cleaved at least about 10 times, 20, times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times or more, or at least about 100 times faster in a target cell or under a first reference condition (which can, e.g., be selected to mimic or represent intracellular conditions) than in the blood of a subject, or under a second reference condition (which can, e.g., be selected to mimic or represent conditions found in the blood or serum).
[0525] Cleavable linking groups are susceptible to cleavage agents, e.g., pH, redox potential or the presence of degradative molecules. Generally, cleavage agents are more prevalent or found at higher levels or activities inside cells than in serum or blood. Examples of such degradative agents include: redox agents which are selected for particular substrates or which have no substrate specificity, including, e.g., oxidative or reductive enzymes or reductive agents such as mercaptans, present in cells, that can degrade a redox cleavable linking group by reduction; esterases; endosomes or agents that can create an acidic environment, e.g., those that result in a pH of five or lower; enzymes that can hydrolyze or degrade an acid cleavable linking group by acting as a general acid, peptidases (which can be substrate specific), and phosphatases.
[0526] A cleavable linkage group, such as a disulfide bond can be susceptible to pH. The pH of human serum is 7.4, while the average intracellular pH is slightly lower, ranging from about 7.1-7.3. Endosomes have a more acidic pH, in the range of 5.5-6.0, and lysosomes have an even more acidic pH at around 5.0. Some linkers will have a cleavable linking group that is cleaved at a preferred pH, thereby releasing a cationic lipid from the ligand inside the cell, or into the desired compartment of the cell.
[0527] A linker can include a cleavable linking group that is cleavable by a particular enzyme. The type of cleavable linking group incorporated into a linker can depend on the cell to be targeted. For example, a liver-targeting ligand can be linked to a cationic lipid through a linker that includes an ester group. Liver cells are rich in esterases, and therefore the linker will be cleaved more efficiently in liver cells than in cell types that are not esterase-rich. Other cell-types rich in esterases include cells of the lung, renal cortex, and testis.
[0528] Linkers that contain peptide bonds can be used when targeting cell types rich in peptidases, such as liver cells and synoviocytes.
[0529] In general, the suitability of a candidate cleavable linking group can be evaluated by testing the ability of a degradative agent (or condition) to cleave the candidate linking group. It will also be desirable to also test the candidate cleavable linking group for the ability to resist cleavage in the blood or when in contact with other non-target tissue. Thus, one can determine the relative susceptibility to cleavage between a first and a second condition, where the first is selected to be indicative of cleavage in a target cell and the second is selected to be indicative of cleavage in other tissues or biological fluids, e.g., blood or serum. The evaluations can be carried out in cell free systems, in cells, in cell culture, in organ or tissue culture, or in whole animals. It can be useful to make initial evaluations in cell-free or culture conditions and to confirm by further evaluations in whole animals. In preferred embodiments, useful candidate compounds are cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions).
[0530] Redox Cleavable Linking Groups
[0531] In one embodiment, a cleavable linking group is a redox cleavable linking group that is cleaved upon reduction or oxidation. An example of reductively cleavable linking group is a disulphide linking group (—S—S—). To determine if a candidate cleavable linking group is a suitable “reductively cleavable linking group,” or for example is suitable for use with a particular iRNA moiety and particular targeting agent one can look to methods described herein. For example, a candidate can be evaluated by incubation with dithiothreitol (DTT), or other reducing agent using reagents know in the art, which mimic the rate of cleavage which would be observed in a cell, e.g., a target cell. The candidates can also be evaluated under conditions which are selected to mimic blood or serum conditions. In one, candidate compounds are cleaved by at most about 10% in the blood. In other embodiments, useful candidate compounds are degraded at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood (or under in vitro conditions selected to mimic extracellular conditions). The rate of cleavage of candidate compounds can be determined using standard enzyme kinetics assays under conditions chosen to mimic intracellular media and compared to conditions chosen to mimic extracellular media.
[0532] Phosphate-Based Cleavable Linking Groups
[0533] In another embodiment, a cleavable linker comprises a phosphate-based cleavable linking group. A phosphate-based cleavable linking group is cleaved by agents that degrade or hydrolyze the phosphate group. An example of an agent that cleaves phosphate groups in cells are enzymes such as phosphatases in cells. Examples of phosphate-based linking groups are —O—P(O)(ORk)-O—, —O—P(S)(ORk)-O—, —O—P(S)(SRk)-O—, —S—P(O)(ORk)-O—, —O—P(O)(ORk)-S—, —S—P(O)(ORk)-S—, —O—P(S)(ORk)-S—, —S—P(S)(ORk)-O—, —O—P(O)(Rk)-O—, —O—P(S)(Rk)-O—, —S—P(O)(Rk)-O—, —S—P(S)(Rk)-O—, —S—P(O)(Rk)-S—, —O—P(S)(Rk)-S—. Preferred embodiments are —O—P(O)(OH)—O—, —O—P(S)(OH)—O—, —O—P(S)(SH)—O—, —S—P(O)(OH)—O—, —O—P(O)(OH)—S—, —S—P(O)(OH)—S—, —O—P(S)(OH)—S—, —S—P(S)(OH)—O—, —O—P(O)(H)—O—, —O—P(S)(H)—O—, —S—P(O)(H)—O, —S—P(S)(H)—O—, —S—P(O)(H)—S—, —O—P(S)(H)—S—. A preferred embodiment is —O—P(O)(OH)—O—. These candidates can be evaluated using methods analogous to those described above.
[0534] Acid Cleavable Linking Groups
[0535] In another embodiment, a cleavable linker comprises an acid cleavable linking group. An acid cleavable linking group is a linking group that is cleaved under acidic conditions. In preferred embodiments acid cleavable linking groups are cleaved in an acidic environment with a pH of about 6.5 or lower (e.g., about 6.0, 5.75, 5.5, 5.25, 5.0, or lower), or by agents such as enzymes that can act as a general acid. In a cell, specific low pH organelles, such as endosomes and lysosomes can provide a cleaving environment for acid cleavable linking groups. Examples of acid cleavable linking groups include but are not limited to hydrazones, esters, and esters of amino acids. Acid cleavable groups can have the general formula —C═NN—, C(O)O, or —OC(O). A preferred embodiment is when the carbon attached to the oxygen of the ester (the alkoxy group) is an aryl group, substituted alkyl group, or tertiary alkyl group such as dimethyl pentyl or t-butyl. These candidates can be evaluated using methods analogous to those described above.
[0536] Ester-Based Cleavable Linking Groups
[0537] In another embodiment, a cleavable linker comprises an ester-based cleavable linking group. An ester-based cleavable linking group is cleaved by enzymes such as esterases and amidases in cells. Examples of ester-based cleavable linking groups include but are not limited to esters of alkylene, alkenylene and alkynylene groups. Ester cleavable linking groups have the general formula —C(O)O—, or —OC(O)—. These candidates can be evaluated using methods analogous to those described above.
[0538] Peptide-Based Cleavable Linking Groups
[0539] In yet another embodiment, a cleavable linker comprises a peptide-based cleavable linking group. A peptide-based cleavable linking group is cleaved by enzymes such as peptidases and proteases in cells. Peptide-based cleavable linking groups are peptide bonds formed between amino acids to yield oligopeptides (e.g., dipeptides, tripeptides etc.) and polypeptides. Peptide-based cleavable groups do not include the amide group (—C(O)NH—). The amide group can be formed between any alkylene, alkenylene or alkynelene. A peptide bond is a special type of amide bond formed between amino acids to yield peptides and proteins. The peptide based cleavage group is generally limited to the peptide bond (i.e., the amide bond) formed between amino acids yielding peptides and proteins and does not include the entire amide functional group. Peptide-based cleavable linking groups have the general formula —NHCHRAC(O)NHCHRBC(O)—, where RA and RB are the R groups of the two adjacent amino acids. These candidates can be evaluated using methods analogous to those described above.
[0540] Representative U.S. patents that teach the preparation of RNA conjugates include, but are not limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941; 6,294,664; 6,320,017; 6,576,752; 6,783,931; 6,900,297; 7,037,646; 8,106,022, the entire contents of each of which is herein incorporated by reference.
[0541] It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single compound or even at a single nucleoside within an iRNA. The present invention also includes iRNA compounds that are chimeric compounds.
[0542] “Chimeric” iRNA compounds, or “chimeras,” in the context of the present invention, are iRNA compounds, e.g., dsRNAs, that contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of a dsRNA compound. These iRNAs typically contain at least one region wherein the RNA is modified so as to confer upon the iRNA increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid. An additional region of the iRNA may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of iRNA inhibition of gene expression. Consequently, comparable results can often be obtained with shorter iRNAs when chimeric dsRNAs are used, compared to phosphorothioate deoxy dsRNAs hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.
[0543] In certain instances, the RNA of an iRNA can be modified by a non-ligand group. A number of non-ligand molecules have been conjugated to iRNAs in order to enhance the activity, cellular distribution or cellular uptake of the iRNA, and procedures for performing such conjugations are available in the scientific literature. Such non-ligand moieties have included lipid moieties, such as cholesterol (Kubo, T. et al., Biochem. Biophys. Res. Comm., 2007, 365(1):54-61; Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86:6553), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4:1053), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3:2765), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10:111; Kabanov et al., FEBS Lett., 1990, 259:327; Svinarchuk et al., Biochimie, 1993, 75:49), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651; Shea et al., Nucl. Acids Res., 1990, 18:3777), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923). Representative United States patents that teach the preparation of such RNA conjugates have been listed above. Typical conjugation protocols involve the synthesis of an RNAs bearing an aminolinker at one or more positions of the sequence. The amino group is then reacted with the molecule being conjugated using appropriate coupling or activating reagents. The conjugation reaction may be performed either with the RNA still bound to the solid support or following cleavage of the RNA, in solution phase. Purification of the RNA conjugate by HPLC typically affords the pure conjugate.
[0544] Delivery of iRNA The delivery of an iRNA to a subject in need thereof can be achieved in a number of different ways. In vivo delivery can be performed directly by administering a composition comprising an iRNA, e.g. a dsRNA, to a subject. Alternatively, delivery can be performed indirectly by administering one or more vectors that encode and direct the expression of the iRNA. These alternatives are discussed further below.
[0545] Direct Delivery
[0546] In general, any method of delivering a nucleic acid molecule can be adapted for use with an iRNA (see e.g., Akhtar S. and Julian R L. (1992) Trends Cell. Biol. 2(5):139-144 and WO94/02595, which are incorporated herein by reference in their entireties). However, there are three factors that are important to consider in order to successfully deliver an iRNA molecule in vivo: (a) biological stability of the delivered molecule, (2) preventing non-specific effects, and (3) accumulation of the delivered molecule in the target tissue. The non-specific effects of an iRNA can be minimized by local administration, for example by direct injection or implantation into a tissue (as a non-limiting example, a tumor) or topically administering the preparation. Local administration to a treatment site maximizes local concentration of the agent, limits the exposure of the agent to systemic tissues that may otherwise be harmed by the agent or that may degrade the agent, and permits a lower total dose of the iRNA molecule to be administered. Several studies have shown successful knockdown of gene products when an iRNA is administered locally. For example, intraocular delivery of a VEGF dsRNA by intravitreal injection in cynomolgus monkeys (Tolentino, M J et al (2004) Retina 24:132-138) and subretinal injections in mice (Reich, S J., et al (2003) Mol. Vis. 9:210-216) were both shown to prevent neovascularization in an experimental model of age-related macular degeneration. In addition, direct intratumoral injection of a dsRNA in mice reduces tumor volume (Pille, J., et al (2005) Mol. Ther. 11:267-274) and can prolong survival of tumor-bearing mice (Kim, W J., et al (2006) Mol. Ther. 14:343-350; Li, S., et al (2007) Mol. Ther. 15:515-523). RNA interference has also shown success with local delivery to the CNS by direct injection (Dorn, G., et al. (2004) Nucleic Acids 32:e49; Tan, P H., et al (2005) Gene Ther. 12:59-66; Makimura, H., et al (2002) BMC Neurosci. 3:18; Shishkina, G T., et al (2004) Neuroscience 129:521-528; Thakker, E R., et al (2004) Proc. Natl. Acad. Sci. U.S.A. 101:17270-17275; Akaneya, Y., et al (2005) J. Neurophysiol. 93:594-602) and to the lungs by intranasal administration (Howard, K A., et al (2006) Mol. Ther. 14:476-484; Zhang, X., et al (2004) J. Biol. Chem. 279:10677-10684; Bitko, V., et al (2005) Nat. Med. 11:50-55). For administering an iRNA systemically for the treatment of a disease, the RNA can be modified or alternatively delivered using a drug delivery system; both methods act to prevent the rapid degradation of the dsRNA by endo- and exo-nucleases in vivo.
[0547] Modification of the RNA or the pharmaceutical carrier can also permit targeting of the iRNA composition to the target tissue and avoid undesirable off-target effects. iRNA molecules can be modified by chemical conjugation to other groups, e.g., a lipid or carbohydrate group as described herein. Such conjugates can be used to target iRNA to particular cells, e.g., liver cells, e.g., hepatocytes. For example, GalNAc conjugates or lipid (e.g., LNP) formulations can be used to target iRNA to particular cells, e.g., liver cells, e.g., hepatocytes.
[0548] Lipophilic groups such as cholesterol to enhance cellular uptake and prevent degradation.
[0549] For example, an iRNA directed against ApoB conjugated to a lipophilic cholesterol moiety was injected systemically into mice and resulted in knockdown of apoB mRNA in both the liver and jejunum (Soutschek, J., et al (2004) Nature 432:173-178). Conjugation of an iRNA to an aptamer has been shown to inhibit tumor growth and mediate tumor regression in a mouse model of prostate cancer (McNamara, J O., et al (2006) Nat. Biotechnol. 24:1005-1015). In an alternative embodiment, the iRNA can be delivered using drug delivery systems such as a nanoparticle, a dendrimer, a polymer, liposomes, or a cationic delivery system. Positively charged cationic delivery systems facilitate binding of an iRNA molecule (negatively charged) and also enhance interactions at the negatively charged cell membrane to permit efficient uptake of an iRNA by the cell. Cationic lipids, dendrimers, or polymers can either be bound to an iRNA, or induced to form a vesicle or micelle (see e.g., Kim S H., et al (2008) Journal of Controlled Release 129(2):107-116) that encases an iRNA. The formation of vesicles or micelles further prevents degradation of the iRNA when administered systemically. Methods for making and administering cationic-iRNA complexes are well within the abilities of one skilled in the art (see e.g., Sorensen, D R., et al (2003) J. Mol. Biol 327:761-766; Verma, U N., et al (2003) Clin. Cancer Res. 9:1291-1300; Arnold, A S et al (2007) J. Hypertens. 25:197-205, which are incorporated herein by reference in their entirety). Some non-limiting examples of drug delivery systems useful for systemic delivery of iRNAs include DOTAP (Sorensen, D R., et al (2003), supra; Verma, U N., et al (2003), supra), Oligofectamine, “solid nucleic acid lipid particles” (Zimmermann, T S., et al (2006) Nature 441:111-114), cardiolipin (Chien, P Y., et al (2005) Cancer Gene Ther. 12:321-328; Pal, A., et al (2005) Int J. Oncol. 26:1087-1091), polyethyleneimine (Bonnet M E., et al (2008) Pharm. Res. August 16 Epub ahead of print; Aigner, A. (2006) J. Biomed. Biotechnol. 71659), Arg-Gly-Asp (RGD) peptides (Liu, S. (2006) Mol. Pharm. 3:472-487), and polyamidoamines (Tomalia, D A., et al (2007) Biochem. Soc. Trans. 35:61-67; Yoo, H., et al (1999) Pharm. Res. 16:1799-1804). In some embodiments, an iRNA forms a complex with cyclodextrin for systemic administration. Methods for administration and pharmaceutical compositions of iRNAs and cyclodextrins can be found in U.S. Pat. No. 7,427,605, which is herein incorporated by reference in its entirety.
[0550] Vector Encoded iRNAs
[0551] In another aspect, iRNA targeting the ALAS1 gene can be expressed from transcription units inserted into DNA or RNA vectors (see, e.g., Couture, A, et al., TIG. (1996), 12:5-10; Skillern, A., et al., International PCT Publication No. WO 00/22113, Conrad, International PCT Publication No. WO 00/22114, and Conrad, U.S. Pat. No. 6,054,299). Expression can be transient (on the order of hours to weeks) or sustained (weeks to months or longer), depending upon the specific construct used and the target tissue or cell type. These transgenes can be introduced as a linear construct, a circular plasmid, or a viral vector, which can be an integrating or non-integrating vector. The transgene can also be constructed to permit it to be inherited as an extrachromosomal plasmid (Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995) 92:1292).
[0552] The individual strand or strands of an iRNA can be transcribed from a promoter on an expression vector. Where two separate strands are to be expressed to generate, for example, a dsRNA, two separate expression vectors can be co-introduced (e.g., by transfection or infection) into a target cell. Alternatively each individual strand of a dsRNA can be transcribed by promoters both of which are located on the same expression plasmid. In one embodiment, a dsRNA is expressed as an inverted repeat joined by a linker polynucleotide sequence such that the dsRNA has a stem and loop structure.
[0553] An iRNA expression vector is typically a DNA plasmid or viral vector. An expression vector compatible with eukaryotic cells, e.g., with vertebrate cells, can be used to produce recombinant constructs for the expression of an iRNA as described herein. Eukaryotic cell expression vectors are well known in the art and are available from a number of commercial sources. Typically, such vectors contain convenient restriction sites for insertion of the desired nucleic acid segment. Delivery of iRNA expressing vectors can be systemic, such as by intravenous or intramuscular administration, by administration to target cells ex-planted from the patient followed by reintroduction into the patient, or by any other means that allows for introduction into a desired target cell.
[0554] An iRNA expression plasmid can be transfected into a target cell as a complex with a cationic lipid carrier (e.g., Oligofectamine) or a non-cationic lipid-based carrier (e.g., Transit-TKO™). Multiple lipid transfections for iRNA-mediated knockdowns targeting different regions of a target RNA over a period of a week or more are also contemplated by the invention. Successful introduction of vectors into host cells can be monitored using various known methods. For example, transient transfection can be signaled with a reporter, such as a fluorescent marker, such as Green Fluorescent Protein (GFP). Stable transfection of cells ex vivo can be ensured using markers that provide the transfected cell with resistance to specific environmental factors (e.g., antibiotics and drugs), such as hygromycin B resistance.
[0555] Viral vector systems which can be utilized with the methods and compositions described herein include, but are not limited to, (a) adenovirus vectors; (b) retrovirus vectors, including but not limited to lentiviral vectors, moloney murine leukemia virus, etc.; (c) adeno-associated virus vectors; (d) herpes simplex virus vectors; (e) SV40 vectors; (f) polyoma virus vectors; (g) papilloma virus vectors; (h) picornavirus vectors; (i) pox virus vectors such as an orthopox, e.g., vaccinia virus vectors or avipox, e.g. canary pox or fowl pox; and (j) a helper-dependent or gutless adenovirus. Replication-defective viruses can also be advantageous. Different vectors will or will not become incorporated into the cells' genome. The constructs can include viral sequences for transfection, if desired. Alternatively, the construct may be incorporated into vectors capable of episomal replication, e.g EPV and EBV vectors. Constructs for the recombinant expression of an iRNA will generally require regulatory elements, e.g., promoters, enhancers, etc., to ensure the expression of the iRNA in target cells. Other aspects to consider for vectors and constructs are further described below.
[0556] Vectors useful for the delivery of an iRNA will include regulatory elements (promoter, enhancer, etc.) sufficient for expression of the iRNA in the desired target cell or tissue. The regulatory elements can be chosen to provide either constitutive or regulated/inducible expression.
[0557] Expression of the iRNA can be precisely regulated, for example, by using an inducible regulatory sequence that is sensitive to certain physiological regulators, e.g., circulating glucose levels, or hormones (Docherty et al., 1994, FASEB J. 8:20-24). Such inducible expression systems, suitable for the control of dsRNA expression in cells or in mammals include, for example, regulation by ecdysone, by estrogen, progesterone, tetracycline, chemical inducers of dimerization, and isopropyl-β-D1-thiogalactopyranoside (IPTG). A person skilled in the art would be able to choose the appropriate regulatory/promoter sequence based on the intended use of the iRNA transgene.
[0558] In a specific embodiment, viral vectors that contain nucleic acid sequences encoding an iRNA can be used. For example, a retroviral vector can be used (see Miller et al., Meth. Enzymol. 217:581-599 (1993)). These retroviral vectors contain the components necessary for the correct packaging of the viral genome and integration into the host cell DNA. The nucleic acid sequences encoding an iRNA are cloned into one or more vectors, which facilitates delivery of the nucleic acid into a patient. More detail about retroviral vectors can be found, for example, in Boesen et al., Biotherapy 6:291-302 (1994), which describes the use of a retroviral vector to deliver the mdr1 gene to hematopoietic stem cells in order to make the stem cells more resistant to chemotherapy. Other references illustrating the use of retroviral vectors in gene therapy are: Clowes et al., J. Clin. Invest. 93:644-651 (1994); Kiem et al., Blood 83:1467-1473 (1994); Salmons and Gunzberg, Human Gene Therapy 4:129-141 (1993); and Grossman and Wilson, Curr. Opin. in Genetics and Devel. 3:110-114 (1993). Lentiviral vectors contemplated for use include, for example, the HIV based vectors described in U.S. Pat. Nos. 6,143,520; 5,665,557; and 5,981,276, which are herein incorporated by reference.
[0559] Adenoviruses are also contemplated for use in delivery of iRNAs. Adenoviruses are especially attractive vehicles, e.g., for delivering genes to respiratory epithelia. Adenoviruses naturally infect respiratory epithelia where they cause a mild disease. Other targets for adenovirus-based delivery systems are liver, the central nervous system, endothelial cells, and muscle. Adenoviruses have the advantage of being capable of infecting non-dividing cells. Kozarsky and Wilson, Current Opinion in Genetics and Development 3:499-503 (1993) present a review of adenovirus-based gene therapy. Bout et al., Human Gene Therapy 5:3-10 (1994) demonstrated the use of adenovirus vectors to transfer genes to the respiratory epithelia of rhesus monkeys. Other instances of the use of adenoviruses in gene therapy can be found in Rosenfeld et al., Science 252:431-434 (1991); Rosenfeld et al., Cell 68:143-155 (1992); Mastrangeli et al., J. Clin. Invest. 91:225-234 (1993); PCT Publication WO94/12649; and Wang, et al., Gene Therapy 2:775-783 (1995). A suitable AV vector for expressing an iRNA featured in the invention, a method for constructing the recombinant AV vector, and a method for delivering the vector into target cells, are described in Xia H et al. (2002), Nat. Biotech. 20: 1006-1010.
[0560] Use of Adeno-associated virus (AAV) vectors is also contemplated (Walsh et al., Proc. Soc. Exp. Biol. Med. 204:289-300 (1993); U.S. Pat. No. 5,436,146). In one embodiment, the iRNA can be expressed as two separate, complementary single-stranded RNA molecules from a recombinant AAV vector having, for example, either the U6 or H1 RNA promoters, or the cytomegalovirus (CMV) promoter. Suitable AAV vectors for expressing the dsRNA featured in the invention, methods for constructing the recombinant AV vector, and methods for delivering the vectors into target cells are described in Samulski R et al. (1987), J. Virol. 61: 3096-3101; Fisher K J et al. (1996), J. Virol, 70: 520-532; Samulski R et al. (1989), J. Virol. 63: 3822-3826; U.S. Pat. Nos. 5,252,479; 5,139,941; International Patent Application No. WO 94/13788; and International Patent Application No. WO 93/24641, the entire disclosures of which are herein incorporated by reference.
[0561] Another typical viral vector is a pox virus such as a vaccinia virus, for example an attenuated vaccinia such as Modified Virus Ankara (MVA) or NYVAC, an avipox such as fowl pox or canary pox.
[0562] The tropism of viral vectors can be modified by pseudotyping the vectors with envelope proteins or other surface antigens from other viruses, or by substituting different viral capsid proteins, as appropriate. For example, lentiviral vectors can be pseudotyped with surface proteins from vesicular stomatitis virus (VSV), rabies, Ebola, Mokola, and the like. AAV vectors can be made to target different cells by engineering the vectors to express different capsid protein serotypes; see, e.g., Rabinowitz J E et al. (2002), J Virol 76:791-801, the entire disclosure of which is herein incorporated by reference.
[0563] The pharmaceutical preparation of a vector can include the vector in an acceptable diluent, or can include a slow release matrix in which the gene delivery vehicle is imbedded. Alternatively, where the complete gene delivery vector can be produced intact from recombinant cells, e.g., retroviral vectors, the pharmaceutical preparation can include one or more cells which produce the gene delivery system.
III. Pharmaceutical Compositions Containing iRNA
[0564] In one embodiment, the invention provides pharmaceutical compositions containing an iRNA, as described herein, and a pharmaceutically acceptable carrier. The pharmaceutical composition containing the iRNA is useful for treating a disease or disorder related to the expression or activity of an ALAS1 gene (e.g., a disorder involving the porphyrin pathway). Such pharmaceutical compositions are formulated based on the mode of delivery. For example, compositions can be formulated for systemic administration via parenteral delivery, e.g., by intravenous (IV) delivery. In some embodiments, a composition provided herein (e.g., an LNP formulation) is formulated for intravenous delivery. In some embodiments, a composition provided herein (e.g., a composition comprising a GalNAc conjugate) is formulated for subcutaneous delivery.
[0565] The pharmaceutical compositions featured herein are administered in a dosage sufficient to inhibit expression of an ALAS1 gene. In general, a suitable dose of iRNA will be in the range of 0.01 to 200.0 milligrams per kilogram body weight of the recipient per day, generally in the range of 1 to 50 mg per kilogram body weight per day. For example, the dsRNA can be administered at 0.05 mg/kg, 0.5 mg/kg, 1 mg/kg, 1.5 mg/kg, 2 mg/kg, 3 mg/kg, 10 mg/kg, 20 mg/kg, 30 mg/kg, 40 mg/kg, or 50 mg/kg per single dose. The pharmaceutical composition may be administered once daily, or the iRNA may be administered as two, three, or more sub-doses at appropriate intervals throughout the day or even using continuous infusion or delivery through a controlled release formulation. In that case, the iRNA contained in each sub-dose must be correspondingly smaller in order to achieve the total daily dosage. The dosage unit can also be compounded for delivery over several days, e.g., using a conventional sustained release formulation which provides sustained release of the iRNA over a several day period. Sustained release formulations are well known in the art and are particularly useful for delivery of agents at a particular site, such as can be used with the agents of the present invention. In this embodiment, the dosage unit contains a corresponding multiple of the daily dose.
[0566] The effect of a single dose on ALAS1 levels can be long lasting, such that subsequent doses are administered at not more than 3, 4, or 5 day intervals, or at not more than 1, 2, 3, or 4 week intervals.
[0567] The skilled artisan will appreciate that certain factors may influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of a composition can include a single treatment or a series of treatments. Estimates of effective dosages and in vivo half-lives for the individual iRNAs encompassed by the invention can be made using conventional methodologies or on the basis of in vivo testing using an appropriate animal model, as described elsewhere herein.
[0568] Advances in mouse genetics have generated a number of mouse models for the study of various human diseases, such as pathological processes related to ALAS1 expression (e.g., pathological processes involving porphyrins or defects in the porphyrin pathway, such as, for example, porphyrias). Such models can be used for in vivo testing of iRNA, as well as for determining a therapeutically effective dose and/or an effective dosing regimen.
[0569] A suitable mouse model is, for example, a mouse containing a transgene expressing human ALAS1. Mice that have knock-in mutations (e.g., mutations that are associated with acute hepatic porphyrias in humans) can be used to determine the therapeutically effective dosage and/or duration of administration of ALAS1 siRNA. The present invention also includes pharmaceutical compositions and formulations that include the iRNA compounds featured in the invention. The pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (e.g., by a transdermal patch), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal, oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subdermal, e.g., via an implanted device; or intracranial, e.g., by intraparenchymal, intrathecal or intraventricular, administration.
[0570] The iRNA can be delivered in a manner to target a particular tissue, such as a tissue that produces erythrocytes. For example, the iRNA can be delivered to bone marrow, liver (e.g., hepatocyes of liver), lymph glands, spleen, lungs (e.g., pleura of lungs) or spine. In one embodiment, the iRNA is delivered to bone marrow.
[0571] Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves and the like may also be useful. Suitable topical formulations include those in which the iRNAs featured in the invention are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Suitable lipids and liposomes include neutral (e.g., dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g., dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g., dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA). iRNAs featured in the invention may be encapsulated within liposomes or may form complexes thereto, in particular to cationic liposomes. Alternatively, iRNAs may be complexed to lipids, in particular to cationic lipids. Suitable fatty acids and esters include but are not limited to arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a C.sub.1-20 alkyl ester (e.g., isopropylmyristate IPM), monoglyceride, diglyceride or pharmaceutically acceptable salt thereof. Topical formulations are described in detail in U.S. Pat. No. 6,747,014, which is incorporated herein by reference.
[0572] Liposomal Formulations
[0573] There are many organized surfactant structures besides microemulsions that have been studied and used for the formulation of drugs. These include monolayers, micelles, bilayers and vesicles. Vesicles, such as liposomes, have attracted great interest because of their specificity and the duration of action they offer from the standpoint of drug delivery. As used in the present invention, the term “liposome” means a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayers.
[0574] Liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the composition to be delivered. Cationic liposomes possess the advantage of being able to fuse to the cell wall. Non-cationic liposomes, although not able to fuse as efficiently with the cell wall, are taken up by macrophages in vivo.
[0575] In order to traverse intact mammalian skin, lipid vesicles must pass through a series of fine pores, each with a diameter less than 50 nm, under the influence of a suitable transdermal gradient. Therefore, it is desirable to use a liposome which is highly deformable and able to pass through such fine pores.
[0576] Further advantages of liposomes include; liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water and lipid soluble drugs; liposomes can protect encapsulated drugs in their internal compartments from metabolism and degradation (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245). Important considerations in the preparation of liposome formulations are the lipid surface charge, vesicle size and the aqueous volume of the liposomes.
[0577] Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomes start to merge with the cellular membranes and as the merging of the liposome and cell progresses, the liposomal contents are emptied into the cell where the active agent may act.
[0578] Liposomal formulations have been the focus of extensive investigation as the mode of delivery for many drugs. There is growing evidence that for topical administration, liposomes present several advantages over other formulations. Such advantages include reduced side-effects related to high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer a wide variety of drugs, both hydrophilic and hydrophobic, into the skin.
[0579] Several reports have detailed the ability of liposomes to deliver agents including high-molecular weight DNA into the skin. Compounds including analgesics, antibodies, hormones and high-molecular weight DNAs have been administered to the skin. The majority of applications resulted in the targeting of the upper epidermis
[0580] Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes which interact with the negatively charged DNA molecules to form a stable complex. The positively charged DNA/liposome complex binds to the negatively charged cell surface and is internalized in an endosome. Due to the acidic pH within the endosome, the liposomes are ruptured, releasing their contents into the cell cytoplasm (Wang et al., Biochem. Biophys. Res. Commun., 1987, 147, 980-985).
[0581] Liposomes which are pH-sensitive or negatively-charged, entrap DNA rather than complex with it. Since both the DNA and the lipid are similarly charged, repulsion rather than complex formation occurs. Nevertheless, some DNA is entrapped within the aqueous interior of these liposomes. pH-sensitive liposomes have been used to deliver DNA encoding the thymidine kinase gene to cell monolayers in culture. Expression of the exogenous gene was detected in the target cells (Zhou et al., Journal of Controlled Release, 1992, 19, 269-274).
[0582] One major type of liposomal composition includes phospholipids other than naturally-derived phosphatidylcholine. Neutral liposome compositions, for example, can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC). Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanolamine (DOPE). Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC. Another type is formed from mixtures of phospholipid and/or phosphatidylcholine and/or cholesterol.
[0583] Several studies have assessed the topical delivery of liposomal drug formulations to the skin. Application of liposomes containing interferon to guinea pig skin resulted in a reduction of skin herpes sores while delivery of interferon via other means (e.g., as a solution or as an emulsion) were ineffective (Weiner et al., Journal of Drug Targeting, 1992, 2, 405-410). Further, an additional study tested the efficacy of interferon administered as part of a liposomal formulation to the administration of interferon using an aqueous system, and concluded that the liposomal formulation was superior to aqueous administration (du Plessis et al., Antiviral Research, 1992, 18, 259-265).
[0584] Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems comprising non-ionic surfactant and cholesterol. Non-ionic liposomal formulations comprising Novasome™ I (glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and Novasome™ II (glyceryl distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver cyclosporin-A into the dermis of mouse skin. Results indicated that such non-ionic liposomal systems were effective in facilitating the deposition of cyclosporin-A into different layers of the skin (Hu et al. S. T. P. Pharma. Sci., 1994, 4, 6, 466).
[0585] Liposomes also include “sterically stabilized” liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome (A) comprises one or more glycolipids, such as monosialoganglioside G.sub.M1, or (B) is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. While not wishing to be bound by any particular theory, it is thought in the art that, at least for sterically stabilized liposomes containing gangliosides, sphingomyelin, or PEG-derivatized lipids, the enhanced circulation half-life of these sterically stabilized liposomes derives from a reduced uptake into cells of the reticuloendothelial system (RES) (Allen et al., FEBS Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53, 3765).
[0586] Various liposomes comprising one or more glycolipids are known in the art. Papahadjopoulos et al. (Ann. N.Y. Acad. Sci., 1987, 507, 64) reported the ability of monosialoganglioside G.sub.M1, galactocerebroside sulfate and phosphatidylinositol to improve blood half-lives of liposomes. These findings were expounded upon by Gabizon et al. (Proc. Natl. Acad. Sci. U.S.A., 1988, 85, 6949). U.S. Pat. No. 4,837,028 and WO 88/04924, both to Allen et al., disclose liposomes comprising (1) sphingomyelin and (2) the ganglioside G.sub.M1 or a galactocerebroside sulfate ester. U.S. Pat. No. 5,543,152 (Webb et al.) discloses liposomes comprising sphingomyelin. Liposomes comprising 1,2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97/13499 (Lim et al).
[0587] Many liposomes comprising lipids derivatized with one or more hydrophilic polymers, and methods of preparation thereof, are known in the art. Sunamoto et al. (Bull. Chem. Soc. Jpn., 1980, 53, 2778) described liposomes comprising a nonionic detergent, 2C.sub.1215G, that contains a PEG moiety. Illum et al. (FEBS Lett., 1984, 167, 79) noted that hydrophilic coating of polystyrene particles with polymeric glycols results in significantly enhanced blood half-lives. Synthetic phospholipids modified by the attachment of carboxylic groups of polyalkylene glycols (e.g., PEG) are described by Sears (U.S. Pat. Nos. 4,426,330 and 4,534,899). Klibanov et al. (FEBS Lett., 1990, 268, 235) described experiments demonstrating that liposomes comprising phosphatidylethanolamine (PE) derivatized with PEG or PEG stearate have significant increases in blood circulation half-lives. Blume et al. (Biochimica et Biophysica Acta, 1990, 1029, 91) extended such observations to other PEG-derivatized phospholipids, e.g., DSPE-PEG, formed from the combination of distearoylphosphatidylethanolamine (DSPE) and PEG. Liposomes having covalently bound PEG moieties on their external surface are described in European Patent No. EP 0 445 131 B1 and WO 90/04384 to Fisher. Liposome compositions containing 1-20 mole percent of PE derivatized with PEG, and methods of use thereof, are described by Woodle et al. (U.S. Pat. Nos. 5,013,556 and 5,356,633) and Martin et al. (U.S. Pat. No. 5,213,804 and European Patent No. EP 0 496 813 B1). Liposomes comprising a number of other lipid-polymer conjugates are disclosed in WO 91/05545 and U.S. Pat. No. 5,225,212 (both to Martin et al.) and in WO 94/20073 (Zalipsky et al.) Liposomes comprising PEG-modified ceramide lipids are described in WO 96/10391 (Choi et al). U.S. Pat. No. 5,540,935 (Miyazaki et al.) and U.S. Pat. No. 5,556,948 (Tagawa et al.) describe PEG-containing liposomes that can be further derivatized with functional moieties on their surfaces.
[0588] A number of liposomes comprising nucleic acids are known in the art. WO 96/40062 to Thierry et al. discloses methods for encapsulating high molecular weight nucleic acids in liposomes. U.S. Pat. No. 5,264,221 to Tagawa et al. discloses protein-bonded liposomes and asserts that the contents of such liposomes may include a dsRNA. U.S. Pat. No. 5,665,710 to Rahman et al. describes certain methods of encapsulating oligodeoxynucleotides in liposomes. WO 97/04787 to Love et al. discloses liposomes comprising dsRNAs targeted to the raf gene.
[0589] Transfersomes are yet another type of liposomes, and are highly deformable lipid aggregates which are attractive candidates for drug delivery vehicles. Transfersomes may be described as lipid droplets which are so highly deformable that they are easily able to penetrate through pores which are smaller than the droplet. Transfersomes are adaptable to the environment in which they are used, e.g., they are self-optimizing (adaptive to the shape of pores in the skin), self-repairing, frequently reach their targets without fragmenting, and often self-loading. To make transfersomes it is possible to add surface edge-activators, usually surfactants, to a standard liposomal composition. Transfersomes have been used to deliver serum albumin to the skin. The transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.
[0590] Surfactants find wide application in formulations such as emulsions (including microemulsions) and liposomes. The most common way of classifying and ranking the properties of the many different types of surfactants, both natural and synthetic, is by the use of the hydrophile/lipophile balance (HLB). The nature of the hydrophilic group (also known as the “head”) provides the most useful means for categorizing the different surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).
[0591] If the surfactant molecule is not ionized, it is classified as a nonionic surfactant. Nonionic surfactants find wide application in pharmaceutical and cosmetic products and are usable over a wide range of pH values. In general their HLB values range from 2 to about 18 depending on their structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated/propoxylated block polymers are also included in this class. The polyoxyethylene surfactants are the most popular members of the nonionic surfactant class.
[0592] If the surfactant molecule carries a negative charge when it is dissolved or dispersed in water, the surfactant is classified as anionic. Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates. The most important members of the anionic surfactant class are the alkyl sulfates and the soaps.
[0593] If the surfactant molecule carries a positive charge when it is dissolved or dispersed in water, the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. The quaternary ammonium salts are the most used members of this class.
[0594] If the surfactant molecule has the ability to carry either a positive or negative charge, the surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines and phosphatides.
[0595] The use of surfactants in drug products, formulations and in emulsions has been reviewed (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).
[0596] Nucleic Acid Lipid Particles
[0597] In one embodiment, an ALAS1 dsRNA featured in the invention is fully encapsulated in the lipid formulation, e.g., to form a SPLP, pSPLP, SNALP, or other nucleic acid-lipid particle. As used herein, the term “SNALP” refers to a stable nucleic acid-lipid particle, including SPLP. As used herein, the term “SPLP” refers to a nucleic acid-lipid particle comprising plasmid DNA encapsulated within a lipid vesicle. SNALPs and SPLPs typically contain a cationic lipid, a non-cationic lipid, and a lipid that prevents aggregation of the particle (e.g., a PEG-lipid conjugate). SNALPs and SPLPs are extremely useful for systemic applications, as they exhibit extended circulation lifetimes following intravenous (i.v.) injection and accumulate at distal sites (e.g., sites physically separated from the administration site). SPLPs include “pSPLP,” which include an encapsulated condensing agent-nucleic acid complex as set forth in PCT Publication No. WO 00/03683. The particles of the present invention typically have a mean diameter of about 50 nm to about 150 nm, more typically about 60 nm to about 130 nm, more typically about 70 nm to about 110 nm, most typically about 70 nm to about 90 nm, and are substantially nontoxic. In addition, the nucleic acids when present in the nucleic acid-lipid particles of the present invention are resistant in aqueous solution to degradation with a nuclease. Nucleic acid-lipid particles and their method of preparation are disclosed in, e.g., U.S. Pat. Nos. 5,976,567; 5,981,501; 6,534,484; 6,586,410; 6,815,432; and PCT Publication No. WO 96/40964.
[0598] In one embodiment, the lipid to drug ratio (mass/mass ratio) (e.g., lipid to dsRNA ratio) will be in the range of from about 1:1 to about 50:1, from about 1:1 to about 25:1, from about 3:1 to about 15:1, from about 4:1 to about 10:1, from about 5:1 to about 9:1, or about 6:1 to about 9:1.
[0599] The cationic lipid may be, for example, N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(I-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), N-(I-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-dimethyl-2,3-dioleyloxy)propylamine (DODMA), 1,2-DiLinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), 1,2-Dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1,2-Dilinoleyoxy-3-(dimethylamino)acetoxypropane (DLin-DAC), 1,2-Dilinoleyoxy-3-morpholinopropane (DLin-MA), 1,2-Dilinoleoyl-3-dimethylaminopropane (DLinDAP), 1,2-Dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA), 1-Linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1,2-Dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.Cl), 1,2-Dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP.Cl), 1,2-Dilinoleyloxy-3-(N-methylpiperazino)propane (DLin-MPZ), or 3-(N,N-Dilinoleylamino)-1,2-propanediol (DLinAP), 3-(N,N-Dioleylamino)-1,2-propanedio (DOAP), 1,2-Dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), 1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLinDMA), 2,2-Dilinoleyl-4-dimethylaminomethyl[1,3]-dioxolane (DLin-K-DMA) or analogs thereof, (3aR,5s,6aS)—N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine (ALN100), (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (MC3), 1,1′-(2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1-yl)ethylazanediyl)didodecan-2-ol (Tech G1), or a mixture thereof. The cationic lipid may comprise from about 20 mol % to about 50 mol % or about 40 mol % of the total lipid present in the particle.
[0600] In another embodiment, the compound 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane can be used to prepare lipid-siRNA nanoparticles. Synthesis of 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane is described in U.S. provisional patent application No. 61/107,998 filed on Oct. 23, 2008, which is herein incorporated by reference.
[0601] In one embodiment, the lipid-siRNA particle includes 40% 2, 2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane: 10% DSPC: 40% Cholesterol: 10% PEG-C-DOMG (mole percent) with a particle size of 63.0±20 nm and a 0.027 siRNA/Lipid Ratio.
[0602] The non-cationic lipid may be an anionic lipid or a neutral lipid including, but not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), cholesterol, or a mixture thereof. The non-cationic lipid may be from about 5 mol % to about 90 mol %, about 10 mol %, or about 58 mol % if cholesterol is included, of the total lipid present in the particle.
[0603] The conjugated lipid that inhibits aggregation of particles may be, for example, a polyethyleneglycol (PEG)-lipid including, without limitation, a PEG-diacylglycerol (DAG), a PEG-dialkyloxypropyl (DAA), a PEG-phospholipid, a PEG-ceramide (Cer), or a mixture thereof. The PEG-DAA conjugate may be, for example, a PEG-dilauryloxypropyl (Ci.sub.2), a PEG-dimyristyloxypropyl (Ci.sub.4), a PEG-dipalmityloxypropyl (Ci.sub.6), or a PEG-distearyloxypropyl (C].sub.8). The conjugated lipid that prevents aggregation of particles may be from 0 mol % to about 20 mol % or about 2 mol % of the total lipid present in the particle.
[0604] In some embodiments, the nucleic acid-lipid particle further includes cholesterol at, e.g., about 10 mol % to about 60 mol % or about 48 mol % of the total lipid present in the particle.
[0605] In some embodiments, the iRNA is formulated in a lipid nanoparticle (LNP).
[0606] LNP01
[0607] In one embodiment, the lipidoid ND98.4HCl (MW 1487) (see U.S. patent application Ser. No. 12/056,230, filed Mar. 26, 2008, which is herein incorporated by reference), Cholesterol (Sigma-Aldrich), and PEG-Ceramide C16 (Avanti Polar Lipids) can be used to prepare lipid-dsRNA nanoparticles (e.g., LNP01 particles). Stock solutions of each in ethanol can be prepared as follows: ND98, 133 mg/ml; Cholesterol, 25 mg/ml, PEG-Ceramide C16, 100 mg/ml. The ND98, Cholesterol, and PEG-Ceramide C16 stock solutions can then be combined in a, e.g., 42:48:10 molar ratio. The combined lipid solution can be mixed with aqueous dsRNA (e.g., in sodium acetate pH 5) such that the final ethanol concentration is about 35-45% and the final sodium acetate concentration is about 100-300 mM. Lipid-dsRNA nanoparticles typically form spontaneously upon mixing. Depending on the desired particle size distribution, the resultant nanoparticle mixture can be extruded through a polycarbonate membrane (e.g., 100 nm cut-off) using, for example, a thermobarrel extruder, such as Lipex Extruder (Northern Lipids, Inc). In some cases, the extrusion step can be omitted. Ethanol removal and simultaneous buffer exchange can be accomplished by, for example, dialysis or tangential flow filtration. Buffer can be exchanged with, for example, phosphate buffered saline (PBS) at about pH 7, e.g., about pH 6.9, about pH 7.0, about pH 7.1, about pH 7.2, about pH 7.3, or about pH 7.4.
##STR00027##
[0608] LNP01 formulations are described, e.g., in International Application Publication No. WO 2008/042973, which is hereby incorporated by reference.
[0609] Additional exemplary lipid-dsRNA formulations are provided in the following table.
TABLE-US-00002 TABLE 10 Exemplary lipid formulations cationic lipid/non-cationic lipid/cholesterol/PEG-lipid conjugate Cationic Lipid Lipid:siRNA ratio SNALP 1,2-Dilinolenyloxy-N,N- DLinDMA/DPPC/ dimethylaminopropane Cholesterol/PEG-cDMA (DLinDMA) (57.1/7.1/34.4/1.4) lipid:siRNA~7:1 S-XTC 2,2-Dilinoleyl-4- XTC/DPPC/Cholesterol/ dimethylaminoethyl- PEG-cDMA 57.1/7.1/34.4/ [1,3]-dioxolane (XTC) 1.4 lipid:siRNA~7:1 LNP05 2,2-Dilinoleyl-4- XTC/DSPC/Cholesterol/ dimethylaminoethyl- PEG-DMG 57.5/7.5/31.5/ [1,3]-dioxolane (XTC) 3.5 lipid:siRNA~6:1 LNP06 2,2-Dilinoleyl-4- XTC/DSPC/Cholesterol/ dimethylaminoethyl- PEG-DMG 57.5/7.5/31.5/ [1,3]-dioxolane (XTC) 3.5 lipid:siRNA~11:1 LNP07 2,2-Dilinoleyl-4- XTC/DSPC/Cholesterol/ dimethylaminoethyl- PEG-DMG 60/7.5/31/1.5, [1,3]-dioxolane (XTC) lipid:siRNA~6:1 LNP08 2,2-Dilinoleyl-4- XTC/DSPC/Cholesterol/ dimethylaminoethyl- PEG-DMG 60/7.5/31/1.5, [1,3]-dioxolane (XTC) lipid:siRNA~11:1 LNP09 2,2-Dilinoleyl-4- XTC/DSPC/Cholesterol/ dimethylaminoethyl- PEG-DMG 50/10/38.5/1.5 [1,3]-dioxolane (XTC) Lipid:siRNA 10:1 LNP10 (3aR,5s,6aS)-N,N-dimethyl- ALN100/DSPC/Cholesterol/ 2,2-di((9Z,12Z)-octadeca- PEG-DMG 50/10/38.5/1.5 9,12-dienyl)tetrahydro-3aH- Lipid:siRNA 10:1 cyclopenta[d][1,3]dioxol-5- amine (ALN100) LNP11 (6Z,9Z,28Z,31Z)- MC-3/DSPC/Cholesterol/ heptatriaconta-6,9,28,31- PEG-DMG 50/10/38.5/1.5 tetraen-19-yl 4- Lipid:siRNA 10:1 (dimethylamino)butanoate (MC3) LNP12 1,1′-(2-(4-(2-((2-(bis(2- C12-200/DSPC/Cholesterol/ hydroxydodecyl)amino)ethyl)(2- PEG-DMG 50/10/38.5/1.5 hydroxydodecyl)amino)ethyl)- Lipid:siRNA 10:1 piperazin-1-yl)ethylazanediyl)- didodecan-2-ol (C12-200) LNP13 XTC XTC/DSPC/Chol/PEG- DMG 50/10/38.5/1.5 Lipid:siRNA: 33:1 LNP14 MC3 MC3/DSPC/Chol/PEG- DMG 40/15/40/5 Lipid:siRNA: 11:1 LNP15 MC3 MC3/DSPC/Chol/PEG- DSG/GalNAc-PEG-DSG 50/10/35/4.5/0.5 Lipid:siRNA: 11:1 LNP16 MC3 MC3/DSPC/Chol/PEG- DMG 50/10/38.5/1.5 Lipid:siRNA: 7:1 LNP17 MC3 MC3/DSPC/Chol/PEG- DSG 50/10/38.5/1.5 Lipid:siRNA: 10:1 LNP18 MC3 MC3/DSPC/Chol/PEG- DMG 50/10/38.5/1.5 Lipid:siRNA: 12:1 LNP19 MC3 MC3/DSPC/Chol/PEG- DMG 50/10/35/5 Lipid:siRNA: 8:1 LNP20 MC3 MC3/DSPC/Chol/PEG- DPG 50/10/38.5/1.5 Lipid:siRNA: 10:1 LNP21 C12-200 C12-200/DSPC/Chol/PEG- DSG 50/10/38.5/1.5 Lipid:siRNA: 7:1 LNP22 XTC XTC/DSPC/Chol/PEG- DSG 50/10/38.5/1.5 Lipid:siRNA: 10:1
DSPC: distearoylphosphatidylcholine
DPPC: dipalmitoylphosphatidylcholine
PEG-DMG: PEG-didimyristoyl glycerol (C14-PEG, or PEG-C14) (PEG with avg mol wt of 2000)
PEG-DSG: PEG-distyryl glycerol (C18-PEG, or PEG-C18) (PEG with avg mol wt of 2000)
PEG-cDMA: PEG-carbamoyl-1,2-dimyristyloxypropylamine (PEG with avg mol wt of 2000)
[0610] SNALP (1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLinDMA)) comprising formulations are described in International Publication No. WO2009/127060, filed Apr. 15, 2009, which is hereby incorporated by reference.
[0611] XTC comprising formulations are described, e.g., in U.S. Provisional Ser. No. 61/148,366, filed Jan. 29, 2009; U.S. Provisional Ser. No. 61/156,851, filed Mar. 2, 2009; U.S. Provisional Ser. No. filed Jun. 10, 2009; U.S. Provisional Ser. No. 61/228,373, filed Jul. 24, 2009; U.S. Provisional Ser. No. 61/239,686, filed Sep. 3, 2009, and International Application No. PCT/US2010/022614, filed Jan. 29, 2010, which are hereby incorporated by reference.
[0612] MC3 comprising formulations are described, e.g., in U.S. Provisional Ser. No. 61/244,834, filed Sep. 22, 2009, U.S. Provisional Ser. No. 61/185,800, filed Jun. 10, 2009, and International Application No. PCT/US10/28224, filed Jun. 10, 2010, which are hereby incorporated by reference.
[0613] ALNY-100 comprising formulations are described, e.g., International patent application number PCT/US09/63933, filed on Nov. 10, 2009, which is hereby incorporated by reference.
[0614] C12-200 comprising formulations are described in U.S. Provisional Ser. No. 61/175,770, filed May 5, 2009 and International Application No. PCT/US10/33777, filed May 5, 2010, which are hereby incorporated by reference.
Synthesis of Cationic Lipids
[0615] Any of the compounds, e.g., cationic lipids and the like, used in the nucleic acid-lipid particles featured in the invention may be prepared by known organic synthesis techniques, including the methods described in more detail in the Examples. All substituents are as defined below unless indicated otherwise.
[0616] “Alkyl” means a straight chain or branched, noncyclic or cyclic, saturated aliphatic hydrocarbon containing from 1 to 24 carbon atoms. Representative saturated straight chain alkyls include methyl, ethyl, n-propyl, n-butyl, n-pentyl, n-hexyl, and the like; while saturated branched alkyls include isopropyl, sec-butyl, isobutyl, tert-butyl, isopentyl, and the like. Representative saturated cyclic alkyls include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and the like; while unsaturated cyclic alkyls include cyclopentenyl and cyclohexenyl, and the like.
[0617] “Alkenyl” means an alkyl, as defined above, containing at least one double bond between adjacent carbon atoms. Alkenyls include both cis and trans isomers. Representative straight chain and branched alkenyls include ethylenyl, propylenyl, 1-butenyl, 2-butenyl, isobutylenyl, 1-pentenyl, 2-pentenyl, 3-methyl-1-butenyl, 2-methyl-2-butenyl, 2,3-dimethyl-2-butenyl, and the like.
[0618] “Alkynyl” means any alkyl or alkenyl, as defined above, which additionally contains at least one triple bond between adjacent carbons. Representative straight chain and branched alkynyls include acetylenyl, propynyl, 1-butynyl, 2-butynyl, 1-pentynyl, 2-pentynyl, 3-methyl-1 butynyl, and the like.
[0619] “Acyl” means any alkyl, alkenyl, or alkynyl wherein the carbon at the point of attachment is substituted with an oxo group, as defined below. For example, —C(═O)alkyl, —C(═O)alkenyl, and —C(═O)alkynyl are acyl groups.
[0620] “Heterocycle” means a 5- to 7-membered monocyclic, or 7- to 10-membered bicyclic, heterocyclic ring which is either saturated, unsaturated, or aromatic, and which contains from 1 or 2 heteroatoms independently selected from nitrogen, oxygen and sulfur, and wherein the nitrogen and sulfur heteroatoms may be optionally oxidized, and the nitrogen heteroatom may be optionally quaternized, including bicyclic rings in which any of the above heterocycles are fused to a benzene ring. The heterocycle may be attached via any heteroatom or carbon atom. Heterocycles include heteroaryls as defined below. Heterocycles include morpholinyl, pyrrolidinonyl, pyrrolidinyl, piperidinyl, piperizynyl, hydantoinyl, valerolactamyl, oxiranyl, oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, tetrahydropyridinyl, tetrahydroprimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl, tetrahydropyrimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl, and the like.
[0621] The terms “optionally substituted alkyl”, “optionally substituted alkenyl”, “optionally substituted alkynyl”, “optionally substituted acyl”, and “optionally substituted heterocycle” means that, when substituted, at least one hydrogen atom is replaced with a substituent. In the case of an oxo substituent (═O) two hydrogen atoms are replaced. In this regard, substituents include oxo, halogen, heterocycle, —CN, —OR.sup.x, —NR.sup.xR.sup.y, —NR.sup.xC(═O)R.sup.y, —NR.sup.xSO.sub.2R.sup.y, —C(═O)R.sup.x, —C(═O)OR.sup.x, —C(═O)NR.sup.xR.sup.y, —SO.sub.nR.sup.x and —SO.sub.nNR.sup.xR.sup.y, wherein n is 0, 1 or 2, R.sup.x and R.sup.y are the same or different and independently hydrogen, alkyl or heterocycle, and each of said alkyl and heterocycle substituents may be further substituted with one or more of oxo, halogen, —OH, —CN, alkyl, —OR.sup.x, heterocycle, —NR.sup.xR.sup.y, —NR.sup.xC(═O)R.sup.y, —NR.sup.xSO.sub.2R.sup.y, —C(═O)R.sup.x, —C(═O)OR.sup.x, —C(═O)NR.sup.xR.sup.y, —SO.sub.nR.sup.x and —SO.sub.nNR.sup.xR.sup.y.
[0622] “Halogen” means fluoro, chloro, bromo and iodo.
[0623] In some embodiments, the methods featured in the invention may require the use of protecting groups. Protecting group methodology is well known to those skilled in the art (see, for example, P
[0624] Synthesis of Formula A
[0625] In one embodiments, nucleic acid-lipid particles featured in the invention are formulated using a cationic lipid of formula A:
##STR00028##
where R1 and R2 are independently alkyl, alkenyl or alkynyl, each can be optionally substituted, and R3 and R4 are independently lower alkyl or R3 and R4 can be taken together to form an optionally substituted heterocyclic ring. In some embodiments, the cationic lipid is XTC (2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane). In general, the lipid of formula A above may be made by the following Reaction Schemes 1 or 2, wherein all substituents are as defined above unless indicated otherwise.
##STR00029##
[0626] Lipid A, where R.sub.1 and R.sub.2 are independently alkyl, alkenyl or alkynyl, each can be optionally substituted, and R.sub.3 and R.sub.4 are independently lower alkyl or R.sub.3 and R.sub.4 can be taken together to form an optionally substituted heterocyclic ring, can be prepared according to Scheme 1. Ketone 1 and bromide 2 can be purchased or prepared according to methods known to those of ordinary skill in the art. Reaction of 1 and 2 yields ketal 3. Treatment of ketal 3 with amine 4 yields lipids of formula A. The lipids of formula A can be converted to the corresponding ammonium salt with an organic salt of formula 5, where X is anion counter ion selected from halogen, hydroxide, phosphate, sulfate, or the like.
##STR00030##
[0627] Alternatively, the ketone 1 starting material can be prepared according to Scheme 2. Grignard reagent 6 and cyanide 7 can be purchased or prepared according to methods known to those of ordinary skill in the art. Reaction of 6 and 7 yields ketone 1. Conversion of ketone 1 to the corresponding lipids of formula A is as described in Scheme 1.
[0628] Synthesis of MC3
[0629] Preparation of DLin-M-C3-DMA (i.e (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate) was as follows. A solution of (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-ol (0.53 g), 4-N,N-dimethylaminobutyric acid hydrochloride (0.51 g), 4-N,N-dimethylaminopyridine (0.61 g) and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (0.53 g) in dichloromethane (5 mL) was stirred at room temperature overnight. The solution was washed with dilute hydrochloric acid followed by dilute aqueous sodium bicarbonate. The organic fractions were dried over anhydrous magnesium sulphate, filtered and the solvent removed on a rotovap. The residue was passed down a silica gel column (20 g) using a 1-5% methanol/dichloromethane elution gradient. Fractions containing the purified product were combined and the solvent removed, yielding a colorless oil (0.54 g).
[0630] Synthesis of ALNY-100
[0631] Synthesis of ketal 519 [ALNY-100] was performed using the following scheme 3:
##STR00031##
[0632] Synthesis of 515:
[0633] To a stirred suspension of LiAlH4 (3.74 g, 0.09852 mol) in 200 ml anhydrous THF in a two neck RBF (1 L), was added a solution of 514 (10 g, 0.04926 mol) in 70 mL of THF slowly at 0° C. under nitrogen atmosphere. After complete addition, reaction mixture was warmed to room temperature and then heated to reflux for 4 h. Progress of the reaction was monitored by TLC. After completion of reaction (by TLC) the mixture was cooled to 0° C. and quenched with careful addition of saturated Na2SO4 solution. Reaction mixture was stirred for 4 h at room temperature and filtered off. Residue was washed well with THF. The filtrate and washings were mixed and diluted with 400 mL dioxane and 26 mL conc. HCl and stirred for 20 minutes at room temperature. The volatilities were stripped off under vacuum to furnish the hydrochloride salt of 515 as a white solid. Yield: 7.12 g 1H-NMR (DMSO, 400 MHz): δ=9.34 (broad, 2H), 5.68 (s, 2H), 3.74 (m, 1H), 2.66-2.60 (m, 2H), 2.50-2.45 (m, 5H).
[0634] Synthesis of 516:
[0635] To a stirred solution of compound 515 in 100 mL dry DCM in a 250 mL two neck RBF, was added NEt3 (37.2 mL, 0.2669 mol) and cooled to 0° C. under nitrogen atmosphere. After a slow addition of N-(benzyloxy-carbonyloxy)-succinimide (20 g, 0.08007 mol) in 50 mL dry DCM, reaction mixture was allowed to warm to room temperature. After completion of the reaction (2-3 h by TLC) mixture was washed successively with 1N HCl solution (1×100 mL) and saturated NaHCO.sub.3 solution (1×50 mL). The organic layer was then dried over anhyd. Na2SO4 and the solvent was evaporated to give crude material which was purified by silica gel column chromatography to get 516 as sticky mass. Yield: 11 g (89%). 1H-NMR (CDCl3, 400 MHz): δ=7.36-7.27 (m, 5H), 5.69 (s, 2H), 5.12 (s, 2H), 4.96 (br., 1H) 2.74 (s, 3H), 2.60 (m, 2H), 2.30-2.25 (m, 2H). LC-MS [M+H] −232.3 (96.94%).
[0636] Synthesis of 517A and 517B:
[0637] The cyclopentene 516 (5 g, 0.02164 mol) was dissolved in a solution of 220 mL acetone and water (10:1) in a single neck 500 mL RBF and to it was added N-methyl morpholine-N-oxide (7.6 g, 0.06492 mol) followed by 4.2 mL of 7.6% solution of OsO4 (0.275 g, 0.00108 mol) in tert-butanol at room temperature. After completion of the reaction (˜3 h), the mixture was quenched with addition of solid Na2SO3 and resulting mixture was stirred for 1.5 h at room temperature. Reaction mixture was diluted with DCM (300 mL) and washed with water (2×100 mL) followed by saturated NaHCO.sub.3 (1×50 mL) solution, water (1×30 mL) and finally with brine (1×50 mL). Organic phase was dried over an. Na2SO4 and solvent was removed in vacuum. Silica gel column chromatographic purification of the crude material was afforded a mixture of diastereomers, which were separated by prep HPLC. Yield:—6 g crude
[0638] 517A—Peak-1 (white solid), 5.13 g (96%). 1H-NMR (DMSO, 400 MHz): δ=7.39-7.31 (m, 5H), 5.04 (s, 2H), 4.78-4.73 (m, 1H), 4.48-4.47 (d, 2H), 3.94-3.93 (m, 2H), 2.71 (s, 3H), 1.72-1.67 (m, 4H). LC-MS-[M+H]-266.3, [M+NH4+]-283.5 present, HPLC-97.86%. Stereochemistry confirmed by X-ray.
[0639] Synthesis of 518:
[0640] Using a procedure analogous to that described for the synthesis of compound 505, compound 518 (1.2 g, 41%) was obtained as a colorless oil. 1H-NMR (CDCl3, 400 MHz): δ=7.35-7.33 (m, 4H), 7.30-7.27 (m, 1H), 5.37-5.27 (m, 8H), 5.12 (s, 2H), 4.75 (m, 1H), 4.58-4.57 (m, 2H), 2.78-2.74 (m, 7H), 2.06-2.00 (m, 8H), 1.96-1.91 (m, 2H), 1.62 (m, 4H), 1.48 (m, 2H), 1.37-1.25 (br m, 36H), 0.87 (m, 6H). HPLC-98.65%.
[0641] General Procedure for the Synthesis of Compound 519:
[0642] A solution of compound 518 (1 eq) in hexane (15 mL) was added in a drop-wise fashion to an ice-cold solution of LAH in THF (1 M, 2 eq). After complete addition, the mixture was heated at 40° C. over 0.5 h then cooled again on an ice bath. The mixture was carefully hydrolyzed with saturated aqueous Na2SO4 then filtered through celite and reduced to an oil. Column chromatography provided the pure 519 (1.3 g, 68%) which was obtained as a colorless oil. 13C NMR=130.2, 130.1 (×2), 127.9 (×3), 112.3, 79.3, 64.4, 44.7, 38.3, 35.4, 31.5, 29.9 (×2), 29.7, 29.6 (×2), 29.5 (×3), 29.3 (×2), 27.2 (×3), 25.6, 24.5, 23.3, 226, 14.1; Electrospray MS (+ve): Molecular weight for C44H80NO2 (M+H)+ Calc. 654.6, Found 654.6.
[0643] Formulations prepared by either the standard or extrusion-free method can be characterized in similar manners. For example, formulations are typically characterized by visual inspection. They should be whitish translucent solutions free from aggregates or sediment. Particle size and particle size distribution of lipid-nanoparticles can be measured by light scattering using, for example, a Malvern Zetasizer Nano ZS (Malvern, USA). Particles should be about 20-300 nm, such as 40-100 nm in size. The particle size distribution should be unimodal. The total dsRNA concentration in the formulation, as well as the entrapped fraction, is estimated using a dye exclusion assay. A sample of the formulated dsRNA can be incubated with an RNA-binding dye, such as Ribogreen (Molecular Probes) in the presence or absence of a formulation disrupting surfactant, e.g., 0.5% Triton-X100. The total dsRNA in the formulation can be determined by the signal from the sample containing the surfactant, relative to a standard curve. The entrapped fraction is determined by subtracting the “free” dsRNA content (as measured by the signal in the absence of surfactant) from the total dsRNA content. Percent entrapped dsRNA is typically >85%. For SNALP formulation, the particle size is at least 30 nm, at least 40 nm, at least 50 nm, at least 60 nm, at least 70 nm, at least 80 nm, at least 90 nm, at least 100 nm, at least 110 nm, and at least 120 nm. The suitable range is typically about at least 50 nm to about at least 110 nm, about at least 60 nm to about at least 100 nm, or about at least 80 nm to about at least 90 nm.
[0644] Compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable. In some embodiments, oral formulations are those in which dsRNAs featured in the invention are administered in conjunction with one or more penetration enhancers surfactants and chelators. Suitable surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof. Suitable bile acids/salts include chenodeoxycholic acid (CDCA) and ursodeoxychenodeoxycholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, glucholic acid, glycholic acid, glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, sodium tauro-24,25-dihydro-fusidate and sodium glycodihydrofusidate. Suitable fatty acids include arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a monoglyceride, a diglyceride or a pharmaceutically acceptable salt thereof (e.g., sodium). In some embodiments, combinations of penetration enhancers are used, for example, fatty acids/salts in combination with bile acids/salts. One exemplary combination is the sodium salt of lauric acid, capric acid and UDCA. Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether. DsRNAs featured in the invention may be delivered orally, in granular form including sprayed dried particles, or complexed to form micro or nanoparticles. DsRNA complexing agents include poly-amino acids; polyimines; polyacrylates; polyalkylacrylates, polyoxethanes, polyalkylcyanoacrylates; cationized gelatins, albumins, starches, acrylates, polyethyleneglycols (PEG) and starches; polyalkylcyanoacrylates; DEAE-derivatized polyimines, pollulans, celluloses and starches. Suitable complexing agents include chitosan, N-trimethylchitosan, poly-L-lysine, polyhistidine, polyornithine, polyspermines, protamine, polyvinylpyridine, polythiodiethylaminomethylethylene P(TDAE), polyaminostyrene (e.g., p-amino), poly(methylcyanoacrylate), poly(ethylcyanoacrylate), poly(butylcyanoacrylate), poly(isobutylcyanoacrylate), poly(isohexylcynaoacrylate), DEAE-methacrylate, DEAE-hexylacrylate, DEAE-acrylamide, DEAE-albumin and DEAE-dextran, polymethylacrylate, polyhexylacrylate, poly(D,L-lactic acid), poly(DL-lactic-co-glycolic acid (PLGA), alginate, and polyethyleneglycol (PEG). Oral formulations for dsRNAs and their preparation are described in detail in U.S. Pat. No. 6,887,906, US Publn. No. 20030027780, and U.S. Pat. No. 6,747,014, each of which is incorporated herein by reference.
[0645] Compositions and formulations for parenteral, intraparenchymal (into the brain), intrathecal, intraventricular or intrahepatic administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
[0646] Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions may be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids.
[0647] The pharmaceutical formulations featured in the present invention, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
[0648] The compositions featured in the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions may also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.
[0649] Additional Formulations
[0650] Emulsions
[0651] The compositions of the present invention may be prepared and formulated as emulsions. Emulsions are typically heterogeneous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 μm in diameter (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., Volume 1, p. 245; Block in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p. 335; Higuchi et al., in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 301). Emulsions are often biphasic systems comprising two immiscible liquid phases intimately mixed and dispersed with each other. In general, emulsions may be of either the water-in-oil (w/o) or the oil-in-water (o/w) variety. When an aqueous phase is finely divided into and dispersed as minute droplets into a bulk oily phase, the resulting composition is called a water-in-oil (w/o) emulsion. Alternatively, when an oily phase is finely divided into and dispersed as minute droplets into a bulk aqueous phase, the resulting composition is called an oil-in-water (o/w) emulsion. Emulsions may contain additional components in addition to the dispersed phases, and the active drug which may be present as a solution in either the aqueous phase, oily phase or itself as a separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and anti-oxidants may also be present in emulsions as needed. Pharmaceutical emulsions may also be multiple emulsions that are comprised of more than two phases such as, for example, in the case of oil-in-water-in-oil (o/w/o) and water-in-oil-in-water (w/o/w) emulsions. Such complex formulations often provide certain advantages that simple binary emulsions do not. Multiple emulsions in which individual oil droplets of an o/w emulsion enclose small water droplets constitute a w/o/w emulsion. Likewise a system of oil droplets enclosed in globules of water stabilized in an oily continuous phase provides an o/w/o emulsion. Emulsions are characterized by little or no thermodynamic stability. Often, the dispersed or discontinuous phase of the emulsion is well dispersed into the external or continuous phase and maintained in this form through the means of emulsifiers or the viscosity of the formulation. Either of the phases of the emulsion may be a semisolid or a solid, as is the case of emulsion-style ointment bases and creams. Other means of stabilizing emulsions entail the use of emulsifiers that may be incorporated into either phase of the emulsion. Emulsifiers may broadly be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and finely dispersed solids (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).
[0652] Synthetic surfactants, also known as surface active agents, have found wide applicability in the formulation of emulsions and have been reviewed in the literature (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and
[0653] Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, N.Y., 1988, volume 1, p. 199). Surfactants are typically amphiphilic and comprise a hydrophilic and a hydrophobic portion. The ratio of the hydrophilic to the hydrophobic nature of the surfactant has been termed the hydrophile/lipophile balance (HLB) and is a valuable tool in categorizing and selecting surfactants in the preparation of formulations. Surfactants may be classified into different classes based on the nature of the hydrophilic group: nonionic, anionic, cationic and amphoteric (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y. Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285).
[0654] Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin and acacia. Absorption bases possess hydrophilic properties such that they can soak up water to form w/o emulsions yet retain their semisolid consistencies, such as anhydrous lanolin and hydrophilic petrolatum. Finely divided solids have also been used as good emulsifiers especially in combination with surfactants and in viscous preparations. These include polar inorganic solids, such as heavy metal hydroxides, nonswelling clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, pigments and nonpolar solids such as carbon or glyceryl tri stearate.
[0655] A large variety of non-emulsifying materials are also included in emulsion formulations and contribute to the properties of emulsions. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives and antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).
[0656] Hydrophilic colloids or hydrocolloids include naturally occurring gums and synthetic polymers such as polysaccharides (for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth), cellulose derivatives (for example, carboxymethylcellulose and carboxypropylcellulose), and synthetic polymers (for example, carbomers, cellulose ethers, and carboxyvinyl polymers). These disperse or swell in water to form colloidal solutions that stabilize emulsions by forming strong interfacial films around the dispersed-phase droplets and by increasing the viscosity of the external phase.
[0657] Since emulsions often contain a number of ingredients such as carbohydrates, proteins, sterols and phosphatides that may readily support the growth of microbes, these formulations often incorporate preservatives. Commonly used preservatives included in emulsion formulations include methyl paraben, propyl paraben, quaternary ammonium salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric acid. Antioxidants are also commonly added to emulsion formulations to prevent deterioration of the formulation. Antioxidants used may be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite, and antioxidant synergists such as citric acid, tartaric acid, and lecithin.
[0658] The application of emulsion formulations via dermatological, oral and parenteral routes and methods for their manufacture have been reviewed in the literature (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Emulsion formulations for oral delivery have been very widely used because of ease of formulation, as well as efficacy from an absorption and bioavailability standpoint (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Mineral-oil base laxatives, oil-soluble vitamins and high fat nutritive preparations are among the materials that have commonly been administered orally as o/w emulsions.
[0659] In one embodiment of the present invention, the compositions of iRNAs and nucleic acids are formulated as microemulsions. A microemulsion may be defined as a system of water, oil and amphiphile which is a single optically isotropic and thermodynamically stable liquid solution (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245). Typically microemulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, generally an intermediate chain-length alcohol to form a transparent system. Therefore, microemulsions have also been described as thermodynamically stable, isotropically clear dispersions of two immiscible liquids that are stabilized by interfacial films of surface-active molecules (Leung and Shah, in: Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 185-215). Microemulsions commonly are prepared via a combination of three to five components that include oil, water, surfactant, cosurfactant and electrolyte. Whether the microemulsion is of the water-in-oil (w/o) or an oil-in-water (o/w) type is dependent on the properties of the oil and surfactant used and on the structure and geometric packing of the polar heads and hydrocarbon tails of the surfactant molecules (Schott, in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 271).
[0660] The phenomenological approach utilizing phase diagrams has been extensively studied and has yielded a comprehensive knowledge, to one skilled in the art, of how to formulate microemulsions (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335). Compared to conventional emulsions, microemulsions offer the advantage of solubilizing water-insoluble drugs in a formulation of thermodynamically stable droplets that are formed spontaneously.
[0661] Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, non-ionic surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (SO750), decaglycerol decaoleate (DAO750), alone or in combination with cosurfactants. The cosurfactant, usually a short-chain alcohol such as ethanol, 1-propanol, and 1-butanol, serves to increase the interfacial fluidity by penetrating into the surfactant film and consequently creating a disordered film because of the void space generated among surfactant molecules. Microemulsions may, however, be prepared without the use of cosurfactants and alcohol-free self-emulsifying microemulsion systems are known in the art. The aqueous phase may typically be, but is not limited to, water, an aqueous solution of the drug, glycerol, PEG300, PEG400, polyglycerols, propylene glycols, and derivatives of ethylene glycol. The oil phase may include, but is not limited to, materials such as Captex 300, Captex 355, Capmul M C M, fatty acid esters, medium chain (C8-C12) mono, di, and tri-glycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oil. Microemulsions are particularly of interest from the standpoint of drug solubilization and the enhanced absorption of drugs. Lipid based microemulsions (both o/w and w/o) have been proposed to enhance the oral bioavailability of drugs, including peptides (see e.g., U.S. Pat. Nos. 6,191,105; 7,063,860; 7,070,802; 7,157,099; Constantinides et al., Pharmaceutical Research, 1994, 11, 1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol., 1993, 13, 205). Microemulsions afford advantages of improved drug solubilization, protection of drug from enzymatic hydrolysis, possible enhancement of drug absorption due to surfactant-induced alterations in membrane fluidity and permeability, ease of preparation, ease of oral administration over solid dosage forms, improved clinical potency, and decreased toxicity (see e.g., U.S. Pat. Nos. 6,191,105; 7,063,860; 7,070,802; 7,157,099; Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J. Pharm. Sci., 1996, 85, 138-143). Often microemulsions may form spontaneously when their components are brought together at ambient temperature. This may be particularly advantageous when formulating thermolabile drugs, peptides or iRNAs. Microemulsions have also been effective in the transdermal delivery of active components in both cosmetic and pharmaceutical applications. It is expected that the microemulsion compositions and formulations of the present invention will facilitate the increased systemic absorption of iRNAs and nucleic acids from the gastrointestinal tract, as well as improve the local cellular uptake of iRNAs and nucleic acids.
[0662] Microemulsions of the present invention may also contain additional components and additives such as sorbitan monostearate (Grill 3), Labrasol, and penetration enhancers to improve the properties of the formulation and to enhance the absorption of the iRNAs and nucleic acids of the present invention. Penetration enhancers used in the microemulsions of the present invention may be classified as belonging to one of five broad categories—surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these classes has been discussed above.
[0663] Penetration Enhancers
[0664] In one embodiment, the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids, particularly iRNAs, to the skin of animals. Most drugs are present in solution in both ionized and nonionized forms. However, usually only lipid soluble or lipophilic drugs readily cross cell membranes. It has been discovered that even non-lipophilic drugs may cross cell membranes if the membrane to be crossed is treated with a penetration enhancer. In addition to aiding the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs.
[0665] Penetration enhancers may be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, N.Y., 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of the above mentioned classes of penetration enhancers are described below in greater detail.
[0666] Surfactants: In connection with the present invention, surfactants (or “surface-active agents”) are chemical entities which, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, with the result that absorption of iRNAs through the mucosa is enhanced. In addition to bile salts and fatty acids, these penetration enhancers include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether) (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, N.Y., 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92); and perfluorochemical emulsions, such as FC-43. Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252).
[0667] Fatty acids: Various fatty acids and their derivatives which act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (1-monooleoyl-rac-glycerol), dilaurin, caprylic acid, arachidonic acid, glycerol 1-monocaprate, 1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines, C1-20 alkyl esters thereof (e.g., methyl, isopropyl and t-butyl), and mono- and di-glycerides thereof (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.) (see e.g., Touitou, E., et al. Enhancement in Drug Delivery, CRC Press, Danvers, Mass., 2006; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; El Hariri et al., J. Pharm. Pharmacol., 1992, 44, 651-654).
[0668] Bile salts: The physiological role of bile includes the facilitation of dispersion and absorption of lipids and fat-soluble vitamins (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, N.Y., 2002; Brunton, Chapter 38 in: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al. Eds., McGraw-Hill, New York, 1996, pp. 934-935). Various natural bile salts, and their synthetic derivatives, act as penetration enhancers. Thus the term “bile salts” includes any of the naturally occurring components of bile as well as any of their synthetic derivatives. Suitable bile salts include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glucholic acid (sodium glucholate), glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro-24,25-dihydro-fusidate (STDHF), sodium glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, N.Y., 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Yamamoto et al., J. Pharm. Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990, 79, 579-583).
[0669] Chelating Agents: Chelating agents, as used in connection with the present invention, can be defined as compounds that remove metallic ions from solution by forming complexes therewith, with the result that absorption of iRNAs through the mucosa is enhanced. With regards to their use as penetration enhancers in the present invention, chelating agents have the added advantage of also serving as DNase inhibitors, as most characterized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315-339). Suitable chelating agents include but are not limited to disodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylate and homovanilate), N-acyl derivatives of collagen, laureth-9 and N-amino acyl derivatives of β-diketones (enamines)(see e.g., Katdare, A. et al., Excipient development for pharmaceutical, biotechnology, and drug delivery, CRC Press, Danvers, Mass., 2006; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Buur et al., J. Control Rel., 1990, 14, 43-51).
[0670] Non-chelating non-surfactants: As used herein, non-chelating non-surfactant penetration enhancing compounds can be defined as compounds that demonstrate insignificant activity as chelating agents or as surfactants but that nonetheless enhance absorption of iRNAs through the alimentary mucosa (see e.g., Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). This class of penetration enhancers include, for example, unsaturated cyclic ureas, 1-alkyl- and 1-alkenylazacyclo-alkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and non-steroidal anti-inflammatory agents such as diclofenac sodium, indomethacin and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol., 1987, 39, 621-626).
[0671] Agents that enhance uptake of iRNAs at the cellular level may also be added to the pharmaceutical and other compositions of the present invention. For example, cationic lipids, such as lipofectin (Junichi et al, U.S. Pat. No. 5,705,188), cationic glycerol derivatives, and polycationic molecules, such as polylysine (Lollo et al., PCT Application WO 97/30731), are also known to enhance the cellular uptake of dsRNAs. Examples of commercially available transfection reagents include, for example Lipofectamine™ (Invitrogen; Carlsbad, Calif.), Lipofectamine 2000™ (Invitrogen; Carlsbad, Calif.), 293fectin™ (Invitrogen; Carlsbad, Calif.), Cellfectin™ (Invitrogen; Carlsbad, Calif.), DMRIE-C™ (Invitrogen; Carlsbad, Calif.), FreeStyle™ MAX (Invitrogen; Carlsbad, Calif.), Lipofectamine™ 2000 CD (Invitrogen; Carlsbad, Calif.), Lipofectamine™ (Invitrogen; Carlsbad, Calif.), RNAiMAX (Invitrogen; Carlsbad, Calif.), Oligofectamine™ (Invitrogen; Carlsbad, Calif.), Optifect™ (Invitrogen; Carlsbad, Calif.), X-tremeGENE Q2 Transfection Reagent (Roche; Grenzacherstrasse, Switzerland), DOTAP Liposomal Transfection Reagent (Grenzacherstrasse, Switzerland), DOSPER Liposomal Transfection Reagent (Grenzacherstrasse, Switzerland), or Fugene (Grenzacherstrasse, Switzerland), Transfectam® Reagent (Promega; Madison, Wis.), TransFast™ Transfection Reagent (Promega; Madison, Wis.), Tfx™-20 Reagent (Promega; Madison, Wis.), Tfx™-50 Reagent (Promega; Madison, Wis.), DreamFect™ (OZ Biosciences; Marseille, France), EcoTransfect (OZ Biosciences; Marseille, France), TransPass' D1 Transfection Reagent (New England Biolabs; Ipswich, Mass., USA), LyoVec™/LipoGen™ (Invivogen; San Diego, Calif., USA), PerFectin Transfection Reagent (Genlantis; San Diego, Calif., USA), NeuroPORTER Transfection Reagent (Genlantis; San Diego, Calif., USA), GenePORTER Transfection reagent (Genlantis; San Diego, Calif., USA), GenePORTER 2 Transfection reagent (Genlantis; San Diego, Calif., USA), Cytofectin Transfection Reagent (Genlantis; San Diego, Calif., USA), BaculoPORTER Transfection Reagent (Genlantis; San Diego, Calif., USA), TroganPORTER™ transfection Reagent (Genlantis; San Diego, Calif., USA), RiboFect (Bioline; Taunton, Mass., USA), PlasFect (Bioline; Taunton, Mass., USA), UniFECTOR (B-Bridge International; Mountain View, Calif., USA), SureFECTOR (B-Bridge International; Mountain View, Calif., USA), or HiFect™ (B-Bridge International, Mountain View, Calif., USA), among others.
[0672] Other agents may be utilized to enhance the penetration of the administered nucleic acids, including glycols such as ethylene glycol and propylene glycol, pyrrols such as 2-pyrrol, azones, and terpenes such as limonene and menthone.
[0673] Carriers
[0674] Certain compositions of the present invention also incorporate carrier compounds in the formulation. As used herein, “carrier compound” or “carrier” can refer to a nucleic acid, or analog thereof, which is inert (i.e., does not possess biological activity per se) but is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of a nucleic acid having biological activity by, for example, degrading the biologically active nucleic acid or promoting its removal from circulation. The coadministration of a nucleic acid and a carrier compound, typically with an excess of the latter substance, can result in a substantial reduction of the amount of nucleic acid recovered in the liver, kidney or other extracirculatory reservoirs, presumably due to competition between the carrier compound and the nucleic acid for a common receptor. For example, the recovery of a partially phosphorothioate dsRNA in hepatic tissue can be reduced when it is coadministered with polyinosinic acid, dextran sulfate, polycytidic acid or 4-acetamido-4′isothiocyano-stilbene-2,2′-disulfonic acid (Miyao et al., DsRNA Res. Dev., 1995, 5, 115-121; Takakura et al., DsRNA & Nucl. Acid Drug Dev., 1996, 6, 177-183.
[0675] Excipients
[0676] In contrast to a carrier compound, a “pharmaceutical carrier” or “excipient” is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal. The excipient may be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulphate, etc).
[0677] Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can also be used to formulate the compositions of the present invention. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.
[0678] Formulations for topical administration of nucleic acids may include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of the nucleic acids in liquid or solid oil bases. The solutions may also contain buffers, diluents and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can be used.
[0679] Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.
[0680] Other Components
[0681] The compositions of the present invention may additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels. Thus, for example, the compositions may contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful in physically formulating various dosage forms of the compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention. The formulations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the formulation.
[0682] Aqueous suspensions may contain substances that increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.
[0683] In some embodiments, pharmaceutical compositions featured in the invention include (a) one or more iRNA compounds and (b) one or more biologic agents which function by a non-RNAi mechanism. Examples of such biologic agents include agents that interfere with an interaction of ALAS1 and at least one ALAS1 binding partner.
[0684] Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Compounds that exhibit high therapeutic indices are typical.
[0685] The data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of compositions featured in the invention lies generally within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the methods featured in the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range of the compound or, when appropriate, of the polypeptide product of a target sequence (e.g., achieving a decreased concentration of the polypeptide) that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography.
[0686] In addition to their administration, as discussed above, the iRNAs featured in the invention can be administered in combination with other known agents effective in treatment of diseases or disorders related to ALAS1 expression. In any event, the administering physician can adjust the amount and timing of iRNA administration on the basis of results observed using standard measures of efficacy known in the art or described herein.
[0687] Methods for Treating Diseases Related to Expression of an ALAS1 Gene
[0688] The invention relates in particular to the use of an iRNA targeting ALAS1 to inhibit ALAS1 expression and/or to treat a disease, disorder, or pathological process that is related to ALAS1 expression.
[0689] As used herein, “a disorder related to ALAS1 expression,” a “disease related to ALAS1 expression, a “pathological process related to ALAS1 expression,” or the like includes any condition, disorder, or disease in which ALAS1 expression is altered (e.g., elevated), the level of one or more porphyrins is altered (e.g., elevated), the level or activity of one or more enzymes in the heme biosynthetic pathway (porphyrin pathway) is altered, or other mechanisms that lead to pathological changes in the heme biosynthetic pathway. For example, an iRNA targeting an ALAS1 gene, or a combination thereof, may be used for treatment of conditions in which levels of a porphyrin or a porphyrin precursor (e.g., ALA or PBG) are elevated (e.g., certain porphyrias), or conditions in which there are defects in the enzymes of the heme biosynthetic pathway (e.g., certain porphyrias). Disorders related to ALAS1 expression include, for example, X-linked sideroblastic anemia (XLSA), ALA deyhdratase deficiency porphyria (Doss porphyria), acute intermittent porphyria (AIP), congenital erythropoietic porphyria, prophyria cutanea tarda, hereditary coproporphyria (coproporphyria), variegate porphyria, erythropoietic protoporphyria (EPP), and transient erythroporphyria of infancy.
[0690] As used herein, a “subject” to be treated according to the methods described herein, includes a human or non-human animal, e.g., a mammal. The mammal may be, for example, a rodent (e.g., a rat or mouse) or a primate (e.g., a monkey). In some embodiments, the subject is a human.
[0691] In some embodiments, the subject is suffering from a disorder related to ALAS1 expression (e.g., has been diagnosed with a porphyria or has suffered from one or more symptoms of porphyria and is a carrier of a mutation associated with porphyria) or is at risk of developing a disorder related to ALAS1 expression (e.g., a subject with a family history of porphyria, or a subject who is a carrier of a genetic mutation associated with porphyria).
[0692] Classifications of porphyrias, including acute hepatic porphyrias, are described, e.g., in Balwani, M. & Desnick, R. J., Blood, 120(23), published online as Blood First Edition paper, July 12, 102; DOI 10.1182/blood-2012-05-423186. As described in Balwain & Desnick, acute intermittent porphyria (AIP) hereditary coproporphyria (HCP), variegate porphyria (VP) are autosomal dominant porphyrias and ALA deyhdratase deficiency porphyria (ADP) is autosomal recessive. In rare cases, AIP, HCP, and VP occur as homozygous dominant forms. In addition, there is a rare homozygous recessive form of porphyria cutanea tarda (PCT), which is the single hepatic cutaneous porphyria, and is also known as hepatoerythropoietic porphyria. The clinical and laboratory features of these porphyrias are described in Table 11 below.
TABLE-US-00003 TABLE 11 Human hepatic porphyrias: clinical and laboratory features Enzyme Principal activity, Increased porphyrin Deficient symptoms, % of precursors and/or porphyrins* Porphyria enzyme Inheritance NV or CP normal Erythrocytes Urine Stool Acute hepatic porphyrias ADP ALA- AR NV ~5 Zn- ALA, — dehydratase protoporphyrin coproporphyrin III AIP HMB- AD NV ~50 — ALA, PBG, — synthase uroporphyrin HCP COPRO- AD NV and CP ~50 — ALA, PBG, coproporphyrin oxidase coproporphyrin III III VP PROTO- AD NV and CP ~50 — ALA, PBG coproporphyrin oxidase coproporphyrin III, III protoporphyrin Hepatic cutaneous porphyrias PCT URO- Sporadic or CP <20 — uroporphyrin, uroporphyrin, decarboxylase AD 7-carboxylate 7-carboxylate porphyrin porphyrin AR indicates autosomal recessive; AD, autosomal dominant; NV, neurovisceral; CP, cutaneous photosensitivity; and —, not applicable. *Increases that may be important for diagnosis.
[0693] In some embodiments, the subject has or is at risk for developing a porphyria, e.g., a hepatic porphyria, e.g., AIP, HCP, VP, ADP, or hepatoerythropoietic porphyria.
[0694] In some embodiments, the porphyria is an acute hepatic porphyria, e.g., an acute hepatic porphyria is elected from acute intermittent porphyria (AIP), hereditary coproporphyria (HCP), variegate porphyria (VP), and ALA deyhdratase deficiency porphyria (ADP).
[0695] In some embodiments, the porphyria is a dual porphyria, e.g., at least two porphyrias. In some embodiments, the dual porphyria comprises two or more porphyrias selected from acute intermittent porphyria (AIP) hereditary coproporphyria (HCP), variegate porphyria (VP), and ALA deyhdratase deficiency porphyria (ADP).
[0696] In some embodiments, the porphyria is a homozygous dominant hepatic porphyria (e.g., homozygous dominant AIP, HCP, or VP) or hepatoerythropoietic porphyria, In some embodiments, the porphyria is AIP, HCP, VP, or hepatoerythropoietic porphyria, or a combination thereof (e.g., a dual porphyria). In embodiments, the AIP, HCP, or VP is either heterozygous dominant or homozygous dominant.
[0697] In embodiments, the subject has or is at risk for developing a porphyria, e.g., ADP, and shows an elevated level (e.g., an elevated urine level) of ALA and/or coproporphyrin III. In embodiments, the subject has or is at risk for developing a porphyria, e.g., ADP, and shows an elevated level of erythrocyte Zn-protoporphyrin.
[0698] In embodiments, the subject has or is at risk for developing a porphyria, e.g., AIP, and shows an elevated level (e.g., an elevated urine level) of ALA, PBG, and/or uroporphyrin.
[0699] In embodiments, the subject has or is at risk for developing a porphyria, e.g., HCP, and shows an elevated level (e.g., an elevated urine level) of ALA, PBG, and/or coproporphyrin III. In embodiments, the subject has or is at risk for developing a porphyria, e.g., HCP, and shows an elevated level (e.g., an elevated stool level) of coproporphyrin III.
[0700] In embodiments, the subject has or is at risk for developing a porphyria, e.g., VP, and shows an elevated level (e.g., an elevated urine level) of ALA, PBG, and/or coproporphyrin III.
[0701] In embodiments, the subject has or is at risk for developing a porphyria, e.g., HCP, and shows an elevated level (e.g., an elevated stool level) of coproporphyrin III and/or protoporphyrin.
[0702] In embodiments, the subject has or is at risk for developing a porphyria, e.g., PCT, (e.g., hepatoerythropoietic porphyria) and shows an elevated level (e.g., an elevated urine level) of uroporphyrin and/or 7-carboxylate porphyrin. In embodiments, the subject has or is at risk for developing a porphyria, e.g., PCT, (e.g., hepatoerythropoietic porphyria) and shows an elevated level (e.g., an elevated stool level) of uroporphyrin and/or 7-carboxylate porphyrin.
[0703] A mutation associated with porphyria includes any mutation in a gene encoding an enzyme in the heme biosynthetic pathway (porphyrin pathway) or a gene which alters the expression of a gene in the heme biosynthetic pathway. In many embodiments, the subject carries one or more mutations in an enzyme of the porphyrin pathway (e.g., a mutation in ALA deydratase or PBG deaminase). In some embodiments, the subject is suffering from an acute porphyria (e.g., AIP, ALA deydratase deficiency porphyria).
[0704] In some cases, patients with an acute hepatic porphyria (e.g., AIP), or patients who carry mutations associated with an acute hepatic porphyria (e.g., AIP) but who are asymptomatic, have elevated ALA and/or PBG levels compared with healthy individuals. See, e.g., Floderus, Y. et al, Clinical Chemistry, 52(4): 701-707, 2006; Sardh et al., Clinical Pharmacokinetics, 46(4): 335-349, 2007. In such cases, the level of ALA and/or PBG can be elevated even when the patient is not having, or has never had, an attack. In some such cases, the patient is otherwise completely asymptomatic. In some such cases, the patient suffers from pain, e.g., neuropathic pain, which can be chronic pain (e.g., chronic neuropathic pain). In some cases, the patient has a neuropathy. In some cases, the patient has a progressive neuropathy.
[0705] In some embodiments, the subject to be treated according to the methods described herein has an elevated level of a porphyrin or a porphyrin precursor, e.g., ALA and/or PBG. Levels of a porphyrin or a porphyrin precursor can be assessed using methods known in the art or methods described herein. For example, methods of assessing during and plasma ALA and PBG levels, as well as urine and plasma porphyrin levels, are disclosed in Floderus, Y. et al, Clinical Chemistry, 52(4): 701-707, 2006; and Sardh et al., Clinical Pharmacokinetics, 46(4): 335-349, 2007, the entire contents of which are hereby incorporated in their entirety.
[0706] In some embodiments, the subject is an animal model of a porphyria, e.g., a mouse model of a porphyria (e.g., a mutant mouse as described in Lindberg et al. Nature Genetics, 12: 195-199, 1996). In some embodiments, the subject is a human, e.g., a human who has or is at risk for developing a porphyria, as described herein. In some embodiments, the subject is not having an acute attack of porphyria. In some embodiments, the subject has never had an attack. In some embodiments, the patient suffers from chronic pain. In some embodiments, the patient has nerve damage. In embodiments, the subject has EMG changes and/or changes in nerve conduction velocity. In some embodiments, the subject is asymptomatic. In some embodiments, the subject is at risk for developing a porphyria (e.g., carries a gene mutation associated with a porphyria) and is asymptomatic. In some embodiments, the subject has previously had an acute attack but is asymptomatic at the time of treatment.
[0707] In some embodiments, the subject is at risk for developing a porphyria and is treated prophylactically to prevent the development of a porphyria. In some embodiments the subject has an elevated level of a porphyrin or a porphyrin precursor, e.g., ALA and/or PBG. In some embodiments, the prophylactic treatment begins at puberty. In some embodiments the treatment lowers the level (e.g., the plasma level or the urine level) of a porphyrin or a porphyrin precursor, e.g., ALA and/or PBG. In some embodiments, the treatment prevents the development of an elevated level of a porphyrin or a porphyrin precursor, e.g., ALA and/or PBG. In some embodiments, the treatment prevents the development of, or decreases the frequency or severity of, a symptom associated with a porphyria, e.g., pain or nerve damage.
[0708] In some embodiments, the level of a porphyrin or a porphyrin precursor, e.g., ALA or PBG, is elevated, e.g., in a sample of plasma or urine from the subject. In some embodiments, the level of a porphyrin or a porphyrin precursor, e.g., ALA or PBG, in the subject is assessed based on the absolute level of the porphyrin or the porphyrin precursor, e.g., ALA or PBG in a sample from the subject. In some embodiments, the level of a porphyrin or a porphyrin precursor, e.g., ALA or PBG, in the subject is assessed based on the relative level of the porphyrin or porphyrin precursor, e.g., ALA or PBG, in a sample from the subject. In some embodiments, the relative level is relative to the level of another protein or compound, e.g., the level of creatinine, in a sample from the subject. In some embodiments, the sample is a urine sample. In some embodiments, the sample is a plasma sample. In some embodiments, the sample is a stool sample.
[0709] An elevated level of a porphyrin or a porphyrin precursor, e.g., ALA and/or PBG, can be established, e.g., by showing that the subject has a level of a porphyrin or a porphyrin precursor, e.g., ALA and/or PBG (e.g., a plasma or urine level of ALA and/or PBG) that is greater than, or greater than or equal to, a reference value. A physician with expertise in the treatment of porphyrias would be able to determine whether the level of a porphyrin or a porphyrin precursor, (e.g., ALA and/or PBG) is elevated, e.g., for the purpose of diagnosing a porphyria or for determining whether a subject is at risk for developing a porphyria, e.g., a subject may be predisposed to an acute attack or to pathology associated with a porphyria, such as, e.g., chronic pain (e.g., neuropathic pain) and neuropathy (e.g., progressive neuropathy).
[0710] As used herein, a “reference value” refers to a value from the subject when the subject is not in a disease state, or a value from a normal or healthy subject, or a value from a reference sample or population, e.g., a group of normal or healthy subjects (e.g., a group of subjects that does not carry a mutation associated with a porphyria and/or a group of subjects that does not suffer from symptoms associated with a porphyria).
[0711] In some embodiments, the reference value is a pre-disease level in the same individual. In some embodiments, the reference value is a level in a reference sample or population. In some embodiments, the reference value is the mean or median value in a reference sample or population. In some embodiments, the reference value the value that is two standard deviations above the mean in a reference sample or population. In some embodiments, the reference value is the value that is 2.5, 3, 3.5, 4, 4.5, or 5 standard deviations above the mean in a reference sample or population.
[0712] In some embodiments, wherein the subject has an elevated level of a porphyrin or a porphyrin precursor, e.g., ALA and/or PBG, the subject has a level of ALA and/or PBG that is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% higher than a reference value. In some embodiments, the subject has a level of a porphyrin or a porphyrin precursor, e.g., ALA and/or PBG, that is at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 fold higher than a reference value.
[0713] In some embodiments, the reference value is an upper reference limit. As used herein, an “upper reference limit” refers to a level that is the upper limit of the 95% confidence interval for a reference sample or population, e.g., a group of normal (e.g., wild type) or healthy individuals, e.g., individuals who do not carry a genetic mutation associated with a porphyria and/or individuals who do not suffer from a porphyria. Accordingly, a lower reference limit refers to a level that is the lower limit of the same 95% confidence interval.
[0714] In some embodiments wherein the subject has an elevated level, e.g., a plasma level or a urine level, of a porphyrin or a porphyrin precursor, e.g., ALA or PBG, the level is greater than or equal to 2 times, 3 times, 4 times, or 5 times that of a reference value, e.g., an upper reference limit. In some embodiments, the subject has a urine level of a porphyrin or a porphyrin precursor, e.g., ALA or PBG, that is greater than 4 times that of an upper reference limit.
[0715] In some embodiments, the reference value is a value provided in Floderus, Y. et al, Clinical Chemistry, 52(4): 701-707, 2006 or Sardh et al., Clinical Pharmacokinetics, 46(4): 335-349, 2007. In some embodiments, the reference value is a value provided in Table 1 of Sardh et al.
[0716] In some embodiments, the subject is a human and has a urine level of PBG that is greater than or equal to 4.8 mmol/mol creatinine. In certain embodiments, the subject is a human and has a urine level of PBG that is greater than, or greater than or equal to, about 3, 4, 5, 6, 7, or 8 mmol/mol creatinine.
[0717] In embodiments, the reference value for plasma PBG is 0.12 μmol/L. In embodiments, the subject is a human and has a plasma PBG level that is greater than, or greater than or equal to, 0.10 μmol/L, 0.12 μmol/L, 0.24 μmol/L, 0.36 μmol/L, 0.48 μmol/L, or 0.60 μmol/L. In embodiments, the subject is a human and has a plasma level of PBG that is greater than, or greater than or equal to, 0.48 μmol/L.
[0718] In embodiments, the reference value for urine PBG is 1.2 mmol/mol creatinine. In embodiments, the subject is a human and has a urine PBG level that is greater than, or greater than or equal to, 1.0 mmol/mol creatinine, 1.2 mmol/mol creatinine, 2.4 mmol/mol creatinine, 3.6 mmol/mol creatinine, 4.8 mmol/mol creatinine, or 6.0 mmol/mol creatinine. In embodiments, the subject is a human and has a urine level of PBG that is greater than, or greater than or equal to, 4.8 mmol/mol creatinine.
[0719] In embodiments, the reference value for plasma ALA is 0.12 μmol/L. In embodiments, the subject is a human and has a plasma ALA level that is greater than, or greater than or equal to, 0.10 μmol/L, 0.12 μmol/L, 0.24 μmol/L, 0.36 μmol/L, 0.48 μmol/L, or 0.60 μmol/L. In embodiments, the subject is a human and has a plasma ALA level that is greater than, or greater than or equal to 0.48 μmol/L.
[0720] In embodiments, the reference value for urine ALA is 3.1 mmol/mol creatinine. In embodiments, the subject is a human and has a urine ALA level that is greater than, or greater than or equal to, 2.5 mmol/mol creatinine, 3.1 mmol/mol creatinine, 6.2 mmol/mol creatinine, 9.3 mmol/mol creatinine, 12.4 mmol/mol creatinine, or 15.5 mmol/mol creatinine.
[0721] In embodiments, the reference value for plasma porphyrin is 10 nmol/L. In embodiments, the subject is a human and has a plasma porphyrin level that is greater than, or greater than or equal to, 10 nmol/L. In embodiments, the subject is a human and has a plasma porphyrin level that is greater than, or greater than or equal to, 8, 10, 15, 20, 25, 30, 35, 40, 45, or 50 nmol/L. the subject is a human and has a plasma porphyrin level that is greater than, or greater than or equal to 40 nmol/L. In embodiments, the reference value for urine porphyrin is 25 μmol/mol creatinine. In embodiments, the subject is a human and has a urine porphyrin level that is greater than, or greater than or equal to, 25 μmol/mol creatinine. In embodiments, the subject is a human and has a urine porphyrin level that is greater than, or equal to, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, or 80 μmol/mol creatinine.
[0722] In some embodiments, the subject has a level, e.g., a plasma level or a urine level, of a porphyrin or a porphyrin precursor, e.g., ALA or PBG, that is greater than that of 99% of individuals in a sample of healthy individuals.
[0723] In some embodiments, the subject has a level, e.g., a plasma level or a urine level, of ALA or PBG that is greater than two standard deviations above the mean level in a sample of healthy individuals.
[0724] In some embodiments, the subject has a urine level of ALA that is 1.6 or more times that of the mean level in a normal subject (e.g., a subject that does not carry a mutation associated with a porphyria). In some embodiments, the subject has a plasma level of ALA that is 2 or 3 times that of the mean level in a normal subject. In some embodiments, the subject has a urine level of PBG that is four or more times that of the mean level in a normal subject. In some embodiments, the subject has a plasma level of PBG that is four or more times that of the mean level in a normal subject.
[0725] In some embodiments, the method is effective to decrease the level of a porphyrin or a porphyrin precursor, e.g., ALA and/or PBG. In embodiments, the method is effective to produce a predetermined reduction in the elevated level of the porphyrin or porphyrin precursor, e.g., ALA or PBG. In some embodiments, the predetermined reduction is a decrease of at least 10%, 20%, 30%, 40%, or 50%. In some embodiments, the predetermined reduction is a reduction that is effective to prevent or ameliorate symptoms, e.g., pain or recurring attacks.
[0726] In some embodiments, the predetermined reduction is a reduction that is at least 1, 2, 3, or more standard deviations, wherein the standard deviation is determined based on the values from a reference sample, e.g., a reference sample as described herein.
[0727] In some embodiments, the predetermined reduction is a reduction that brings the level of the porphyrin or porphyrin precursor to a level that is less than, or to a level that is less than or equal to, a reference value (e.g., a reference value as described herein).
[0728] In some embodiments, the subject to be treated according to the methods described suffers from pain, e.g., chronic pain. In some embodiments, the subject has or is at risk for developing a porphyria, e.g. an acute hepatic porphyria, e.g., AIP. In embodiments, the method is effective to treat the pain, e.g., by reducing the severity of the pain or curing the pain. In embodiments, the method is effective to decrease or prevent nerve damage.
[0729] In some embodiments, the subject to be treated according to the methods described herein (a) has an elevated level of ALA and/or PBG and (b) suffers from pain, e.g., chronic pain. In embodiments, the method is effective to decrease an elevated level of ALA and/or PBG and/or to treat the pain, e.g., by reducing the severity of the pain or curing the pain.
[0730] In some embodiments, the subject is an animal that serves as a model for a disorder related to ALAS1 expression.
[0731] In some embodiments the subject is an animal that serves as a model for porphyria (e.g., a genetically modified animal with one or more mutations. In some embodiments, the porphyria is AIP and the subject is an animal model of AIP. In one such embodiment, the subject is a genetically modified mouse that is deficient in porphobilinogen deaminase, such as, for example, the mouse described in Lindberg et al., Nature Genetics, 12:195-199, 1996, or the homozygous R167Q mouse described in Yasuda, M., Yu, C. Zhang, J., Clavero, S., Edelmann, W., Gan, L., Phillips, J. D., & Desnick, R. J. Acute intermittent porphyria: A severely affected knock-in mouse that mimics the human homozygous dominant phenotype. (Abstract of Presentation on Oct. 14, 2011 at the American Society of Human Genetics; Program No. 1308F; accessed online on Apr. 4, 2012 at ichg2011.org/cgi-bin/showdetail.pl?absno=21167); both of these references are hereby incorporated herein in their entirety. Several knock-in models for mutations causing homozygous dominant AIP in humans have been generated. The mutations employed include, e.g., R167Q, R173Q, and R173W in PBG deaminase. Viable homozygotes included the R167Q/R176Q and R167Q/R173Q, both of which exhibit constitutively elevated ALA and PBG levels analogous to the phenotype in human homozygous dominant AIP; in some embodiments, such a viable homozygous AIP mouse model is the subject.
[0732] In one embodiment, a subject to be treated according to the methods described herein, (e.g., a human subject or patient), is at risk of developing, or has been diagnosed, with a disorder related to ALAS1 expression, e.g. a porphyria. In some embodiments, the subject is a subject who has suffered one or more acute attacks of one or more porphyric symptoms. In other embodiments, the subject is a subject who has suffered chronically from one or more symptoms of porphyria (e.g., pain, e.g., neuropathic pain and or neuropathy, e.g., progressive neuropathy). In some embodiments, the subject carries a genetic alteration (e.g., a mutation) as described herein but is otherwise asymptomatic. In some embodiments, the subject has previously been treated with a heme product (e.g., hemin, heme arginate, or heme albumin), as described herein.
[0733] In some embodiments, a subject (e.g., a subject with a porphyria, such as, e.g., AIP) to be treated according to the methods described herein has recently experienced or is currently experiencing a prodrome. In some such embodiments, the subject is administered a combination treatment, e.g., an iRNA as described herein, and one or more additional treatments known to be effective against porphyria (e.g., glucose and/or a heme product such as hemin, as described herein) or its associated symptoms.
[0734] In one embodiment, an iRNA as described herein is administered in combination with glucose or dextrose. For example, 10-20% dextrose in normal saline may be provided intravenously. Typically, when glucose is administered, at least 300 g of 10% glucose is administered intravenously daily. The iRNA (e.g., an iRNA in an LNP formulation) may also be administered intravenously, as part of the same infusion that is used to administer the glucose or dextrose, or as a separate infusion that is administered before, concurrently, or after the administration of the glucose or dextrose. In some embodiments, the iRNA is administered via a different route of administration (e.g., subcutaneously). In yet another embodiment, the iRNA is administered in combination with total parenteral nutrition. The iRNA may be administered before, concurrent with, or after the administration of total parenteral nutrition.
[0735] In one embodiment, the iRNA is administered in combination with a heme product (e.g., hemin, heme arginate, or heme albumin). In a further embodiment, the iRNA is administered in combination with a heme product and glucose, a heme product and dextrose, or a heme product and total parenteral nutrition.
[0736] A “prodrome,” as used herein, includes any symptom that the individual subject has previously experienced immediately prior to developing an acute attack. Typical symptoms of a prodrome include, e.g., abdominal pain, nausea, headaches, psychological symptoms (e.g., anxiety), restlessness and/or insomnia. In some embodiments, the subject experiences pain (e.g., abdominal pain and/or a headache) during the prodrome. In some embodiments, the subject experiences nausea during the prodrome. In some embodiments, the subject experiences psychological symptoms (e.g., anxiety) during the prodrome. In some embodiments, the subject becomes restless and/or suffers from insomnia during the prodrome.
[0737] An acute “attack” of porphyria involves the onset of one or more symptoms of porphyria, typically in a patient who carries a mutation associated with porphyria (e.g., a mutation in a gene that encodes an enzyme in the porphyrin pathway).
[0738] In certain embodiments, administration of an ALAS1 iRNA results in a decrease in the level of one or more porphyrins or porphyrin precursors, as described herein (e.g., ALA and/or PBG). The decrease may be measured relative to any appropriate control or reference value. For example, the decrease in the level of one or more porphyrins or porphyrin precursors may be established in an individual subject, e.g., as a decrease of at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% or more compared with the level prior to treatment (e.g., immediately prior to treatment). A decrease in the level of a porphyrin precursor, a porphyrin, or or a porphyrin metabolite may be measured using any method known in the art. For example, the level of PBG and/or ALA in urine or plasma may be assessed, using the Watson-Schwartz test, ion exchange chromatography, or high-performance liquid chromatography—mass spectrometry. See, e.g., Thunell (1993).
[0739] In some embodiments, administration of an ALAS1 siRNA is effective to reduce the level of ALA and/or PBG in the subject. The level of ALA or PBG in the subject can be assessed, e.g., based on the absolute level of ALA or PBG, or based on the relative level of ALA or PBG (e.g., relative to the level of another protein or compound, e.g., the level of creatinine) in a sample from the subject. In some embodiments, the sample is a urine sample. In some embodiments, the sample is a plasma sample.
[0740] In certain embodiments, an iRNA that targets ALAS1 is administered in combination one or more additional treatments, e.g., another treatment known to be effective in treating porphyria or symptoms of porphyria. For example, the other treatment may be glucose (e.g., IV glucose) or a heme product (e.g., hemin, heme arginate, or heme albumin). The additional treatment(s) may be administered before, after, or concurrent with the administration of iRNA.
[0741] The iRNA and an additional therapeutic agent can be administered in combination in the same composition, e.g., intravenously, or the additional therapeutic agent can be administered as part of a separate composition or by another method described herein.
[0742] In some embodiments, administration of iRNA, or administration of iRNA in combination one or more additional treatments (e.g., glucose, dextrose or the like), decreases the frequency of acute attacks (e.g., by preventing acute attacks so that they no longer occur, or by reducing the number of attacks that occur in a certain time period, e.g., fewer attacks occur per year). In some such embodiments, the iRNA is administered according to a regular dosing regimen, e.g., daily, weekly, biweekly, or monthly.
[0743] In some embodiments, the iRNA is administered after an acute attack of porphyria. In some such embodiments, the iRNA is in a composition, e.g. a composition comprising a lipid formulation, e.g. an LNP formulation.
[0744] In some embodiments, the iRNA is administered during an acute attack of porphyria. In some such embodiments, the iRNA is in a composition, e.g. a composition comprising a lipid formulation (e.g., an LNP formulation) or a composition comprising a GalNAc conjugate.
[0745] In some embodiments, administration of an ALAS1 siRNA is effective to lessen the severity of the attack (e.g., by ameliorating one or more signs or symptoms associated with the attack). In some embodiments, administration of an ALAS1 siRNA is effective to shorten the duration of an attack. In some embodiments, administration of an ALAS1 siRNA is effective to stop an attack. In some embodiments, the iRNA is administered prophylactically to prevent an acute attack of porphyria. In some such embodiments, the iRNA is in the form of a GalNAc conjugate, e.g., in a composition comprising a GalNAc conjugate. In some embodiments, the prophylactic administration is before, during, or after exposure to or occurrence of a precipitating factor. In some embodiments, the subject is at risk of developing porphyria.
[0746] In some embodiments, the siRNA is administered during a prodrome. In some embodiments, the prodrome is characterized by pain (e.g., headache and/or abdominal pain), nausea, psychological symptoms (e.g., anxiety), restlessness and/or insomnia.
[0747] In some embodiments, the siRNA is administered during a particular phase of the menstrual cycle, e.g., during the luteal phase.
[0748] In some embodiments, administration of an ALAS1 siRNA is effective to prevent attacks (e.g., recurrent attacks that are associated with a prodrome and/or with a precipitating factor, e.g., with a particular phase of the menstrual cycle, e.g., the luteal phase). In some embodiments, administration of an ALAS1 siRNA is effective to reduce the frequency of attacks. In embodiments, administration of an ALAS1 siRNA is effective to lessen the severity of the attack (e.g., by ameliorating one or more signs or symptoms associated with the attack). In some embodiments, administration of an ALAS1 siRNA is effective to shorten the duration of an attack. In some embodiments, administration of an ALAS1 siRNA is effective to stop an attack.
[0749] In some embodiments administration of an ALAS1 siRNA is effective to prevent or decrease the frequency or severity of pain, e.g., neuropathic pain.
[0750] In some embodiments administration of an ALAS1 siRNA is effective to prevent or decrease the frequency or severity of neuropathy
[0751] Effects of administration of an ALAS1 siRNA can be established, for example, by comparison with an appropriate control. For example, a decrease in the frequency of acute attacks, as well as a decrease in the level of one or more porphyrins or porphyrin precursors, may be established, for example, in a group of patients with AIP, as a decreased frequency compared with an appropriate control group. A control group (e.g., a group of similar individuals or the same group of individuals in a crossover design) may include, for example, an untreated population, a population that has been treated with a conventional treatment for porphyria (e.g., a conventional treatment for AIP may include glucose, hemin, or both); a population that has been treated with placebo, or a non-targeting iRNA, optionally in combination with one or more conventional treatments for porphyria (e.g., glucose, e.g., IV glucose), and the like.
[0752] A subject “at risk” of developing porphyria, as used herein, includes a subject with a family history of porphyria and/or a history of one or more recurring or chronic porphyric symptoms, and/or a subject who carries a genetic alteration (e.g., a mutation) in a gene encoding an enzyme of the heme biosynthetic pathway, and a subject who carries a genetic alteration, e.g., a mutation. known to be associated with porphyria.
[0753] In embodiments, the alteration, e.g., the mutation, makes an individual susceptible to an acute attack (e.g., upon exposure to a precipitating factor, e.g., a drug, dieting or other precipitating factor, e.g., a precipitating factor as disclosed herein). In embodiments, the alteration, e.g., the mutation, is associated with elevated levels of a porphyrin or a porphyrin precursor (e.g., ALA and/or PBG). In embodiments, the alteration, e.g., the mutation, is associated with chronic pain (e.g., chronic neuropathic pain) and/or neuropathy (e.g., progressive neuropathy). In embodiments, the, the alteration, e.g., the mutation, is associated with changes in EMG and/or nerve conduction velocities.
[0754] In embodiments, the alteration is a mutation in the ALAS1 gene. In embodiments, the alteration is a mutation in the ALAS1 gene promoter, or in regions upstream or downstream from the ALAS1 gene. In embodiments, the alteration is a mutation in transcription factors or other genes that interact with ALAS1. In embodiments, the alteration is an alteration, e.g., a mutation, in a gene that encodes an enzyme in the heme biosynthetic pathway.
[0755] In some embodiments, the subject has an genetic alteration as described herein (e.g., a genetic mutation known to be associated with a porphyria). In some such embodiments, the subject has an elevated level (e.g., urine or plasma level) of ALA and/or PBG. In some such embodiments, the subject does not have an elevated level of ALA and/or PBG. In embodiments, the subject has a genetic alteration as described herein and has other symptoms, e.g., chronic pain, EMG changes, changes in nerve conduction velocity, and/or other symptoms associated with a porphyria. In embodiments, the subject has a genetic alteration but does not suffer from acute attacks.
[0756] In embodiments, the subject has a mutation associated with AIP, HCP, VP, or ADP.
[0757] In some embodiments, the porphyria is AIP. In some such embodiments, the subject has an alteration, e.g., at least one mutation, in the PBG deaminase gene. Many PBG deaminase mutations are known in the art, for example, as reported in Hrdinka, M. et al. Physiological Research, 55 (Suppl 2):S119-136 (2006). In some embodiments, the subject is heterozygous for a PBG deaminase mutation. In other embodiments, the subject is homozygous for a PBG deaminase mutation. A homozygous subject may carry two identical mutations or two different mutations in the PBG deaminase gene.
[0758] In some embodiments, the porphyria is HCP. In some such embodiments, the subject has an alteration, e.g., at least one mutation, in the gene that encodes the enzyme coproporphyrinogen III oxidase.
[0759] In some embodiments, the porphyria is VP. In some such embodiments, the subject has an alteration, e.g., at least one mutation, in the gene that encodes protoporphrinogen oxidase.
[0760] In embodiments, the porphyria is ADP, e.g., autosomal recessive ADP. In some such embodiments, the subject has an alteration, e.g., at least one mutation, in the gene that encodes ALA deydratase.
[0761] Methods of treatment provided herein may serve to ameliorate one or more symptoms associated with porphyria, to reduce the frequency of attacks associated with porphyria, to reduce the likelihood that an attack of one or more symptoms associated with porphyria will occur upon exposure to a precipitating factor, or to reduce the risk of developing conditions associated with porphyria (e.g., neuropathy (e.g., progressive neuropathy), hepatocellular cancer). Additionally, the methods provided herein may serve to decrease the level of one or more porphyrin precursors, porphyrins and/or related porphyrin products or metabolites. The level of a porphyrin precursor or a porhyrin may be measured in any biological sample, such as, e.g., urine, blood, feces, cerebrospinal fluid, or a tissue sample. The sample may be present within a subject or may be obtained or extracted from the subject. In some embodiments, the porphyria is AIP, and the level of PBG and/or ALA is decreased. In some embodiments, the porphyrin product or metabolite is porphobilin, porphobilinogen, or uroporphyrin. A decrease in the level of a porphyrin product or metabolite may be measured using any method known in the art. For example, the level of PBG and/or ALA in urine or plasma may be assessed, using the Watson-Schwartz test, ion exchange chromatography, or high-performance liquid chromatography-mass spectrometry. See, e.g., Thunell (1993).
[0762] Methods described herein may also serve to reduce chronically elevated levels of porphyrin precursors (e.g., ALA and/or PBG) in subjects suffering from a porphyria (e.g., an acute hepatic porphyria, e.g., AIP) or at risk for developing a porphyria. Methods for assessing plasma and urine levels (e.g., chronically elevated levels) of porphyrin precursors include, e.g., HPLC-mass spectrometry and ion-exchange chromatography. The levels of porphyrin precursors may be expressed as the level relative to another protein or compound, e.g., creatinine. See, e.g., Floderus, Y. et al, Clinical Chemistry, 52(4): 701-707, 2006; Sardh et al., Clinical Pharmacokinetics, 46(4): 335-349, 2007
[0763] A “precipitating factor” as used herein, refers to an endogenous or exogenous factor that may induce an acute attack of one or more symptoms associated with porphyria. Precipitating factors include fasting (or other forms of reduced or inadequate caloric intake, due to crash diets, long-distance athletics, etc.), metabolic stresses (e.g., infections, surgery, international air travel, and psychological stress), endogenous hormones (e.g., progesterone), cigarette smoking, lipid-soluble foreign chemicals (including, e.g., chemicals present in tobacco smoke, certain prescription drugs, organic solvents, biocides, components in alcoholic beverages), endocrine factors (e.g., reproductive hormones (women may experience exacerbations during the premenstrual period), synthetic estrogens, progesterones, ovulation stimulants, and hormone replacement therapy). See, for example, Thunell (1993). Common precipitating factors include cytochrome P450 inducing drugs and phenobarbital.
[0764] Symptoms associated with porphyria may include abdominal pain or cramping, headaches, effects caused by nervous system abnormalities, and light sensitivity, causing rashes, blistering, and scarring of the skin (photodermatitis). In certain embodiments, the porphyria is AIP. Symptoms of AIP include gastrointestinal symptoms (e.g., severe and poorly localized abdominal pain, nausea/vomiting, constipation, diarrhea, ileus), urinary symptoms (dysuria, urinary retention/incontinence, or dark urine), neurologic symptoms (e.g., sensory neuropathy, motor neuropathy (e.g., affecting the cranial nerves and/or leading to weakness in the arms or legs), seizures, neuropathic pain, progressive neuropathy, headaches, neuropsychiatric symptoms (e.g., mental confusion, anxiety, agitation, hallucination, hysteria, delirium, apathy, depression, phobias, psychosis, insomnia, somnolence, coma), autonomic nervous system involvement (resulting e.g., in cardiovascular symptoms such as tachycardia, hypertension, and/or arrhythmias, as well as other symptoms, such as, e.g., increased circulating catecholamine levels, sweating, restlessness, and/or tremor), dehydration, and electrolyte abnormalities.
[0765] In some embodiments, an iRNA targeting ALAS1 is administered together with (e.g., before, after, or concurrent with) another treatment that may serve to alleviate one or more of the above symptoms. For example, abdominal pain may be treated, e.g., with narcotic analgesics, seizures may be treated, e.g., with anti-seizure medications, nausea/vomiting may be treated, e.g., with phenothiazines, and tachycardia/hypertension may be treated, e.g., with beta blockers.
[0766] The term “decrease” (or “increase”) is intended to refer to a measurable change, e.g., a statistically significant change. The change may be, for example, at least 5%, 10%, 20%, 30%, 40%, 50% or more change (e.g., decrease (or increase) relative to a reference value, e.g., a reference where no iRNA is provided).
[0767] The invention further relates to the use of an iRNA or a pharmaceutical composition thereof, e.g., for treating a disorder related to ALAS1 expression, in combination with other pharmaceuticals and/or other therapeutic methods, e.g., with known pharmaceuticals and/or known therapeutic methods, such as, for example, those which are currently employed for treating the disorder. In one embodiment, the iRNA or pharmaceutical composition thereof can be administered in conjunction with a heme product (e.g., hemin, heme arginate, or heme albumin, as described herein) and/or in conjunction with intravenous glucose infusions. In some embodiments, the iRNA or pharmaceutical composition thereof is used prophylactically, e.g., to prevent or ameliorate symptoms of an anticipated attack of acute porphyria. The prophylactic use may be timed according to the exposure or anticipated exposure of the subject to a precipitating factor. As described herein, a precipitating factor may be any endogenous or exogenous factor known to precipitate an acute attack. For example, the premenstrual phase is an endogenous precipitating factor, and a cytochrome P450 inducing drug is an exogenous precipitating factor.
[0768] The effective amount for the treatment of a disorder related to ALAS1 expression (e.g., a porphyria such as AIP) depends on the type of disorder to be treated, the severity of the symptoms, the subject being treated, the sex, age and general condition of the subject, the mode of administration and so forth. For any given case, an appropriate “effective amount” can be determined by one of ordinary skill in the art using routine experimentation. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters. In connection with the administration of an iRNA targeting ALAS1 or pharmaceutical composition thereof, “effective against” a disorder related to ALAS1 expression indicates that administration in a clinically appropriate manner results in a beneficial effect, e.g., for an individual patient or for at least a fraction of patients, e.g., a statistically significant fraction of patients. Beneficial effects include, e.g., prevention of or reduction of symptoms or other effects. For example, beneficial effects include, e.g., an improvement (e.g., decrease in the severity or frequency) of symptoms, a reduction in the severity or frequency of attacks, a reduced risk of developing associated disease (e.g., neuropathy (e.g., progressive neuropathy), hepatocellular cancer), an improved ability to tolerate a precipitating factor, an improvement in quality of life, a reduction in the expression of ALAS1, a reduction in a level (e.g., a plasma or urine level) of a porphyrin or a porphyrin precursor (e.g., ALA and/or PBG) or other effect generally recognized as positive by medical doctors familiar with treating the particular type of disorder.
[0769] A treatment or preventive effect is evident when there is an improvement, e.g., a statistically significant improvement in one or more parameters of disease status, or by a failure to worsen or to develop symptoms where they would otherwise be anticipated. As an example, a favorable change of at least 10% in a measurable parameter of disease, e.g., at least 20%, 30%, 40%, 50% or more can be indicative of effective treatment. Efficacy for a given iRNA drug or formulation of that drug can also be judged using an experimental animal model for the given disease as known in the art. When using an experimental animal model, efficacy of treatment is evidenced when a statistically significant reduction in a marker (e.g., plasma or urinary ALA or PBG) or symptom is observed.
[0770] Patients can be administered a therapeutic amount of iRNA. The therapeutic amount can be, e.g., 0.05-50 mg/kg. For example, the therapeutic amount can be 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, or 2.5, 3.0, 3.5, 4.0, 4.5, 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 mg/kg dsRNA.
[0771] In some embodiments, the iRNA is formulated as a lipid formulation, e.g., an LNP formulation as described herein. In some such embodiments, the therapeutic amount is 0.05-5 mg/kg, e.g., 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, or 5.0 mg/kg dsRNA. In some embodiments, the lipid formulation, e.g., LNP formulation, is administered intravenously.
[0772] In some embodiments, the iRNA is administered by intravenous infusion over a period of time, such as over a 5 minute, 10 minute, 15 minute, 20 minute, or 25 minute period. In some embodiments, the iRNA is in the form of a GalNAc conjugate as described herein. In some such embodiments, the therapeutic amount is 0.5-50 mg, e.g., 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 mg/kg dsRNA. In some embodiments, the GalNAc conjugate is administered subcutaneously.
[0773] In some embodiments, the administration is repeated, for example, on a regular basis, such as, daily, biweekly (i.e., every two weeks) for one month, two months, three months, four months or longer. After an initial treatment regimen, the treatments can be administered on a less frequent basis. For example, after administration biweekly for three months, administration can be repeated once per month, for six months or a year or longer.
[0774] In some embodiments, the iRNA agent is administered in two or more doses. In some embodiments, the number or amount of subsequent doses is dependent on the achievement of a desired effect, e.g., suppression of a ALAS gene, reduction of a level of a porphyrin or porphyrin precursor (e.g., ALA and/or PBG), or the achievement of a therapeutic or prophylactic effect, e.g., reduction or prevention of one or more symptoms associated with porphyria (e.g., pain, e.g., neuropathic pain), and/or prevention of attacks or reduction in the frequency and/or severity of attacks associated with porphyria.
[0775] In some embodiments, the iRNA agent is administered according to a schedule. For example, the iRNA agent may be administered once per week, twice per week, three times per week, four times per week, or five times per week. In some embodiments, the schedule involves regularly spaced administrations, e.g., hourly, every four hours, every six hours, every eight hours, every twelve hours, daily, every 2 days, every 3 days, every 4 days, every 5 days, weekly, biweekly, or monthly. In embodiments, the iRNA agent is administered weekly or biweekly to achieve a desired effect, e.g., to decrease the level of ALA and/or PBG, to decrease pain, and/or to prevent acute attacks.
[0776] In embodiments, the schedule involves closely spaced administrations followed by a longer period of time during which the agent is not administered. For example, the schedule may involve an initial set of doses that are administered in a relatively short period of time (e.g., about every 6 hours, about every 12 hours, about every 24 hours, about every 48 hours, or about every 72 hours) followed by a longer time period (e.g., about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, or about 8 weeks) during which the iRNA agent is not administered. In one embodiment, the iRNA agent is initially administered hourly and is later administered at a longer interval (e.g., daily, weekly, biweekly, or monthly). In another embodiment, the iRNA agent is initially administered daily and is later administered at a longer interval (e.g., weekly, biweekly, or monthly). In certain embodiments, the longer interval increases over time or is determined based on the achievement of a desired effect. In a specific embodiment, the iRNA agent is administered once daily during an acute attack, followed by weekly dosing starting on the eighth day of administration. In another specific embodiment, the iRNA agent is administered every other day during a first week followed by weekly dosing starting on the eighth day of administration.
[0777] In one embodiment, the iRNA agent is administered to prevent or reduce the severity or frequency of recurring attacks, e.g., cyclical attacks associated with a precipitating factor. In some embodiments, the precipitating factor is the menstrual cycle. In some embodiments, the iRNA is administered repeatedly, e.g., at regular intervals to prevent or reduce the severity or frequency of recurring attacks, e.g., cyclical attacks associated with a precipitating factor, e.g., the menstrual cycle, e.g., a particular phase of the menstrual cycle, e.g., the luteal phase. In some embodiments, the iRNA is administered during a particular phase of the menstrual cycle or based on hormone levels of the patient being treated (e.g., based on hormone levels that are associated with a particular phase of the menstrual cycle). In some embodiments, the iRNA is administered on one or more particular days of the menstrual cycle, e.g., on day 1, 2, 3, 4, 5, 6, 7, 8. 9. 10. 11. 12. 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or on day 28 (or later day for subjects who have a longer menstrual cycle). In some embodiments, the iRNA is administered during the luteal phase, e.g., on one or more days between days 14-28 of the menstrual cycle (or later, in subjects who have a menstrual cycle longer than 28 days). In some embodiments, ovulation of the subject is assessed (e.g., using a blood or urine test that detects a hormone associated with ovulation, e.g., LH) and the iRNA is administered at a predetermined interval after ovulation. In some embodiments, the iRNA is administered immediately after ovulation. In some embodiments, the iRNA is administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 days after ovulation. Any of these schedules may optionally be repeated for one or more iterations. The number of iterations may depend on the achievement of a desired effect, e.g., the suppression of a ALAS1 gene and/or the achievement of a therapeutic or prophylactic effect, e.g., reduce or prevent one or more symptoms associated with porphyria, to reduce the frequency of attacks associated with porphyria.
[0778] In some embodiments, an initial dose of the iRNA agent is administered and the level of ALA or PBG is tested, e.g., 1-48 hours, e.g., 2, 4, 8, 12, or 24 hours following administration of the initial dose. In some embodiments, if the level of ALA and/or PBG has decreased (e.g., to achieve a predetermined reduction, e.g., a normalization), and/or if the symptoms associated with porphyria (e.g., pain) have improved (e.g., such that the patient is asymptomatic), no further dose is administered, whereas if the level of ALA and/or PBG has not decreased (e.g., has not achieved a predetermined reduction, e.g., has not normalized), a further dose of ALA or PBG is administered. In some embodiments, the further dose is administered 12, 24, 36, 48, 60, or 72 hours after the initial dose. In some embodiments, if the initial dose is not effective to decrease the level of ALA and/or PBG, the further dose is modified, e.g., increased to achieve a desired decrease (e.g., a predetermined reduction, e.g., a normalization) in ALA or PBG levels.
[0779] In some embodiments, the predetermined reduction is a decrease of at least 10%, 20%, 30%, 40%, or 50%. In some embodiments, the predetermined reduction is a reduction that is effective to prevent or ameliorate symptoms, e.g., pain, prodromal symptoms, or recurring attacks.
[0780] In some embodiments, the predetermined reduction is a reduction of at least 1, 2, 3, or more standard deviations, wherein the standard deviation is determined based on the values from a reference sample, e.g., a reference sample as described herein.
[0781] In some embodiments, the predetermined reduction is a reduction that brings the level of the porphyrin or porphyrin precursor to a level that is less than, or to a level that is less than or equal to, a reference value (e.g., a reference value as described herein).
[0782] As used herein, a “normalization” in ALA or PBG levels (or a “normal” or “normalized” level) refers to a level (e.g., a urine and/or plasma level) of either ALA, or PBG, or both, that is within the expected range for a healthy individual, an individual who is asymptomatic (e.g., an individual who does not experience pain and/or suffer from neuropathy), or an individual who does not have a mutation associated with a porphyria. For example, in some embodiments, a normalized level is within two standard deviations of the normal mean. In some embodiments, a normalized level is within normal reference limits, e.g., within the 95% confidence interval for an appropriate control sample, e.g., a sample of healthy individuals or individuals who do not carry a gene mutation associated with a porphyria. In some embodiments, the ALA and/or PBG level of the subject (e.g., the urine and/or plasma ALA and/or PBG level) is monitored at intervals, a further dose of the iRNA agent is administered when the level increases above the reference value
[0783] Administration of the iRNA may reduce ALAS1 mRNA or protein levels, e.g., in a cell, tissue, blood, urine or other compartment of the patient by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80 or at least 90% or more. Administration of the iRNA may reduce levels of products associated with ALAS1 gene expression, e.g., levels of one or more porphyrins or porphyrin precursors (e.g., the level of ALA and/or PBG). Administration of the iRNA agent may also inhibit or prevent the upregulation of ALAS1 mRNA or protein levels during an acute attack of AIP.
[0784] Before administration of a full dose of the iRNA, patients can be administered a smaller dose, such as a 5% infusion dose, and monitored for adverse effects, such as an allergic reaction, or for elevated lipid levels or blood pressure. In another example, the patient can be monitored for unwanted effects.
[0785] Methods for Modulating Expression of an ALAS1 Gene
[0786] In yet another aspect, the invention provides a method for modulating (e.g., inhibiting or activating) the expression of an ALAS1 gene, e.g., in a cell or in a subject. In some embodiments, the cell is ex vivo, in vitro, or in vivo. In some embodiments, the cell is an erythroid cell or a hepatocyte. In some embodiments, the cell is in a subject (e.g., a mammal, such as, for example, a human). In some embodiments, the subject (e.g., the human) is at risk, or is diagnosed with a disease related to ALAS1 expression, as described above.
[0787] In one embodiment, the method includes contacting the cell with an iRNA as described herein, in an amount effective to decrease the expression of an ALAS1 gene in the cell. “Contacting,” as used herein, includes directly contacting a cell, as well as indirectly contacting a cell. For example, a cell within a subject (e.g., an erythroid cell or a liver cell, such as a hepatocyte) may be contacted when a composition comprising an iRNA is administered (e.g., intravenously or subcutaneously) to the subject.
[0788] The expression of an ALAS1 gene may be assessed based on the level of expression of an ALAS1 mRNA, an ALAS1 protein, or the level of a parameter functionally linked to the level of expression of an ALAS1 gene (e.g., the level of a porphyrin or the incidence or severity of a symptom related to a porphyria). In some embodiments, the expression of ALAS1 is inhibited by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%. In some embodiments, the iRNA has an IC.sub.50 in the range of 0.001-0.01 nM, 0.001-0.10 nM, 0.001-1.0 nM, 0.001-10 nM, 0.01-0.05 nM, 0.01-0.50 nM, 0.02-0.60 nM, 0.01-1.0 nM, 0.01-1.5 nM, 0.01-10 nM. The IC.sub.50 value may be normalized relative to an appropriate control value, e.g., the IC.sub.50 of a non-targeting iRNA.
[0789] In some embodiments, the method includes introducing into the cell an iRNA as described herein and maintaining the cell for a time sufficient to obtain degradation of the mRNA transcript of an ALAS1 gene, thereby inhibiting the expression of the ALAS1 gene in the cell.
[0790] In one embodiment, the method includes administering a composition described herein, e.g., a composition comprising an iRNA that targets ALAS1, to the mammal such that expression of the target ALAS1 gene is decreased, such as for an extended duration, e.g., at least two, three, four days or more, e.g., one week, two weeks, three weeks, or four weeks or longer. In some embodiments, the decrease in expression of ALAS1 is detectable within 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, or 24 hours of the first administration.
[0791] In another embodiment, the method includes administering a composition as described herein to a mammal such that expression of the target ALAS1 gene is increased by e.g., at least 10% compared to an untreated animal. In some embodiments, the activation of ALAS1 occurs over an extended duration, e.g., at least two, three, four days or more, e.g., one week, two weeks, three weeks, four weeks, or more. Without wishing to be bound by theory, an iRNA can activate ALAS1 expression by stabilizing the ALAS1 mRNA transcript, interacting with a promoter in the genome, and/or inhibiting an inhibitor of ALAS1 expression.
[0792] The iRNAs useful for the methods and compositions featured in the invention specifically target RNAs (primary or processed) of an ALAS1 gene. Compositions and methods for inhibiting the expression of an ALAS1 gene using iRNAs can be prepared and performed as described elsewhere herein.
[0793] In one embodiment, the method includes administering a composition containing an iRNA, where the iRNA includes a nucleotide sequence that is complementary to at least a part of an RNA transcript of the ALAS1 gene of the mammal to be treated. When the organism to be treated is a mammal such as a human, the composition may be administered by any means known in the art including, but not limited to oral, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal and intrathecal), intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), nasal, rectal, and topical (including buccal and sublingual) administration.
[0794] In certain embodiments, the compositions are administered by intravenous infusion or injection. In some such embodiments, the compositions comprise a lipid formulated siRNA (e.g., an LNP formulation, such as an LNP11 formulation) for intravenous infusion. In particular embodiments, such compositions may be used to treat acute attacks of porphyria and/or for prophylaxis (e.g., to decrease the severity or frequency of attacks).
[0795] In other embodiments, the compositions are administered subcutaneously. In some such embodiments, the compositions comprise an iRNA conjugated to a GalNAc ligand. In particular embodiments, such compositions may be used to treat acute attacks of porphyria or for prophylaxis (e.g., to decrease the severity or frequency of attacks).
[0796] Methods for Decreasing a Level of a Porphyrin or Porphyrin Precursor
[0797] In another aspect, the invention provides a method for decreasing a level of a porphyrin or a porphyrin precursor, e.g., in a cell or in a subject.
[0798] In some embodiments, the cell is ex vivo, in vitro, or in vivo. In some embodiments, the cell is an erythroid cell or a hepatocyte. In some embodiments, the cell is a hepatocyte. In some embodiments, the cell is in a subject (e.g., a mammal, such as, for example, a human).
[0799] In some embodiments, the subject (e.g., the human) is at risk, or is diagnosed with a porphyria, as described herein. In some embodiments, the method is effective to treat a porphyria as described herein (e.g., by ameliorating one or more symptoms associated with a porphyria, reducing the frequency of attacks associated with a porphyria, reducing the likelihood that an attack of one or more symptoms associated with porphyria will occur upon exposure to a precipitating factor, or reducing the risk of developing conditions associated with a porphyria (e.g., neuropathy (e.g., progressive neuropathy), hepatocellular cancer). In one embodiment, the method includes contacting the cell with an RNAi, as described herein, in an amount sufficient to decrease the level of the porphyrin or porphyrin precursor (e.g., ALA or PBG) in the cell, or in another related cell or group of cells, or in the subject. “Contacting,” as used herein, includes directly contacting a cell, as well as indirectly contacting a cell. For example, a cell within a subject (e.g., an erythroid cell or a liver cell, such as a hepatocyte) may be contacted when a composition comprising an RNAi is administered (e.g., intravenously or subcutaneously) to the subject. “Another related cell or group of cells,” as used herein, includes any cell or group of cells in which the level of the porphyrin or porphyrin precursor decreases as a result of the contacting. For example, the cell may be part of a tissue present within a subject (e.g., a liver cell present within a subject), and contacting the cell within the subject (e.g., contacting one or more liver cells present within a subject) with the RNAi may result in a decrease in the level of the porphyrin or porphyrin precursor in another related cell or group of cells (e.g., nerve cells of the subject), or in a tissue or fluid of the subject (e.g., in the urine, blood, plasma, or cerebrospinal fluid of the subject).
[0800] In some embodiments, the porphyrin or porphyrin precursor is selected from the group consisting of δ-aminolevulinic acid (ALA), porphopilinogen (PBG), hydroxymethylbilane (HMB), uroporphyrinogen III, coproporphyrinogen III, protoporphrinogen IX, and protoporphyrin IX In some embodiments the porphyrin precursor is ALA. In some embodiments, the porphyrin precursor is PBG. In some embodiments, the method decreases the level of ALA and PBG. The level of a porphyrin or a porphyrin precursor may be measured as described herein and as known in the art.
[0801] Assays and Methods for Monitoring RNAi Activity
[0802] In another aspect, the invention provides assays and methods for monitoring ALAS1 mRNA levels. RNAi activity in the liver can be monitored by detecting mRNA levels or 5′RACE product in tissue, or by detecting the level of circulating secreted protein.
[0803] Alternatively, or in combination, circulating extracellular levels of ALAS1 mRNA can be detected, e.g., by cERD assays (Circulating Extracellular RNA Detection). In some embodiments, the ALAS1 mRNA level can be detected in a bodily fluid sample, e.g., a serum or urine sample. In some embodiments, exosomes are shed into bodily fluids from different cells types, which contain mRNA and miRNA derived from a tissue of origin. Such exosomes can be used to monitor the level of RNAi in circulation. In one embodiment, a sample, e.g., a serum or urine sample from a subject treated with an iRNA described herein can be purified with low speed spin, followed by a spin at about 160,000 g for about 2 hours to form a pellet. RNA can be extracted and analyzed to measure the levels of ALAS1 mRNA. Exemplary methods and assays are disclosed in PCT/US2012/043584, published as WO 2012/177906, the contents of which are incorporated by reference.
[0804] Accordingly, an assay, or method, is provided for detecting the level of circulating extracellular ALAS1 mRNA in a subject. The assay, or method includes providing RNA (e.g., extracellular RNA) from a biological fluid sample (e.g., urine, blood or plasma sample) from the subject, said biological fluid sample comprising the ALAS1 mRNA; and detecting the level of circulating extracellular ALAS1 mRNA in the sample.
[0805] In one embedment, the assay or method includes the step of obtaining an ALAS1 cDNA from the ALAS1 mRNA; and contacting the ALAS1 cDNA with a nucleic acid complementary (e.g., probe and/or primer) to the ALAS1 cDNA or a portion thereof, thereby producing a reaction mix; and detecting (e.g., measuring) the level of ALAS1 cDNA in the reaction mix, wherein the ALAS1 cDNA level is indicative of the ALAS1 mRNA level, thereby assaying the level of circulating extracellular ALAS1 mRNA in the subject.
[0806] In one embodiment, the assay or method includes acquiring a biological fluid sample from a subject, where the biological sample is separate from the tissue, and where the biological sample contains exosomes. The assay or method can further include detecting the levels of an RNA in the biological sample, where the RNA is expressed from the gene in the tissue of the subject, where the exosomes are not purified from the biological sample prior to detecting levels of RNA in the biological sample.
[0807] In embodiments, said biological fluid sample is a blood sample. In embodiments, said biological fluid sample is a serum sample. In another embodiment, the biological fluid sample is a urine sample.
[0808] In embodiments, the method comprises PCR, qPCR or 5′-RACE.
[0809] In embodiments, said nucleic acid is a probe or primer.
[0810] In embodiments, said nucleic acid comprises a detectable moiety and the level of ALAS1 mRNA is determined by detection of the amount of the detectable moiety.
[0811] In embodiments, said method further comprises obtaining the biological fluid sample from the subject.
[0812] In embodiments of these methods, the efficacy of a porphyria treatment is assessed based on a comparison of the level of circulating extracellular ALAS1 mRNA in the subject relative to a reference value.
[0813] In embodiments, a decrease in the level of circulating extracellular ALAS1 mRNA in the subject in response to the porphyria treatment, relative to the reference value, indicates that the porphyria treatment is efficacious. In embodiments, the reference value is the level of circulating extracellular ALAS1 mRNA in the subject prior to the porphyria treatment.
[0814] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the iRNAs and methods featured in the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
EXAMPLES
Example 1. siRNA Synthesis
[0815] Source of Reagents
[0816] Where the source of a reagent is not specifically given herein, such reagent may be obtained from any supplier of reagents for molecular biology at a quality/purity standard for application in molecular biology.
[0817] Oligonucleotide Synthesis.
[0818] All oligonucleotides are synthesized on an AKTAoligopilot synthesizer. Commercially available controlled pore glass solid support (dT-CPG, 500 {acute over (Å)}, Prime Synthesis) and RNA phosphoramidites with standard protecting groups, 5′-O-dimethoxytrityl N6-benzoyl-2′-t-butyldimethylsilyl-adenosine-3′-O-N,N′-diisopropyl-2-cyanoethylphosphoramidite, 5′-O-dimethoxytrityl-N4-acetyl-2′-t-butyldimethylsilyl-cytidine-3′-O-N,N′-diisopropyl-2-cyanoethylphosphoramidite, 5′-O-dimethoxytrityl-N2-isobutryl-2′-t-butyldimethylsilyl-guanosine-3′-O-N,N′-diisopropyl-2-cyanoethylphosphoramidite, and 5′-O-dimethoxytrityl-2′-t-butyldimethylsilyl-uridine-3′-O-N,N′-diisopropyl-2-cyanoethylphosphoramidite (Pierce Nucleic Acids Technologies) were used for the oligonucleotide synthesis. The 2′-F phosphoramidites, 5′-0-dimethoxytrityl-N4-acetyl-2′-fluro-cytidine-3′-O-N,N′-diisopropyl-2-cyanoethyl-phosphoramidite and 5′-O-dimethoxytrityl-2′-fluro-uridine-3′-O-N,N′-diisopropyl-2-cyanoethyl-phosphoramidite are purchased from (Promega). All phosphoramidites are used at a concentration of 0.2M in acetonitrile (CH.sub.3CN) except for guanosine which is used at 0.2M concentration in 10% THF/ANC (v/v). Coupling/recycling time of 16 minutes is used. The activator is 5-ethyl thiotetrazole (0.75M, American International Chemicals); for the PO-oxidation iodine/water/pyridine is used and for the PS-oxidation PADS (2%) in 2,6-lutidine/ACN (1:1 v/v) is used.
[0819] 3′-ligand conjugated strands are synthesized using solid support containing the corresponding ligand. For example, the introduction of cholesterol unit in the sequence is performed from a hydroxyprolinol-cholesterol phosphoramidite. Cholesterol is tethered to trans-4-hydroxyprolinol via a 6-aminohexanoate linkage to obtain a hydroxyprolinol-cholesterol moiety. 5′-end Cy-3 and Cy-5.5 (fluorophore) labeled iRNAs are synthesized from the corresponding Quasar-570 (Cy-3) phosphoramidite are purchased from Biosearch Technologies. Conjugation of ligands to 5′-end and or internal position is achieved by using appropriately protected ligand-phosphoramidite building block. An extended 15 min coupling of 0.1 M solution of phosphoramidite in anhydrous CH.sub.3CN in the presence of 5-(ethylthio)-1H-tetrazole activator to a solid-support-bound oligonucleotide. Oxidation of the internucleotide phosphite to the phosphate is carried out using standard iodine-water as reported (1) or by treatment with tert-butyl hydroperoxide/acetonitrile/water (10:87:3) with 10 min oxidation wait time conjugated oligonucleotide. Phosphorothioate is introduced by the oxidation of phosphite to phosphorothioate by using a sulfur transfer reagent such as DDTT (purchased from AM Chemicals), PADS and or Beaucage reagent. The cholesterol phosphoramidite is synthesized in house and used at a concentration of 0.1 M in dichloromethane. Coupling time for the cholesterol phosphoramidite is 16 minutes.
Deprotection I (Nucleobase Deprotection)
[0820] After completion of synthesis, the support is transferred to a 100 mL glass bottle (VWR). The oligonucleotide is cleaved from the support with simultaneous deprotection of base and phosphate groups with 80 mL of a mixture of ethanolic ammonia [ammonia: ethanol (3:1)] for 6.5 h at 55° C. The bottle is cooled briefly on ice and then the ethanolic ammonia mixture is filtered into a new 250-mL bottle. The CPG is washed with 2×40 mL portions of ethanol/water (1:1 v/v). The volume of the mixture is then reduced to −30 mL by roto-vap. The mixture is then frozen on dry ice and dried under vacuum on a speed vac.
Deprotection II (Removal of 2′-TBDMS Group)
[0821] The dried residue is resuspended in 26 mL of triethylamine, triethylamine trihydrofluoride (TEA⋅3HF) or pyridine-HF and DMSO (3:4:6) and heated at 60° C. for 90 minutes to remove the tert-butyldimethylsilyl (TBDMS) groups at the 2′ position. The reaction is then quenched with 50 mL of 20 mM sodium acetate and the pH is adjusted to 6.5. Oligonucleotide is stored in a freezer until purification.
Analysis
[0822] The oligonucleotides are analyzed by high-performance liquid chromatography (HPLC) prior to purification and selection of buffer and column depends on nature of the sequence and or conjugated ligand.
HPLC Purification
[0823] The ligand-conjugated oligonucleotides are purified by reverse-phase preparative HPLC. The unconjugated oligonucleotides are purified by anion-exchange HPLC on a TSK gel column packed in house. The buffers are 20 mM sodium phosphate (pH 8.5) in 10% CH.sub.3CN (buffer A) and 20 mM sodium phosphate (pH 8.5) in 10% CH.sub.3CN, 1M NaBr (buffer B). Fractions containing full-length oligonucleotides are pooled, desalted, and lyophilized. Approximately 0.15 OD of desalted oligonucleotides are diluted in water to 150 μL and then pipetted into special vials for CGE and LC/MS analysis. Compounds are then analyzed by LC-ESMS and CGE.
siRNA Preparation
[0824] For the general preparation of siRNA, equimolar amounts of sense and anti sense strand are heated in 1×PBS at 95° C. for 5 min and slowly cooled to room temperature. Integrity of the duplex is confirmed by HPLC analysis.
Nucleic acid sequences are represented below using standard nomenclature, and specifically the abbreviations of Table 1.
TABLE-US-00004 TABLE 1 Abbreviations of nucleotide monomers used in nucleic acid sequence representation. It will be understood that these monomers, when present in an oligonucleotide, are mutually linked by 5′-3′-phosphodiester bonds. Abbreviation Nucleotide(s)/Nucleosides A Adenosine-3′-phosphate, 2′-deoxy-2′-fluorouridine-5′-phosphate or adenosine Ab beta-L-adenosine-3 phosphate, beta-L-adenosine-5
phosphate or beta-L-adenosine Abs beta-L-adenosine-3
phosphorothioate Af 2′-deoxy-2′-fluoroadenosine-3′-phosphate, 2′-deoxy-2′- fluoroadenosine-5′-phosphate or 2′-deoxy-2′-fluoroadenosine Afs 2′-deoxy-2′-fluoroadenosine-3′-phosphorothioate As adenosine-3′-phosphorothioate C cytidine-3′-phosphate, cytidine-5′-phosphate or cytidine Cb beta-L-cytidine-3′-phosphate or beta-L-cytidine Cbs beta-L-cytidine-3′-phosphorothioate Cf 2′-deoxy-2′-fluorocytidine-3′-phosphate, 2′-deoxy-2′- fluorocytidine-5′-phosphate or 2′-deoxy-2′-fluorocytidine Cfs 2′-deoxy-2′-fluorocytidine-3′-phosphorothioate (Chd) 2′-O-hexadecyl-cytidine-3′-phosphate or 2′-O-hexadecyl-cytidine (Chds) 2′-O-hexadecyl-cytidine-3′-phosphorothioate Cs cytidine-3′-phosphorothioate G guanosine-3′-phosphate, guanosine-5′-phosphate or guanosine Gb beta-L-guanosine-3
phosphate, beta-L-guanosine-5
phosphate or beta-L-guanosine Gbs beta-L-guanosine-3
phosphorothioate Gf 2′-deoxy-2′-fluoroguanosine-3′-phosphate, 2′-deoxy-2′- fluoroguanosine-5′-phosphate or 2′-deoxy-2′-fluoroguanosine Gfs 2′-deoxy-2′-fluoroguanosine-3′-phosphorothioate Gs guanosine-3′-phosphorothioate T 5′-methyluridine-3′-phosphate, 5′-methyluridine-5′-phosphate or 5′- methyluridine Tb beta-L-thymidine-3′-phosphate, beta-L-thymidine-5′-phosphate or beta-L-thymidine Tbs beta-L-thymidine-3′-phosphorothioate Tf 2′-deoxy-2′-fluoro-5-methyluridine-3′-phosphate, 2′-deoxy-2′- fluoro-5-methyluridine-3′-phosphate or 2′-deoxy-2′-fluoro-5- methyluridine Tfs 2′-deoxy-2′-fluoro-5-methyluridine-3′-phosphorothioate Ts 5-methyluridine-3′-phosphorothioate U Uridine-3′-phosphate, uridine-5′-phosphate or uridine- Ub beta-L-uridine-3
phosphate, beta-L-uridine-5
phosphate or beta-L- uridine Ubs beta-L-uridine-3
phosphorothioate Uf 2′-deoxy-2′-fluorouridine-3′-phosphate, 2′-deoxy-2′-fluorouridine or 2′-deoxy-2′-fluorouridine-3′-phosphate Ufs 2′-deoxy-2′-fluorouridine -3′-phosphorothioate (Uhd) 2′-O-hexadecyl-uridine-3′-phosphate, 2′-O-hexadecyl-uridine-6′- phosphate or 2′-O-hexadecyl-uridine (Uhds) 2′-O-hexadecyl-uridine-3′-phosphorothioate Us uridine-3′-phosphorothioate N any nucleotide (G, A, C, T or U) a 2′-O-methyladenosine-3′-phosphate, 2′-O-methyladenosine-5′- phosphate or 2′-O-methyladenosine as 2′-O-methyladenosine-3′-phosphorothioate c 2′-O-methylcytidine-3′-phosphate, 2′-O-methylcytidine-5′- phosphate or 2′-O-methylcytidine cs 2′-O-methylcytidine-3′- phosphorothioate g 2′-O-methylguanosine-3′-phosphate, 2′-O-methylguanosine-5′- phosphate or 2′-O-methylguanosine gs 2′-O-methylguanosine-3′-phosphorothioate t 2′-O-methyl-5-methyluridine-3′-phosphate, 2′-O-methyl-5- methyluridine-5′-phosphate or 2′-O-methyl-5-methyluridine ts 2′-O-methyl-5-methyluridine-3′-phosphorothioate u 2′-O-methyluridine-3′-phosphate, 2′-O-methyluridine-5′-phosphate or 2′-O-methyluridine us 2′-O-methyluridine-3′-phosphorothioate dA 2
deoxyadenosine-3
phosphate, 2
deoxyadenosine-5
phosphate or 2
deoxyadenosine dAs 2
deoxyadenosine-3
phosphorothioate dC 2
deoxycytidine-3
phosphate, 2
deoxycytidine-5
phosphate or 2
deoxycytidine dCs 2
deoxycytidine-3
phosphorothioate dG 2
deoxyguanosine-3
phosphate, 2
deoxyguanosine-5
phosphate or 2
deoxyguanosine dGs 2
deoxyguanosine-3
phosphorothioate or 2
deoxyguanosine dT 2′-deoxythymidine-3′-phosphate, 2′-deoxythymidine-5′-phosphate or 2′-deoxythymidine dTs 2
deoxythymidine-3
phosphorothioate dU 2
deoxyuridine-3′-phosphate, 2
deoxyuridine-5′-phosphate or 2′- deoxyuridine s phosphorothioate linkage L96.sup.1 N-[tris(GalNAc-alkyl)-amidodecanoyl)]-4-hydroxyprolinol Hyp- (GalNAc-alkyl)3 (Aeo) 2′-O-methoxyethyladenosine-3′-phosphate, 2′-O- methoxyethyladenosine-5′-phosphate or 2′-O- methoxyethyladenosine (Aeos) 2′-O-methoxyethyladenosine-3′-phosphorothioate (Ceo) 2′-O-methoxyethylcytidine-3′-phosphate, 2′-O- methoxyethylcytidine-5′-phosphate or 2′-O-methoxyethylcytidine (Ceos) 2′-O-methoxyethylcytidine-3′-phosphorothioate (Geo) 2′-O-methoxyethylguanosine-3′-phosphate, 2′-O- methoxyethylguanosine-5′-phosphate or 2′-O- methoxyethylguanosine (Geos) 2′-O-methoxyethylguanosine-3′-phosphorothioate (Teo) 2′-O-methoxyethyl-5-methyluridine-3′-phosphate, 2′-O- methoxyethyl-5-methyluridine-5′-phosphate or 2′-O-methoxyethyl- 5-methyluridine (Teos) 2′-O-methoxyethyl-5-methyluridine-3′-phosphorothioate (m5Ceo) 2′-O-methoxyethyl-5-methylcytidine-3′-phosphate, 2′-O- methoxyethyl-5-methylcytidine-5′-phosphate or 2′-O-methoxyethyl- 5-methylcytidine (m5Ceos) 2′-O-methoxyethyl-5-methylcytidine-3′-phosphorothioate (Agn) 1-(2,3-Dihydroxypropyl)adenine-2-phosphate, 1-(2,3- Dihydroxypropyl)adenine-3-phosphate or 1-(2,3-Dihydroxypropyl) adenine (Agns) 1-(2,3-Dihydroxypropyl)adenine-2-phosphorothioate (Cgn) 1-(2,3-Dihydroxypropyl)cytosine-2-phosphate, 1-(2,3- Dihydroxypropyl)cytosine-3-phosphate or 1-(2,3-Dihydroxypropyl) cytosine (Cgns) 1-(2,3-Dihydroxypropyl)cytosine-2-phosphorothioate (Ggn) 1-(2,3-Dihydroxypropyl)guanine-2-phosphate, 1-(2,3- Dihydroxypropyl)guanine-3-phosphate or 1-(2,3-Dihydroxypropyl) guanine (Ggns) 1-(2,3-Dihydroxypropyl)guanine-2-phosphorothiaote (Tgn) 1-(2,3-Dihydroxypropyl)thymine-2-phosphate, 1-(2,3- Dihydroxypropyl)thymine-3-phosphate or 1-(2,3-Dihydroxypropyl) thymine (Tgns) 1-(2,3-Dihydroxypropyl)thymine-2-phosphorothioate (Ugn) 1-(2,3-Dihydroxypropyl)uracil-2-phosphate, 1-(2,3- Dihydroxypropyl)uracil-3-phosphate or 1-(2,3-Dihydroxypropyl) thymine (Ugns) 1-(2,3-Dihydroxypropyl)uracil-2-phosphorothioate .sup.1The chemical structure of L96 is as follows:
Example 2. ALAS1 siRNA Design and Synthesis
Experimental Methods
Bioinformatics
Transcripts
[0825] siRNA design was carried out to identify siRNAs targeting human, rhesus (Macaca mulatta), mouse, and rat ALAS1 transcripts annotated in the NCBI Gene database (http://www.ncbi.nlm.nih.gov/gene/). Design used the following transcripts from the NCBI RefSeq collection: Human-NM_000688.4 (see
[0826] siRNA Design, Specificity, and Efficacy Prediction
[0827] The predicted specificity of all possible 19mers was predicted from each sequence. Candidate 19mers were then selected that lacked repeats longer than 7 nucleotides. These 1510 candidate human/rhesus, 114 human/rhesus/mouse/rat, and 717 mouse/rat siRNAs were used in comprehensive searches against the appropriate transcriptomes (defined as the set of NM_ and
[0828] XM records within the human, rhesus, dog, mouse, or rat NCBI Refseq sets) using an exhaustive “brute-force” algorithm implemented in the python script ‘BruteForce.py’. The script next parsed the transcript-oligo alignments to generate a score based on the position and number of mismatches between the siRNA and any potential ‘off-target’ transcript. The off-target score is weighted to emphasize differences in the ‘seed’ region of siRNAs, in positions 2-9 from the 5′ end of the molecule. Each oligo-transcript pair from the brute-force search was given a mismatch score by summing the individual mismatch scores; mismatches in the position 2-9 were counted as 2.8, mismatches in the cleavage site positions 10-11 were counted as 1.2, and mismatches in region 12-19 counted as 1.0. An additional off-target prediction was carried out by comparing the frequency of heptamers and octomers derived from 3 distinct, seed-derived hexamers of each oligo. The hexamers from positions 2-7 relative to the 5′ start is used to create 2 heptamers and one octomer. We create ‘heptamer1’ by adding a 3′ A to the hexamer; we create heptamer2 by adding a 5′ A to the hexamer; we create the octomer by adding an A to both 5′ and 3′ ends of the hexamer. The frequency of octomers and heptamers in the human, rhesus, mouse, or rat 3′UTRome (defined as the subsequence of the transcriptome from NCBI's Refseq database where the end of the coding region, the ‘CDS’, is clearly defined) was pre-calculated. The octomer frequency was normalized to the heptamer frequency using the median value from the range of octomer frequencies. A ‘mirSeedScore’ was then calculated by calculating the sum of ((3×normalized octomer count)+(2×heptamer2 count)+(1×heptamer1 count)).
[0829] Both siRNAs strands were assigned to a category of specificity according to the calculated scores: a score above 3 qualifies as highly specific, equal to 3 as specific and between 2.2 and 2.8 as moderately specific. We sorted by the specificity of the antisense strand. We then selected duplexes whose antisense oligos lacked GC at the first position, lacked G at both positions 13 and 14, and had 3 or more Us or As in the seed region (characteristics of duplexes with high predicted efficacy)
[0830] Candidate GalNac-conjugated duplexes, 21 and 23 nucleotides long on the sense and antisense strands respectively, were designed by extending antisense 19mers 4 additional nucleotides in the 3′ direction (preserving perfect complementarity with the target transcript). The sense strand was specified as the reverse complement of the first 21 nucleotides of the antisense 23mer. Duplexes were selected that maintained perfect matches to all selected species transcripts across all 23 nucleotides.
[0831] siRNA Sequence Selection
[0832] A total of 90 sense and 90 antisense derived human/rhesus, 40 sense and 40 antisense derived human/rhesus/mouse/mouse/rat, and 40 sense and 40 antisense derived mouse/rat siRNA 19mer oligos were synthesized and formed into duplexes. A total of 45 sense and 45 antisense derived human/rhesus 21/23mer oligos were synthesized to yield 45 GalNac-conjugated duplexes.
[0833] The sequences of the sense and antisense strands of the modified duplexes are shown in Table 2, and the sequences of the sense and antisense strands of the unmodified duplexes are shown in Table 3.
Synthesis of ALAS1 Sequences
[0834] ALAS1 sequences were synthesized on MerMade 192 synthesizer at either 1 or 0.2 umol scale. Single strands were made with 2′O-methyl modifications for in vitro screening using transfection reagents. 3′ GalNAc conjugates were made with sequences containing 2′F and 2′-O-methyl modifications on the sense strand in the 21-23 mer designs for free uptake in cells. For all the 21mer sequences in the list, ‘endolight’ chemistry was applied as detailed below. [0835] All pyrimidines (cytosine and uridine) in the sense strand contained 2′-O-Methyl bases (2′ 0-Methyl C and 2′-O-Methyl U) [0836] In the antisense strand, pyrimidines adjacent to (towards 5′ position) ribo A nucleoside were replaced with their corresponding 2-O-Methyl nucleosides [0837] A two base dTsdT extension at 3′ end of both sense and anti sense sequences was introduced [0838] The sequence file was converted to a text file to make it compatible for loading in the MerMade 192 synthesis software
[0839] For GalNAc conjugated sense strands and complementary antisense sequences, 2′F and other modified nucleosides were introduced in combination with ribo with 2′O-Methyl nucleosides. The synthesis was performed on a GalNAc modified CPG support for the sense strand and CPG modified with universal support on the antisense sequence.
[0840] Synthesis, Cleavage and Deprotection:
[0841] The synthesis of ALAS1 sequences used solid supported oligonucleotide synthesis using phosphoramidite chemistry. For 21 mer endolight sequences, a deoxy thymidine CPG was used as the solid support while for the GalNAc conjugates, GalNAc solid support for sense strand and an universal CPG for the antisense strand were used.
[0842] The synthesis of the above sequences was performed at either 1 or 0.2 um scale in 96 well plates. The amidite solutions were prepared at 0.1M concentration and ethyl thio tetrazole (0.6M in Acetonitrile) was used as activator.
[0843] The synthesized sequences were cleaved and deprotected in 96 well plates, using methylamine in the first step and fluoride reagent in the second step. For GalNAc and 2′F nucleoside containing sequences, deprotection conditions were modified. Sequences after cleavage and deprotection were precipitated using acetone:ethanol (80:20) mix and the pellet were re-suspended in 0.2M sodium acetate buffer. Samples from each sequence were analyzed by LC-MS to confirm the identity, UV for quantification and a selected set of samples by IEX chromatography to determine purity.
Purification and Desalting:
[0844] ALAS1 sequences were precipitated and purified on AKTA Purifier system using Sephadex column. The ALAS less was run at ambient temperature. Sample injection and collection was performed in 96 well (1.8 mL-deep well) plates. A single peak corresponding to the full length sequence was collected in the eluent. The desalted ALAS1 sequences were analyzed for concentration (by UV measurement at A260) and purity (by ion exchange HPLC). The complementary single strands were then combined in a 1:1 stoichiometric ratio to form siRNA duplexes.
TABLE-US-00005 TABLE 2 Human ALAS1 Modified Single Strands and Duplex Sequences SEQ ID SEQ ID NO: Position on NO: (anti- transcript Duplex (sense) sense) NM_000688.4 Name Sense Sequence (5′-3′) Antisense Sequence (5′-3′) 2 3 522-540 AD-55078.2 cuccGGccAGuGAGAAAGAdTsdT UCUUUCUcACUGGCCGGAGdTsdT 4 5 669-687 AD-55084.2 uGGcAGcAcAGAuGAAucAdTsdT UGAUUcAUCUGUGCUGCcAdTsdT 6 7 790-808 AD-55090.2 cAGuGuGGuuAGuGuGAAAdTsdT UUUcAcACuAACcAcACUGdTsdT 8 9 853-871 AD-55096.2 cAucAuGcAAAAGcAAAGAdTsdT UCUUUGCUUUUGcAUGAUGdTsdT 10 11 876-894 AD-55102.2 AAAGAGuGucucAucuucudTsdT AGAAGAUGAGAcACUCUUUdTsdT 12 13 877-895 AD-55106.2 AAGAGuGucucAucuucuudTsdT AAGAAGAUGAGAcACUCUUdTsdT 14 15 914-932 AD-55111.2 ucuGuuuccAcuuuucAGudTsdT ACUGAAAAGUGGAAAcAGAdTsdT 16 17 923-941 AD-55073.2 AcuuuucAGuAuGAucGuudTsdT AACGAUcAuACUGAAAAGUdTsdT 18 19 926-944 AD-55079.2 uuucAGuAuGAucGuuucudTsdT AGAAACGAUcAuACUGAAAdTsdT 20 21 927-945 AD-55085.2 uucAGuAuGAucGuuucuudTsdT AAGAAACGAUcAuACUGAAdTsdT 22 23 928-946 AD-55091.2 ucAGuAuGAucGuuucuuudTsdT AAAGAAACGAUcAuACUGAdTsdT 24 25 932-950 AD-55097.2 uAuGAucGuuucuuuGAGAdTsdT UCUcAAAGAAACGAUcAuAdTsdT 26 27 973-991 AD-55103.2 uGAccAcAccuAucGAGuudTsdT AACUCGAuAGGUGUGGUcAdTsdT 28 29 975-993 AD-55107.2 AccAcAccuAucGAGuuuudTsdT AAAACUCGAuAGGUGUGGUdTsdT 30 31 1029-1047 AD-55112.2 uGGcAGAuGAcuAuucAGAdTsdT UCUGAAuAGUcAUCUGCcAdTsdT 32 33 1077-1095 AD-55074.2 ucuGGuGcAGuAAuGAcuAdTsdT uAGUcAUuACUGcACcAGAdTsdT 34 35 1124-1142 AD-55080.2 uGuGGGGcAGuuAuGGAcAdTsdT UGUCcAuAACUGCCCcAcAdTsdT 36 37 1137-1155 AD-55086.2 uGGAcAcuuuGAAAcAAcAdTsdT UGUUGUUUcAAAGUGUCcAdTsdT 38 39 1182-1200 AD-55098.2 AuAuuucuGGAAcuAGuAAdTsdT UuACuAGUUCcAGAAAuAUdTsdT 40 41 1184-1202 AD-55104.2 AuuucuGGAAcuAGuAAAudTsdT AUUuACuAGUUCcAGAAAUdTsdT 42 43 1185-1203 AD-55108.2 uuucuGGAAcuAGuAAAuudTsdT AAUUuACuAGUUCcAGAAAdTsdT 44 45 1188-1206 AD-55113.2 cuGGAAcuAGuAAAuuccAdTsdT UGGAAUUuACuAGUUCcAGdTsdT 46 47 1325-1343 AD-55075.2 uGuGAGAuuuAcucuGAuudTsdT AAUcAGAGuAAAUCUcAcAdTsdT 48 49 1364-1382 AD-55081.2 AuccAAGGGAuucGAAAcAdTsdT UGUUUCGAAUCCCUUGGAUdTsdT 50 51 1382-1400 AD-55087.2 AGccGAGuGccAAAGuAcAdTsdT UGuACUUUGGcACUCGGCUdTsdT 52 53 1478-1496 AD-55093.2 uuuGAAAcuGuccAuucAAdTsdT UUGAAUGGAcAGUUUcAAAdTsdT 54 55 1531-1549 AD-55099.2 uGAuGuGGcccAuGAGuuudTsdT AAACUcAUGGGCcAcAUcAdTsdT 56 57 1631-1649 AD-53573.3 GucAuGccAAAAAuGGAcAdTsdT UGUCcAUUUUUGGcAUGACdTsdT 58 59 1637-1655 AD-55109.2 ccAAAAAuGGAcAucAuuudTsdT AAAUGAUGUCcAUUUUUGGdTsdT 60 61 1706-1724 AD-55114.2 AcGAGuucucuGAuuGAcAdTsdT UGUcAAUcAGAGAACUCGUdTsdT 62 63 1962-1980 AD-55076.2 AAGucuGuGAuGAAcuAAudTsdT AUuAGUUcAUcAcAGACUUdTsdT 64 65 1967-1985 AD-55082.2 uGuGAuGAAcuAAuGAGcAdTsdT UGCUcAUuAGUUcAUcAcAdTsdT 66 67 1977-1995 AD-55088.2 uAAuGAGcAGAcAuAAcAudTsdT AUGUuAUGUCUGCUcAUuAdTsdT 68 69 2189-2207 AD-55094.2 uuuGAAGuGAuGAGuGAAAdTsdT UUUcACUcAUcACUUcAAAdTsdT 70 71 2227-2245 AD-55100.2 AGGcuuGAGcAAGuuGGuAdTsdT uACcAACUUGCUcAAGCCUdTsdT 72 73 2313-2331 AD-55105.2 ucuucAGAGuuGucuuuAudTsdT AuAAAGAcAACUCUGAAGAdTsdT 74 75 2317-2335 AD-55110.2 cAGAGuuGucuuuAuAuGudTsdT AcAuAuAAAGAcAACUCUGdTsdT 76 77 2319-2337 AD-55115.2 GAGuuGucuuuAuAuGuGAdTsdT UcAcAuAuAAAGAcAACUCdTsdT 78 79 2320-2338 AD-55077.2 AGuuGucuuuAuAuGuGAAdTsdT UUcAcAuAuAAAGAcAACUdTsdT 80 81 2344-2362 AD-55083.2 uuAuAuuAAAuuuuAAucudTsdT AGAUuAAAAUUuAAuAuAAdTsdT 82 83 2352-2370 AD-55089.2 AAuuuuAAucuAuAGuAAAdTsdT UUuACuAuAGAUuAAAAUUdTsdT 84 85 2353-2371 AD-55095.2 AuuuuAAucuAuAGuAAAAdTsdT UUUuACuAuAGAUuAAAAUdTsdT 86 87 2376-2394 AD-55101.2 AGuccuGGAAAuAAAuucudTsdT AGAAUUuAUUUCcAGGACUdTsdT 88 89 358-376 AD-53511.1 cuGcccAuucuuAucccGAdTsdT UCGGGAuAAGAAUGGGcAGdTsdT 90 91 789-807 AD-53512.1 ccAGuGuGGuuAGuGuGAAdTsdT UUcAcACuAACcAcACUGGdTsdT 92 93 1076-1094 AD-53513.1 GucuGGuGcAGuAAuGAcudTsdT AGUcAUuACUGcACcAGACdTsdT 94 95 1253-1271 AD-53514.1 GcAcucuuGuuuuccucGudTsdT ACGAGGAAAAcAAGAGUGCdTsdT 96 97 1544-1562 AD-53515.1 GAGuuuGGAGcAAucAccudTsdT AGGUGAUUGCUCcAAACUCdTsdT 98 99 2228-2246 AD-53516.1 GGcuuGAGcAAGuuGGuAudTsdT AuACcAACUUGCUcAAGCCdTsdT 100 101 404-422 AD-53517.1 GGcAAAucucuGuuGuucudTsdT AGAAcAAcAGAGAUUUGCCdTsdT 102 103 404-422 AD-53517.1 GGcAAAucucuGuuGuucudTsdT AGAAcAAcAGAGAUUUGCCdTsdT 104 105 866-884 AD-53518.1 cAAAGAccAGAAAGAGuGudTsdT AcACUCUUUCUGGUCUUUGdTsdT 106 107 1080-1098 AD-53519.1 GGuGcAGuAAuGAcuAccudTsdT AGGuAGUcAUuACUGcACCdTsdT 108 109 1258-1276 AD-53520.1 cuuGuuuuccucGuGcuuudTsdT AAAGcACGAGGAAAAcAAGdTsdT 110 111 1616-1634 AD-53521.1 GGGGAucGGGAuGGAGucAdTsdT UGACUCcAUCCCGAUCCCCdTsdT 112 113 2230-2248 AD-53522.1 cuuGAGcAAGuuGGuAucudTsdT AGAuACcAACUUGCUcAAGdTsdT 114 115 436-454 AD-53523.1 ccccAAGAuGAuGGAAGuudTsdT AACUUCcAUcAUCUUGGGGdTsdT 116 117 436-454 AD-53523.1 ccccAAGAuGAuGGAAGuudTsdT AACUUCcAUcAUCUUGGGGdTsdT 118 119 885-903 AD-53524.1 cucAucuucuucAAGAuAAdTsdT UuAUCUUGAAGAAGAUGAGdTsdT 120 121 1127-1145 AD-53525.1 GGGGcAGuuAuGGAcAcuudTsdT AAGUGUCcAuAACUGCCCCdTsdT 122 123 1315-1333 AD-53526.1 GAuGccAGGcuGuGAGAuudTsdT AAUCUcAcAGCCUGGcAUCdTsdT 124 125 1870-1888 AD-53527.1 GAGAcAGAuGcuAAuGGAudTsdT AUCcAUuAGcAUCUGUCUCdTsdT 126 127 2286-2304 AD-53528.1 ccccAGGccAuuAucAuAudTsdT AuAUGAuAAUGGCCUGGGGdTsdT 128 129 489-507 AD-53529.1 cAGcAGuAcAcuAccAAcAdTsdT UGUUGGuAGUGuACUGCUGdTsdT 130 131 489-507 AD-53529.1 cAGcAGuAcAcuAccAAcAdTsdT UGUUGGuAGUGuACUGCUGdTsdT 132 133 915-933 AD-53530.1 cuGuuuccAcuuuucAGuAdTsdT uACUGAAAAGUGGAAAcAGdTsdT 134 135 1138-1156 AD-53531.1 GGAcAcuuuGAAAcAAcAudTsdT AUGUUGUUUcAAAGUGUCCdTsdT 136 137 1324-1342 AD-53532.1 cuGuGAGAuuuAcucuGAudTsdT AUcAGAGuAAAUCUcAcAGdTsdT 138 139 1927-1945 AD-53533.1 cccuGuGcGGGuuGcAGAudTsdT AUCUGcAACCCGcAcAGGGdTsdT 140 141 2312-2330 AD-53534.1 GucuucAGAGuuGucuuuAdTsdT uAAAGAcAACUCUGAAGACdTsdT 142 143 646-664 AD-53535.1 cAcuGcAAGcAAAuGcccudTsdT AGGGcAUUUGCUUGcAGUGdTsdT 144 145 922-940 AD-53536.1 cAcuuuucAGuAuGAucGudTsdT ACGAUcAuACUGAAAAGUGdTsdT 146 147 1163-1181 AD-53537.1 GGGGcAGGuGGuAcuAGAAdTsdT UUCuAGuACcACCUGCCCCdTsdT 148 149 1347-1365 AD-53538.1 GGAAccAuGccuccAuGAudTsdT AUcAUGGAGGcAUGGUUCCdTsdT 150 151 1964-1982 AD-53539.1 GucuGuGAuGAAcuAAuGAdTsdT UcAUuAGUUcAUcAcAGACdTsdT 152 153 2321-2339 AD-53540.1 GuuGucuuuAuAuGuGAAudTsdT AUUcAcAuAuAAAGAcAACdTsdT 154 155 671-689 AD-53541.1 GcAGcAcAGAuGAAucAGAdTsdT UCUGAUUcAUCUGUGCUGCdTsdT 156 157 924-942 AD-53542.1 cuuuucAGuAuGAucGuuudTsdT AAACGAUcAuACUGAAAAGdTsdT 158 159 1164-1182 AD-53543.1 GGGcAGGuGGuAcuAGAAAdTsdT UUUCuAGuACcACCUGCCCdTsdT 160 161 1460-1478 AD-53544.1 GuccccAAGAuuGuGGcAudTsdT AUGCcAcAAUCUUGGGGACdTsdT 162 163 1976-1994 AD-53545.1 cuAAuGAGcAGAcAuAAcAdTsdT UGUuAUGUCUGCUcAUuAGdTsdT 164 165 786-804 AD-53546.1 GccccAGuGuGGuuAGuGudTsdT AcACuAACcAcACUGGGGCdTsdT 166 167 935-953 AD-53547.1 GAucGuuucuuuGAGAAAAdTsdT UUUUCUcAAAGAAACGAUCdTsdT 168 169 1165-1183 AD-53548.1 GGcAGGuGGuAcuAGAAAudTsdT AUUUCuAGuACcACCUGCCdTsdT 170 171 1530-1548 AD-53549.1 GuGAuGuGGcccAuGAGuudTsdT AACUcAUGGGCcAcAUcACdTsdT 172 173 2003-2021 AD-53550.1 cAAGcAAucAAuuAcccuAdTsdT uAGGGuAAUUGAUUGCUUGdTsdT 174 175 788-806 AD-53551.1 cccAGuGuGGuuAGuGuGAdTsdT UcAcACuAACcAcACUGGGdTsdT 176 177 974-992 AD-53552.1 GAccAcAccuAucGAGuuudTsdT AAACUCGAuAGGUGUGGUCdTsdT 178 179 1191-1209 AD-53553.1 GAAcuAGuAAAuuccAuGudTsdT AcAUGGAAUUuACuAGUUCdTsdT 180 181 1541-1559 AD-53554.1 cAuGAGuuuGGAGcAAucAdTsdT UGAUUGCUCcAAACUcAUGdTsdT 182 183 2075-2093 AD-53555.1 ccccAGAuGAuGAAcuAcudTsdT AGuAGUUcAUcAUCUGGGGdTsdT 184 185 360-378 AD-53561.1 GcccAuucuuAucccGAGudTsdT ACUCGGGAuAAGAAUGGGCdTsdT 186 187 1356-1374 AD-53567.1 ccuccAuGAuccAAGGGAudTsdT AUCCCUUGGAUcAUGGAGGdTsdT 188 189 1631-1649 AD-53573.1 GucAuGccAAAAAuGGAcAdTsdT UGUCcAUUUUUGGcAUGACdTsdT 190 191 1634-1652 AD-53579.1 AuGccAAAAAuGGAcAucAdTsdT UGAUGUCcAUUUUUGGcAUdTsdT
TABLE-US-00006 TABLE 3 Human ALAS1 Unmodified Single Strands and Duplex Sequences SEQ ID NO: Position on SEQ ID NO: (anti- transcript Sense Antisense (sense) sense) NM_000688.4 Duplex Name Sequence (5′-3′) Sequence (5′-3′) 192 193 522-540 AD-55078.2 CUCCGGCCAGUGAGAAAGA UCUUUCUCACUGGCCGGAG 194 195 669-687 AD-55084.2 UGGCAGCACAGAUGAAUCA UGAUUCAUCUGUGCUGCCA 196 197 790-808 AD-55090.2 CAGUGUGGUUAGUGUGAAA UUUCACACUAACCACACUG 198 199 853-871 AD-55096.2 CAUCAUGCAAAAGCAAAGA UCUUUGCUUUUGCAUGAUG 200 201 876-894 AD-55102.2 AAAGAGUGUCUCAUCUUCU AGAAGAUGAGACACUCUUU 202 203 877-895 AD-55106.2 AAGAGUGUCUCAUCUUCUU AAGAAGAUGAGACACUCUU 204 205 914-932 AD-55111.2 UCUGUUUCCACUUUUCAGU ACUGAAAAGUGGAAACAGA 206 207 923-941 AD-55073.2 ACUUUUCAGUAUGAUCGUU AACGAUCAUACUGAAAAGU 208 209 926-944 AD-55079.2 UUUCAGUAUGAUCGUUUCU AGAAACGAUCAUACUGAAA 210 211 927-945 AD-55085.2 UUCAGUAUGAUCGUUUCUU AAGAAACGAUCAUACUGAA 212 213 928-946 AD-55091.2 UCAGUAUGAUCGUUUCUUU AAAGAAACGAUCAUACUGA 214 215 932-950 AD-55097.2 UAUGAUCGUUUCUUUGAGA UCUCAAAGAAACGAUCAUA 216 217 973-991 AD-55103.2 UGACCACACCUAUCGAGUU AACUCGAUAGGUGUGGUCA 218 219 975-993 AD-55107.2 ACCACACCUAUCGAGUUUU AAAACUCGAUAGGUGUGGU 220 221 1029-1047 AD-55112.2 UGGCAGAUGACUAUUCAGA UCUGAAUAGUCAUCUGCCA 222 223 1077-1095 AD-55074.2 UCUGGUGCAGUAAUGACUA UAGUCAUUACUGCACCAGA 224 225 1124-1142 AD-55080.2 UGUGGGGCAGUUAUGGACA UGUCCAUAACUGCCCCACA 226 227 1137-1155 AD-55086.2 UGGACACUUUGAAACAACA UGUUGUUUCAAAGUGUCCA 228 229 1182-1200 AD-55098.2 AUAUUUCUGGAACUAGUAA UUACUAGUUCCAGAAAUAU 230 231 1184-1202 AD-55104.2 AUUUCUGGAACUAGUAAAU AUUUACUAGUUCCAGAAAU 232 233 1185-1203 AD-55108.2 UUUCUGGAACUAGUAAAUU AAUUUACUAGUUCCAGAAA 234 235 1188-1206 AD-55113.2 CUGGAACUAGUAAAUUCCA UGGAAUUUACUAGUUCCAG 236 237 1325-1343 AD-55075.2 UGUGAGAUUUACUCUGAUU AAUCAGAGUAAAUCUCACA 238 239 1364-1382 AD-55081.2 AUCCAAGGGAUUCGAAACA UGUUUCGAAUCCCUUGGAU 240 241 1382-1400 AD-55087.2 AGCCGAGUGCCAAAGUACA UGUACUUUGGCACUCGGCU 242 243 1478-1496 AD-55093.2 UUUGAAACUGUCCAUUCAA UUGAAUGGACAGUUUCAAA 244 245 1531-1549 AD-55099.2 UGAUGUGGCCCAUGAGUUU AAACUCAUGGGCCACAUCA 246 247 1631-1649 AD-53573.3 GUCAUGCCAAAAAUGGACA UGUCCAUUUUUGGCAUGAC 248 249 1637-1655 AD-55109.2 CCAAAAAUGGACAUCAUUU AAAUGAUGUCCAUUUUUGG 250 251 1706-1724 AD-55114.2 ACGAGUUCUCUGAUUGACA UGUCAAUCAGAGAACUCGU 252 253 1962-1980 AD-55076.2 AAGUCUGUGAUGAACUAAU AUUAGUUCAUCACAGACUU 254 255 1967-1985 AD-55082.2 UGUGAUGAACUAAUGAGCA UGCUCAUUAGUUCAUCACA 256 257 1977-1995 AD-55088.2 UAAUGAGCAGACAUAACAU AUGUUAUGUCUGCUCAUUA 258 259 2189-2207 AD-55094.2 UUUGAAGUGAUGAGUGAAA UUUCACUCAUCACUUCAAA 260 261 2227-2245 AD-55100.2 AGGCUUGAGCAAGUUGGUA UACCAACUUGCUCAAGCCU 262 263 2313-2331 AD-55105.2 UCUUCAGAGUUGUCUUUAU AUAAAGACAACUCUGAAGA 264 265 2317-2335 AD-55110.2 CAGAGUUGUCUUUAUAUGU ACAUAUAAAGACAACUCUG 266 267 2319-2337 AD-55115.2 GAGUUGUCUUUAUAUGUGA UCACAUAUAAAGACAACUC 268 269 2320-2338 AD-55077.2 AGUUGUCUUUAUAUGUGAA UUCACAUAUAAAGACAACU 270 271 2344-2362 AD-55083.2 UUAUAUUAAAUUUUAAUCU AGAUUAAAAUUUAAUAUAA 272 273 2352-2370 AD-55089.2 AAUUUUAAUCUAUAGUAAA UUUACUAUAGAUUAAAAUU 274 275 2353-2371 AD-55095.2 AUUUUAAUCUAUAGUAAAA UUUUACUAUAGAUUAAAAU 276 277 2376-2394 AD-55101.2 AGUCCUGGAAAUAAAUUCU AGAAUUUAUUUCCAGGACU 278 279 358-376 AD-53511.1 CUGCCCAUUCUUAUCCCGA UCGGGAUAAGAAUGGGCAG 280 281 789-807 AD-53512.1 CCAGUGUGGUUAGUGUGAA UUCACACUAACCACACUGG 282 283 1076-1094 AD-53513.1 GUCUGGUGCAGUAAUGACU AGUCAUUACUGCACCAGAC 284 285 1253-1271 AD-53514.1 GCACUCUUGUUUUCCUCGU ACGAGGAAAACAAGAGUGC 286 287 1544-1562 AD-53515.1 GAGUUUGGAGCAAUCACCU AGGUGAUUGCUCCAAACUC 288 289 2228-2246 AD-53516.1 GGCUUGAGCAAGUUGGUAU AUACCAACUUGCUCAAGCC 290 291 404-422 AD-53517.1 GGCAAAUCUCUGUUGUUCU AGAACAACAGAGAUUUGCC 292 293 404-422 AD-53517.1 GGCAAAUCUCUGUUGUUCU AGAACAACAGAGAUUUGCC 294 295 866-884 AD-53518.1 CAAAGACCAGAAAGAGUGU ACACUCUUUCUGGUCUUUG 296 297 1080-1098 AD-53519.1 GGUGCAGUAAUGACUACCU AGGUAGUCAUUACUGCACC 298 299 1258-1276 AD-53520.1 CUUGUUUUCCUCGUGCUUU AAAGCACGAGGAAAACAAG 300 301 1616-1634 AD-53521.1 GGGGAUCGGGAUGGAGUCA UGACUCCAUCCCGAUCCCC 302 303 2230-2248 AD-53522.1 CUUGAGCAAGUUGGUAUCU AGAUACCAACUUGCUCAAG 304 305 436-454 AD-53523.1 CCCCAAGAUGAUGGAAGUU AACUUCCAUCAUCUUGGGG 306 307 436-454 AD-53523.1 CCCCAAGAUGAUGGAAGUU AACUUCCAUCAUCUUGGGG 308 309 885-903 AD-53524.1 CUCAUCUUCUUCAAGAUAA UUAUCUUGAAGAAGAUGAG 310 311 1127-1145 AD-53525.1 GGGGCAGUUAUGGACACUU AAGUGUCCAUAACUGCCCC 312 313 1315-1333 AD-53526.1 GAUGCCAGGCUGUGAGAUU AAUCUCACAGCCUGGCAUC 314 315 1870-1888 AD-53527.1 GAGACAGAUGCUAAUGGAU AUCCAUUAGCAUCUGUCUC 316 317 2286-2304 AD-53528.1 CCCCAGGCCAUUAUCAUAU AUAUGAUAAUGGCCUGGGG 318 319 489-507 AD-53529.1 CAGCAGUACACUACCAACA UGUUGGUAGUGUACUGCUG 320 321 489-507 AD-53529.1 CAGCAGUACACUACCAACA UGUUGGUAGUGUACUGCUG 322 323 915-933 AD-53530.1 CUGUUUCCACUUUUCAGUA UACUGAAAAGUGGAAACAG 324 325 1138-1156 AD-53531.1 GGACACUUUGAAACAACAU AUGUUGUUUCAAAGUGUCC 326 327 1324-1342 AD-53532.1 CUGUGAGAUUUACUCUGAU AUCAGAGUAAAUCUCACAG 328 329 1927-1945 AD-53533.1 CCCUGUGCGGGUUGCAGAU AUCUGCAACCCGCACAGGG 330 331 2312-2330 AD-53534.1 GUCUUCAGAGUUGUCUUUA UAAAGACAACUCUGAAGAC 332 333 646-664 AD-53535.1 CACUGCAAGCAAAUGCCCU AGGGCAUUUGCUUGCAGUG 334 335 922-940 AD-53536.1 CACUUUUCAGUAUGAUCGU ACGAUCAUACUGAAAAGUG 336 337 1163-1181 AD-53537.1 GGGGCAGGUGGUACUAGAA UUCUAGUACCACCUGCCCC 338 339 1347-1365 AD-53538.1 GGAACCAUGCCUCCAUGAU AUCAUGGAGGCAUGGUUCC 340 341 1964-1982 AD-53539.1 GUCUGUGAUGAACUAAUGA UCAUUAGUUCAUCACAGAC 342 343 2321-2339 AD-53540.1 GUUGUCUUUAUAUGUGAAU AUUCACAUAUAAAGACAAC 344 345 671-689 AD-53541.1 GCAGCACAGAUGAAUCAGA UCUGAUUCAUCUGUGCUGC 346 347 924-942 AD-53542.1 CUUUUCAGUAUGAUCGUUU AAACGAUCAUACUGAAAAG 348 349 1164-1182 AD-53543.1 GGGCAGGUGGUACUAGAAA UUUCUAGUACCACCUGCCC 350 351 1460-1478 AD-53544.1 GUCCCCAAGAUUGUGGCAU AUGCCACAAUCUUGGGGAC 352 353 1976-1994 AD-53545.1 CUAAUGAGCAGACAUAACA UGUUAUGUCUGCUCAUUAG 354 355 786-804 AD-53546.1 GCCCCAGUGUGGUUAGUGU ACACUAACCACACUGGGGC 356 357 935-953 AD-53547.1 GAUCGUUUCUUUGAGAAAA UUUUCUCAAAGAAACGAUC 358 359 1165-1183 AD-53548.1 GGCAGGUGGUACUAGAAAU AUUUCUAGUACCACCUGCC 360 361 1530-1548 AD-53549.1 GUGAUGUGGCCCAUGAGUU AACUCAUGGGCCACAUCAC 362 363 2003-2021 AD-53550.1 CAAGCAAUCAAUUACCCUA UAGGGUAAUUGAUUGCUUG 364 365 788-806 AD-53551.1 CCCAGUGUGGUUAGUGUGA UCACACUAACCACACUGGG 366 367 974-992 AD-53552.1 GACCACACCUAUCGAGUUU AAACUCGAUAGGUGUGGUC 368 369 1191-1209 AD-53553.1 GAACUAGUAAAUUCCAUGU ACAUGGAAUUUACUAGUUC 370 371 1541-1559 AD-53554.1 CAUGAGUUUGGAGCAAUCA UGAUUGCUCCAAACUCAUG 372 373 2075-2093 AD-53555.1 CCCCAGAUGAUGAACUACU AGUAGUUCAUCAUCUGGGG 374 375 360-378 AD-53561.1 GCCCAUUCUUAUCCCGAGU ACUCGGGAUAAGAAUGGGC 376 377 1356-1374 AD-53567.1 CCUCCAUGAUCCAAGGGAU AUCCCUUGGAUCAUGGAGG 378 379 1631-1649 AD-53573.1 GUCAUGCCAAAAAUGGACA UGUCCAUUUUUGGCAUGAC 380 381 1634-1652 AD-53579.1 AUGCCAAAAAUGGACAUCA UGAUGUCCAUUUUUGGCAU
Example 3. In Vitro Screening of ALAS1 siRNA Duplexes for ALAS1 Knockdown Activity
[0845] ALAS1 siRNA duplexes were screened for the ability to knockdown ALAS1 expression in vitro.
In Vitro Screening
[0846] Cell Culture and Transfections
[0847] Hep3B cells (ATCC, Manassas, Va.) were grown to near confluence at 37° C. in an atmosphere of 5% CO.sub.2 in MEM (ATCC) supplemented with 10% FBS, before being released from the plate by trypsinization. Transfection was carried out by adding 14.8 μl of Opti-MEM plus 0.2 μl of Lipofectamine RNAiMax per well (Invitrogen, Carlsbad Calif. cat #13778-150) to 5 μl of siRNA duplexes per well into a 96-well plate and incubated at room temperature for 15 minutes. 80 μl of complete growth media containing ˜2×10.sup.4 Hep3B cells were then added to the siRNA mixture. Cells were incubated for either 24 or 120 hours prior to RNA purification. Single dose experiments were performed at 10 nM and 0.1 nM final duplex concentration and dose response experiments were done at 10, 1.67, 0.27, 0.046, 0.0077, 0.0013, 0.00021, 0.00004 nM final duplex concentration.
[0848] Total RNA Isolation Using DYNABEADS mRNA Isolation Kit (Invitrogen, Part #: 610-12)
[0849] Cells were harvested and lysed in 150 μl of Lysis/Binding Buffer then mixed for 5 minutes at 850 rpm using an Eppendorf Thermomixer (the mixing speed was the same throughout the process). Ten microliters of magnetic beads and 80 μl Lysis/Binding Buffer mixture were added to a round bottom plate and mixed for 1 minute. Magnetic beads were captured using magnetic stand and the supernatant was removed without disturbing the beads. After removing supernatant, the lysed cells were added to the remaining beads and mixed for 5 minutes. After removing supernatant, magnetic beads were washed 2 times with 150 μl Wash Buffer A and mixed for 1 minute. Beads were captured again and supernatant removed. Beads were then washed with 150 μl Wash Buffer B, captured and supernatant was removed. Beads were next washed with 150 μl Elution Buffer, captured and supernatant removed. Beads were allowed to dry for 2 minutes. After drying, 50 μl of Elution Buffer was added and mixed for 5 minutes at 70° C. Beads were captured on magnet for 5 minutes. 40 μl of supernatant was removed and added to another 96 well plate.
[0850] cDNA Synthesis Using ABI High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, Calif., Cat #4368813)
[0851] A master mix of 2 μl 10× Buffer, 0.8 μl 25× dNTPs, 2 μl Random primers, 1 μl Reverse Transcriptase, 1 μl RNase inhibitor and 3.2 μl of H.sub.2O per reaction were added into 10 μl total RNA. cDNA was generated using a Bio-Rad C-1000 or S-1000 thermal cycler (Hercules, Calif.) through the following steps: 25° C. 10 min, 37° C. 120 min, 85° C. 5 sec, 4° C. hold.
[0852] Real Time PCR
[0853] 2 μl of cDNA were added to a master mix containing 0.5 μl GAPDH TaqMan Probe (Applied Biosystems Cat #4326317E), 0.5 μl ALAS1 TaqMan probe (Applied Biosystems cat #Hs00167441_m1) and 5 μl Lightcycler 480 probe master mix (Roche Cat #04887301001) per well in a 384 well plates (Roche cat #04887301001). Real time PCR was done in a Roche LC480 Real Time PCR system (Roche) using the ΔΔCt(RQ) assay. Each duplex was tested in two independent transfections with two biological replicates each, and each transfection was assayed in duplicate, unless otherwise noted in the summary tables.
[0854] To calculate relative fold change, real time data were analyzed using the ΔΔCt method and normalized to assays performed with cells transfected with 10 nM AD-1955, or mock transfected cells. IC50s were calculated using a 4 parameter fit model using XLFit and normalized to cells transfected with AD-1955 or naïve cells over the same dose range, or to its own lowest dose.
In Vitro Knockdown of Endogenous ALAS1 Expression by ALAS1 siRNA Duplexes
[0855] Table 4 illustrates the knockdown of ALAS1 in Hep3B cells by ALAS1 modified siRNA duplexes (See Table 2). Silencing is expressed as the fraction RNA message remaining relative to the negative (luciferase) control siRNA AD-1955. Data were generated as described above following transfection of 10 nM or 0.1 nM of each siRNA. qPCR was run using the ALAS1 TaqMan probe Hs00167441_m1.
TABLE-US-00007 TABLE 4 ALAS1 expression in Hep3B cells following transfection with ALAS1 siRNA 10 nM 0.1 nM 10 nM 0.1 nM Duplex ID Avg Avg STDEV STDEV AD-55078.2 0.7 0.87 0.001 0.089 AD-55084.2 0.08 0.3 0 0.04 AD-55090.2 0.06 0.08 0.002 0.003 AD-55096.2 0.61 0.92 0.171 0.34 AD-55102.2 0.63 0.62 0.005 0.069 AD-55106.2 0.07 0.08 0.004 0.027 AD-55111.2 0.06 0.23 0.013 0.062 AD-55073.2 0.21 0.4 0.018 0.061 AD-55079.2 0.17 0.43 0.033 0.089 AD-55085.2 0.13 0.21 0.011 0.019 AD-55091.2 0.27 0.55 0.033 0.009 AD-55097.2 0.31 0.38 0.051 0.059 AD-55103.2 0.05 0.11 0.017 0.006 AD-55107.2 0.12 0.24 0.007 0.008 AD-55112.2 0.15 0.2 0.036 0.025 AD-55074.2 0.16 0.45 0.008 0.002 AD-55080.2 0.79 0.99 0.095 0.304 AD-55086.2 0.09 0.22 0.005 0.035 AD-55098.2 0.25 0.51 0.03 0.07 AD-55104.2 0.06 0.1 0.017 0.001 AD-55108.2 0.47 0.65 0.03 0.015 AD-55113.2 0.38 0.62 0.068 0.039 AD-55075.2 0.12 0.28 0.007 0.051 AD-55081.2 0.21 0.51 0.036 0.066 AD-55087.2 0.1 0.19 0.017 0.02 AD-55093.2 0.24 0.56 0.029 0.053 AD-55099.2 0.05 0.18 0.001 0.038 AD-53573.3 0.67 1.07 0.16 0.153 AD-55109.2 0.07 0.23 0.006 0.052 AD-55114.2 0.08 0.16 0.004 0.017 AD-55076.2 0.05 0.14 0.007 0.035 AD-55082.2 0.08 0.3 0.019 0.016 AD-55088.2 0.06 0.12 0.008 0.02 AD-55094.2 0.06 0.18 0.005 0.023 AD-55100.2 0.45 0.83 0.02 0.05 AD-55105.2 0.02 0.05 0.005 0.004 AD-55110.2 0.15 0.19 0.031 0.016 AD-55115.2 0.35 0.58 0.045 0.052 AD-55077.2 0.14 0.14 0.006 0.019 AD-55083.2 0.56 0.98 0.24 0.188 AD-55089.2 0.62 0.79 0.036 0.094 AD-55095.2 0.59 0.92 0.12 0.079 AD-55101.2 0.71 0.97 0.074 0.097 AD-1955 1.00 1.01 0.03 0.04 AD-53511.1 0.84 1.08 0.028 0.0515 AD-53512.1 0.15 0.65 0.062 0.023 AD-53513.1 0.34 0.86 0.055 0.011 AD-53514.1 0.12 0.61 0.003 0.008 AD-53515.1 0.25 0.66 0.005 0.004 AD-53516.1 1.05 1.02 0.032 0.011 AD-53517.1 0.145 0.725 0.025 0.0155 AD-53518.1 0.72 0.85 0.045 0.028 AD-53519.1 0.18 0.66 0.061 0.004 AD-53520.1 0.18 0.9 0.041 0.001 AD-53521.1 0.97 1.07 0.01 0.003 AD-53522.1 0.87 1.1 0.065 0.112 AD-53523.1 0.48 0.96 0.0305 0.0255 AD-53524.1 0.11 0.66 0.02 0.006 AD-53525.1 0.71 1.03 0.016 0.01 AD-53526.1 0.23 0.85 0.075 0.01 AD-53527.1 0.25 0.83 0.015 0.017 AD-53528.1 0.44 0.93 0.037 0.006 AD-53529.1 0.185 0.73 0.015 0.014 AD-53530.1 0.1 0.62 0.02 0.003 AD-53531.1 0.48 0.93 0.019 0.045 AD-53532.1 0.06 0.17 0 0.003 AD-53533.1 0.36 0.93 0.025 0.034 AD-53534.1 0.1 0.36 0.014 0.012 AD-53535.1 0.58 1.05 0.036 0.071 AD-53536.1 0.12 0.45 0.009 0.026 AD-53537.1 0.73 0.96 0.101 0.015 AD-53538.1 0.74 1.07 0 0.046 AD-53539.1 0.52 0.97 0.057 0.032 AD-53540.1 0.1 0.47 0.017 0.012 AD-53541.1 0.11 0.29 0.026 0.015 AD-53542.1 0.08 0.23 0.008 0.006 AD-53543.1 0.62 1.01 0.027 0.014 AD-53544.1 0.8 1.04 0.002 0.001 AD-53545.1 0.17 0.73 0.007 0.007 AD-53546.1 0.27 0.93 0.058 0.019 AD-53547.1 0.12 0.28 0.008 0.01 AD-53548.1 0.1 0.34 0.022 0.002 AD-53549.1 0.8 1.04 0.011 0.026 AD-53550.1 0.05 0.54 0.02 0.003 AD-53551.1 0.96 1.16 0.029 0.044 AD-53552.1 0.13 0.5 0.002 0.009 AD-53553.1 0.92 1.1 0.027 0.02 AD-53554.1 0.76 0.67 0.005 0.004 AD-53555.1 0.11 0.53 0.009 0.007 AD-53561.1 0.72 0.94 0.014 0.001 AD-53567.1 0.16 0.66 0.019 0.003 AD-53573.1 1.06 1.10 0.019 0.037 AD-53579.1 0.19 0.76 0.036 0.019
IC.sub.50s of Select ALAS1 siRNA Duplexes in In Vitro Screen
[0856] Table 5 illustrates the IC.sub.50s of select ALAS1 siRNA duplexes determined from the knockdown of endogenously expressed ALAS1 in the Hep3B cell line, by ALAS1 modified siRNA duplexes (see Table 2). Data were generated as described above, at 24 or 120 hours following transfection of each siRNA duplex. In this example, silencing of ALAS1 is expressed as the fraction mRNA message remaining relative to the siRNA AD-1955, a non-targeting siRNA that was used as a negative control. Data from replicate transfection experiments were used to fit a single line to determine the IC.sub.50. Several of the duplexes (e.g., AD-53541.1, AD-53542.1, and AD-53547.1) had an IC.sub.50 as low as about 0.03 nM at 24 hours. Numerous duplexes had an IC.sub.50 of less than 0.1 nM (e.g., AD-53534.1, AD-53536.1, AD-53540.1, AD-53541.1, AD-53542.1, AD-53547.1, AD-53548.1, AD-53550.1, AD-53552.1) at 24 hours, and some of these also had an IC.sub.50 of less than 0.1 nM (e.g., AD-53534.1, AD-53540.1, AD-53541.1, AD-53542.1, AD-53547.1, AD-53552.1) at 120 hours.
TABLE-US-00008 TABLE 5 IC.sub.50S of select ALAS1 siRNA duplexes normalized to AD-1955 IC50 (nM) DUPLEX ID 24 hrs 120 hrs AD-53534.1 0.045 0.076 AD-53536.1 0.049 0.105 AD-53540.1 0.054 0.077 AD-53541.1 0.032 0.062 AD-53542.1 0.028 0.093 AD-53547.1 0.03 0.062 AD-53548.1 0.044 0.101 AD-53550.1 0.085 0.152 AD-53552.1 0.077 0.063 AD-53567.1 0.219 0.357 AD-53579.1 0.217 0.566
Example 4. In Vivo Silencing Using a Mouse/Rat ALAS1 siRNA Formulated as a LNP
[0857] The sequences of the modified duplex AD-53558 are shown in Table 6 below.
TABLE-US-00009 TABLE 6 Sequences of ALAS1 siRNA Duplex AD-53558.4 SEQ ID Start SEQ ID NO: Position on NO: (anti- transcript of (sense) sense) NM_020559.2 Duplex Name Sense Sequence (5′-3′) Antisense Sequence (5′-3′) 383 384 1184 AD-53558 cuGuGAAAuuuAcucuGAudTsdT AUcAGAGuAAAUUUcAcAGdTsdT
[0858] This duplex was formulated as a LNP11 formulation (see Table 10 above). The LNP-formulated AD-53558 siRNA was tested in in vivo in mice (N=25 animals; 5 animals per group) and rats (N=20 animals; 4 animals per group) and was confirmed to silence ALAS1 mRNA in vivo. The results are shown in
[0859]
[0860] Similarly,
[0861] The durability of silencing was also tested in mice (N=15; 3 animals per timepoint. The results are shown in
Example 5. Efficacy of ALAS1 siRNA in an Animal Model of AIP
[0862] The effects of the AD-53558 LNP11 formulation (a mouse/rat ALAS1 siRNA described in the previous example) were investigated in a mouse model of AIP. The PBGD knockout is not viable (−/−, 0% activity). Heterozygous PBGD knockout mice (+/−, ˜50% activity) are available but do not have the full biochemical phenotype and thus do not recapitulate the human disease phenotype. Thus, a mouse model of AIP has been developed that is a compound heterozygote with T1/T2 alleles, including T1 (+/−) promoter disruption and T2 (−/−) splice-site alteration. These mice have been shown to have hepatic residual PBGD activity that is about ˜30% of the wild-type level and normal or slightly elevated baseline plasma ALA and PBG levels. The mice have been found to appear normal early in life and to become slightly slower and ataxic with age. By six months of age, the mice have been documented to develop impaired motor coordination and muscular performance and axonal degeneration on pathological examination. Investigation of the pathology of the mouse model has shown axonal degeneration, impaired motor coordination and muscular performance in older mice. Urinary and plasma ALA and PBG have been found to markedly increase with serial i.p. administration of phenobarbital (see Lindberg et al., (1996), Nature Genetics, 12:195-219 and Lindberg et al., (1999), Journal of Clinical Investigation, 103:1127-34). The mice were rescued by AAV-mediated expression of PBGD in the liver (Yasuda et al. (2010), Molecular Medicine, 1:17-22 and Unzu et al. (2011), Molecular Medicine, 2:243-50).
[0863] On day 1, the mice were administered 1 mg/kg ALAS1 siRNA (n=5) or LUC AD-1955 control (n=3) by i.v. injection. Three phenobarbital injections were given (1 injection per day on days 2, 3, and 4) to induce hepatic ALAS1 and the porphyrin precursors, ALA and PBG. Plasma and overnight urine specimens were collected on day 5 and metabolite levels were measured by LC-MS. Metabolite levels were measured in plasma by LC-MS and were also measured in urine. Baseline levels of metabolites were measured prior to the first treatment on day 1. The results are shown in
[0864]
[0865]
[0866] Tables 12 and 13 shows urine ALA and PBG levels at baseline and after phenobarbital treatment in LUC siRNA (n=2) control (CTR, which refers to a PBS buffer treated animal, n=1) and ALAS1 siRNA (n=5) treated animals.
TABLE-US-00010 TABLE 12 Urine data from individual animals showing prevention of induced acute attack ALA PBG ALA PBG (micro (micro Creatinine (microM/mg (microM/mg Mouse ID M/I) M/L) (mg/dl) creatinine) creatinine) siRNA PB Ha-17-4-6 29.7 7.9 Baseline − Ha-19-5-4/2 15.7 5.1 Baseline − Ha-20-39- 28.6 6.7 Baseline − 4/3 Ha-20-38-4 21.4 4.7 Baseline − Ha-21-33-4 934.92 483.71 0.4205 222.33 115.03 Luc + Ha-21-36-9 944.08 563.53 0.5055 186.76 111.48 Luc + Ha-21-18-8 32.88 8.69 0.133 24.72 6.53 ALAS1; + 1 mg/kg Ha-21-33-7 83.07 23.28 0.426 19.50 5.46 ALAS1; + 1 mg/kg Ha-21-34-5 59.15 18.41 0.263 22.49 7.00 ALAS1; + 1 mg/kg PB stands for phenobarbital. A “+” indicates that phenobarbital was administered.
TABLE-US-00011 TABLE 13 Average Urine Data Mean ALA Mean PBG (microM/mg (microM/mg Condition creatinine) creatinine) AIP Baseline 23.8 6.1 Luc-siRNA 204.55 113.26 ALAS1-siRNA 22.24 6.33
[0867] Phenobarbital treatment induced strong increases (˜25-30 fold increases) in urine ALA (˜9-fold over baseline levels) and PBG (˜19-fold over baseline levels) in the LUC siRNA treated mice, control, whereas such increases were not observed in the ALAS1 siRNA treated animals. Thus, ALAS1 siRNA blocked phenobarbital-induced increases in urinary ALA and PBG. These results are consistent with the plasma measurements and show that ALAS1 siRNA treatment was effective in preventing increases in urinary metabolites (ALA and PBG) associated with the phenobarbital-induced acute attacks in this AIP animal model.
[0868] In further experiments (
[0869] Collectively, the results provided in this Example show that ALAS1 siRNA was effective in treating acute attacks in an animal model of the acute hepatic porphyria AIP. Multiple outcome measures support this conclusion, including plasma ALA levels, plasma PBG levels, urine ALA levels, urine PBG levels, and liver ALAS1 mRNA expression levels.
Example 6. In Vivo Silencing Using GalNAc-Conjugated Mouse ALAS1 siRNA
[0870] The experiments described in this example investigated the in vivo efficacy of three GalNAc-conjugated siRNAs (see Table 7). These siRNAs were designed and produced with methods such as those described in Example 2.
TABLE-US-00012 TABLE 7 Sequences AD-57929 SEQ Position Position SEQ ID of sense of antisense ID NO: seq. on seq. on NO: (anti- transcript Duplex Sense transcript (sense) sense) NM_020559.2 Name Sequence (5′-3′) Antisense Sequence (5′-3′) NM_020559.2 385 386 775-795 AD- AfaGfuCfuGfuUfUfC uUfgAfaAfaGfuGfgaaAfcAfgA 773-795 56211 fcAfcUfuUfuCfaAfL96 fcUfusUfsg 387 388 2168-2188 AD- AfcAfuAfgUfaGfCfC aGfaCfaAfuUfcUfggcUfaCfuA 2166-2188 56173 faGfaAfuUfgUfcUfL96 fuGfusGfsg 389 390 775-795 AD- AfsasGfuCfuGfuUfUfC usUfsgAfaAfaGfuGfgaaAfcAf 773-795 57929 fcAfcUfuUfuCfaAfL96 gAfcUfususg
[0871] The mice (n=40; n=4 per experimental condition) were divided into groups that received PBS or doses of 3 mg/kg, 10 mg/kg, or 30 mg/kg of siRNA administered subcutaneously. The level of mALAS1/mGAPDH mRNA, relative to the PBS control, was determined in liver cells at 72 hours post-administration. The results are shown in
Example 7. Human siRNAs
[0872] Additional human siRNAs were designed and produced as described in Example 2. The top 45 siRNAs were selected based on their predicted efficacy. The sequences of these 45 siRNAs are provided in Table 8 and the Sequence Listing attached herewith (e.g., a sense sequence corresponding to one of the odd numbered sequences identified as SEQ ID NOs: 391 to 551, and an antisense sequence corresponding to one of the even numbered sequences identified as SEQ ID NOs: 392 to 552, respectively). Table 8 is disclosed in International Publication No. WO2013/155204A2. The contents of WO 2013/155204 and the Sequence Listing, including Table 8, are expressly incorporated by reference.
Example 8. Human siRNAs
[0873] Additional 19mer human siRNAs were generated. The sequences of these siRNAs are provided in Table 9 and the Sequence Listing attached herewith (e.g., a sense sequence corresponding to one of the odd numbered sequences identified as SEQ ID NOs: 553 to 3365, and an antisense sequence corresponding to one of the even numbered sequences identified as SEQ ID NOs: 554 to 3366, respectively). Table 9 is disclosed in International Publication No. WO2013/155204A2. The contents of WO 2013/155204 and the Sequence Listing, including Table 9, are expressly incorporated by reference. These siRNAs can be tested for efficacy using methods described herein and/or methods known in the art.
Example 9. Suppression of Porphyrin Precursors Using ALAS1 siRNA in an Acute Treatment Paradigm
[0874] The AIP mouse model (see Example 5) was used to investigate whether ALAS1 siRNA would work an acute treatment paradigm to lower already elevated levels of ALA and PBG, as would be present, for example, when a human porphyria patient suffers from an acute attack. Administration of the AD-53558 LNP11 formulation siRNA at a 1 mg/kg dose 12 hours after the last dose of phenobarbital rapidly decreased the levels of both ALA and PBG in mouse plasma, whereas in Luc control treated animals the levels continued to rise (
[0875] As can be observed in
Example 10. siRNAs that Target ALAS1
[0876] Further unmodified and modified siRNA sequences that target ALAS1 siRNA were designed and produced as described in Example 2. The in vitro activity of the modified duplexes was tested as described below.
Methods
Lipid Mediated Transfection
[0877] For Hep3B, PMH, and primary Cynomolgus hepatocytes, transfection was carried out by adding 14.8 μl of Opti-MEM plus 0.2 μl of Lipofectamine RNAiMax per well (Invitrogen, Carlsbad Calif. catalog number 13778-150) to 5 μl of each siRNA duplex to an individual well in a 96-well plate. The mixture was then incubated at room temperature for 20 minutes. Eighty μ1 of complete growth media without antibiotic containing the appropriate cell number were then added to the siRNA mixture. Cells were incubated for 24 hours prior to RNA purification.
[0878] Single dose experiments were performed at 1 uM, 500 nM, 20 nM, 10 nM and 0.2 nM final duplex concentration for GalNAc modified.
[0879] Free Uptake Transfection
[0880] Cryopreserved Primary Cynomolgus Hepatocytes (Celsis In Vitro Technologies, M003055-P) were thawed at 37° C. water bath immediately prior to usage and re-suspended at 0.26×10.sup.6 cells/ml in InVitroGRO CP (plating) medium (Celsis In Vitro Technologies, catalog number Z99029). During transfections, cells were plated onto a BD BioCoat 96 well collagen plate (BD, 356407) at 25,000 cells per well and incubated at 37° C. in an atmosphere of 5% CO.sub.2. Free Uptake experiments were performed by adding 10 μl of siRNA duplexes in PBS per well into a 96 well (96 w) plate. Ninety μ1 of complete growth media containing appropriate cell number for the cell type was then added to the siRNA. Cells were incubated for 24 hours prior to RNA purification. Single dose experiments were performed at 1 uM, 500 nM, 20 nM and 10 nM final duplex.
[0881] Total RNA Isolation Using DYNABEADS mRNA Isolation Kit (Invitrogen, Part #: 610-12)
[0882] Cells were harvested and lysed in 150 μl of Lysis/Binding Buffer then mixed for 5 minutes at 850 rpm using an Eppendorf Thermomixer (the mixing speed was the same throughout the process). Ten microliters of magnetic beads and 80 μl Lysis/Binding Buffer mixture were added to a round bottom plate and mixed for 1 minute. Magnetic beads were captured using a magnetic stand and the supernatant was removed without disturbing the beads. After removing the supernatant, the lysed cells were added to the remaining beads and mixed for 5 minutes. After removing the supernatant, magnetic beads were washed 2 times with 150 μl Wash Buffer A and mixed for 1 minute. The beads were captured again and the supernatant was removed. The beads were then washed with 150 μl Wash Buffer B, captured and the supernatant was removed. The beads were next washed with 150 μl Elution Buffer, captured and the supernatant removed. Finally, the beads were allowed to dry for 2 minutes. After drying, 50 μl of Elution Buffer was added and mixed for 5 minutes at 70° C. The beads were captured on magnet for 5 minutes. Forty-five μ1 of supernatant was removed and added to another 96 well plate.
[0883] cDNA Synthesis Using ABI High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, Calif., Cat #4368813)
[0884] A master mix of 2 μl 10× Buffer, 0.8 μl 25× dNTPs, 2 μl Random primers, 1 μl Reverse Transcriptase, 1 μl RNase inhibitor and 3.2 μl of H.sub.2O per reaction as prepared. Equal volumes master mix and RNA were mixed for a final volume of 14.1 for in vitro screened or 20μ. 1 for in vivo screened samples. cDNA was generated using a Bio-Rad C-1000 or S-1000 thermal cycler (Hercules, Calif.) through the following steps: 25° C. for 10 minutes, 37° C. for 120 minutes, 85° C. for 5 seconds, and 4° C. hold.
[0885] Real Time PCR
[0886] Two μl of cDNA were added to a master mix containing 2 μl of H.sub.2O, 0.5 μl GAPDH TaqMan Probe (Life Technologies catalog number 4326317E for Hep3B cells, catalog number 352339E for primary mouse hepatocytes or custom probe for cynomolgus primary hepatocytes), 0.5 μl C5 TaqMan probe (Life Technologies catalog number Hs00167441 ml for Hep3B cells or Mm00457879_m1 for Primary Mouse Hepatoctyes or custom probe for cynomolgus primary hepatocytes) and 5 μl Lightcycler 480 probe master mix (Roche catalog number 04887301001) per well in a 384 well (384 w) plates (Roche catalog number 04887301001). Real time PCR was performed in an Roche LC480 Real Time PCR system (Roche) using the ΔΔCt(RQ) assay. For in vitro screening, each duplex was tested with two biological replicates unless otherwise noted and each Real Time PCR was performed in duplicate technical replicates. For in vivo screening, each duplex was tested in one or more experiments (3 mice per group) and each Real Time PCR was run in duplicate technical replicates.
[0887] To calculate relative fold change in ALAS1 mRNA levels, real time data were analyzed using the ΔΔCt method and normalized to assays performed with cells transfected with 10 nM AD-1955, or mock transfected cells. IC.sub.50s were calculated using a 4 parameter fit model using XLFit and normalized to cells transfected with AD-1955 over the same dose range, or to its own lowest dose.
[0888] The Sense and Antisense Sequences of AD-1955 are:
TABLE-US-00013 SENSE: (SEQ ID NO: 3682) cuuAcGcuGAGuAcuucGAdTsdT ANTISENSE: (SEQ ID NO: 3683) UCGAAGuACUcAGCGuAAGdTsdT.
[0889] The single strand and duplex sequences of the modified and unmodified siRNAs are provided in Table 14 and Table 15, respectively.
TABLE-US-00014 TABLE 14 Human ALAS1 Modified Single Strands and Duplex Sequences SEQ ID Target sites SEQ ID NO: of antisense NO: (anti- Duplex sequence on (sense) sense) Name Sense Sequence (5′-3′) Antisense Sequence (5′-3′) NM_000688.4 3371 3372 AD-58848 CfsasUfgCfcAfaAfAfAfuGfgAfcAf asUfsgAfuGfuCfcAfuuuUfuGfgCfaU 1635-1657 uCfaUfL96 fgsAfsc 3373 3374 AD-58849 AfsusUfuUfgAfaGfUfGfaUfgAfgU usUfsuCfaCfuCfaUfcacUfuCfaAfaAf 2189-2211 fgAfaAfL96 usGfsc 3375 3376 AD-58850 AfsgsUfuAfuAfuUfAfAfaUfuUfuA asGfsaUfuAfaAfaUfuuaAfuAfuAfaC 2344-2366 faUfcUfL96 fusUfsa 3377 3378 AD-58851 GfscsAfuUfuUfgAfAfGfuGfaUfgA usCfsaCfuCfaUfcAfcuuCfaAfaAfuGf 2187-2209 fgUfgAfL96 csAfsg 3379 3380 AD-58852 GfsasAfcUfaAfuGfAfGfcAfgAfcAf gsUfsuAfuGfuCfuGfcucAfuUfaGfuU 1975-1997 uAfaCfL96 fcsAfsu 3381 3382 AD-58853 AfsasUfgAfcCfaCfAfCfcUfaUfcGf asAfscUfcGfaUfaGfgugUfgGfuCfaU 973-995 aGfuUfL96 fusCfsu 3383 3384 AD-58854 UfsasAfaUfuUfuAfAfUfcUfaUfaG usUfsuAfcUfaUfaGfauuAfaAfaUfuU 2352-2374 fuAfaAfL96 fasAfsu 3385 3386 AD-58855 UfsusCfaGfuAfuGfAfUfcGfuUfuC csAfsaAfgAfaAfcGfaucAfuAfcUfgAf 929-951 fuUfuGfL96 asAfsa 3387 3388 AD-58856 CfsasCfuUfuUfcAfGfUfaUfgAfuCf asAfsaCfgAfuCfaUfacuGfaAfaAfgUf 924-946 gUfuUfL96 gsGfsa 3389 3390 AD-58857 AfsasAfuCfuGfuUfUfCfcAfcUfuUf csUfsgAfaAfaGfuGfgaaAfcAfgAfuUf 913-935 uCfaGfL96 usUfsg 3391 3392 AD-58858 CfsasUfuUfgAfaAfCfUfgUfcCfaUf usUfsgAfaUfgGfaCfaguUfuCfaAfaU 1478-1500 uCfaAfL96 fgsCfsc 3393 3394 AD-58859 CfscsUfaUfcGfaGfUfUfuUfuAfaA csAfsgUfuUfuAfaAfaacUfcGfaUfaG 983-1005 faCfuGfL96 fgsUfsg 3395 3396 AD-58861 GfsasCfcAfgAfaAfGfAfgUfgUfcUf gsAfsuGfaGfaCfaCfucuUfuCfuGfgU 872-894 cAfuCfL96 fcsUfsu 3397 3398 AD-58862 AfscsCfaGfaAfaGfAfGfuGfuCfuCf asGfsaUfgAfgAfcAfcucUfuUfcUfgGf 873-895 aUfcUfL96 usCfsu 3399 3400 AD-58863 AfscsUfaAfuGfaGfCfAfgAfcAfuAf asUfsgUfuAfuGfuCfugcUfcAfuUfaG 1977-1999 aCfaUfL96 fusUfsc 3401 3402 AD-58864 UfsasGfuAfaAfaAfCfAfuAfgUfcCf usCfscAfgGfaCfuAfuguUfuUfuAfcU 2366-2388 uGfgAfL96 fasUfsa 3403 3404 AD-58865 UfsasUfuUfcUfgGfAfAfcUfaGfuA asAfsuUfuAfcUfaGfuucCfaGfaAfaU 1185-1207 faAfuUfL96 fasUfsu 3405 3406 AD-58867 UfsusCfuGfcAfaAfGfCfcAfgUfcUf csUfscAfaGfaCfuGfgcuUfuGfcAfgAf 706-728 uGfaGfL96 asGfsa 3407 3408 AD-58868 GfsasGfgAfaAfgAfGfGfuUfgCfuG gsUfsuUfcAfgCfaAfccuCfuUfuCfcUf 759-781 faAfaCfL96 csAfsc 3409 3410 AD-58869 GfsgsUfaCfuAfgAfAfAfuAfuUfuCf usCfscAfgAfaAfuAfuuuCfuAfgUfaCf 1174-1196 uGfgAfL96 csAfsc 3411 3412 AD-58870 GfsasCfaUfcAfuGfCfAfaAfaGfcAf usCfsuUfuGfcUfuUfugcAfuGfaUfgU 853-875 aAfgAfL96 fcsCfsu 3413 3414 AD-58871 AfsasAfuUfuUfaAfUfCfuAfuAfgU usUfsuUfaCfuAfuAfgauUfaAfaAfuU 2353-2375 faAfaAfL96 fusAfsa 3415 3416 AD-58873 CfsasUfgAfuCfcAfAfGfgGfaUfuCf usUfsuCfgAfaUfcCfcuuGfgAfuCfaUf 1362-1384 gAfaAfL96 gsGfsa 3417 3418 AD-58874 AfsgsAfcCfaGfaAfAfGfaGfuGfuCf asUfsgAfgAfcAfcUfcuuUfcUfgGfuCf 871-893 uCfaUfL96 usUfsu 3419 3420 AD-58875 AfsusCfcUfgAfaGfAfGfcGfcUfgAf usCfscCfuCfaGfcGfcucUfuCfaGfgAf 1810-1832 gGfgAfL96 usCfsc 3421 3422 AD-58876 GfsusCfuGfuGfaUfGfAfaCfuAfaU gsCfsuCfaUfuAfgUfucaUfcAfcAfgAf 1966-1988 fgAfgCfL96 csUfsu 3423 3424 AD-58877 CfsasGfaAfaGfaGfUfGfuCfuCfaUf gsAfsaGfaUfgAfgAfcacUfcUfuUfcUf 875-897 cUfuCfL96 gsGfsu 3425 3426 AD-58878 AfscsUfuUfuCfaGfUfAfuGfaUfcG gsAfsaAfcGfaUfcAfuacUfgAfaAfaGf 925-947 fuUfuCfL96 usGfsg 3427 3428 AD-58879 UfscsAfuGfcCfaAfAfAfaUfgGfaCf usGfsaUfgUfcCfaUfuuuUfgGfcAfuG 1634-1656 aUfcAfL96 fasCfsu 3429 3430 AD-58880 AfsasUfaUfuUfcUfGfGfaAfcUfaG usUfsuAfcUfaGfuUfccaGfaAfaUfaU 1183-1205 fuAfaAfL96 fusUfsc 3431 3432 AD-58881 CfsusUfcUfuCfaAfGfAfuAfaCfuUf usGfsgCfaAfgUfuAfucuUfgAfaGfaA 892-914 gCfcAfL96 fgsAfsu 3433 3434 AD-58882 UfsusUfcAfgUfaUfGfAfuCfgUfuU asAfsaGfaAfaCfgAfucaUfaCfuGfaAf 928-950 fcUfuUfL96 asAfsg 3435 3436 AD-58883 CfscsCfaGfuGfuGfGfUfuAfgUfgU usUfsuCfaCfaCfuAfaccAfcAfcUfgGf 790-812 fgAfaAfL96 gsGfsc 3437 3438 AD-58884 GfscsUfgUfgAfgAfUfUfuAfcUfcUf asAfsuCfaGfaGfuAfaauCfuCfaCfaGf 1325-1347 gAfuUfL96 csCfsu 3439 3440 AD-58885 AfsgsGfcUfuGfaGfCfAfaGfuUfgG gsAfsuAfcCfaAfcUfugcUfcAfaGfcCf 2229-2251 fuAfuCfL96 usGfsa 3441 3442 AD-58886 GfsasAfaGfaGfuGfUfCfuCfaUfcU asAfsgAfaGfaUfgAfgacAfcUfcUfuUf 877-899 fuCfuUfL96 csUfsg 3443 3444 AD-58887 AfsusUfuCfuGfgAfAfCfuAfgUfaAf gsAfsaUfuUfaCfuAfguuCfcAfgAfaAf 1186-1208 aUfuCfL96 usAfsu 3445 3446 AD-58888 UfsgsUfgAfuGfuGfGfCfcCfaUfgAf asAfsaCfuCfaUfgGfgccAfcAfuCfaCf 1531-1553 gUfuUfL96 asCfsa 3447 3448 AD-58889 AfsasGfaGfaGfaAfGfUfcCfuAfuU gsAfsgAfaAfuAfgGfacuUfcUfcUfcUf 2208-2230 fuCfuCfL96 usUfsc 3449 3450 AD-58890 UfsgsGfcAfgCfaCfAfGfaUfgAfaUf usCfsuGfaUfuCfaUfcugUfgCfuGfcCf 671-693 cAfgAfL96 asGfsg 3451 3452 AD-58891 AfsusGfaUfcGfuUfUfCfuUfuGfaG usUfsuUfcUfcAfaAfgaaAfcGfaUfcAf 935-957 faAfaAfL96 usAfsc 3453 3454 AD-58892 UfscsUfgGfaAfcUfAfGfuAfaAfuU asUfsgGfaAfuUfuAfcuaGfuUfcCfaG 1189-1211 fcCfaUfL96 fasAfsa 3455 3456 AD-59095 GfscsCfcAfuUfcUfUfAfuCfcCfgAf asCfsuCfgGfgAfuAfagaAfuGfgsgsc 360-382 gUfL96 3457 3458 AD-59096 GfsgsAfaCfcAfuGfCfCfuCfcAfuGf asUfscAfuGfgAfgGfcauGfgUfuscsc 1347-1369 aUfL96 3459 3460 AD-59097 UfsgsGfaGfuCfuGfUfGfcGfgAfuC asGfsgAfuCfcGfcAfcagAfcUfcscsa 1794-1816 fcUfL96 3461 3462 AD-59098 CfsasCfcCfaCfgGfGfUfgUfgUfgGf usCfscCfaCfaCfaCfccgUfgGfgsusg 1112-1134 gAfL96 3463 3464 AD-59099 GfsgsAfgUfcUfgUfGfCfgGfaUfcCf usAfsgGfaUfcCfgCfacaGfaCfuscsc 1795-1817 uAfL96 3465 3466 AD-59100 CfsasAfaAfcUfgCfCfCfcAfaGfaUf usCfsaUfcUfuGfgGfgcaGfuUfususg 428-450 gAfL96 3467 3468 AD-59101 GfscsCfuCfcAfuGfAfUfcCfaAfgGf usCfscCfuUfgGfaUfcauGfgAfgsgsc 1355-1377 gAfL96 3469 3470 AD-59102 CfsasUfcAfuCfcCfUfGfuGfcGfgGf asAfscCfcGfcAfcAfgggAfuGfasusg 1921-1943 uUfL96 3471 3472 AD-59103 AfscsCfcAfcGfgGfUfGfuGfuGfgGf usCfscCfcAfcAfcAfcccGfuGfgsgsu 1113-1135 gAfL96 3473 3474 AD-59104 CfsasCfaUfcAfuCfCfCfuGfuGfcGf usCfscGfcAfcAfgGfgauGfaUfgsusg 1919-1941 gAfL96 3475 3476 AD-59105 CfsasGfaAfaGfaGfUfGfuCfuCfaUf asGfsaUfgAfgAfcAfcucUfuUfcsusg 873-895 cUfL96 3477 3478 AD-59106 CfscsUfcCfaUfgAfUfCfcAfaGfgGf asUfscCfcUfuGfgAfucaUfgGfasgsg 1356-1378 aUfL96 3479 3480 AD-59107 UfsgsCfcCfaUfuCfUfUfaUfcCfcGf usUfscGfgGfaUfaAfgaaUfgGfgscsa 359-381 aAfL96 3481 3482 AD-59108 CfsusUfcAfcCfcUfGfGfcUfaAfgAf usAfsuCfuUfaGfcCfaggGfuGfasasg 1297-1319 uAfL96 3483 3484 AD-59109 AfsusCfaUfcCfcUfGfUfgCfgGfgUf usAfsaCfcCfgCfaCfaggGfaUfgsasu 1922-1944 uAfL96 3485 3486 AD-59110 AfsgsAfaAfgAfgUfGfUfcUfcAfuCf asAfsgAfuGfaGfaCfacuCfuUfuscsu 874-896 uUfL96 3487 3488 AD-59111 CfsusCfcAfuGfaUfCfCfaAfgGfgAf asAfsuCfcCfuUfgGfaucAfuGfgsasg 1357-1379 uUfL96 3489 3490 AD-59112 CfscsAfuUfcUfuAfUfCfcCfgAfgUf usGfsaCfuCfgGfgAfuaaGfaAfusgsg 362-384 cAfL96 3491 3492 AD-59113 CfsasCfcCfuGfgCfUfAfaGfaUfgAf usAfsuCfaUfcUfuAfgccAfgGfgsusg 1300-1322 uAfL96 3493 3494 AD-59114 UfscsAfuCfcCfuGfUfGfcGfgGfuUf usCfsaAfcCfcGfcAfcagGfgAfusgsa 1923-1945 gAfL96 3495 3496 AD-59115 AfsasGfaGfuGfuCfUfCfaUfcUfuCf asAfsgAfaGfaUfgAfgacAfcUfcsusu 877-899 uUfL96 3497 3498 AD-59116 GfsusCfaUfgCfcAfAfAfaAfuGfgAf usGfsuCfcAfuUfuUfuggCfaUfgsasc 1631-1653 cAfL96 3499 3500 AD-59117 CfsasUfuCfuUfaUfCfCfcGfaGfuCf usGfsgAfcUfcGfgGfauaAfgAfasusg 363-385 cAfL96 3501 3502 AD-59118 AfscsCfcUfgGfcUfAfAfgAfuGfaUf usCfsaUfcAfuCfuUfagcCfaGfgsgsu 1301-1323 gAfL96 3503 3504 AD-59119 CfsusCfuUfcAfcCfCfUfgGfcUfaAf usCfsuUfaGfcCfaGfgguGfaAfgsasg 1295-1317 gAfL96 3505 3506 AD-59120 AfsusGfcCfaAfaAfAfUfgGfaCfaUf usGfsaUfgUfcCfaUfuuuUfgGfcsasu 1634-1656 cAfL96 3507 3508 AD-59121 UfsgsCfcCfcAfaGfAfUfgAfuGfgAf asUfsuCfcAfuCfaUfcuuGfgGfgscsa 434-456 aUfL96 3509 3510 AD-59122 GfsasAfcCfaUfgCfCfUfcCfaUfgAf usAfsuCfaUfgGfaGfgcaUfgGfususc 1348-1370 uAfL96 3511 3512 AD-59123 UfscsUfuCfaCfcCfUfGfgCfuAfaGf asUfscUfuAfgCfcAfgggUfgAfasgsa 1296-1318 aUfL96 3513 3514 AD-59124 UfsgsCfcAfaAfaAfUfGfgAfcAfuCf asUfsgAfuGfuCfcAfuuuUfuGfgscsa 1635-1657 aUfL96 3515 3516 AD-59125 CfscsAfgAfaAfgAfGfUfgUfcUfcAf usAfsuGfaGfaCfaCfucuUfuCfusgsg 872-894 uAfL96 3517 3518 AD-59126 GfsasAfaCfuGfuCfCfAfuUfcAfaUf usCfsaUfuGfaAfuGfgacAfgUfususc 1481-1503 gAfL96 3519 3520 AD-59127 UfscsAfcCfcUfgGfCfUfaAfgAfuGf asUfscAfuCfuUfaGfccaGfgGfusgsa 1299-1321 aUfL96 3521 3522 AD-59128 CfscsCfuGfgAfgUfCfUfgUfgCfgGf asUfscCfgCfaCfaGfacuCfcAfgsgsg 1791-1813 aUfL96 3523 3524 AD-59129 GfsasAfaGfaGfuGfUfCfuCfaUfcU usAfsaGfaUfgAfgAfcacUfcUfususc 875-897 fuAfL96 3525 3526 AD-59130 UfsgsGfaGfcCfcUfGfGfaGfuCfuG usAfscAfgAfcUfcCfaggGfcUfcscsa 1786-1808 fuAfL96
TABLE-US-00015 TABLE 15 Human ALAS1 Unmodified Single Strands and Duplex Sequences SEQ ID Target sites SEQ ID NO: of antisense NO: (anti- Duplex Antisense sequence on (sense) sense) Name Sense Sequence (5′-3′) Sequence (5′-3′) NM_000688.4 3684 3527 AD-58848 CAUGCCAAAAAUGGACAUCAU AUGAUGUCCAUUUUUGGCAUGAC 1635-1657 3528 3529 AD-58849 AUUUUGAAGUGAUGAGUGAAA UUUCACUCAUCACUUCAAAAUGC 2189-2211 3530 3531 AD-58850 AGUUAUAUUAAAUUUUAAUCU AGAUUAAAAUUUAAUAUAACUUA 2344-2366 3532 3533 AD-58851 GCAUUUUGAAGUGAUGAGUGA UCACUCAUCACUUCAAAAUGCAG 2187-2209 3534 3535 AD-58852 GAACUAAUGAGCAGACAUAAC GUUAUGUCUGCUCAUUAGUUCAU 1975-1997 3536 3537 AD-58853 AAUGACCACACCUAUCGAGUU AACUCGAUAGGUGUGGUCAUUCU 973-995 3538 3539 AD-58854 UAAAUUUUAAUCUAUAGUAAA UUUACUAUAGAUUAAAAUUUAAU 2352-2374 3540 3541 AD-58855 UUCAGUAUGAUCGUUUCUUUG CAAAGAAACGAUCAUACUGAAAA 929-951 3542 3543 AD-58856 CACUUUUCAGUAUGAUCGUUU AAACGAUCAUACUGAAAAGUGGA 924-946 3544 3545 AD-58857 AAAUCUGUUUCCACUUUUCAG CUGAAAAGUGGAAACAGAUUUUG 913-935 3546 3547 AD-58858 CAUUUGAAACUGUCCAUUCAA UUGAAUGGACAGUUUCAAAUGCC 1478-1500 3548 3549 AD-58859 CCUAUCGAGUUUUUAAAACUG CAGUUUUAAAAACUCGAUAGGUG 983-1005 3550 3551 AD-58861 GACCAGAAAGAGUGUCUCAUC GAUGAGACACUCUUUCUGGUCUU 872-894 3552 3553 AD-58862 ACCAGAAAGAGUGUCUCAUCU AGAUGAGACACUCUUUCUGGUCU 873-895 3554 3555 AD-58863 ACUAAUGAGCAGACAUAACAU AUGUUAUGUCUGCUCAUUAGUUC 1977-1999 3556 3557 AD-58864 UAGUAAAAACAUAGUCCUGGA UCCAGGACUAUGUUUUUACUAUA 2366-2388 3558 3559 AD-58865 UAUUUCUGGAACUAGUAAAUU AAUUUACUAGUUCCAGAAAUAUU 1185-1207 3560 3561 AD-58867 UUCUGCAAAGCCAGUCUUGAG CUCAAGACUGGCUUUGCAGAAGA 706-728 3562 3563 AD-58868 GAGGAAAGAGGUUGCUGAAAC GUUUCAGCAACCUCUUUCCUCAC 759-781 3564 3565 AD-58869 GGUACUAGAAAUAUUUCUGGA UCCAGAAAUAUUUCUAGUACCAC 1174-1196 3566 3567 AD-58870 GACAUCAUGCAAAAGCAAAGA UCUUUGCUUUUGCAUGAUGUCCU 853-875 3568 3569 AD-58871 AAAUUUUAAUCUAUAGUAAAA UUUUACUAUAGAUUAAAAUUUAA 2353-2375 3570 3571 AD-58873 CAUGAUCCAAGGGAUUCGAAA UUUCGAAUCCCUUGGAUCAUGGA 1362-1384 3572 3573 AD-58874 AGACCAGAAAGAGUGUCUCAU AUGAGACACUCUUUCUGGUCUUU 871-893 3574 3575 AD-58875 AUCCUGAAGAGCGCUGAGGGA UCCCUCAGCGCUCUUCAGGAUCC 1810-1832 3576 3577 AD-58876 GUCUGUGAUGAACUAAUGAGC GCUCAUUAGUUCAUCACAGACUU 1966-1988 3578 3579 AD-58877 CAGAAAGAGUGUCUCAUCUUC GAAGAUGAGACACUCUUUCUGGU 875-897 3580 3581 AD-58878 ACUUUUCAGUAUGAUCGUUUC GAAACGAUCAUACUGAAAAGUGG 925-947 3582 3583 AD-58879 UCAUGCCAAAAAUGGACAUCA UGAUGUCCAUUUUUGGCAUGACU 1634-1656 3584 3585 AD-58880 AAUAUUUCUGGAACUAGUAAA UUUACUAGUUCCAGAAAUAUUUC 1183-1205 3586 3587 AD-58881 CUUCUUCAAGAUAACUUGCCA UGGCAAGUUAUCUUGAAGAAGAU 892-914 3588 3589 AD-58882 UUUCAGUAUGAUCGUUUCUUU AAAGAAACGAUCAUACUGAAAAG 928-950 3590 3591 AD-58883 CCCAGUGUGGUUAGUGUGAAA UUUCACACUAACCACACUGGGGC 790-812 3592 3593 AD-58884 GCUGUGAGAUUUACUCUGAUU AAUCAGAGUAAAUCUCACAGCCU 1325-1347 3594 3595 AD-58885 AGGCUUGAGCAAGUUGGUAUC GAUACCAACUUGCUCAAGCCUGA 2229-2251 3596 3597 AD-58886 GAAAGAGUGUCUCAUCUUCUU AAGAAGAUGAGACACUCUUUCUG 877-899 3598 3599 AD-58887 AUUUCUGGAACUAGUAAAUUC GAAUUUACUAGUUCCAGAAAUAU 1186-1208 3600 3601 AD-58888 UGUGAUGUGGCCCAUGAGUUU AAACUCAUGGGCCACAUCACACA 1531-1553 3602 3603 AD-58889 AAGAGAGAAGUCCUAUUUCUC GAGAAAUAGGACUUCUCUCUUUC 2208-2230 3604 3605 AD-58890 UGGCAGCACAGAUGAAUCAGA UCUGAUUCAUCUGUGCUGCCAGG 671-693 3606 3607 AD-58891 AUGAUCGUUUCUUUGAGAAAA UUUUCUCAAAGAAACGAUCAUAC 935-957 3608 3609 AD-58892 UCUGGAACUAGUAAAUUCCAU AUGGAAUUUACUAGUUCCAGAAA 1189-1211 3610 3611 AD-59095 GCCCAUUCUUAUCCCGAGU ACUCGGGAUAAGAAUGGGC 360-382 3612 3613 AD-59096 GGAACCAUGCCUCCAUGAU AUCAUGGAGGCAUGGUUCC 1347-1369 3614 3615 AD-59097 UGGAGUCUGUGCGGAUCCU AGGAUCCGCACAGACUCCA 1794-1816 3616 3617 AD-59098 CACCCACGGGUGUGUGGGA UCCCACACACCCGUGGGUG 1112-1134 3618 3619 AD-59099 GGAGUCUGUGCGGAUCCUA UAGGAUCCGCACAGACUCC 1795-1817 3620 3621 AD-59100 CAAAACUGCCCCAAGAUGA UCAUCUUGGGGCAGUUUUG 428-450 3622 3623 AD-59101 GCCUCCAUGAUCCAAGGGA UCCCUUGGAUCAUGGAGGC 1355-1377 3624 3625 AD-59102 CAUCAUCCCUGUGCGGGUU AACCCGCACAGGGAUGAUG 1921-1943 3626 3627 AD-59103 ACCCACGGGUGUGUGGGGA UCCCCACACACCCGUGGGU 1113-1135 3628 3629 AD-59104 CACAUCAUCCCUGUGCGGA UCCGCACAGGGAUGAUGUG 1919-1941 3630 3631 AD-59105 CAGAAAGAGUGUCUCAUCU AGAUGAGACACUCUUUCUG 873-895 3632 3633 AD-59106 CCUCCAUGAUCCAAGGGAU AUCCCUUGGAUCAUGGAGG 1356-1378 3634 3635 AD-59107 UGCCCAUUCUUAUCCCGAA UUCGGGAUAAGAAUGGGCA 359-381 3636 3637 AD-59108 CUUCACCCUGGCUAAGAUA UAUCUUAGCCAGGGUGAAG 1297-1319 3638 3639 AD-59109 AUCAUCCCUGUGCGGGUUA UAACCCGCACAGGGAUGAU 1922-1944 3640 3641 AD-59110 AGAAAGAGUGUCUCAUCUU AAGAUGAGACACUCUUUCU 874-896 3642 3643 AD-59111 CUCCAUGAUCCAAGGGAUU AAUCCCUUGGAUCAUGGAG 1357-1379 3644 3645 AD-59112 CCAUUCUUAUCCCGAGUCA UGACUCGGGAUAAGAAUGG 362-384 3646 3647 AD-59113 CACCCUGGCUAAGAUGAUA UAUCAUCUUAGCCAGGGUG 1300-1322 3648 3649 AD-59114 UCAUCCCUGUGCGGGUUGA UCAACCCGCACAGGGAUGA 1923-1945 3650 3651 AD-59115 AAGAGUGUCUCAUCUUCUU AAGAAGAUGAGACACUCUU 877-899 3652 3653 AD-59116 GUCAUGCCAAAAAUGGACA UGUCCAUUUUUGGCAUGAC 1631-1653 3654 3655 AD-59117 CAUUCUUAUCCCGAGUCCA UGGACUCGGGAUAAGAAUG 363-385 3656 3657 AD-59118 ACCCUGGCUAAGAUGAUGA UCAUCAUCUUAGCCAGGGU 1301-1323 3658 3659 AD-59119 CUCUUCACCCUGGCUAAGA UCUUAGCCAGGGUGAAGAG 1295-1317 3660 3661 AD-59120 AUGCCAAAAAUGGACAUCA UGAUGUCCAUUUUUGGCAU 1634-1656 3662 3663 AD-59121 UGCCCCAAGAUGAUGGAAU AUUCCAUCAUCUUGGGGCA 434-456 3664 3665 AD-59122 GAACCAUGCCUCCAUGAUA UAUCAUGGAGGCAUGGUUC 1348-1370 3666 3667 AD-59123 UCUUCACCCUGGCUAAGAU AUCUUAGCCAGGGUGAAGA 1296-1318 3668 3669 AD-59124 UGCCAAAAAUGGACAUCAU AUGAUGUCCAUUUUUGGCA 1635-1657 3670 3671 AD-59125 CCAGAAAGAGUGUCUCAUA UAUGAGACACUCUUUCUGG 872-894 3672 3673 AD-59126 GAAACUGUCCAUUCAAUGA UCAUUGAAUGGACAGUUUC 1481-1503 3674 3675 AD-59127 UCACCCUGGCUAAGAUGAU AUCAUCUUAGCCAGGGUGA 1299-1321 3676 3677 AD-59128 CCCUGGAGUCUGUGCGGAU AUCCGCACAGACUCCAGGG 1791-1813 3678 3679 AD-59129 GAAAGAGUGUCUCAUCUUA UAAGAUGAGACACUCUUUC 875-897 3680 3681 AD-59130 UGGAGCCCUGGAGUCUGUA UACAGACUCCAGGGCUCCA 1786-1808
[0890] The results of the in vitro assays are provided in Table 16. Table 16 also notes the target species of each of the siRNAs.
TABLE-US-00016 TABLE 16 Results of Functional Assays Cyno Free Uptake Cyno Transfection Hep3b Transfection Target 1 uM 20 nM 20 nM 0.2 nM 10 nM 0.1 nM Duplex ID Species Type Avg 500 nM Avg 10 nM Avg Avg Avg Avg AD-58848 M/R/Rh/H 21/23 131.6 176.0 104.4 128.0 43.5 44.8 25.3 76.8 AD-58849 H/Rh 21/23 91.9 88.1 92.2 105.0 29.4 35.4 11.5 47.1 AD-58850 H/Rh 21/23 79.4 103.4 80.0 111.2 NA 62.2 31.3 72.0 AD-58851 H/Rh 21/23 99.7 74.7 94.8 104.7 NA 40.7 8.6 81.3 AD-58852 H/Rh 21/23 108.1 91.8 103.3 111.9 101.1 128.8 43.4 129.0 AD-58853 H/Rh 21/23 74.8 67.7 84.2 93.5 24.7 52.9 14.1 61.2 AD-58854 H/Rh 21/23 145.9 124.1 106.6 115.3 119.0 83.9 85.0 84.0 AD-58855 H/Rh 21/23 81.5 97.9 92.7 101.8 39.5 40.3 15.3 67.6 AD-58856 H/Rh 21/23 74.1 90.6 84.6 82.6 22.4 30.7 8.7 33.3 AD-58857 H/Rh 21/23 64.7 91.4 62.3 87.1 22.0 31.6 9.8 106.3 AD-58858 H/Rh 21/23 67.4 91.7 68.6 98.3 27.9 40.3 17.4 44.8 AD-58859 H/Rh 21/23 71.2 77.2 92.4 90.1 19.1 34.3 13.1 39.7 AD-58861 H/Rh 21/23 104.6 107.2 102.0 100.6 25.9 35.1 18.0 69.8 AD-58862 H/Rh 21/23 66.8 77.0 68.7 88.5 20.3 31.1 24.2 49.9 AD-58863 H/Rh 21/23 70.8 66.8 76.8 98.5 21.5 29.7 8.7 54.9 AD-58864 H/Rh 21/23 76.2 85.6 83.7 100.8 60.4 61.0 56.4 87.3 AD-58865 H/Rh 21/23 67.9 77.9 95.9 98.4 21.3 38.6 15.5 81.4 AD-58867 H/Rh 21/23 95.9 93.3 107.0 97.5 32.3 42.7 16.6 79.8 AD-58868 H/Rh 21/23 95.2 92.1 116.2 94.7 54.6 69.2 61.5 105.9 AD-58869 H/Rh 21/23 65.0 78.2 75.8 88.2 17.4 25.0 13.0 63.9 AD-58870 H/Rh 21/23 69.4 92.3 81.0 88.1 29.2 43.8 33.7 79.1 AD-58871 H/Rh 21/23 61.2 77.3 88.2 77.0 71.2 73.2 36.7 110.3 AD-58873 H/Rh 21/23 95.2 100.9 83.3 94.6 54.2 52.8 36.6 73.3 AD-58874 H/Rh 21/23 75.8 76.8 63.8 85.3 22.3 31.2 15.0 38.2 AD-58875 H/Rh 21/23 80.7 88.7 78.6 97.9 48.6 73.6 61.2 90.6 AD-58876 H/Rh 21/23 90.8 93.1 82.5 100.2 41.1 56.9 21.2 58.7 AD-58877 H/Rh 21/23 68.3 85.1 51.2 78.7 18.5 46.6 11.9 27.4 AD-58878 H/Rh 21/23 78.3 68.3 81.2 91.2 24.1 23.4 6.2 37.1 AD-58879 H/Rh 21/23 87.9 94.1 79.7 95.4 32.0 47.8 15.7 82.5 AD-58880 H/Rh 21/23 74.9 72.2 88.9 88.1 20.1 27.5 14.0 60.7 AD-58881 H/Rh 21/23 85.9 76.8 78.8 118.0 22.2 36.7 27.6 71.6 AD-58882 H/Rh 21/23 54.1 53.4 60.3 85.8 14.6 27.2 8.2 23.8 AD-58883 H/Rh 21/23 80.4 69.9 75.7 80.3 31.8 25.8 12.3 63.0 AD-58884 H/Rh 21/23 57.7 55.3 64.8 78.2 20.0 30.0 11.8 68.9 AD-58885 H/Rh 21/23 101.8 91.8 104.1 101.5 85.9 71.9 61.8 71.2 AD-58886 M/R/Rh/H 21/23 47.1 58.0 36.3 93.3 16.0 26.6 9.2 32.0 AD-58887 H/Rh 21/23 73.6 98.7 82.6 95.2 28.5 33.5 12.8 65.2 AD-58888 H/Rh 21/23 90.2 69.9 69.4 85.6 46.9 45.0 16.6 72.0 AD-58889 H/Rh 21/23 83.6 98.6 82.4 92.2 36.5 40.3 31.6 99.4 AD-58890 H/Rh 21/23 69.5 95.4 84.2 88.2 50.8 45.6 21.7 92.9 AD-58891 H/Rh 21/23 62.8 75.7 75.4 109.2 23.6 34.3 15.6 55.8 AD-58892 H/Rh 21/23 60.2 92.9 89.8 92.9 22.8 43.3 20.2 75.6 AD-59095 M/R/Rh/H 19mer 88.9 NA 132.8 NA 48.3 97.4 54.3 99.0 AD-59096 M/R/Rh/H 19mer 95.5 NA 90.5 NA 105.7 138.6 131.4 120.7 AD-59097 M/R/Rh/H 19mer 92.5 NA 84.2 NA 75.0 NA 94.7 108.5 AD-59098 M/R/Rh/H 19mer 84.0 NA 87.7 NA 109.3 NA 130.0 87.3 AD-59099 M/R/Rh/H 19mer 89.7 NA 90.0 NA 77.8 85.4 46.8 74.9 AD-59100 M/R/Rh/H 19mer 84.8 NA 144.3 NA 70.6 108.1 91.5 117.6 AD-59101 M/R/Rh/H 19mer 79.0 NA 103.8 NA 89.8 102.9 124.2 107.0 AD-59102 M/R/Rh/H 19mer 85.9 NA 100.6 NA 72.2 68.5 87.9 95.1 AD-59103 M/R/Rh/H 19mer 86.0 NA 91.1 NA 93.0 81.3 130.0 96.0 AD-59104 M/R/Rh/H 19mer 92.6 NA 96.9 NA 94.9 91.4 124.4 83.1 AD-59105 M/R/Rh/H 19mer 48.9 NA 101.7 NA 18.4 48.9 17.0 34.7 AD-59106 M/R/Rh/H 19mer 63.2 NA 76.7 NA 28.5 40.7 28.6 46.4 AD-59107 M/R/Rh/H 19mer 71.4 NA 68.7 NA 37.1 45.3 26.8 63.6 AD-59108 M/R/Rh/H 19mer 70.7 NA 85.1 NA 89.9 84.8 139.2 101.7 AD-59109 M/R/Rh/H 19mer 86.1 NA 83.4 NA 84.9 96.2 131.7 86.7 AD-59110 M/R/Rh/H 19mer 70.8 NA 119.7 NA 38.5 60.4 67.4 80.3 AD-59111 M/R/Rh/H 19mer 66.1 NA 76.5 NA 52.2 61.0 69.7 87.6 AD-59112 M/R/Rh/H 19mer 71.2 NA 80.2 NA 91.2 83.4 127.4 89.0 AD-59113 M/R/Rh/H 19mer 67.0 NA 77.8 NA 49.1 59.0 66.8 91.4 AD-59114 M/R/Rh/H 19mer 81.7 NA 79.3 NA 96.3 88.0 129.6 72.4 AD-59115 M/R/Rh/H 19mer 40.4 NA 69.6 NA 19.6 35.7 9.3 16.9 AD-59116 M/R/Rh/H 19mer 72.2 NA 78.3 NA 53.5 77.8 70.1 107.8 AD-59117 M/R/Rh/H 19mer 70.7 NA 75.6 NA 75.8 74.9 129.0 103.5 AD-59118 M/R/Rh/H 19mer 68.8 NA 75.9 NA 81.4 82.1 114.1 89.7 AD-59119 M/R/Rh/H 19mer 64.9 NA 86.5 NA 85.1 125.1 122.8 124.8 AD-59120 M/R/Rh/H 19mer 63.5 NA 75.1 NA 29.9 52.0 16.1 54.1 AD-59121 M/R/Rh/H 19mer 67.6 NA 72.0 NA 88.8 77.4 108.0 103.1 AD-59122 M/R/Rh/H 19mer 60.2 NA 62.3 NA 25.1 45.3 16.2 54.8 AD-59123 M/R/Rh/H 19mer 68.6 NA 108.2 NA 59.2 84.6 80.0 97.7 AD-59124 M/R/Rh/H 19mer 47.5 NA 56.5 NA 23.9 40.0 9.8 18.9 AD-59125 M/R/Rh/H 19mer 45.4 NA 47.2 NA 15.2 40.7 14.7 15.1 AD-59126 M/R/Rh/H 19mer 64.3 NA 74.6 NA 51.6 57.1 35.5 54.4 AD-59127 M/R/Rh/H 19mer 103.4 NA 105.8 NA 94.0 156.4 135.9 113.7 AD-59128 M/R/Rh/H 19mer 102.4 NA 81.4 NA 66.3 89.3 60.2 74.9 AD-59129 M/R/Rh/H 19mer 41.3 NA 38.8 NA 17.9 41.4 8.6 12.6 AD-59130 M/R/Rh/H 19mer 58.3 NA 80.8 NA 94.9 78.3 106.7 88.0
[0891] Table 17 illustrates the IC.sub.50s of select ALAS1 siRNA duplexes. The IC.sub.50s were determined from the knockdown of endogenously expressed ALAS1 in the Hep3B cell line, at 24 hours following transfection of each ALAS1 modified siRNA duplex (see Table 14). At least seven duplexes, including AD-58882, AD-58878, AD-58886, AD-58877, AD-59115, AD-58856, and AD-59129, consistently demonstrated IC.sub.50s of less than 0.1 nm, indicating that these duplexes were particularly effective in suppressing ALAS1 expression.
TABLE-US-00017 TABLE 17 IC.sub.50S of select ALAS1 siRNA duplexes Duplex ID 384w IC50 (nM) 96w IC50 (nM) AD-58882 0.008 0.014 AD-58878 0.040 0.031 AD-58886 0.037 0.033 AD-58877 0.031 0.034 AD-59115 0.093 0.052 AD-58856 0.061 0.066 AD-59129 0.085 0.071 AD-59124 0.572 0.078 AD-58874 0.140 0.102 AD-59125 0.118 0.115 AD-59105 0.511 0.144 AD-59120 180.592 0.498 AD-59122 36.646 0.646 AD-59106 7.906 0.847 AD-59126 n/a 1.014 AD-59107 n/a 1.971
Example 11. ALAS1-GalNAc Activity in AIP Phenobarbital Induction Mouse Model
[0892] The AIP mouse model was used to investigate the effect of an siRNA that was an ALAS1-GalNAc conjugate. The siRNA had the sequence of duplex AD-58632 (see Table 20)
TABLE-US-00018 TABLE 20 Sequences of ALAS1 siRNA Duplex AD-58632 SEQ Target ID sites SEQ ID NO: of NO: (anti- antisense Duplex (sense) sense) sequence Name Sense Sequence (5′-3′) Antisense Sequence (5′-3′) 4149 4150 873-895 AD- GfsasAfaGfaGfuGfUfCfu asAfsgAfaGfaUfgAfgacAfcUf 58632 CfaUfcUfuCfuUfL96 cUfuUfcsusg
[0893] AIP mice were untreated (baseline), or injected subcutaneously on day 1 with saline or the ALAS1-GalNAc conjugate at a dose of 20 mg/kg. On Days 2, 3, and 4 they were left untreated (baseline) or they were treated with IP injections of Phenobarbital. On Day 5 plasma was taken and levels of ALA and PBG were measured using an LC-MS assay. As shown in
Example 12. Further siRNAs that Target ALAS1 and Inhibit ALAS1 Expression
[0894] Modified siRNA sequences that target ALAS1 siRNA were designed and produced as described in Example 2. The sequences are provided in Table 18. The in vitro activity of the modified duplexes was tested as described below.
TABLE-US-00019 TABLE 18 Human ALAS1 Modified Single Strands and Duplex Sequences SEQ ID Target sites SEQ ID NO: of antisense NO: (anti- Duplex Antisense sequence on (sense) sense) Name Sense Sequence (5′-3′) Sequence (5′-3′) NM_000688.4 3685 3686 AD-59453 CAGGCAAAUCUCUGUUGUUdTdT AACAACAGAGAUUUGCCUGdTdT 402-420 3687 3688 AD-59395 GAAAAAAAUUGAUGAGAAAdTdT UUUCUCAUCAAUUUUUUUCdTdT 949-967 3689 3690 AD-59477 GGAAAGAUGCCGCACUCUUdTdT AAGAGUGCGGCAUCUUUCCdTdT 1242-1260 3691 3692 AD-59492 UGUCUCAUCUUCUUCAAGAdTdT UCUUGAAGAAGAUGAGACAdTdT 882-900 3693 3694 AD-59361 ACAUCUACGUGCAAGCAAUdTdT AUUGCUUGCACGUAGAUGUdTdT 1992-2010 3695 3696 AD-59462 UUCUCUGAUUGACACCGUAdTdT UACGGUGUCAAUCAGAGAAdTdT 1711-1729 3697 3698 AD-59433 GCUGCUGGCUUCAUCUUCAdTdT UGAAGAUGAAGCCAGCAGCdTdT 1739-1757 3699 3700 AD-59424 AGCGCAACGUCAAACUCAUdTdT AUGAGUUUGACGUUGCGCUdTdT 1851-1869 3701 3702 AD-59414 UAUUUCUGGAACUAGUAAAdTdT UUUACUAGUUCCAGAAAUAdTdT 1183-1201 3703 3704 AD-59539 GGUUGUGUUGGAGGGUACAdTdT UGUACCCUCCAACACAACCdTdT 1679-1697 3705 3706 AD-59400 GUGUCAGUCUGGUGCAGUAdTdT UACUGCACCAGACUGACACdTdT 1070-1088 3707 3708 AD-59551 CUUUGUGGCCAAUGACUCAdTdT UGAGUCAUUGGCCACAAAGdTdT 1273-1291 3709 3710 AD-59482 AGAUGCUGCUAAAAACACAdTdT UGUGUUUUUAGCAGCAUCUdTdT 1942-1960 3711 3712 AD-59448 GAGUCAUGCCAAAAAUGGAdTdT UCCAUUUUUGGCAUGACUCdTdT 1629-1647 3713 3714 AD-59392 CUGUGCGGAUCCUGAAGAGdTdT CUCUUCAGGAUCCGCACAGdTdT 1800-1818 3715 3716 AD-59469 CACUUUGAAACAACAUGGUdTdT ACCAUGUUGUUUCAAAGUGdTdT 1141-1159 3717 3718 AD-59431 AAGUGAUGAGUGAAAGAGAdTdT UCUCUUUCACUCAUCACUUdTdT 2193-2211 3719 3720 AD-59423 AUCUGCUAGUCACAUGGAAdTdT UUCCAUGUGACUAGCAGAUdTdT 2103-2121 3721 3722 AD-59517 UGGGGCAGGUGGUACUAGAdTdT UCUAGUACCACCUGCCCCAdTdT 1162-1180 3723 3724 AD-59578 GCAGAUGACUAUUCAGACUdTdT AGUCUGAAUAGUCAUCUGCdTdT 1031-1049 3725 3726 AD-59495 GCCUCAUUCCUCAGCUGAGdTdT CUCAGCUGAGGAAUGAGGCdTdT 2143-2161 3727 3728 AD-59432 GUAUGAUCGUUUCUUUGAGdTdT CUCAAAGAAACGAUCAUACdTdT 931-949 3729 3730 AD-59382 UAUCCAGAUGGUCUUCAGAdTdT UCUGAAGACCAUCUGGAUAdTdT 2302-2320 3731 3732 AD-59472 UAGUGUGAAAACCGAUGGAdTdT UCCAUCGGUUUUCACACUAdTdT 799-817 3733 3734 AD-59459 UCCCCAUGGCAGAUGACUAdTdT UAGUCAUCUGCCAUGGGGAdTdT 1023-1041 3735 3736 AD-59413 CCACUGCAGCAGUACACUAdTdT UAGUGUACUGCUGCAGUGGdTdT 483-501 3737 3738 AD-59478 CUGUGAACCGGCGAGCACAdTdT UGUGCUCGCCGGUUCACAGdTdT 999-1017 3739 3740 AD-59376 GGUCCUAUGCUGCUGGCUUdTdT AAGCCAGCAGCAUAGGACCdTdT 1731-1749 3741 3742 AD-59556 AGCCUUUGGUUGUGUUGGAdTdT UCCAACACAACCAAAGGCUdTdT 1672-1690 3743 3744 AD-59399 AAUUCCAUGUGGACUUAGAdTdT UCUAAGUCCACAUGGAAUUdTdT 1200-1218 3745 3746 AD-59474 CCAGGGCACUGCAAGCAAAdTdT UUUGCUUGCAGUGCCCUGGdTdT 640-658 3747 3748 AD-53542 cuuuucAGuAuGAucGuuudTsdT AAACGAUcAuACUGAAAAGdTsdT 924-942 3749 3750 AD-59480 GAAUCAGAGAGGCAGCAGUdTdT ACUGCUGCCUCUCUGAUUCdTdT 682-700 3751 3752 AD-59549 GCAAAGAUCUGACCCCUCAdTdT UGAGGGGUCAGAUCUUUGCdTdT 1441-1459 3753 3754 AD-59515 GGAGAAGAGCUCCUACGGAdTdT UCCGUAGGAGCUCUUCUCCdTdT 2033-2051 3755 3756 AD-59427 CCAUGAGUUUGGAGCAAUCdTdT GAUUGCUCCAAACUCAUGGdTdT 1540-1558 3757 3758 AD-59390 CUUUGAGAAAAAAAUUGAUdTdT AUCAAUUUUUUUCUCAAAGdTdT 943-961 3759 3760 AD-59511 UGAGCAGACAUAACAUCUAdTdT UAGAUGUUAUGUCUGCUCAdTdT 1980-1998 3761 3762 AD-59532 CGUGCAAGCAAUCAAUUACdTdT GUAAUUGAUUGCUUGCACGdTdT 1999-2017 3763 3764 AD-59562 AAAGCAAAGACCAGAAAGAdTdT UCUUUCUGGUCUUUGCUUUdTdT 862-880 3765 3766 AD-59513 GGAUGUGCAGGAAAUGAAUdTdT AUUCAUUUCCUGCACAUCCdTdT 733-751 3767 3768 AD-59362 CAGCAUACUUCCUGAACAUdTdT AUGUUCAGGAAGUAUGCUGdTdT 321-339 3769 3770 AD-53541 GcAGcAcAGAuGAAucAGAdTsdT UCUGAUUcAUCUGUGCUGCdTsdT 671-689 3771 3772 AD-59490 UCUGUUGUUCUAUGCCCAAdTdT UUGGGCAUAGAACAACAGAdTdT 412-430 3773 3774 AD-59422 UGAGACAGAUGCUAAUGGAdTdT UCCAUUAGCAUCUGUCUCAdTdT 1869-1887 3775 3776 AD-59467 GCCAAUGACUCAACCCUCUdTdT AGAGGGUUGAGUCAUUGGCdTdT 1280-1298 3777 3778 AD-59579 GAGUGCAACUUCUGCAGGAdTdT UCCUGCAGAAGUUGCACUCdTdT 2159-2177 3779 3780 AD-59426 GUGAAAGAGAGAAGUCCUAdTdT UAGGACUUCUCUCUUUCACdTdT 2202-2220 3781 3782 AD-59363 UAACUUGCCAAAAUCUGUUdTdT AACAGAUUUUGGCAAGUUAdTdT 901-919 3783 3784 AD-59436 AAGCCAGUCUUGAGCUUCAdTdT UGAAGCUCAAGACUGGCUUdTdT 711-729 3785 3786 AD-53536 cAcuuuucAGuAuGAucGudTsdT ACGAUcAuACUGAAAAGUGdTsdT 922-940 3787 3788 AD-59491 GCAGCAGUGUCUUCUGCAAdTdT UUGCAGAAGACACUGCUGCdTdT 693-711 3789 3790 AD-59500 UCCUGAACAUGGAGAGUGUdTdT ACACUCUCCAUGUUCAGGAdTdT 330-348 3791 3792 AD-59394 AUUUCUGGAACACUUGGCAdTdT UGCCAAGUGUUCCAGAAAUdTdT 1652-1670 3793 3794 AD-59441 CAGUACACUACCAACAGAUdTdT AUCUGUUGGUAGUGUACUGdTdT 492-510 3795 3796 AD-59365 GCAUGACCUCAAUUAUUUCdTdT GAAAUAAUUGAGGUCAUGCdTdT 2261-2279 3797 3798 AD-59411 AGAACUGCUGCAAAGAUCUdTdT AGAUCUUUGCAGCAGUUCUdTdT 1432-1450 3799 3800 AD-59544 CACCCCAGAUGAUGAACUAdTdT UAGUUCAUCAUCUGGGGUGdTdT 2073-2091 3801 3802 AD-59428 GAUCCAAGGGAUUCGAAACdTdT GUUUCGAAUCCCUUGGAUCdTdT 1363-1381 3803 3804 AD-59471 CUCAUCACCAAAAAGCAAGdTdT CUUGCUUUUUGGUGAUGAGdTdT 1052-1070 3805 3806 AD-59518 ACAACAUGGUGCUGGGGCAdTdT UGCCCCAGCACCAUGUUGUdTdT 1150-1168 3807 3808 AD-53547 GAucGuuucuuuGAGAAAAdTsdT UUUUCUcAAAGAAACGAUCdTsdT 935-953 3809 3810 AD-59573 CAGCACGAGUUCUCUGAUUdTdT AAUCAGAGAACUCGUGCUGdTdT 1702-1720 3811 3812 AD-59473 AAUGAUGUCAGCCACCUCAdTdT UGAGGUGGCUGACAUCAUUdTdT 1412-1430 3813 3814 AD-59412 AGUUAUGGACACUUUGAAAdTdT UUUCAAAGUGUCCAUAACUdTdT 1132-1150 3815 3816 AD-59522 GAUGAUGAACUACUUCCUUdTdT AAGGAAGUAGUUCAUCAUCdTdT 2080-2098 3817 3818 AD-59502 GCAGGAAAUGAAUGCCGUGdTdT CACGGCAUUCAUUUCCUGCdTdT 739-757 3819 3820 AD-59499 UCUUCAAGAUAACUUGCCAdTdT UGGCAAGUUAUCUUGAAGAdTdT 892-910 3821 3822 AD-59520 CGAUGGAGGGGAUCCCAGUdTdT ACUGGGAUCCCCUCCAUCGdTdT 811-829 3823 3824 AD-59581 CCAAAAAGCAAGUGUCAGUdTdT ACUGACACUUGCUUUUUGGdTdT 1059-1077 3825 3826 AD-59461 GAUUGGGGAUCGGGAUGGAdTdT UCCAUCCCGAUCCCCAAUCdTdT 1612-1630 3827 3828 AD-59370 CCCUGGAGUCUGUGCGGAUdTdT AUCCGCACAGACUCCAGGGdTdT 1791-1809 3829 3830 AD-53540 GuuGucuuuAuAuGuGAAudTsdT AUUcAcAuAuAAAGAcAACdTsdT 2321-2339 3831 3832 AD-59574 CGGGCAUUGUCCACUGCAGdTdT CUGCAGUGGACAAUGCCCGdTdT 473-491 3833 3834 AD-59375 UAUUCAGACUCCCUCAUCAdTdT UGAUGAGGGAGUCUGAAUAdTdT 1040-1058 3835 3836 AD-59387 CACUGCAUUUUGAAGUGAUdTdT AUCACUUCAAAAUGCAGUGdTdT 2181-2199 3837 3838 AD-59397 CCAGAAAGAGUGUCUCAUCdTdT GAUGAGACACUCUUUCUGGdTdT 872-890 3839 3840 AD-59396 AGGCGGAGGGAUUGGGGAUdTdT AUCCCCAAUCCCUCCGCCUdTdT 1603-1621 3841 3842 AD-59393 AGACCUCCAUGGGAAAGAUdTdT AUCUUUCCCAUGGAGGUCUdTdT 1231-1249 3843 3844 AD-59483 GCAGGAGGCCACUGCAUUUdTdT AAAUGCAGUGGCCUCCUGCdTdT 2172-2190 3845 3846 AD-59430 AUCUGUUUCCACUUUUCAGdTdT CUGAAAAGUGGAAACAGAUdTdT 913-931 3847 3848 AD-59463 AGAGAAGUCCUAUUUCUCAdTdT UGAGAAAUAGGACUUCUCUdTdT 2209-2227 3849 3850 AD-53534 GucuucAGAGuuGucuuuAdTsdT uAAAGAcAACUCUGAAGACdTsdT 2312-2330 3851 3852 AD-59514 GGCUGGAACUGAAGCCUCAdTdT UGAGGCUUCAGUUCCAGCCdTdT 2130-2148 3853 3854 AD-59575 GCCAUUAUCAUAUCCAGAUdTdT AUCUGGAUAUGAUAAUGGCdTdT 2292-2310 3855 3856 AD-59364 AGCAGGCCCCAGUGUGGUUdTdT AACCACACUGGGGCCUGCUdTdT 781-799 3857 3858 AD-59402 UCAGCUGAGUGCAACUUCUdTdT AGAAGUUGCACUCAGCUGAdTdT 2153-2171 3859 3860 AD-59479 GAGCACACAUCUUCCCCAUdTdT AUGGGGAAGAUGUGUGCUCdTdT 1011-1029 3861 3862 AD-59481 ACUUCCAGGACAUCAUGCAdTdT UGCAUGAUGUCCUGGAAGUdTdT 843-861 3863 3864 AD-59530 CCUAUCGAGUUUUUAAAACdTdT GUUUUAAAAACUCGAUAGGdTdT 981-999 3865 3866 AD-59582 CUUCCUUGAGAAUCUGCUAdTdT UAGCAGAUUCUCAAGGAAGdTdT 2092-2110 3867 3868 AD-59506 ACCAACAGAUCAAAGAAACdTdT GUUUCUUUGAUCUGUUGGUdTdT 501-519 3869 3870 AD-59567 UAACCCCAGGCCAUUAUCAdTdT UGAUAAUGGCCUGGGGUUAdTdT 2283-2301 3871 3872 AD-59485 CCAUGCCUCCAUGAUCCAAdTdT UUGGAUCAUGGAGGCAUGGdTdT 1351-1369 3873 3874 AD-59525 UGAUGAACUAAUGAGCAGAdTdT UCUGCUCAUUAGUUCAUCAdTdT 1969-1987 3875 3876 AD-59566 CCUGAAGAGCGCUGAGGGAdTdT UCCCUCAGCGCUCUUCAGGdTdT 1810-1828 3877 3878 AD-59580 AACACUUGGCAAAGCCUUUdTdT AAAGGCUUUGCCAAGUGUUdTdT 1660-1678 3879 3880 AD-59512 UCUGCAGAAAGCAGGCAAAdTdT UUUGCCUGCUUUCUGCAGAdTdT 391-409 3881 3882 AD-59475 CCGGCCUCCCUGUUGUCCAdTdT UGGACAACAGGGAGGCCGGdTdT 1890-1908 3883 3884 AD-59438 CAUCAUCCCUGUGCGGGUUdTdT AACCCGCACAGGGAUGAUGdTdT 1921-1939 3885 3886 AD-59442 UGUGCGGGUUGCAGAUGCUdTdT AGCAUCUGCAACCCGCACAdTdT 1930-1948 3887 3888 AD-59516 GGAAAGAGGUUGCUGAAACdTdT GUUUCAGCAACCUCUUUCCdTdT 759-777 3889 3890 AD-59429 AGGUCCACGCAGUGGGGCUdTdT AGCCCCACUGCGUGGACCUdTdT 1572-1590 3891 3892 AD-59510 UGCCGUGAGGAAAGAGGUUdTdT AACCUCUUUCCUCACGGCAdTdT 751-769 3893 3894 AD-59457 GCUAAUGGAUGCCGGCCUCdTdT GAGGCCGGCAUCCAUUAGCdTdT 1879-1897 3895 3896 AD-59434 GAAGCAAGUGGGGCUGGAAdTdT UUCCAGCCCCACUUGCUUCdTdT 2119-2137 3897 3898 AD-59454 CAUCUUCCGCCACAAUGAUdTdT AUCAUUGUGGCGGAAGAUGdTdT 1399-1417 3899 3900 AD-59468 AUUUCUCAGGCUUGAGCAAdTdT UUGCUCAAGCCUGAGAAAUdTdT 2220-2238 3901 3902 AD-59565 CCCGAGUCCCCCAGGCCUUdTdT AAGGCCUGGGGGACUCGGGdTdT 372-390 3903 3904 AD-59416 CAAGCAAAUGCCCUUUCCUdTdT AGGAAAGGGCAUUUGCUUGdTdT 651-669 3905 3906 AD-59420 CCCCUCAGUCCCCAAGAUUdTdT AAUCUUGGGGACUGAGGGGdTdT 1453-1471 3907 3908 AD-59552 CUACGGUGCCCCGGGGAGAdTdT UCUCCCCGGGGCACCGUAGdTdT 2019-2037 3909 3910 AD-59558 AAAACUGCCCCAAGAUGAUdTdT AUCAUCUUGGGGCAGUUUUdTdT 429-447 3911 3912 AD-59404 ACAAAACUGCUAAGGCCAAdTdT UUGGCCUUAGCAGUUUUGUdTdT 540-558 3913 3914 AD-59455 GAUUCUGGGAACCAUGCCUdTdT AGGCAUGGUUCCCAGAAUCdTdT 1340-1358 3915 3916 AD-59496 CCAGAUGGCACACAGCUUCdTdT GAAGCUGUGUGCCAUCUGGdTdT 593-611 3917 3918 AD-59446 AGGGAUUCGAAACAGCCGAdTdT UCGGCUGUUUCGAAUCCCUdTdT 1369-1387 3919 3920 AD-59435 CUCUGCAGUCCUCAGCGCAdTdT UGCGCUGAGGACUGCAGAGdTdT 109-127 3921 3922 AD-59419 CCGCCGCCUCUGCAGUCCUdTdT AGGACUGCAGAGGCGGCGGdTdT 102-120 3923 3924 AD-59533 CUGGCUGGAGCCCUGGAGUdTdT ACUCCAGGGCUCCAGCCAGdTdT 1781-1799 3925 3926 AD-59366 GACAUCAUGCAAAAGCAAAdTdT UUUGCUUUUGCAUGAUGUCdTdT 851-869 3927 3928 AD-59521 GCUUGAGCAAGUUGGUAUCdTdT GAUACCAACUUGCUCAAGCdTdT 2229-2247 3929 3930 AD-59563 CAGGCUGUGAGAUUUACUCdTdT GAGUAAAUCUCACAGCCUGdTdT 1320-1338 3931 3932 AD-59534 AGAGCUGUGUGAUGUGGCCdTdT GGCCACAUCACACAGCUCUdTdT 1522-1540 3933 3934 AD-59407 GGAGCUGGCAGACCUCCAUdTdT AUGGAGGUCUGCCAGCUCCdTdT 1222-1240 3935 3936 AD-59445 AUCCCAGUGGACUGCUGAAdTdT UUCAGCAGUCCACUGGGAUdTdT 822-840 3937 3938 AD-59546 GUCAAACUCAUGAGACAGAdTdT UCUGUCUCAUGAGUUUGACdTdT 1859-1877 3939 3940 AD-59456 CUUUCCUGGCAGCACAGAUdTdT AUCUGUGCUGCCAGGAAAGdTdT 663-681 3941 3942 AD-59503 CCCUCCGGCCAGUGAGAAAdTdT UUUCUCACUGGCCGGAGGGdTdT 520-538 3943 3944 AD-59536 CUACCUAGGAAUGAGUCGCdTdT GCGACUCAUUCCUAGGUAGdTdT 1093-1111 3945 3946 AD-59385 CCCAAGAUUGUGGCAUUUGdTdT CAAAUGCCACAAUCUUGGGdTdT 1463-1481 3947 3948 AD-59367 GAGCAAUCACCUUCGUGGAdTdT UCCACGAAGGUGAUUGCUCdTdT 1551-1569 3949 3950 AD-59458 UGCCCAUUCUUAUCCCGAGdTdT CUCGGGAUAAGAAUGGGCAdTdT 359-377 3951 3952 AD-59381 AAGGCCAAGGUCCAACAGAdTdT UCUGUUGGACCUUGGCCUUdTdT 551-569 3953 3954 AD-59538 CACACAGCUUCCGUCUGGAdTdT UCCAGACGGAAGCUGUGUGdTdT 601-619 3955 3956 AD-59421 UUAUGGGGCUCGAGGCGGAdTdT UCCGCCUCGAGCCCCAUAAdTdT 1591-1609 3957 3958 AD-59388 UGUCUUCUGCAAAGCCAGUdTdT ACUGGCUUUGCAGAAGACAdTdT 700-718 3959 3960 AD-59444 AGGCCUGAGCAUGACCUCAdTdT UGAGGUCAUGCUCAGGCCUdTdT 2253-2271 3961 3962 AD-59528 AUGUGAAUUAAGUUAUAUUdTdT AAUAUAACUUAAUUCACAUdTdT 2332-2350 3963 3964 AD-59498 ACUGCUGAAGAACUUCCAGdTdT CUGGAAGUUCUUCAGCAGUdTdT 832-850 3965 3966 AD-59497 UGAGAAAGACAAAACUGCUdTdT AGCAGUUUUGUCUUUCUCAdTdT 532-550 3967 3968 AD-59384 UCAGCCACCUCAGAGAACUdTdT AGUUCUCUGAGGUGGCUGAdTdT 1419-1437 3969 3970 AD-59452 GGCAACGAGCGUUUCGUUUdTdT AAACGAAACGCUCGUUGCCdTdT 51-69 3971 3972 AD-59379 CCUGAUGGAUCCCAGCAGAdTdT UCUGCUGGGAUCCAUCAGGdTdT 572-590 3973 3974 AD-59529 UGUGCCCACUGGAAGAGCUdTdT AGCUCUUCCAGUGGGCACAdTdT 1509-1527 3975 3976 AD-59389 CCACAGGAGCCAGCAUACUdTdT AGUAUGCUGGCUCCUGUGGdTdT 311-329 3977 3978 AD-59585 GUGGUACUAGAAAUAUUUCdTdT GAAAUAUUUCUAGUACCACdTdT 1170-1188 3979 3980 AD-59570 UUCGCCGCUGCCCAUUCUUdTdT AAGAAUGGGCAGCGGCGAAdTdT 351-369 3981 3982 AD-59415 CCGCCAGCACCAGCGCAACdTdT GUUGCGCUGGUGCUGGCGGdTdT 1840-1858 3983 3984 AD-59505 CGCUGAGGGACGGGUGCUUdTdT AAGCACCCGUCCCUCAGCGdTdT 1819-1837 3985 3986 AD-59557 UGGACUUCUCGACUUGAGUdTdT ACUCAAGUCGAGAAGUCCAdTdT 69-87 3987 3988 AD-59548 AAAGAAACCCCUCCGGCCAdTdT UGGCCGGAGGGGUUUCUUUdTdT 512-530 3989 3990 AD-59487 UUGACACCGUACGGUCCUAdTdT UAGGACCGUACGGUGUCAAdTdT 1719-1737 3991 3992 AD-59550 CCCUCUUCACCCUGGCUAAdTdT UUAGCCAGGGUGAAGAGGGdTdT 1293-1311 3993 3994 AD-59572 CCCCCAGGCCUUUCUGCAGdTdT CUGCAGAAAGGCCUGGGGGdTdT 379-397 3995 3996 AD-59554 AUGCCCAAAACUGCCCCAAdTdT UUGGGGCAGUUUUGGGCAUdTdT 423-441 3997 3998 AD-59437 CUUGAGUGCCCGCCUCCUUdTdT AAGGAGGCGGGCACUCAAGdTdT 81-99 3999 4000 AD-59584 GGGUACAUCGCCAGCACGAdTdT UCGUGCUGGCGAUGUACCCdTdT 1691-1709 4001 4002 AD-59373 GUGUGGGGCAGUUAUGGACdTdT GUCCAUAACUGCCCCACACdTdT 1123-1141 4003 4004 AD-59545 ACAUAGUCCUGGAAAUAAAdTdT UUUAUUUCCAGGACUAUGUdTdT 2372-2390 4005 4006 AD-59547 AUCCCAGCAGAGUCCAGAUdTdT AUCUGGACUCUGCUGGGAUdTdT 580-598 4007 4008 AD-59470 CUAGAUUCUUUCCACAGGAdTdT UCCUGUGGAAAGAAUCUAGdTdT 300-318 4009 4010 AD-59417 UUGUUUUCCUCGUGCUUUGdTdT CAAAGCACGAGGAAAACAAdTdT 1259-1277 4011 4012 AD-59535 CCUCCUUCGCCGCCGCCUCdTdT GAGGCGGCGGCGAAGGAGGdTdT 93-111 4013 4014 AD-59507 UGAGGCUGCUCCCGGACAAdTdT UUGUCCGGGAGCAGCCUCAdTdT 31-49 4015 4016 AD-59519 CCAACAGACUCCUGAUGGAdTdT UCCAUCAGGAGUCUGUUGGdTdT 562-580 4017 4018 AD-59391 UCACAUGGAAGCAAGUGGGdTdT CCCACUUGCUUCCAUGUGAdTdT 2112-2130 4019 4020 AD-59537 CAUUCAAUGGAUGGGGCGGdTdT CCGCCCCAUCCAUUGAAUGdTdT 1490-1508 4021 4022 AD-59450 AGGAAUGAGUCGCCACCCAdTdT UGGGUGGCGACUCAUUCCUdTdT 1099-1117 4023 4024 AD-59449 UGGACUUAGAGCGGGAGCUdTdT AGCUCCCGCUCUAAGUCCAdTdT 1209-1227 4025 4026 AD-59418 CUAAAAACACAGAAGUCUGdTdT CAGACUUCUGUGUUUUUAGdTdT 1950-1968 4027 4028 AD-59561 CCCUCACCACACACCCCAGdTdT CUGGGGUGUGUGGUGAGGGdTdT 2062-2080 4029 4030 AD-59460 AAUCCUUGCUUCAGGGACUdTdT AGUCCCUGAAGCAAGGAUUdTdT 171-189 4031 4032 AD-59409 UUGUGGCAUUUGAAACUGUdTdT ACAGUUUCAAAUGCCACAAdTdT 1470-1488 4033 4034 AD-59476 UCAAUUACCCUACGGUGCCdTdT GGCACCGUAGGGUAAUUGAdTdT 2010-2028 4035 4036 AD-59406 CAAGCCAGCCCCUCGGGCAdTdT UGCCCGAGGGGCUGGCUUGdTdT 460-478 4037 4038 AD-59569 GAGUCUUCCCUGCCUGGAUdTdT AUCCAGGCAGGGAAGACUCdTdT 259-277 4039 4040 AD-59451 UGGAGAGUGUUGUUCGCCGdTdT CGGCGAACAACACUCUCCAdTdT 339-357 4041 4042 AD-59553 ACCCCUUGCCUGCCACAAGdTdT CUUGUGGCAGGCAAGGGGUdTdT 621-639 4043 4044 AD-59372 CUGGAUGGAUGAGUGGCUUdTdT AAGCCACUCAUCCAUCCAGdTdT 272-290 4045 4046 AD-59377 CAAGAUGAUGGAAGUUGGGdTdT CCCAACUUCCAUCAUCUUGdTdT 439-457 4047 4048 AD-59531 UUUCGUUUGGACUUCUCGAdTdT UCGAGAAGUCCAAACGAAAdTdT 62-80 4049 4050 AD-59560 UCAUCUUCACCACCUCUCUdTdT AGAGAGGUGGUGAAGAUGAdTdT 1749-1767 4051 4052 AD-59489 UGCCCAGUUCUUCCCGCUGdTdT CAGCGGGAAGAACUGGGCAdTdT 132-150 4053 4054 AD-59540 AAAAAUGGACAUCAUUUCUdTdT AGAAAUGAUGUCCAUUUUUdTdT 1639-1657 4055 4056 AD-59378 CUUGAGCUUCAGGAGGAUGdTdT CAUCCUCCUGAAGCUCAAGdTdT 719-737 4057 4058 AD-59403 CCUCUCUGCCACCCAUGCUdTdT AGCAUGGGUGGCAGAGAGGdTdT 1761-1779 4059 4060 AD-59493 AAAGUCAGGAUCCCUAAGAdTdT UCUUAGGGAUCCUGACUUUdTdT 242-260 4061 4062 AD-59374 CGACCACGGAGGAAUCCUUdTdT AAGGAUUCCUCCGUGGUCGdTdT 159-177 4063 4064 AD-59380 UUCCGUCUGGACACCCCUUdTdT AAGGGGUGUCCAGACGGAAdTdT 609-627 4065 4066 AD-59576 CCACCCAUGCUGCUGGCUGdTdT CAGCCAGCAGCAUGGGUGGdTdT 1769-1787 4067 4068 AD-59425 UGAGAAAAAGAAUGACCACdTdT GUGGUCAUUCUUUUUCUCAdTdT 961-979 4069 4070 AD-59509 UAAGAUGAUGCCAGGCUGUdTdT ACAGCCUGGCAUCAUCUUAdTdT 1309-1327 4071 4072 AD-59488 AGUUAUAUUAAAUUUUAAUdTdT AUUAAAAUUUAAUAUAACUdTdT 2342-2360 4073 4074 AD-59486 UCUUCCCGCUGUGGGGACAdTdT UGUCCCCACAGCGGGAAGAdTdT 140-158 4075 4076 AD-59465 UGCCACAAGCCAGGGCACUdTdT AGUGCCCUGGCUUGUGGCAdTdT 631-649 4077 4078 AD-59484 AGCGCAGUUAUGCCCAGUUdTdT AACUGGGCAUAACUGCGCUdTdT 122-140 4079 4080 AD-59368 GGACCAGGAGAAAGUCAGGdTdT CCUGACUUUCUCCUGGUCCdTdT 232-250 4081 4082 AD-59464 UGUCCACUGCCCCAGCCACdTdT GUGGCUGGGGCAGUGGACAdTdT 1903-1921 4083 4084 AD-59386 AUCGCGGCCUGAGGCUGCUdTdT AGCAGCCUCAGGCCGCGAUdTdT 22-40 4085 4086 AD-59439 GGGGAUGUGGGGACCAGGAdTdT UCCUGGUCCCCACAUCCCCdTdT 222-240 4087 4088 AD-59440 CUGGAAAUAAAUUCUUGCUdTdT AGCAAGAAUUUAUUUCCAGdTdT 2380-2398 4089 4090 AD-59542 UUGAAACUGUCCAUUCAAUdTdT AUUGAAUGGACAGUUUCAAdTdT 1479-1497 4091 4092 AD-59559 GUGGGGACACGACCACGGAdTdT UCCGUGGUCGUGUCCCCACdTdT 150-168 4093 4094 AD-59586 CGCAGUGGGGCUUUAUGGGdTdT CCCAUAAAGCCCCACUGCGdTdT 1579-1597 4095 4096 AD-59408 UUGUCUUUAUAUGUGAAUUdTdT AAUUCACAUAUAAAGACAAdTdT 2322-2340 4097 4098 AD-59568 UCACCCUGGCUAAGAUGAUdTdT AUCAUCUUAGCCAGGGUGAdTdT 1299-1317 4099 4100 AD-59398 GUAUCUGCUCAGGCCUGAGdTdT CUCAGGCCUGAGCAGAUACdTdT 2243-2261 4101 4102 AD-59508 AUGAGUGGCUUCUUCUCCAdTdT UGGAGAAGAAGCCACUCAUdTdT 280-298 4103 4104 AD-59523 GAAGUUGGGGCCAAGCCAGdTdT CUGGCUUGGCCCCAACUUCdTdT 449-467 4105 4106 AD-59410 UCAGGGACUCGGGACCCUGdTdT CAGGGUCCCGAGUCCCUGAdTdT 181-199 4107 4108 AD-59541 UCCUACGGAUUGCCCCCACdTdT GUGGGGGCAAUCCGUAGGAdTdT 2043-2061 4109 4110 AD-59524 UUACUCUGAUUCUGGGAACdTdT GUUCCCAGAAUCAGAGUAAdTdT 1333-1351 4111 4112 AD-59501 AUCCCUAAGAGUCUUCCCUdTdT AGGGAAGACUCUUAGGGAUdTdT 251-269 4113 4114 AD-59383 UGCCAAAGUACAUCUUCCGdTdT CGGAAGAUGUACUUUGGCAdTdT 1389-1407 4115 4116 AD-59577 UCCUCGGGUUUAGGGGAUGdTdT CAUCCCCUAAACCCGAGGAdTdT 210-228 4117 4118 AD-59447 UGCUGAAACCUCAGCAGGCdTdT GCCUGCUGAGGUUUCAGCAdTdT 769-787 4119 4120 AD-59555 CCACCCACGGGUGUGUGGGdTdT CCCACACACCCGUGGGUGGdTdT 1111-1129 4121 4122 AD-59405 UGGUGCAGUAAUGACUACCdTdT GGUAGUCAUUACUGCACCAdTdT 1079-1097 4123 4124 AD-59371 UUCUCCACCUAGAUUCUUUdTdT AAAGAAUCUAGGUGGAGAAdTdT 292-310 4125 4126 AD-59443 UAAGGCGCCGGCGAUCGCGdTdT CGCGAUCGCCGGCGCCUUAdTdT 9-27 4127 4128 AD-59401 UGGAACUAGUAAAUUCCAUdTdT AUGGAAUUUACUAGUUCCAdTdT 1189-1207 4129 4130 AD-59494 GGACCCUGCUGGACCCCUUdTdT AAGGGGUCCAGCAGGGUCCdTdT 192-210 4131 4132 AD-59504 UCAAUUAUUUCACUUAACCdTdT GGUUAAGUGAAAUAAUUGAdTdT 2269-2287 4133 4134 AD-59369 CCCGGACAAGGGCAACGAGdTdT CUCGUUGCCCUUGUCCGGGdTdT 41-59 4135 4136 AD-59571 UUUUAAAACUGUGAACCGGdTdT CCGGUUCACAGUUUUAAAAdTdT 991-1009 4137 4138 AD-59527 GUGCUUCGCCGCCAGCACCdTdT GGUGCUGGCGGCGAAGCACdTdT 1832-1850 4139 4140 AD-59466 UGGACCCCUUCCUCGGGUUdTdT AACCCGAGGAAGGGGUCCAdTdT 201-219 4141 4142 AD-59526 CUGUAUAUUAAGGCGCCGGdTdT CCGGCGCCUUAAUAUACAGdTdT 1-19 4143 4144 AD-59543 UUGCCCCCACCCCUCACCAdTdT UGGUGAGGGGUGGGGGCAAdTdT 2052-2070 4145 4146 AD-59564 AUGGGGCGGUGUGCCCACUdTdT AGUGGGCACACCGCCCCAUdTdT 1500-1518 4147 4148 AD-59583 CUAUAGUAAAAACAUAGUCdTdT GACUAUGUUUUUACUAUAGdTdT 2361-2379
[0895] The in vitro activity of the siRNAs in suppressing ALAS1 mRNA was tested in a single dose screen in Hep3B cells that were transfected using Lipofectamine2000 as a transfection reagent. Single dose experiments were performed at 10 nM duplex concentration and analyzed by branched DNA (bDNA) assay. The results are shown in Table 19 and are expressed as percent remaining mRNA.
TABLE-US-00020 TABLE 19 Suppression of ALAS1 mRNA as assessed by bDNA assay % remaining Duplex mRNA SD AD-59453 11.2 1.5 AD-59395 12.7 1.1 AD-59477 14.5 2.0 AD-59492 14.8 2.1 AD-59361 15.1 4.9 AD-59462 15.4 2.6 AD-59433 15.8 2.7 AD-59424 16.0 1.7 AD-59414 16.1 1.3 AD-59539 16.2 2.6 AD-59400 16.2 1.8 AD-59551 16.3 2.3 AD-59482 16.6 2.1 AD-59448 16.6 3.7 AD-59392 16.9 3.5 AD-59469 16.9 2.2 AD-59431 17.0 2.0 AD-59423 17.1 3.8 AD-59517 17.2 1.5 AD-59578 17.3 3.1 AD-59495 17.7 3.7 AD-59432 17.7 2.8 AD-59382 17.9 3.2 AD-59472 18.6 3.5 AD-59459 18.7 3.8 AD-59413 18.8 2.4 AD-59478 18.9 3.0 AD-59376 18.9 3.2 AD-59556 18.9 2.4 AD-59399 19.0 4.1 AD-59474 19.4 1.6 AD-53542 19.4 1.7 AD-59480 19.6 1.6 AD-59549 19.7 2.1 AD-59515 19.8 4.4 AD-59427 19.9 3.2 AD-59390 19.9 3.4 AD-59511 19.9 2.2 AD-59532 20.0 2.4 AD-59562 20.2 2.6 AD-59513 20.3 3.9 AD-59362 20.6 2.5 AD-53541 20.6 2.2 AD-59490 20.7 2.3 AD-59422 20.8 4.5 AD-59467 21.2 2.3 AD-59579 21.2 3.3 AD-59426 21.7 2.3 AD-59363 21.7 2.7 AD-59436 21.7 2.7 AD-53536 21.9 1.5 AD-59491 21.9 2.6 AD-59500 22.2 2.8 AD-59394 22.3 10.1 AD-59441 22.3 2.6 AD-59365 22.4 4.2 AD-59411 22.5 2.9 AD-59544 22.5 2.1 AD-59428 22.7 4.7 AD-59471 22.9 5.0 AD-59518 22.9 2.3 AD-53547 22.9 1.5 AD-59573 23.0 4.2 AD-59473 23.2 1.8 AD-59412 23.4 2.5 AD-59522 23.4 3.3 AD-59502 23.6 2.7 AD-59499 23.6 1.6 AD-59520 23.8 3.8 AD-59581 23.9 6.0 AD-59461 24.3 4.2 AD-59370 24.3 5.6 AD-53540 24.4 2.1 AD-59574 24.5 2.0 AD-59375 24.6 2.3 AD-59387 24.8 7.2 AD-59397 24.9 9.6 AD-59396 25.0 10.2 AD-59393 25.3 11.6 AD-59483 25.4 3.8 AD-59430 25.5 1.8 AD-59463 25.6 4.8 AD-53534 25.9 3.1 AD-59514 26.2 5.7 AD-59575 26.2 3.2 AD-59364 26.2 4.5 AD-59402 26.3 3.1 AD-59479 26.3 2.5 AD-59481 26.4 2.2 AD-59530 26.4 4.4 AD-59582 26.6 3.9 AD-59506 27.0 4.1 AD-59567 27.3 1.1 AD-59485 27.7 4.7 AD-59525 28.3 3.1 AD-59566 28.5 0.6 AD-59580 28.7 7.1 AD-59512 29.5 2.5 AD-59475 29.6 4.2 AD-59438 29.6 3.3 AD-59442 29.9 2.8 AD-59516 30.4 3.8 AD-59429 30.8 4.3 AD-59510 31.3 1.9 AD-59457 31.4 1.2 AD-59434 31.6 3.5 AD-59454 32.0 1.9 AD-59468 32.2 3.2 AD-59565 32.4 1.5 AD-59416 32.7 1.7 AD-59420 33.2 3.1 AD-59552 33.2 2.2 AD-59558 33.8 3.8 AD-59404 34.0 5.4 AD-59455 34.8 1.3 AD-59496 34.9 5.2 AD-59446 35.5 1.7 AD-59435 35.9 1.2 AD-59419 36.0 1.4 AD-59533 36.7 3.7 AD-59366 36.7 6.0 AD-59521 36.9 4.3 AD-59563 36.9 4.1 AD-59534 36.9 3.3 AD-59407 37.1 4.7 AD-59445 37.2 3.2 AD-59546 37.9 4.9 AD-59456 38.3 4.0 AD-59503 38.8 5.0 AD-59536 39.8 4.2 AD-59385 39.9 13.7 AD-59367 40.0 3.6 AD-59458 40.0 3.4 AD-59381 40.3 9.9 AD-59538 40.8 4.9 AD-59421 40.9 6.4 AD-59388 41.0 9.1 AD-59444 41.1 2.7 AD-59528 41.9 3.3 AD-59498 42.2 3.3 AD-59497 42.4 4.9 AD-59384 42.7 17.6 AD-59452 42.7 3.1 AD-59379 43.6 2.6 AD-59529 43.8 4.8 AD-59389 44.1 6.4 AD-59585 44.3 3.2 AD-59570 45.1 4.0 AD-59415 46.6 2.3 AD-59505 47.5 6.2 AD-59557 48.1 4.4 AD-59548 49.9 4.0 AD-59487 50.7 3.2 AD-59550 50.8 5.8 AD-59572 51.1 4.0 AD-59554 51.3 6.0 AD-59437 52.2 4.8 AD-59584 54.9 2.7 AD-59373 55.3 20.1 AD-59545 55.4 3.4 AD-59547 55.9 4.7 AD-59470 56.0 2.7 AD-59417 56.4 7.7 AD-59535 57.6 5.1 AD-59507 58.8 4.7 AD-59519 59.1 5.6 AD-59391 60.1 12.5 AD-59537 60.6 9.1 AD-59450 60.7 7.2 AD-59449 61.6 6.8 AD-59418 61.8 8.4 AD-59561 62.2 7.2 AD-59460 62.8 4.7 AD-59409 64.4 9.0 AD-59476 65.2 5.6 AD-59406 65.6 3.5 AD-59569 66.7 7.6 AD-59451 66.9 2.9 AD-59553 67.2 8.8 AD-59372 67.3 25.6 AD-59377 68.7 5.1 AD-59531 68.7 9.0 AD-59560 68.7 12.7 AD-59489 69.6 8.9 AD-59540 70.1 10.1 AD-59378 70.6 14.1 AD-59403 71.4 3.3 AD-59493 72.3 3.5 AD-59374 75.9 5.1 AD-59380 76.4 11.1 AD-59576 77.5 16.2 AD-59425 77.9 10.6 AD-59509 78.0 3.2 AD-59488 78.6 7.1 AD-59486 79.4 5.0 AD-59465 79.5 5.1 AD-59484 79.8 3.2 AD-59368 80.0 11.9 AD-59464 80.2 9.3 AD-59386 80.6 33.2 AD-59439 80.9 4.0 AD-59440 82.2 1.9 AD-59542 83.3 10.6 AD-59559 83.7 9.1 AD-59586 83.8 11.5 AD-59408 86.3 2.8 AD-59568 86.8 4.2 AD-59398 87.4 24.9 AD-59508 87.5 2.5 AD-59523 87.6 11.8 AD-59410 88.8 8.3 AD-59541 88.9 10.8 AD-59524 89.5 12.1 AD-59501 89.9 5.1 AD-59383 90.8 27.4 AD-59577 91.1 2.3 AD-59447 91.3 12.9 AD-59555 91.7 3.4 AD-59405 92.5 5.7 AD-59371 93.5 31.7 AD-59443 93.8 9.0 AD-59401 94.5 7.1 AD-59494 95.1 9.1 AD-59504 96.8 11.7 AD-59369 96.8 4.8 AD-59571 97.4 7.0 AD-59527 98.6 7.8 AD-59466 99.7 14.0 AD-59526 102.9 4.6 AD-59543 103.7 3.0 AD-59564 103.7 12.1 AD-59583 112.4 13.2
The two hundred thirty-two duplexes that were tested suppressed ALAS1 mRNA to varying extents in this single dose assay. According to this assay, at least four of the duplexes (AD-59453, AD-59395, AD-59477, and AD-59492) suppressed ALAS1 mRNA by 85% or more, 39 of the duplexes suppressed ALAS1 mRNA by 80% or more, 101 of the duplexes suppressed ALAS1 mRNA by 70% or more, and 152 of the duplexes suppressed ALAS1 mRNA by 50% or more. In contrast, some duplexes did not show appreciable suppression in this assay.
Example 13: Dose Responsive Inhibition of Porphyrin Precursors ALA and PBG Using ALAS1 siRNA
[0896] The dose response effects of an ALAS1 siRNA were investigated in a mouse model of AIP (see Example 5). This model shows ˜30% residual PBGD activity, ˜2 fold increase in basal ALA and PBG levels, ˜30-100 fold increase in ALA and PBG levels following induction by injections of Phenobarbital once per day for 3-4 days. Older animals have axonal degeneration and impaired motor function.
[0897] The ALAS1 siRNA used in this example was the AD-53558 duplex in the AF11 formulation. On day 1, the mice were administered 1 mg/kg, 0.5 mg/kg, 0.1 mg/kg, or 0.05 mg/kg of ALAS1 siRNA or LUC AD-1955 control by i.v. injection. Three phenobarbital injections were given (1 injection per day on days 2, 3, and 4) to induce hepatic ALAS1 and the porphyrin precursors, ALA and PBG. Plasma and overnight urine specimens were collected on day 5 and metabolite levels were measured by LC-MS. Baseline levels of ALA and PBG were measured prior to the first treatment on day 1. The results are shown in
Example 14: Durable Inhibition of Porphyrin Precursors ALA and PBG Using ALAS1 siRNA
[0898] The durability of the effects of an ALAS1 siRNA were investigated in a mouse model of AIP (see Example 5). The ALAS1 siRNA used in this example was the AD-53558 duplex in the AF11 formulation. The experimental design and results of this experiment are shown in
[0899] As is shown in
Example 15: ALAS1 siRNA Provides More Rapid Onset of Action Compared with Hemin Treatment
[0900] The effects of treatment with an ALAS1 siRNA were compared with the effects of hemin treatment in a mouse model of AIP (see Example 5). The ALAS1 siRNA used in this example was the AD-53558 duplex in the AF11 formulation. The experimental design and results of this experiment are shown in
[0901] Hemin at a dose of 4 mg/kg, ALAS1 siRNA at a dose of 2 mg/kg, or control treatment was administered intravenously at 8 hours after the last administration of PB and DDC.
[0902] As is shown in
Example 16: Effects of ALAS1 siRNA GalNAc Conjugate AD-58632
[0903] AD-58632 is a 21/23mer disclosed in Example 11. AD-58632 targets the human transcript NM_000688.4 and is also cross reactive with mouse, rat, and cynomolgous monkey mRNA transcripts. AD-58632 was the only cross reactive 21/23mer identified from a screen of about 45 compounds. Further experiments with this duplex are described in this example.
[0904] Dose Dependent Effects of AD-58632 in Suppressing ALAS1 mRNA
[0905] The dose response effect of AD-58632 in suppressing ALAS1 mRNA, relative to GAPDH mRNA, was investigated in rats. Doses of 30 mg/kg, 10 mg/kg, and 3 mg/kg were tested. The levels of ALAS1 mRNA were measured in liver at 72 hours after the last dose. AD-58632, compared with PBS control, suppressed ALAS1 mRNA in a dose dependent manner (see
[0906] Effects of AD-58632 in Rat AIP Model
[0907] The dose response effect of the AD-58632 ALAS1 GalNAc conjugate siRNA was further investigated in a rat AIP model. In this model, siRNA in an LNP is used to knock down the level of PBGD specifically in liver prior to inducing heme demaind with phenobarbitol. The rat AIP model shows transient PBGD siRNA knockdown in the liver, has ˜15% residual PBGD mRNA, and shows about a 10-50 fold increase in ALA and PBG levels upon induction by daily Phenobarbital injection for three days.
[0908] The experimental design is depicted in
[0909] The mRNA results are shown in
Example 17: Split Dosing with AD-58632
[0910] The efficacy of the ALAS1 siRNA GalNAc conjugate AD-58632 was investigated in two separate split dosing paradigms. For each of these studies, female Sprague Dawley rats were used. The rats were housed in SCLR (a light cycle room that is 12 hours light on and 12 hours light off) and were sacrificed at 72 hours following the last injection. ALAS1 and GAPDH mRNA levels in the liver were measured using branched DNA (bDNA) assay.
[0911] Five Daily Doses Versus One Bolus Dose Paradigm
[0912] In the first paradigm, groups of rats were given either five doses of siRNA (one dose each day) or a single bolus dose that had the same total concentration as the sum of the five individual doses. Specifically, rats were assigned to one of the following treatment conditions: (1) subcutaneous injection of 6 mg/kg siRNA once per day for five days (2) subcutaneous injection of 2 mg/kg siRNA once per day for five days, (3) subcutaneous injection of 1 mg/kg siRNA once per day for five days, (4) subcutaneous injection of a single bolus dose of 30 mg/kg siRNA (5) subcutaneous injection of a single bolus dose of 10 mg/kg siRNA, (6) subcutaneous injection of a single bolus dose of 5 mg/kg siRNA, or (7) PBS control treatment.
[0913] The results are shown in
[0914] Once Per Week Dosing for Four Weeks
[0915] In the second paradigm, rats were given subcutaneous injections of siRNA at one of three doses (10 mg/kg, 5 mg/kg, or 2.5 mg/kg) once per week for four weeks. A control group received PBS injections.
[0916] The results are shown in
Example 18: Identification and Testing of ALAS1 siRNAs with Shorter Sense and Antisense Strands
[0917] Further experiments were conducted to explore the effects of shortening the siRNA duplexes to 19-19mers. Five more new cross-reactive 19-19mer duplexes that bind to human (h) (NM_000688.4), rhesus monkey (rh) (XM 001090440.2), mouse (m) (NM_020559.2), and rat (r) (NM_024484.2) ALAS1 mRNA transcripts were identified. None of these duplexes showed results as good as the 21/23 mer AD-58632 (see
[0918] The effects of modifying the length and overhangs on the best two 19-19mers (AD-59115 and AD-59125) were investigated (
TABLE-US-00021 TABLE 21 Sequences for length/overhang evaluation of best two 19-19mers Target SEQ sites of SEQ ID anti- ID NO: sense NO: (anti- sequence on Cross Over- Duplex Antisense (AS) (sense) sense) NM_000688.4 reactivity hang Name Sense Sequence (5′-3′) Sequence (5′-3′) 4172 4173 877-895 h/rh/m/r 19/19 AD- AfsasGfaGfuGfuCfUfCfaU asAfsgAfaGfaUfgAfgacAfcUfcsusu 59115 fcUfuCfuUfL96 4174 4175 875-895 h/rh/m/r 19/21 AD- AfsasGfaGfuGfuCfUfCfaU asAfsgAfaGfaUfgAfgacAfcUfcUfususc 60090 fcUfuCfuUfL96 4176 4177 877-895 NC OH* 19/21 AD- AfsasGfaGfuGfuCfUfCfaU asAfsgAfaGfaUfgAfgacAfcUfcUfusasa 60091 fcUfuCfuUfL96 4178 4179 873-895 h/rh/m/r 21/23 AD- GfsasAfaGfaGfuGfUfCfuC asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcs 58632 faUfcUfuCfuUfL96 usg 4180 4181 875-895 NC OH* 21/23 AD- GfsasAfaGfaGfuGfUfCfuC asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcs 60092 faUfcUfuCfuUfL96 asa 4182 4183 875-893 h/rh/m/r 19/19 AD- GfsasAfaGfaGfuGfUfCfuC usAfsaGfaUfgAfgAfcacUfcUfususc 59129 faUfcUfuAfL96 4184 4185 873-893 h/rh/m/r 19/21 AD- GfsasAfaGfaGfuGfUfCfuC usAfsaGfaUfgAfgAfcacUfcUfuUfcsusg 60093 faUfcUfuAfL96 4186 4187 875-893 NC OH* 19/21 AD- GfsasAfaGfaGfuGfUfCfuC usAfsaGfaUfgAfgAfcacUfcUfuUfcsasa 60094 faUfcUfuAfL96 4188 4189 871-893 h/rh 21/23 AD- CfsasGfaAfaGfaGfuGfUfC usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgs 60095 fuCfaUfcUfuAfL96 gsu 4190 4191 871-893 m/r 21/23 AD- CfsasGfaAfaGfaGfuGfUfC usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgs 60096 fuCfaUfcUfuAfL96 gsc *Non-complementary overhangOverhangs improved potency. They also provided a further derivative sequence (AD-60489, which was based on AD-60095) for further structure activity relationship (SAR) studies (1 mismatch at pos23 to rodent).
Example 19: Effects of ALAS1 siRNA GalNAc Conjugates AD-60489 and AD-58632
[0919] The effects of a further GalNAc conjugate ALAS1 siRNA duplex AD-60489 were investigated and compared with the effects of AD-58632. The sequences of these duplexes are shown in Table 22A. AD-60489 has a single mismatch to rodent ALAS1 mRNA at the 3′ end of the antisense sequence. Thus, whereas AD-58632 is fully complementary with human, cynomolgous monkey, mouse, and rat sequences, AD-60489 is fully complementary only with human and cynomolgous monkey sequences.
TABLE-US-00022 TABLE 22A Sequences of ALAS1 siRNA Duplexes AD-58632 and AD-60489 SEQ Target ID sites of SEQ NO: antisense ID NO: (anti- sequence on Duplex (sense) sense) NM_000688.4 Name Sense Sequence (5′-3′) Antisense Sequence (5′-3′) 4149 4150 873-895 AD- GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUf asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcs 58632 L96 usg 4151 4152 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAf usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgs 60489 L96 gsu
[0920] The suppression of ALAS1 mRNA is shown in
Example 20: Effects of ALAS1 siRNA GalNAc Conjugates AD-60489 and AD-58632 in Non-Human Primate Studies
[0921] The effectiveness of AD-58632 and AD-60489 in suppressing liver mRNA was investigated in non-human primates. The experimental design is shown in
[0922] AD-58632 and AD-60489 suppressed ALAS1 mRNA in liver in a dose-dependent manner (see
[0923] Clinical chemistry results indicated that the sustained knockdown of ALAS1 using the ALAS1 siRNAs was safe and well tolerated. No elevations in ALT, AST, or ALP were observed.
Example 21: Effects of ALAS1 siRNA GalNAc Conjugates AD-60489 and AD-58632 in Non-Human Primate Studies as Assessed Using the cERD Assay
[0924] The effects of ALAS1 siRNA GalNAc conjugates AD-60489 and AD-58632 were assessed in non-human primates using the circulating extracellular RNA detection (cERD) method. This method is described, e.g., in Sehgal, A. et al. Quantitation of tissue-specific target gene modulation using circulating RNA (Poster presented on Feb. 9, 2012 at the Keystone Gene Silencing by small RNAs symposium (Vancouver, Feb. 7-12, 2012) and in Sehgal, A. et al. Tissue-specific gene silencing monitored in circulating RNA, RNA, 20: 1-7, published online Dec. 19, 2013. As is shown in
[0925] For the cERD assay, serum samples were thawed on ice. 375-400 μL of 8M LiCl was added to 3-3.5 mL of serum in ultracentrifuge (UC) tubes, and incubated at a temperature of 4° C. for at least 1 hour. PBS was added to the top of each UC tube, leaving about 1 cm of dry space at the top of the tube to prevent walls of tubes from collapsing during spin. The tubes were dried to remove any condensation from being incubated on ice. Samples were loaded into an MC 55 Rotor under a hood, and the samples were spun at 150,000-200,000 g for 100-120 minutes. The supernatant was discarded from the pellet. 1 mL Trizol was added to the pellet in the UC tube, the tube was vortexed, and the contents were transferred to a 1.5 mL microcentrifuge tube. To each tube, 200 μL of chloroform was added, and the tube was inverted several times to mix. One sample was prepared at a time. The samples were spun at 13,000 RPM for 10-20 minutes at 4° C. The upper aqueous phase was transferred to a fresh 1.5 mL tube (˜500 μL volume). An equal volume of 100% isopropanol, 1 μL of linear acrylamind (4°), and 1/10.sup.th volume of 3M NaoAc pH 5.5 or less was added to each sample (typically 500 μL of isopropanol and 50 μL NaoAc). The sample was spun at 13,000 RPM for 10 min at 4° C. Supernatants were reserved. The pellet was washed twice with ice cold 70% EtOH (500 μL each wash) and spun at 13,000 RPM for ˜5 min. at 4° C. after each wash. The pellet was allowed to air dry for ˜5 minutes and then resuspended in 20 μL NF H2O. 10 μL was used in cDNA reaction. The resuspended RNA was stored at −80° C.
Results
[0926] The serum mRNA knockdown as assessed using the cERD assay correlated with the results obtained from the liver biopsy. See
[0927] The kinetics of mRNA knockdown were determined using the cERD assay results. See
Example 22: Safety Studies of ALAS1 siRNAs
[0928] The following safety studies indicate that sustained knockdown of ALAS1 is safe and well tolerated.
[0929] Non-Human Primate Studies
[0930] As described above (see Example 20), in non-human primate studies, no ALT, AST, or ALP elevations were observed after administration of AD-60489 and AD-58632.
[0931] Rat Studies
[0932] In rats, a four week study was carried out with AD-58632. The siRNA was administered every day for 5 days at 10 mg/kg in the first week, then every other day at 10 mg/kg for weeks 2-4 of the study. The total exposure was 140 mg. No adverse clinical signs or body weight changes were observed. No test article related changes in hematology or coagulation parameters were observed. Furthermore, no adverse histopathology was observed. There was minimal vacuolation in spleen and minimal subcapsular fibrosis in kidney.
[0933] Mouse Studies
[0934] In mice, P450 mRNAs were assessed after ALAS1 knockdown. Minor dose dependent increases in Cyp2b10 were observed at 48 hours after administration of an ALAS1 LNP formulation. This resolved by 168 hours.
Example 23: Identification of Further Effective ALAS1 siRNAs Using Structure Activity Relationship Studies
[0935] Structure activity relationship (SAR) studies, including studies described in other examples herein, were carried out to identify further effective ALAS1 siRNAs derived from those that have already been identified, e.g., AD-58632 and AD-60489. Effects of chemical modifications were investigated. Chemical modifications include 1) 2′-O-methyl versus 2′-fluoro modifications, 2) Decrease in 2′Uf (2′fluoro modifications), 3) Add PS (phosphorothioate), 4) Use internal dTs, and/or 5) glycol nucleic acids (GNAs). Without wishing to be bound by theory, modifications can enhance potency, e.g., through 1) better unwinding or enhanced RISC loading, or 2) better catalytic target engagement. Modifications can also enhance stability so that compounds can accumulate and perform better when multiple doses are administered.
[0936] Improved activity relative to other duplexes (e.g., AD-58632 and/or AD-60489) was observed in some instances (see Table 22B), whereas similar activity (see Table 23) or reduced activity (Table 24) was observed in other instances. These instances are merely presented as examples based on the screening of more than 150 siRNAs. Further exemplification of SAR studies is provided herein.
TABLE-US-00023 TABLE 22B Improved Activity Relative to Parent Duplex* IC50 Sense (5′to 3′) Antisense (5′to 3′) AD- 0.017 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg (SEQ 58632.10 (SEQ ID NO: 4192) ID NO: 4193) (parent) AD- 0.004 GfsasAfaGfAfGfuGfdTcucaucuucuuL96 asAfsgAfaGfaugAfgAfcAfcucuuucsusg (SEQ ID 80643.1 (SEQ ID NO: 4194) NO: 4195) AD- 0.010 CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 60489.3 (SEQ ID NO: 4196) (SEQ ID NO: 4197) (parent) AD- 0.001 CfsasGfaAfaGfaGfdTGfuCfuCf(Agn)UfscU usAfsaGfaUfgAfgAfcacUfcdTuUfcUfgsgsu 60879.1 fsuAfsL96 (SEQ ID NO: 4198) (SEQ ID NO: 4199) *The number following the decimal point in a duplex name in this and other tables merely refers to a batch production number.
TABLE-US-00024 TABLE 23 Similar Activity Relative to Parent but Increased Stability Duplex IC50 Sense (5′to 3′) Antisense (5′to 3′) AD- 0.017 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 asAfsgAfaGfaUfgAfgacAfcUtUfuLlfcsusg (SEQ 58632.10 (SEQ ID NO: 4200) ID NO: 4201) (parent) AD- 0.014 gsasaagaGfuGfuCfucaucuucuuL96 (SEQ ID asAfsgAfaGfaugAfgacAfcucuuucsusg (SEQ ID 60839.1 NO: 4202) NO: 4203)
TABLE-US-00025 TABLE 24 Reduced Activity Relative to Parent Duplex IC50 Sense (5′to 3′) Antisense (5′to 3′) AD- 0.017 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg (SEQ 58632.10 (SEQ ID NO: 4204) ID NO: 4205) (parent) AD- 0.801 GfsasAfaGfAfGfuGfdTcucaucuucuuL96 asAfsgAf(Agn)GfaUfgAfgacAfcUfWfuUfcsusg 60886.1 (SEQ ID NO: 4206) (SEQ ID NO: 4207)
Example 24: In Vitro Structure Activity Relationship Studies of AD-58632
[0937] AD-58632 and siRNA derivatives of AD-58632 were generated, and some siRNAs were screened in vitro for activity. Abbreviations for chemical modifications are provided in Table 1.
In Vitro Activity at 10 nM and 0.1 nM siRNA
[0938] The in vitro activity of the siRNAs in suppressing ALAS1 mRNA was tested in in Hep3B cells that were transfected using Lipofectamine2000 as a transfection reagent. Experiments were performed at the indicated siRNA concentrations (e.g., 0.1 nM, 10 nM) and analyzed by branched DNA (bDNA) assay at 24 hours post-transfection. The results are expressed as percent remaining mRNA relative to the siRNA AD-1955, a non-targeting siRNA that was used as a negative control.
[0939] Sequences of siRNAs and results of in vitro testing are provided in Table 25, Table 26, and Table 27.
TABLE-US-00026 TABLE 25 Sequences and in vitro screen results for AD-58632 and AD-58632 derivative siRNAs Target SEQ sites of SEQ ID ID NO: antisense Avg SD Avg SD NO: (anti- seq on 10 10 0.1 0.1 (sense) sense) NM_000688.4 Duplex Sense Sequence (5′-3′) Antisense (AS) Sequence (5′-3′) nM nM nM nM 4208 4209 873-895 AD-58632.8 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 11.79 2.70 46.65 4.21 4210 4211 873-895 AD-60405.1 GfsasAfaGfaGfuGfuCfuCfaucuuCfuuL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 15.61 4.49 63.49 10.51 4212 4213 873-895 AD-60411.1 GfsasAfaGfaGfuGfuCfuCfaucuucuuL96 asAfsGfAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg 15.04 6.13 62.59 10.05 4214 4215 873-895 AD-60417.1 GfsasaagaGfuGfuCfuCfaucuucuuL96 asAfsGfAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg 13.96 5.47 66.10 8.21 4216 4217 873-895 AD-60423.1 gsasaagaGfuGfuCfuCfaucuucuuL96 asAfsGfAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg 12.59 3.03 41.47 3.77 4218 4219 873-895 AD-60423.2 gsasaagaGfuGfuCfuCfaucuucuuL96 asAfsGfAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg 13.79 3.38 55.93 7.90 4220 4221 873-895 AD-60434.1 gsasaagaGfuGfuCfucaucuucuuL96 asAfsGfAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg 14.74 2.76 48.68 6.64 4222 4223 873-895 AD-60440.1 gsasaagaGfuGfucucaucuucuuL96 asAfsGfAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg 28.31 8.68 77.01 3.99 4224 4225 873-895 AD-60400.1 gsasaagaguGfucucaucuucuuL96 asAfsGfAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg 39.90 5.67 99.64 8.58 4226 4227 873-895 AD-60406.1 gsasaagagugucucaucuucuuL96 asAfsGfAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg 56.06 2.08 95.83 17.01 4228 4229 873-895 AD-60412.1 GfsasaagaGfuGfucucaucuucuuL96 asAfsGfAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg 43.09 2.23 87.52 8.10 4230 4231 873-895 AD-60418.1 gsasaagaGfuGfucucaucuucuuL96 asAfsGfAfaGfaUfgAfgAfcAfcucUfuUfcsusg 65.84 7.75 108.07 21.88 4232 4233 873-895 AD-60424.1 gsasaagaGfuGfucucaucuucuuL96 asAfsGfAfaGfaUfgAfgAfcAfcucuuUfcsusg 45.51 11.82 84.40 10.69 4234 4235 873-895 AD-60429.1 gsasaagaGfuGfucucaucuucuuL96 asAfsGfAfaGfaUfgAfgAfcAfcucuuucsusg 63.96 13.25 81.21 1.96 4236 4237 873-895 AD-60435.1 gsasaagaGfuGfucucaucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 80.12 10.02 95.33 23.09 4238 4239 873-895 AD-60441.1 gsasaaGfaGfuGfucucaucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 63.29 17.48 97.07 8.04 4240 4241 873-895 AD-60401.1 gsasaaGfAfGfuGfucucaucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 55.27 10.26 109.06 4.23 4242 4243 873-895 AD-60407.1 GfsasaaGfAfGfuGfucucaucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 47.39 1.88 98.04 22.58 4244 4245 873-895 AD-60413.1 GfsasAfaGfAfGfuGfucucaucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 55.60 11.65 92.88 5.65 4246 4247 873-895 AD-60419.1 GfsasAfaGfAfGfuGfdTcucaucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 20.82 15.07 57.82 8.31 4248 4249 873-895 AD-60425.1 GfsasAfaGfAfGfuGfudCucaucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 35.58 13.30 73.46 10.91 4250 4251 873-895 AD-60430.1 GfsasAfaGfAfGfuGfucdTcaucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 40.54 1.41 81.87 11.23 4252 4253 873-895 AD-60436.1 GfsasAfaGfAfGfuGfucudCaucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 60.12 11.74 81.51 7.41 4254 4255 873-895 AD-60442.1 GfsasAfaGfAfGfuGfucucdAucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 40.82 12.61 83.06 1.05 4256 4257 873-895 AD-60402.1 GfsasAfaGfAfGfuGfucucadTcuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 62.16 11.24 123.60 6.71 4258 4259 873-895 AD-60408.1 GfsasAfaGfAfGfuGfucucaudCuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 45.39 15.50 86.69 6.12 4260 4261 873-895 AD-60414.1 GfsasAfaGfAfGfuGfucucaucudTcuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 32.56 3.52 84.21 0.24 4262 4263 873-895 AD-60420.1 GfsasAfaGfAfGfuGfucucaucuudCuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 52.57 10.77 94.45 3.43 4264 4265 873-895 AD-60426.1 GfsasAfaGfAfGfuGfucucaucuucudTL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 52.49 1.91 91.15 14.49 4266 4267 873-895 AD-60431.1 gsasaaGfaGfuGfudCudCaucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 26.66 1.16 73.09 6.83 4268 4269 873-895 AD-60437.1 gsasaaGfaGfuGfudCucadTcuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 32.80 4.58 69.03 3.02 4270 4271 873-895 AD-60443.1 gsasaaGfaGfuGfudCucaucdTucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 35.10 7.10 69.92 17.93 4272 4273 873-895 AD-60403.1 gsasaaGfaGfuGfudCudCaucdTucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 25.28 1.68 105.23 23.99 4274 4275 873-895 AD-60409.1 gsasaaGfaGfuGfudCudCadTcdTucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 30.48 1.88 72.34 3.34 4276 4277 873-895 AD-60415.1 gsasaaGfaGfuGfudCudCadTcdTudCuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 25.28 7.10 69.53 10.72 4278 4279 873-895 AD-60421.1 gsasaaGfaGfuGfucucaucuucuuL96 asAfsGfAfaGfadTgAfgAfcAfcucuuucsusg 59.28 5.83 66.88 0.63 4280 4281 873-895 AD-60427.1 gsasaaGfaGfuGfucucaucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcdTcuuucsusg 34.80 8.13 79.65 11.25 4282 4283 873-895 AD-60432.1 gsasaaGfaGfuGfucucaucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucdTuucsusg 46.78 6.42 79.19 16.72 4284 4285 873-895 AD-60438.1 gsasaaGfaGfuGfucucaucuucuuL96 asAfsGfAfaGfadTgAfgAfcAfcdTcuuucsusg 32.07 9.46 57.87 10.18 4286 4287 873-895 AD-60444.1 gsasaaGfaGfuGfucucaucuucuuL96 asAfsGfAfaGfadTgAfgAfcAfcucdTuucsusg 55.55 10.17 89.52 3.91 4288 4289 873-895 AD-60404.1 gsasaaGfaGfuGfucucaucuucuuL96 asAfsGfAfaGfa(Tgn)gAfgAfcAfcucuuucsusg 50.06 9.17 93.46 2.56 4290 4291 873-895 AD-60410.1 gsasaaGfaGfuGfucucaucuucuuL96 asAfsGfAfaGfaugAfgAfcAfc(Tgn)cuuucsusg 44.40 13.93 88.96 6.06 4292 4293 873-895 AD-60416.1 gsasaaGfaGfuGfucucaucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcuc(Tgn)uucsusg 28.56 7.82 76.36 19.47 4294 4295 873-895 AD-60422.1 GfsasAfaGfAfGfuGf(Tgn)cucaucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 40.37 10.86 84.06 12.08 4296 4297 873-895 AD-60428.1 GfsasAfaGfAfGfuGfuc(Tgn)caucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 56.81 22.64 92.15 0.26 4298 4299 873-895 AD-60433.1 GfsasAfaGfAfGfuGfucuc(Agn)ucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 36.78 5.31 67.92 12.55 4300 4301 873-895 AD-60439.1 GfsasAfaGfAfGfuGfucuca(Tgn)cuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 32.81 6.72 77.93 13.33 4302 4303 873-895 AD-60445.1 GfsasAfaGfAfGfuGfucucauc(Tgn)ucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 13.25 3.28 78.08 4.05 4304 4305 873-895 AD-60451.1 GfsasAfaGfAfGfuGfucucaucu(Tgn)cuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 34.74 11.06 88.93 5.19 4306 4307 873-895 AD-60457.1 GfsasAfaGfAfGfuGfucucaucuuc(Tgn)uL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 41.26 6.16 92.15 0.64 4308 4309 873-895 AD-60463.1 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuAfL96 usAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 19.58 7.98 69.67 4.64 4310 4311 873-895 AD-60469.1 CfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfgsasc 19.35 9.30 72.30 0.50 4312 4313 873-895 AD-60474.1 CfsusAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuAfgsasc 21.60 4.27 76.35 11.71 4314 4315 873-895 AD-60479.1 CfsusUfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfaAfgsasc 28.01 4.45 76.55 27.32 4316 4317 873-895 AD-60484.1 CfsusUfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfaAfgsusg 20.31 3.08 71.99 9.53 4318 4319 873-895 AD-60446.1 GfsusUfuGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 asAfsgAfaGfaUfgAfgacAfcUfcAfaAfcsusg 18.65 5.11 73.52 17.87 4320 4321 873-895 AD-60452.1 GfsasUfuCfaGfuGfUfCfuCfaUfcUfuCfuUfL96 asAfsgAfaGfaUfgAfgacAfcUfgAfaUfcsusg 28.72 1.21 83.09 15.75 4322 4323 873-895 AD-60458.1 GfsasAfuCfuGfuGfUfCfuCfaUfcUfuCfuUfL96 asAfsgAfaGfaUfgAfgacAfcAfgAfuUfcsusg 50.15 13.02 114.93 11.58 4324 4325 873-895 AD-60464.1 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 (Agn)AfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 35.71 5.07 103.88 3.01 4326 4327 873-895 AD-60470.1 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 asAfs(Ggn)AfaGfaUfgAfgacAfcUfcUfuUfcsusg 17.59 0.78 73.15 11.75 4328 4329 873-895 AD-60475.1 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 asAfsg(Agn)aGfaUfgAfgacAfcUfcUfuUfcsusg 22.07 4.57 68.64 25.12 4330 4331 873-895 AD-60480.1 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 asAfsgAf(Agn)GfaUfgAfgacAfcUfcUfuUfcsusg 15.54 1.22 66.39 14.34 4332 4333 873-895 n/a GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 asAfsgAfa(Ggn)aUfgAfgacAfcUfcUfuUfcsusg 4334 4335 873-895 AD-60447.1 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 asAfsgAfaGf(Agn)UfgAfgacAfcUfcUfuUfcsusg 31.33 4.75 104.36 7.71 4336 4337 873-895 AD-60453.1 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 asAfsgAfaGfa(Tgn)gAfgacAfcUfcUfuUfcsusg 15.42 0.90 76.29 0.41 4338 4339 873-895 AD-60459.1 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 asAfsgAfaGfaUf(Ggn)AfgacAfcUfcUfuUfcsusg 27.70 10.91 89.20 3.46 4340 4341 873-895 AD-60465.1 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 asAfsgAfaGfaUfg(Agn)gacAfcUfcUfuUfcsusg 28.44 6.84 87.28 5.73 4342 4343 873-895 AD-60471.1 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 asAfsgAfaGfaUfgAf(Ggn)acAfcUfcUfuUfcsusg 24.03 8.87 85.86 14.62 4344 4345 873-895 AD-60476.1 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 asAfsgAfaGfaUfgAfg(Agn)cAfcUfcUfuUfcsusg 21.48 5.53 88.73 25.48 4346 4347 873-895 AD-60481.1 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfu(Tgn)L96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 15.18 4.19 68.10 6.86 4348 4349 873-895 AD-60486.1 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCf(Tgn) asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 15.31 0.31 74.06 8.48 UfL96 4350 4351 873-895 AD-60448.1 GfsasAfaGfaGfuGfUfCfuCfaUfcUfu(Cgn)uUfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 14.89 1.35 59.22 6.64 4352 4353 873-895 AD-60454.1 GfsasAfaGfaGfuGfUfCfuCfaUfcUf(Tgn)CfuU asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 19.24 5.72 75.90 1.27 fL96 4354 4355 873-895 AD-60460.1 GfsasAfaGfaGfuGfUfCfuCfaUfc(Tgn)uCfuUfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 14.91 5.84 60.11 6.01 4356 4357 873-895 AD-60466.1 GfsasAfaGfaGfuGfUfCfuCfaUf(Cgn)UfuCfuU asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 13.99 7.53 56.83 11.59 fL96 4358 4359 873-895 AD-60472.1 GfsasAfaGfaGfuGfUfCfuCfa(Tgn)cUfuCfuUfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 12.35 0.60 64.36 11.74 4360 4361 873-895 AD-60477.1 GfsasAfaGfaGfuGfUfCfuCf(Agn)UfcUfuCfu asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 15.62 1.76 65.96 7.77 UfL96 4362 4363 873-895 AD-60482.1 GfsasAfaGfaGfuGfUfCfu(Cgn)aUfcUfuCfuUfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 18.58 6.43 66.67 2.31 4364 4365 873-895 AD-60487.1 GfsasAfaGfaGfuGfUfCf(Tgn)CfaUfcUfuCfu asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 34.89 15.62 86.39 6.10 UfL96 4366 4367 873-895 AD-60449.1 GfsasAfaGfaGfuGfUf(Cgn)uCfaUfcUfuCfuUfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 22.65 80.09 0.75 4368 4369 873-895 AD-60455.1 GfsasAfaGfaGfuGf(Tgn)CfuCfaUfcUfuCfuUfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 31.05 2.82 104.24 23.01 4370 4371 873-895 AD-60461.1 GfsasAfaGfaGfuGfUfCfuCfaUfcUfu(Cgn)uUfL96 asAfs(Ggn)AfaGfaUfgAfgacAfcUfcUfuUfcsusg 16.30 2.08 85.78 22.00 4372 4373 873-895 AD-60467.1 GfsasAfaGfaGfuGfUfCfuCfaUfcUf(Tgn)Cfu asAfsg(Agn)aGfaUfgAfgacAfcUfcUfuUfcsusg 17.77 8.38 82.16 18.92 UfL96 4374 4375 873-895 AD-60473.1 GfsasAfaGfaGfuGfUfCfuCfaUfc(Tgn)uCfuUfL96 asAfsgAf(Agn)GfaUfgAfgacAfUtUfuUfcsusg 14.64 4.25 61.05 7.88 4376 4377 873-895 n/a GfsasAfaGfaGfuGfUfCfuCfaUf(Cgn)UfuCfu asAfsgAfa(Ggn)aUfgAfgacAfcUfcUfuUfcsusg UfL96 4378 4379 873-895 AD-60483.1 GfsasAfaGfaGfuGfUfCfuCfa(Tgn)cUfuCfuUfL96 asAfsgAfaGf(Agn)UfgAfgacAfcUfcUfuUfcsusg 26.18 2.83 91.12 16.03 4380 4381 873-895 AD-60488.1 GfsasAfaGfaGfuGfUfCfuCf(Agn)UfcUfuCfu asAfsgAfaGfa(Tgn)gAfgacAfcUfcUfuUfcsusg 24.74 0.56 87.66 7.90 UfL96 4382 4383 873-895 AD-60450.1 GfsasAfaGfaGfuGfUfCfu(Cgn)aUfcUfuCfuUfL96 asAfsgAfaGfaUf(Ggn)AfgacAfcUfcUfuUfcsusg 37.09 2.89 111.90 1.97 4384 4385 873-895 AD-60456.1 GfsasAfaGfaGfuGfUfCf(Tgn)CfaUfcUfuCfu asAfsgAfaGfaUfg(Agn)gacAfcUfcUfuUfcsusg 41.82 0.60 102.56 11.25 UfL96 4386 4387 873-895 AD-60462.1 GfsasAfaGfaGfuGfUf(Cgn)uCfaUfcUfuCfuUfL96 asAfsgAfaGfaUfgAf(Ggn)acAfcUfcUfuUfcsusg 38.91 3.89 122.47 35.17 4388 4389 873-895 AD-60468.1 GfsasAfaGfaGfuGf(Tgn)CfuCfaUfcUfuCfuUfL96 asAfsgAfaGfaUfgAfg(Agn)cAfcUfcUfuUfcsusg 28.44 3.05 97.09 2.66 4390 4391 873-895 AD-60550.1 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfsL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 20.35 0.63 69.13 22.65 4392 4393 873-895 AD-60555.1 GfsasAfaGfaGfuGfUfCfuCfaUfscUfsuCfuUfsL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 19.17 8.76 68.86 17.72 4394 4395 873-895 AD-60560.1 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfsL96 asAfsgAfaGfaUfgAfgacAfcUfscUfsuUfscsusg 25.71 5.66 67.63 27.72 4396 4397 873-895 AD-60565.1 GfsasAfaGfaGfuGfUfCfuCfaUfscUfsuCfuUfsL96 asAfsgAfaGfaUfgAfgacAfcUfscUfsuUfscsusg 22.78 7.32 74.11 1.85
[0940] As is shown in the table above, in this in vitro screen, the siRNAs that provided the greatest ALAS1 mRNA suppression (greater than 80% suppression, such that less than 20% mRNA was remaining) at 10 nM concentration included AD-58632, AD-60472, AD-60423, AD-60445, AD-60423, AD-60417, AD-60466, AD-60473, AD-60434, AD-60448, AD-60460, AD-60411, AD-60481, AD-60486, and AD-60453, AD-60480, AD-60405, AD-60477, AD-60461, AD-60470, AD-60467, AD-60482, AD-60446, AD-60555, AD-60454, AD-60469 and AD-60463. Furthermore, in this in vitro screen, the siRNAs that provided the greatest ALAS1 mRNA suppression (greater than 30% suppression, such that less than 70% mRNA was remaining) at 0.1 nM concentration included AD-60423, AD-58632, AD-60434, AD-60423, AD-60466, AD-60419, AD-60438, AD-60448, AD-60460, AD-60473, AD-60411, AD-60405, AD-60472, AD-60477, AD-60417, AD-60480, AD-60482, AD-60421, AD-60560, AD-60433, AD-60481, AD-60475, AD-60555, AD-60437, AD-60550, AD-60415, AD-60463, and AD-60443.
[0941] As is shown in the table below, testing of further siRNAs revealed that the following duplexes provided greater than 80% suppression at 10 nM concentration: AD-58632, AD-60405, AD-60423, AD-60434, AD-60445, AD-60480, AD-60460, and AD-60466, and the following duplexes provided greater than 30% suppression at 0.1 nM concentration: AD-58632, AD-60405, AD-60423, AD-60434, AD-60419, AD-60480, AD-60460, and AD-60466.
TABLE-US-00027 TABLE 26 Further sequences and in vitro screen results for AD-58632 and AD-58632 derivative siRNAs Target sites SEQ of ID anti- SEQ NO: sense Avg SD Avg SD ID NO: (anti- seq on Duplex 10 10 0.1 0.1 (sense) sense) NM_000688.4 Name Sense Sequence (5′-3′) Antisense (AS) Sequence (5′-3′) nM nM nM nM 4398 4399 873-895 AD-58632.8 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 11.8 2.7 46.7 4.2 4400 4401 873-895 AD-60405.1 GfsasAfaGfaGfuGfuCfuCfaucuuCfuuL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 15.6 4.5 63.5 10.5 4402 4403 873-895 GfsasAfaGfaGfuGfuCfuCfaucuuCfuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 4404 4405 873-895 GfsasAfaGfaGfuGfuCfuCfaucuuCfuuL96 asAfsgAfaGfaugAfgAfcAfcucuuucsusg 4406 4407 873-895 GfsasAfaGfaGfuGfuCfuCfaucuuCfuuL96 asAfsgAfaGfaugAfgacAfcucuuucsusg 4408 4409 873-895 AD-60423.2 gsasaagaGfuGfuCfuCfaucuucuuL96 asAfsGfAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg 13.8 3.4 55.9 7.9 4410 4411 873-895 gsasaagaGfuGfuCfuCfaucuucuuL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 4412 4413 873-895 gsasaagaGfuGfuCfuCfaucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 4414 4415 873-895 gsasaagaGfuGfuCfuCfaucuucuuL96 asAfsgAfaGfaugAfgAfcAfcucuuucsusg 4416 4417 873-895 gsasaagaGfuGfuCfuCfaucuucuuL96 asAfsgAfaGfaugAfgacAfcucuuucsusg 4418 4419 873-895 AD-60434.1 gsasaagaGfuGfuCfucaucuucuuL96 asAfsGfAfaGfaUfgAfcAfcUfcUfuUfcsusg 14.7 2.8 48.7 6.6 4420 4421 873-895 gsasaagaGfuGfuCfucaucuucuuL96 asAfsgAfaGfaUfgAfgacAtUfcUfuUfcsusg 4422 4423 873-895 gsasaagaGfuGfuCfucaucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 4424 4425 873-895 gsasaagaGfuGfuCfucaucuucuuL96 asAfsgAfaGfaugAfgAfcAfcucuuucsusg 4426 4427 873-895 gsasaagaGfuGfuCfucaucuucuuL96 asAfsgAfaGfaugAfgacAfcucuuucsusg 4428 4429 873-895 AD-60419.1 GfsasAfaGfAfGfuGfdTcucaucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 20.8 15.1 57.8 8.3 4430 4431 873-895 GfsasAfaGfAfGfuGfdTcucaucuucuuL96 asAfsgAfaGfaUfgAfgacAtUfcUfuUfcsusg 4432 4433 873-895 GfsasAfaGfAfGfuGfdTcucaucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 4434 4435 873-895 GfsasAfaGfAfGfuGfdTcucaucuucuuL96 asAfsgAfaGfaugAfgAfcAfcucuuucsusg 4436 4437 873-895 GfsasAfaGfAfGfuGfdTcucaucuucuuL96 asAfsgAfaGfaugAfgacAfcucuuucsusg 4438 4439 873-895 AD-60445.1 GfsasAfaGfAfGfuGfucucauc(Tgn)ucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 13.3 3.3 78.1 4.0 4440 4441 873-895 GfsasAfaGfAfGfuGfucucauc(Tgn)ucuuL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 4442 4443 873-895 GfsasAfaGfAfGfuGfucucauc(Tgn)ucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 4444 4445 873-895 GfsasAfaGfAfGfuGfucucauc(Tgn)ucuuL96 asAfsgAfaGfaugAfgAfcAfcucuuucsusg 4446 4447 873-895 GfsasAfaGfAfGfuGfucucauc(Tgn)ucuuL96 asAfsgAfaGfaugAfgacAfcucuuucsusg 4448 4449 873-895 AD-60480.1 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 asAfsgAf(Agn)GfaUfgAfgacAfcUfcUfuUfcsu 15.5 1.2 66.4 14.3 sg 4450 4451 873-895 gsasaagaGfuGfuCfuCfaucuucuuL96 asAfsgAf(Agn)GfaUfgAfgacAfcUfcUfuUfcsu sg 4452 4453 873-895 gsasaagaGfuGfuCfucaucuucuuL96 asAfsgAf(Agn)GfaUfgAfgacAfcUfcUfuUfcsu sg 4454 4455 873-895 GfsasAfaGfAfGfuGfdTcucaucuucuuL96 asAfsgAf(Agn)GfaUfgAfgacAfcUfcUfuUfcsu sg 4456 4457 873-895 GfsasAfaGfAfGfuGfucucauc(Tgn)ucuuL96 asAfsgAf(Agn)GfaUfgAfgacAfcUfcUfuUfcsu sg 4458 4459 873-895 GfsasAfaGfAfGfuGfucucaucs(Tgns)ucuuL96 asAfsgAfs(Agns)GfaUfgAfgacAfcUfcUfuUfc susg 4460 4461 873-895 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 asAfsgAf(Agn)GfaugAfgacAfcucuuucsusg 4462 4463 873-895 gsasaagaGfuGfuCfuCfaucuucuuL96 asAfsgAf(Agn)GfaugAfgacAfcucuuucsusg 4464 4465 873-895 gsasaagaGfuGfuCfucaucuucuuL96 asAfsgAf(Agn)GfaugAfgacAfcucuuucsusg 4466 4467 873-895 GfsasAfaGfAfGfuGfdTcucaucuucuuL96 asAfsgAf(Agn)GfaugAfgacAfcucuuucsusg 4468 4469 873-895 GfsasAfaGfAfGfuGfucucauc(Tgn)ucuuL96 asAfsgAf(Agn)GfaugAfgacAfcucuuucsusg 4470 4471 873-895 GfsasAfaGfAfGfuGfucucaucs(Tgns)ucuuL96 asAfsgAfs(Agns)GfaugAfgacAfcucuuucsusg 4472 4473 873-895 AD-58632.8 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 11.8 2.7 46.7 4.2 4474 4475 873-895 GfsasAfaGfaGfuGfdTCfuCfaUfcUfuCfuUfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 4476 4477 873-895 GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfuUfL96 asAfsgAfaGfaUfgAfgacAfcdTcUfuUfcsusg 4478 4479 873-895 GfsasAfaGfaGfuGfdTCfuCfaUfcUfuCfuUfL96 asAfsgAfaGfaUfgAfgacAfcdTcUfuUfcsusg 4480 4481 873-895 GfsasAfaGfaGfuGfdTCfuCfaUfcUfsuCfsuUfs asAfsgAfaGfaUfgAfgacAfcdTcUfuUfcsusg L96 4482 4483 873-895 GfsasAfaGfaGfuGfdTCfuCfaUfcUfsucsuUfsL asAfsGfAfaGfaUfgAfgacAfcdTcUfuUfcsusg 96 4484 4485 873-895 AD-60460.1 GfsasAfaGfaGfuGfUfCfuCfaUfc(Tgn)uCfuUf asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 14.9 5.8 60.1 6.0 L96 4486 4487 873-895 GfsasAfaGfaGfuGfdTCfuCfaUfc(Tgn)uCfuUf asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg L96 4488 4489 873-895 GfsasAfaGfaGfuGfUfCfuCfaUfc(Tgn)uCfuUf asAfsgAfaGfaUfgAfgacAfcdTcUfuUfcsusg L96 4490 4491 873-895 GfsasAfaGfaGfuGfdTCfuCfaUfc(Tgn)uCfuUf asAfsgAfaGfaUfgAfgacAfcdTcUfuUfcsusg L96 4492 4493 873-895 GfsasAfaGfaGfuGfdTCfuCfaUfc(Tgn)suCfsu asAfsgAfaGfaUfgAfgacAfcdTcUfuUfcsusg UfsL96 4494 4495 873-895 GfsasAfaGfaGfuGfdTCfuCfaUfc(Tgn)sucsuU asAfsGfAfaGfaUfgAfgacAfcdTcUfuUfcsusg fsL96 4496 4497 873-895 AD-60466.1 GfsasAfaGfaGfuGfUfCfuCfaUf(Cgn)UfuCfuU asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 14.0 7.5 56.8 11.6 fL96 4498 4499 873-895 GfsasAfaGfaGfuGfdTCfuCfaUf(Cgn)UfuCfuU asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg fL96 4500 4501 873-895 GfsasAfaGfaGfuGfUfCfuCfaUf(Cgn)UfuCfuU asAfsgAfaGfaUfgAfgacAfcdTcUfuUfcsusg fL96 4502 4503 873-895 GfsasAfaGfaGfuGfdTCfuCfaUf(Cgn)UfuCfuU asAfsgAfaGfaUfgAfgacAfcdTcUfuUfcsusg fL96 4504 4505 873-895 GfsasAfaGfaGfuGfdTCfuCfaUf(Cgn)UfsuCfs asAfsgAfaGfaUfgAfgacAfcdTcUfuUfcsusg uUfsL96 4506 4507 873-895 GfsasAfaGfaGfuGfdTCfuCfaUf(Cgn)Ufsucsu asAfsGfAfaGfaUfgAfgacAfcdTcUfuUfcsusg UfsL96
TABLE-US-00028 TABLE 27 Further sequences of AD-58632 derivative siRNAs SEQ Target SEQ ID sites of ID NO: antisense NO: (anti- sequence Duplex (sense) sense) on NM_ Name Sense Sequence (5′-3′) Antisense Sequence (5′-3′) 4508 4509 873-895 AD- GfsasAfaGfaGfuGfUfCfuCfaUfcU asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 58632 fuCfuUfL96 4510 4511 873-895 AD- GfsasAfaGfaGfuGfuCfuCfaucuuC asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 60405.1 fuuL96 4512 4513 873-895 AD- GfsasAfaGfaGfuGfuCfuCfaucuuC asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 60887 fuuL96 4514 4515 873-895 AD- GfsasAfaGfaGfuGfuCfuCfaucuuC asAfsGfAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg 60923 fuuL96 4516 4517 873-895 AD- gsasaagaGfuGfuCfucaucuucuuL96 asAfsGfAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg 60434.1 4518 4519 873-895 AD- gsasaagaGfuGfuCfucaucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 60892 4520 4521 873-895 AD- gsasaagaGfuGfuCfucaucuucuuL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 60891 4522 4523 873-895 AD- GfsasAfaGfAfGfuGfdTcucaucuucuu asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 60419.1 L96 4524 4525 873-895 AD- GfsasAfaGfAfGfuGfdTcucaucuucuu asAfsGfAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg 60924 L96 4526 4527 873-895 AD- GfsasAfaGfAfGfuGfdTcucaucuucuu asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 60885 L96 4528 4529 873-895 AD- GfsasAfaGfAfGfuGfucucauc(Tgn) asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 60445.1 ucuuL96 4530 4531 873-895 AD- GfsasAfaGfAfGfuGfucucauc(Tgn) asAfsGfAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg 60925 ucuuL96 4532 4533 873-895 AD- GfsasAfaGfAfGfuGfucucauc(Tgn) asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 60890 ucuuL96 4534 4535 873-895 AD- GfsasAfaGfaGfuGfUfCfuCfaUfcU asAfsGfAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg 60926 fuCfuUfL96
IC50s Based on In Vitro Activity
[0942] Similar to the experiments described above, further dose-response experiments were done at 10 nM, 1.66667 nM, 0.277778 nM, 0.046296 nM, 0.007716 nM, 0.001286 nM, 0.000214 nM, and 3.57E-05 nM final duplex concentration, and IC50 values were calculated.
TABLE-US-00029 TABLE 28 Further sequences and IC50s of AD-58632 and AD-58632 derivative siRNAs Target sites of anti-sense SEQ ID NO: SEQ ID NO: seq on Duplex (sense) (anti- sense) NM_000688.4 Name Sense Sequence (5′-3′) Antisense (AS) Sequence (5′-3′) IC50 4536 4537 873-895 AD- GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfu asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 0.017 58632.10 UfL96 4538 4539 873-895 AD- GfsasAfaGfaGfuGfuCfuCfaucuuCfuuL asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 0.070 60405.2 96 4540 4541 873-895 AD- GfsasAfaGfaGfuGfuCfuCfaucuuCfuuL asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 0.120 60887.1 96 4542 4543 873-895 AD- GfsasAfaGfaGfuGfuCfuCfaucuuCfuuL asAfsgAfaGfaugAfgAfcAfcucuuucsusg 0.009 60819.1 96 4544 4545 873-895 AD- GfsasAfaGfaGfuGfuCfuCfaucuuCfuuL asAfsgAfaGfaugAfgacAfcucuuucsusg 0.032 60823.1 96 4546 4547 873-895 AD- gsasaagaGfuGfuCfuCfaucuucuuL96 asAfsGfAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg 0.020 60423.3 4548 4549 873-895 AD- gsasaagaGfuGfuCfuCfaucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 0.242 60889.1 4550 4551 873-895 AD- gsasaagaGfuGfuCfuCfaucuucuuL96 asAfsgAfaGfaugAfgAfcAfcucuuucsusg 0.044 60827.1 4552 4553 873-895 AD- gsasaagaGfuGfuCfuCfaucuucuuL96 asAfsgAfaGfaugAfgacAfcucuuucsusg 0.077 60831.1 4554 4555 873-895 AD- gsasaagaGfuGfuCfucaucuucuuL96 asAfsGfAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg 0.028 60434.2 4556 4557 873-895 AD- gsasaagaGfuGfuCfucaucuucuuL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 0.078 60891.1 4558 4559 873-895 AD- gsasaagaGfuGfuCfucaucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 0.138 60892.1 4560 4561 873-895 AD- gsasaagaGfuGfuCfucaucuucuuL96 asAfsgAfaGfaugAfgAfcAfcucuuucsusg 0.015 60835.1 4562 4563 873-895 AD- gsasaagaGfuGfuCfucaucuucuuL96 asAfsgAfaGfaugAfgacAfcucuuucsusg 0.014 60839.1 4564 4565 873-895 AD- GfsasAfaGfAfGfuGfdTcucaucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 0.014 60419.2 4566 4567 873-895 AD- GfsasAfaGfAfGfuGfdTcucaucuucuuL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 0.091 60885.1 4568 4569 873-895 AD- GfsasAfaGfAfGfuGfdTcucaucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 0.026 60419.3 4570 4571 873-895 AD- GfsasAfaGfAfGfuGfdTcucaucuucuuL96 asAfsgAfaGfaugAfgAfcAfcucuuucsusg 0.004 60843.1 4572 4573 873-895 AD- GfsasAfaGfAfGfuGfdTcucaucuucuuL96 asAfsgAfaGfaugAfgacAfcucuuucsusg 0.012 60847.1 4574 4575 873-895 AD- GfsasAfaGfAfGfuGfucucauc(Tgn)ucuu asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 0.077 60445.2 L96 4576 4577 873-895 AD- GfsasAfaGfAfGfuGfucucauc(Tgn)ucuu asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 1.201 60890.1 L96 4578 4579 873-895 AD- GfsasAfaGfAfGfuGfucucauc(Tgn)ucuu asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 0.302 60445.3 L96 4580 4581 873-895 AD- GfsasAfaGfAfGfuGfucucauc(Tgn)ucuu asAfsgAfaGfaugAfgAfcAfcucuuucsusg 0.006 60820.1 L96 4582 4583 873-895 AD- GfsasAfaGfAfGfuGfucucauc(Tgn)ucuu asAfsgAfaGfaugAfgacAfcucuuucsusg 0.032 60824.1 L96 4584 4585 873-895 AD- GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfu asAfsgAf(Agn)GfaUfgAfgacAfcUfcUfuUfcsu 0.066 60480.2 UfL96 sg 4586 4587 873-895 AD- gsasaagaGfuGfuCfuCfaucuucuuL96 asAfsgAf(Agn)GfaUfgAfgacAfcUfcUfuUfcsu 0.034 60893.1 sg 4588 4589 873-895 AD- gsasaagaGfuGfuCfucaucuucuuL96 asAfsgAf(Agn)GfaUfgAfgacAfcUfcUfuUfcsu 0.157 60884.1 sg 4590 4591 873-895 AD- GfsasAfaGfAfGfuGfdTcucaucuucuuL96 asAfsgAf(Agn)GfaUfgAfgacAfcUfcUfuUfcsu 0.801 60886.1 sg 4592 4593 873-895 AD- GfsasAfaGfAfGfuGfucucauc(Tgn)ucuu asAfsgAf(Agn)GfaUfgAfgacAfcUfcUfuUfcsu 0.201 60888.1 L96 sg 4594 4595 873-895 AD- GfsasAfaGfAfGfuGfucucaucs(Tgns)uc asAfsgAfs(Agns)GfaUfgAfgacAfcUfcUfuUfc 0.145 60828.1 uuL96 susg 4596 4597 873-895 AD- GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfu asAfsgAf(Agn)GfaugAfgacAfcucuuucsusg 0.036 60832.1 UfL96 4598 4599 873-895 AD- gsasaagaGfuGfuCfuCfaucuucuuL96 asAfsgAf(Agn)GfaugAfgacAfcucuuucsusg 0.076 60836.1 4600 4601 873-895 AD- gsasaagaGfuGfuCfucaucuucuuL96 asAfsgAf(Agn)GfaugAfgacAfcucuuucsusg 0.033 60840.1 4602 4603 873-895 AD- GfsasAfaGfAfGfuGfdTcucaucuucuuL96 asAfsgAf(Agn)GfaugAfgacAfcucuuucsusg 0.017 60844.1 4604 4605 873-895 AD- GfsasAfaGfAfGfuGfucucauc(Tgn)ucuu asAfsgAf(Agn)GfaugAfgacAfcucuuucsusg 0.007 60848.1 L96 4606 4607 873-895 AD- GfsasAfaGfAfGfuGfucucaucs(Tgns)uc asAfsgAfs(Agns)GfaugAfgacAfcucuuucsus 0.076 60821.1 uuL-96 g 4608 4609 873-895 AD- GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfu asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 0.063 58632.11 UfL96 4610 4611 873-895 AD- GfsasAfaGfaGfuGfdTCfuCfaUfcUfuCf asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 0.031 60825.1 uUfL96 4612 4613 873-895 AD- GfsasAfaGfaGfuGfUfCfuCfaUfcUfuCfu asAfsgAfaGfaUfgAfgacAfcdTcUfuUfcsusg 0.033 60829.1 UfL96 4614 4615 873-895 AD- GfsasAfaGfaGfuGfdTCfuCfaUfcUfuCf asAfsgAfaGfaUfgAfgacAfcdTcUfuUfcsusg 0.100 60833.1 uUfL96 4616 4617 873-895 AD- GfsasAfaGfaGfuGfdTCfuCfaUfcUfsuC asAfsgAfaGfaUfgAfgacAfcdTcUfuUfcsusg 0.031 60837.1 fsuUfsL96 4618 4619 873-895 AD- GfsasAfaGfaGfuGfdTCfuCfaUfcUfsuc asAfsGfAfaGfaUfgAfgacAfcdTcUfuUfcsusg 0.010 60841.1 suUfsL96 4620 4621 873-895 AD- GfsasAfaGfaGfuGfUfCfuCfaUfc(Tgn)u asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 0.009 60460.2 CfuUfL96 4622 4623 873-895 AD- GfsasAfaGfaGfuGfdTCfuCfaUfc(Tgn)u asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 0.002 60845.1 CfuUfL96 4624 4625 873-895 AD- GfsasAfaGfaGfuGfUfCfuCfaUfc(Tgn)u asAfsgAfaGfaUfgAfgacAfcdTcUfuUfcsusg 0.005 60849.1 CfuUfL96 4626 4627 873-895 AD- GfsasAfaGfaGfuGfdTCfuCfaUfc(Tgn)u asAfsgAfaGfaUfgAfgacAfcdTcUfuUfcsusg 0.007 60822.1 CfuUfL96 4628 4629 873-895 AD- GfsasAfaGfaGfuGfdTCfuCfaUfc(Tgn)s asAfsgAfaGfaUfgAfgacAfcdTcUfuUfcsusg 0.009 60826.1 uCfsuUfsL96 4630 4631 873-895 AD- GfsasAfaGfaGfuGfdTCfuCfaUfc(Tgn)s asAfsGfAfaGfaUfgAfgacAfcdTcUfuUfcsusg 0.019 60830.1 ucsuUfsL96 4632 4633 873-895 AD- GfsasAfaGfaGfuGfUfCfuCfaUf(Cgn)Uf asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 0.066 60466.2 uCfuUfL96 4634 4635 873-895 AD- GfsasAfaGfaGfuGfdTCfuCfaUf(Cgn)Uf asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 0.024 60834.1 uCfuUfL96 4636 4637 873-895 AD- GfsasAfaGfaGfuGfUfCfuCfaUf(Cgn)Uf asAfsgAfaGfaUfgAfgacAfcdTcUfuUfcsusg 0.013 60838.1 uCfuUfL96 4638 4639 873-895 AD- GfsasAfaGfaGfuGfdTCfuCfaUf(Cgn)Uf asAfsgAfaGfaUfgAfgacAfcdTcUfuUfcsusg 0.010 60842.1 uCfuUfL96 4640 4641 873-895 AD- GfsasAfaGfaGfuGfdTCfuCfaUf(Cgn)Uf asAfsgAfaGfaUfgAfgacAfcdTcUfuUfcsusg 0.011 60846.1 suCfsuUfsL96 4642 4643 873-895 AD- GfsasAfaGfaGfuGfdTCfuCfaUf(Cgn)Uf asAfsGfAfaGfaUfgAfgacAfcdTcUfuUfcsusg 0.018 60850.1 sucsuUfsL96
[0943] As is shown in Table 28, the following duplexes had an IC50 of less than 0.01 nM: AD-60845, AD-60843, AD-60849, AD-60820, AD-60848, AD-60822, AD-60826, AD-60819, and AD-60460.
[0944] The following duplexes had an IC50 of less than 0.02 nM: AD-60845, AD-60843, AD-60849, AD-60820, AD-60848, AD-60822, AD-60826, AD-60819, and AD-60460, AD-60841, AD-60842, AD-60846, AD-60847, AD-60838, AD-60419, AD-60839, AD-60835, AD-586320, AD-60844, AD-60850, and AD-60830.
[0945] The following duplexes had an IC50 of less than 0.05 nM: AD-60845, AD-60843, AD-60849, AD-60820, AD-60848, AD-60822, AD-60826, AD-60819, and AD-60460, AD-60841, AD-60842, AD-60846, AD-60847, AD-60838, AD-60419, AD-60839, AD-60835, AD-586320, AD-60844, AD-60850, AD-60830, AD-60423, AD-60834, AD-60419, AD-60434, AD-60825, AD-60837, AD-60823, AD-60824, AD-60840, AD-60829, AD-60893, AD-60832, and AD-60827.
Example 25: In Vivo Structure Activity Relationship Studies of AD-58632
[0946] Derivatives of the AD-58632 parent siRNA were generated and screened in vivo in rats. The sequences of siRNAs that were screened are provided in the table below.
TABLE-US-00030 TABLE 29 Sequences of ALAS1 siRNA Duplexes Target SEQ sites of SEQ ID antisense ID NO: sequence NO: (anti- on Duplex (sense) sense) NM_000688.4 Name Sense Sequence (5′-3′) Antisense Sequence (5′-3′) 4644 4645 873-895 AD- GfsasAfaGfaGfuGfUfCfuCfaUfcUf asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 58632 uCfuUfL96 4646 4647 873-895 AD- GfsasAfaGfaGfuGfuCfuCfaucuuC asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 60405 fuuL96 4648 4649 873-895 AD- GfsasAfaGfaGfuGfuCfuCfaucuuC asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 60887 fuuL96 4650 4651 873-895 AD- gsasaagaGfuGfuCfucaucuucuuL96 asAfsGfAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg 60923 4652 4653 873-895 AD- gsasaagaGfuGfuCfucaucuucuuL96 asAfsGfAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg 60434 4654 4655 873-895 AD- gsasaagaGfuGfuCfucaucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 60892 4656 4657 873-895 AD- GfsasAfaGfAfGfuGfdTcucaucuucu asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 60419 uL96 4658 4659 873-895 AD- GfsasAfaGfAfGfuGfdTcucaucuucu asAfsGfAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg 60924 uL96 4660 4661 873-895 AD- GfsasAfaGfAfGfuGfucucauc(Tgn) asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 60445 ucuuL96 4662 4663 873-895 AD- GfsasAfaGfAfGfuGfucucauc(Tgn) asAfsGfAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg 60925 ucuuL96 4664 4665 873-895 AD- GfsasAfaGfaGfuGfUfCfuCfaUfcU asAfsGfAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg 60926 fuCfuUfL96
[0947] A single dose of 5 mg/kg of siRNA was administered. At 5 days following administration of the siRNA, mRNA measurements of rat ALAS1 (rALAS1) mRNA and rat GAPDH (rGAPDH) mRNA were made using bDNA assay, and tissue levels of drug were determined using qPCR. The results are provided in
Example 26: Efficacy of AD-60925 and AD-60926 in a Rat AIP Model
[0948] The therapeutic efficacy of AD-60925 and AD-60926 (described in the previous example) was investigated in a rat AIP model. The experimental design is shown in the top of
[0949] The results are shown in
[0950] Both AD-60925 and AD-60926 showed therapeutic efficacy treatment of AIP. AD-60925 was even more effective than AD-60926 in suppressing ALAS1 mRNA, urine ALA, and urine PBG.
Example 27: Further In Vivo Structure Activity Relationship Studies of AD-58632
[0951] Derivatives of the AD-58632 parent siRNA were generated and screened in vivo in rats.
In Vivo Screen, Part I
[0952] The sequences of siRNAs that were screened are provided in the table below.
TABLE-US-00031 TABLE 30 Sequences of ALAS1 siRNA Duplexes Target SEQ sites of SEQ ID antisense ID NO: sequence NO: (anti- on Duplex (sense) sense) NM_000688.4 Name Sense Sequence (5′-3′) Antisense Sequence (5′-3′) 4666 4667 873-895 AD- GfsasAfaGfaGfuGfUfCfuCfaUfcU asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 58632 fuCfuUfL96 4668 4669 873-895 AD- GfsasAfaGfAfGfuGfucucauc(Tgn) asAfsgAfaGfaugAfgAfcAfcucuuucsusg 60820 ucuuL96 4670 4671 873-895 AD- GfsasAfaGfAfGfuGfucucauc(Tgn) asAfsgAfaGfaugAfgacAfcucuuucsusg 60824 ucuuL96 4672 4673 873-895 AD- GfsasAfaGfAfGfuGfucucauc(Tgn) asAfsgAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg 61137 ucuuL96 4674 4675 873-895 AD- GfsasAfaGfAfGfuGfdTcucaucuuc asAfsgAfaGfaugAfgAfcAfcucuuucsusg 60843 uuL96 4676 4677 873-895 AD- GfsasAfaGfAfGfuGfdTcucaucuuc asAfsgAfaGfaugAfgacAfcucuuucsusg 60847 uuL96 4678 4679 873-895 AD- GfsasAfaGfAfGfuGfdTcucaucuuc asAfsgAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg 61138 uuL96 4680 4681 873-895 AD- GfsasAfaGfaGfuGfuCfuCfaucuuC asAfsgAfaGfaugAfgAfcAfcucuuucsusg 60819 fuuL96 4682 4683 873-895 AD- GfsasAfaGfaGfuGfuCfuCfaucuuC asAfsgAfaGfaugAfgacAfcucuuucsusg 60823 fuuL96 4684 4685 873-895 AD- GfsasAfaGfaGfuGfuCfuCfaucuuC asAfsgAfaGfaUfgAfgAfcAfcUfcUfuUfcsusg 61139 fuuL96 4686 4687 873-895 AD- GfsasAfaGfaGfuGfdTCfuCfaUfc asAfsgAfaGfaugAfgAfcAfcucuuucsusg 61140 (Tgn)uCfuUfL96
[0953] Rats were administered four doses of 2.5 mg/kg of siRNA biweekly (two times per week) for two weeks. At 72 hours following administration of the last dose of siRNA, the animals were sacrificed and measurements of rat ALAS1 (rALAS1) mRNA and rat GAPDH (rGAPDH) mRNA levels were made using bDNA assay.
[0954] As is shown in
In Vivo Screen, Part II
[0955] The sequences of the siRNAs that were screened are provided in the table below.
TABLE-US-00032 TABLE 31 Sequences of ALAS1 siRNA Duplexes Target SEQ sites of SEQ ID antisense ID NO: sequence NO: (anti- on Duplex (sense) sense) NM_000688.4 Name Sense Sequence (5′-3′) Antisense Sequence (5′-3′) 4688 4689 873-895 AD- GfsasAfaGfaGfuGfUfCfuCfaUfcU asAfsgAfaGfaUfgAfgacAfcUfcUfuUf 58632 fuCfuUfL96 csusg 4690 4691 873-895 AD- GfsasAfaGfaGfuGfdTCfuCfaUfc asAfsgAfaGfaugAfgacAfcucuuucsusg 61141.2 (Tgn)uCfuUfL96 4692 4693 873-895 AD- GfsasAfaGfaGfuGfdTCfuCfaUfc asAfsgAfaGfaUfgAfgAfcAfcUfcUfuUf 61142.2 (Tgn)uCfuUfL96 csusg 4694 4695 873-895 AD- gsasaagaGfuGfuCfucaucuucuuL96 asAfsgAfaGfaugAfgAfcAfcucuuucsusg 60835 4696 4697 873-895 AD- gsasaagaGfuGfuCfucaucuucuuL96 asAfsgAfaGfaugAfgacAfcucuuucsusg 60839 4698 4699 873-895 AD- gsasaagaGfuGfuCfucaucuucuuL96 asAfsgAfaGfaUfgAfgAfcAfcUfcUfuUf 61143.2 csusg 4700 4701 873-895 AD- gsasaagaGfuGfdTCfucaucuucuuL96 asAfsgAfaGfaugAfgAfcAfcucuuucsusg 61144.1 4702 4703 873-895 AD- gsasaagaGfuGfdTCfucaucuucuuL96 asAfsgAfaGfaugAfgacAfcucuuucsusg 61145.1 4704 4705 873-895 AD- gsasaagaGfuGfdTCfucaucuucuuL96 asAfsgAfaGfaUfgAfgAfcAfcUfcUfuUf 61146.1 csusg
[0956] Rats were administered a single dose of 2.5 mg/kg of siRNA. At 72 hours following administration of the siRNA, mRNA measurements of rat ALAS1 (rALAS1) mRNA and rat GAPDH (rGAPDH) mRNA were made using bDNA assay.
[0957] As is shown in
Example 28: In Vitro Structure Activity Relationship Studies of AD-60489
[0958] AD-60489 and siRNA derivatives of AD-60489 were generated, and some siRNAs were screened in vitro for activity. The in vitro activity of the siRNAs in suppressing ALAS1 mRNA was tested as described in Example 24. Sequences of siRNAs and results of in vitro testing are provided in the tables below.
TABLE-US-00033 TABLE 32 Sequences and in vitro screen results for AD-60489 and AD-60489 derivative siRNAs Target sites of SEQ anti- SEQ ID NO: sense Avg SD Avg SD ID NO: (anti- seq on Duplex 10 10 0.1 0.1 (sense) sense) NM_000688.4 Name* Sense Sequence (5′-3′) Antisense (AS) Sequence (5′-3′) nM nM nM nM 4706 4707 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 17.02 0.18 50.65 5.11 60489.1 4708 4709 871-893 AD- CfsasGfaAfaGfaGfuGfuCfuCfaucuuAfL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 17.13 5.94 63.58 18.61 60495.1 4710 4711 871-893 AD- CfsasGfaAfaGfaGfuGfuCfuCfaucuuAfL96 usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsgsu 11.90 0.66 45.19 8.93 60501.1 4712 4713 871-893 AD- CfsasgaaaGfaGfuGfuCfuCfaucuuAfL96 usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsgsu 14.63 7.85 48.50 19.55 60507.1 4714 4715 871-893 AD- CfsasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsgsu 14.39 2.44 51.03 7.01 60513.1 4716 4717 871-893 AD- csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsgsu 14.67 4.88 51.70 7.72 60519.1 4718 4719 871-893 AD- csasgaaaGfaGfuguCfuCfaucuuaL96 usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsgsu 45.24 18.16 105.09 14.17 60525.1 4720 4721 871-893 AD- csasgaaaGfaGfugucuCfaucuuaL96 usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsgsu 62.19 12.47 107.18 1.37 60531.1 4722 4723 871-893 AD- csasgaaaGfaGfugucucaucuuaL96 usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsgsu 39.06 10.92 82.70 10.67 60490.1 4724 4725 871-893 AD- csasgaaaGfaGfugucucaucuuaL96 usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcugsgsu 48.90 1.85 71.55 5.47 60496.1 4726 4727 871-893 AD- csasgaaaGfaGfugucucaucuuaL96 usAfsAfGfaUfgAfgAfcAfcUfcUfuucugsgsu 51.83 12.62 81.85 4.25 60502.1 4728 4729 871-893 AD- csasgaaaGfaGfugucucaucuuaL96 usAfsAfGfaUfgAfgAfcAfcUfcuuucugsgsu 65.34 21.75 89.23 11.08 60508.1 4730 4731 871-893 AD- csasgaaaGfaGfugucucaucuuaL96 usAfsAfGfaUfgAfgAfcAfcucuuucugsgsu 97.13 3.47 102.94 7.36 60514.1 4732 4733 871-893 AD- csasgaaaGfaGfugucucaucuuaL96 usAfsAfGfaugAfgAfcAfcucuuucugsgsu 104.97 0.93 126.75 20.47 60520.1 4734 4735 871-893 AD- csasgaaaGfAfGfugucucaucuuaL96 usAfsAfGfaugAfgAfcAfcucuuucugsgsu 61.48 15.44 81.28 7.99 60526.1 4736 4737 871-893 AD- csasgaaaGfAfGfugucucaucuuaL96 usAfsAfGfaugAfgAfcAfcdTcuuucugsgsu 83.47 13.36 94.13 8.11 60532.1 4738 4739 871-893 AD- csasgaAfaGfAfGfugucucaucuuaL96 usAfsAfGfaugAfgAfcAfcdTcuuucugsgsu 109.05 0.43 97.85 9.77 60491.1 4740 4741 871-893 AD- CfsasgaAfaGfAfGfugucucaucuuaL96 usAfsAfGfaugAfgAfcAfcdTcuuucugsgsu 73.81 10.17 95.01 5.40 60497.1 4742 4743 871-893 AD- csasgaaaGfAfGfudGucucaucuuaL96 usAfsAfGfaugAfgAfcAfcdTcuuucugsgsu 75.30 11.29 96.03 6.30 60503.1 4744 4745 871-893 AD- csasgaaaGfAfGfugudCucaucuuaL96 usAfsAfGfaugAfgAfcAfcdTcuuucugsgsu 71.37 24.41 104.36 18.62 60509.1 4746 4747 871-893 AD- csasgaaaGfAfGfugucudCaucuuaL96 usAfsAfGfaugAfgAfcAfcdTcuuucugsgsu 64.16 13.95 98.80 0.92 60515.1 4748 4749 871-893 AD- csasgaaaGfAfGfugucucadTcuuaL96 usAfsAfGfaugAfgAfcAfcdTcuuucugsgsu 73.99 36.39 99.96 7.29 60521.1 4750 4751 871-893 AD- csasgaaaGfAfGfugucucaucdTuaL96 usAfsAfGfaugAfgAfcAfcdTcuuucugsgsu 82.69 26.56 114.13 4.81 60527.1 4752 4753 871-893 AD- csasgaaaGfAfGfudGudCucaucuuaL96 usAfsAfGfaugAfgAfcAfcdTcuuucugsgsu 89.41 4.69 107.40 9.67 60533.1 4754 4755 871-893 AD- csasgaaaGfAfGfudGucudCaucuuaL96 usAfsAfGfaugAfgAfcAfcdTcuuucugsgsu 83.52 1.56 100.70 0.79 60492.1 4756 4757 871-893 AD- csasgaaaGfAfGfudGucucadTcuuaL96 usAfsAfGfaugAfgAfcAfcdTcuuucugsgsu 64.64 16.21 98.41 19.60 60498.1 4758 4759 871-893 AD- csasgaaaGfAfGfudGudCucadTcuuaL96 usAfsAfGfaugAfgAfcAfcdTcuuucugsgsu 57.55 5.13 93.14 0.41 60504.1 4760 4761 871-893 AD- csasgaaaGfAfGfudGudCudCadTcuuaL96 usAfsAfGfaugAfgAfcAfcdTcuuucugsgsu 58.88 25.48 91.39 2.06 60510.1 4762 4763 871-893 AD- csasgaaaGfAfGfugucucaucuuaL96 usAfsAfGfadTgAfgAfcAfcdTcuuucugsgsu 53.24 6.56 84.40 2.73 60516.1 4764 4765 871-893 AD- csasgaAfaGfAfGfugucucaucuuaL96 usAfsAfGfadTgAfgAfcAfcdTcuuucugsgsu 67.17 6.48 91.62 5.43 60522.1 4766 4767 871-893 AD- CfsasgaAfaGfAfGfugucucaucuuaL96 usAfsAfGfadTgAfgAfcAfcdTcuuucugsgsu 81.44 37.04 89.71 8.60 60528.1 4768 4769 871-893 AD- csasgaaaGfAfGfugucucaucuuaL96 usAfsAfGfaugAfgAfcAfcdTcdTuucugsgsu 62.63 20.55 99.62 7.37 60534.1 4770 4771 871-893 AD- csasgaaaGfAfGfugucucaucuuaL96 usAfsAfGfaugAfgAfcAfcdTcuudTcugsgsu 107.18 0.11 87.98 2.41 60493.1 4772 4773 871-893 AD- csasgaaaGfAfGfugucucaucuuaL96 usAfsAfGfadTgAfgAfcAfcdTcuudTcugsgsu 35.92 13.78 77.52 6.68 60499.1 4774 4775 871-893 AD- csasgaaaGfAfGfugucucaucuuaL96 usAfsAfGfaugAfgAfcAfc(Tgn)cuuucugsgsu 66.77 16.45 109.82 2.48 60505.1 4776 4777 871-893 AD- csasgaAfaGfAfGfugucucaucuuaL96 usAfsAfGfaugAfgAfcAfc(Tgn)cuuucugsgsu 82.10 10.11 95.50 14.73 60511.1 4778 4779 871-893 AD- CfsasgaAfaGfAfGfugucucaucuuaL96 usAfsAfGfaugAfgAfcAfc(Tgn)cuuucugsgsu 80.83 29.69 93.57 18.41 60517.1 4780 4781 871-893 AD- GfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfcscsa 29.60 1.64 67.16 8.40 60523.1 4782 4783 871-893 AD- GfsusGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcAfcscsa 21.15 1.21 79.02 28.99 60529.1 4784 4785 871-893 AD- GfsusCfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 usAfsaGfaUfgAfgAfcacUfcUfuUfgAfcscsa 31.78 13.54 79.36 26.56 60535.1 4786 4787 871-893 AD- GfsusCfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 usAfsaGfaUfgAfgAfcacUfcUfuUfgAfcsgsu 30.14 3.42 81.46 12.88 60494.1 4788 4789 871-893 AD- CfsusCfuAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 usAfsaGfaUfgAfgAfcacUfcUfuAfgAfgsgsu 29.85 11.78 72.14 4.56 60500.1 4790 4791 871-893 AD- CfsusCfuUfaGfaGfUfGfuCfuCfaUfcUfuAfL96 usAfsaGfaUfgAfgAfcacUfcUfaAfgUfgsgsu 19.06 1.98 88.93 11.13 60506.1 4792 4793 871-893 AD- CfsusGfuLlfuGfaGfUfGfuCfuCfaUfcUfuAfL96 usAfsaGfaUfgAfgAfcacUfcAfaAfcUfgsgsu 29.71 1.79 86.32 17.69 60512.1 4794 4795 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 (Tgns)AfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 27.47 2.59 81.03 10.93 60518.1 4796 4797 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 usAfs(Agn)GfaUfgAfgAfcacUfcUfuUfcUfgsgsu 17.02 1.39 71.65 17.42 60524.1 4798 4799 871-893 n/a CfsasGfaAfa GfaGfUfGfuCfuCfaUfcUfuAfL96 usAfsa(Ggn)aUfgAfgAfcacUfcUfuUfcUfgsgsu 4800 4801 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 usAfsaGf(Agn)aUfgAfgAfcacUfcUfuUfcUfgsgs 61.77 10.19 91.55 2.20 60536.1 u 4802 4803 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 usAfsaGfa(Tgn)gAfgAfcacUfcUfuUfcUfgsgsu 25.47 2.83 54.36 15.02 60541.1 4804 4805 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 usAfsaGfaUf(Ggn)AfgAfcacUfcUfuUfcUfgsgsu 49.32 1.50 90.79 11.36 60546.1 4806 4807 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 usAfsaGfaUfg(Agn)gAfcacUfcUfuUfcUfgsgsu 24.37 1.11 76.80 24.99 60551.1 4808 4809 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 usAfsaGfaUfgAf(Ggn)AfcacUfcUfuUfcUfgsgsu 21.43 4.71 61.90 5.64 60556.1 4810 4811 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 usAfsaGfaUfgAfg(Agn)cacUfcUfuUfcUfgsgsu 28.25 6.41 71.84 27.01 60561.1 4812 4813 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 usAfsaGfaUfgAfgAf(Cgn)acUfcUfuUfcUfgsgsu 27.57 4.87 67.91 18.28 60566.1 4814 4815 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 usAfsaGfaUfgAfgAfc(Agn)cUfcUfuUfcUfgsgsu 24.11 0.04 58.75 21.02 60570.1 4816 4817 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfu(Agn)L96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 15.32 4.78 42.01 9.51 60583.1 4818 4819 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUf(Tgn)AfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 21.15 4.14 49.54 13.34 60585.1 4820 4821 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCfaUfc(Tgn)uAfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 14.66 1.73 41.47 13.20 60587.1 4822 4823 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCfaUf(Cgn)UfuAfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 20.77 5.12 43.97 15.63 60589.1 4824 4825 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCfa(Tgn)cUfuAfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 13.66 0.05 36.42 16.94 60591.1 4826 4827 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCf(Agn)UtUfuAfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 13.35 4.11 35.43 11.36 60592.1 4828 4829 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfu(Cgn)aUfcUfuAfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 15.13 0.28 39.99 19.39 60593.1 4830 4831 871-893 AD- CfsasGfaAfaGfaGfUfGfuCf(Tgn)CfaUfcUfuAfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 19.56 8.17 51.59 1.11 60582.1 4832 4833 871-893 AD- CfsasGfaAfaGfaGfUfGfu(Cgn)uCfaUfcUfuAfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 23.36 6.63 58.79 10.35 60584.1 4834 4835 871-893 AD- CfsasGfaAfaGfaGfUfGf(Tgn)CfuCfaUfcUfuAfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 27.78 2.20 76.86 6.81 60586.1 4836 4837 871-893 AD- CfsasGfaAfaGfaGfUf(Ggn)uCfuCfaUfcUfuAfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 105.27 14.25 99.26 19.62 60588.1 4838 4839 871-893 AD- CfsasGfaAfaGfaGf(Tgn)GfuCfuCfaUfcUfuAfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 28.74 1.66 81.88 22.04 60590.1 4840 4841 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCfaUfc(Tgn)uAfL96 usAfs(Agn)GfaUfgAfgAfcacUfcUfuUfcUfgsgsu 22.74 14.85 60.42 19.38 60558.1 4842 4843 871-893 n/a CfsasGfaAfaGfaGfUfGfuCfuCfaUf(Cgn)UfuAfL96 usAfsa(Ggn)aUfgAfgAfcacUfcUfuUfcUfgsgsu 4844 4845 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCfa(Tgn)cUfuAfL96 usAfsaGf(Agn)aUfgAfgAfcacUfcUfuUfcUfgsgs 86.66 21.93 110.05 16.44 60568.1 u 4846 4847 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCf(Agn)UfcUfuAfL96 usAfsaGfa(Tgn)gAfgAfcacUfcUfuUfcUfgsgsu 22.37 4.86 71.24 22.19 60572.1 4848 4849 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfu(Cgn)aUfcUfuAfL96 usAfsaGfaUf(Ggn)AfgAfcacUfcUfuUfcUfgsgsu 43.35 14.53 104.44 2.51 60539.1 4850 4851 871-893 AD- CfsasGfaAfaGfaGfUfGfuCf(Tgn)CfaUfcUfuAfL96 usAfsaGfaUfg(Agn)gAfcacUfcUfuUfcUfgsgsu 25.85 1.18 69.98 5.86 60544.1 4852 4853 871-893 AD- CfsasGfaAfaGfaGfUfGfu(Cgn)uCfaUfcUfuAfL96 usAfsaGfaUfgAf(Ggn)AfcacUfcUfuUfcUfgsgsu 29.40 4.62 72.98 20.16 60549.1 4854 4855 871-893 AD- CfsasGfaAfaGfaGfUfGf(Tgn)CfuCfaUfcUfuAfL96 usAfsaGfaUfgAfg(Agn)cacUfcUfuUfcUfgsgsu 33.74 0.45 75.36 19.39 60554.1 4856 4857 871-893 n/a CfsasGfaAfaGfaGfUf(Ggn)uCfuCfaUfcUfuAfL96 usAfsaGfaUfgAfgAf(Cgn)acUfcUfuUfcUfgsgsu 4858 4859 871-893 AD- CfsasGfaAfa GfaGf(Tgn)GfuCfuCfaUfcUfuAfL96 usAfsaGfaUfgAfgAfc(Agn)cUfcUfuUfcUfgsgsu 27.77 10.34 77.01 11.51 60564.1 4860 4861 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfsL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 20.34 5.29 59.40 19.74 60569.1 4862 4863 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCfaUfscUfsuAfsL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 20.07 3.83 60.80 14.93 60573.1 4864 4865 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfsL96 usAfsaGfaUfsgAfgAfcacUfcUfsuUfscUfgsgsu 24.36 0.56 75.75 14.97 60540.1 4866 4867 871-893 n/a CfsasGfaAfaGfaGfUfGfuCfuCfaUfscUfsuAfsL96 usAfsaGfaUfsgAfgAfcacUfcUfsuUfscUfgsgsu
[0959] In the in vitro screen for which the results are shown in the table above, the siRNAs that provided the greatest ALAS1 mRNA suppression (greater than 80% suppression, such that less than 20% mRNA was remaining) at 10 nM concentration included AD-60501, AD-60592, AD-60591, AD-60513, AD-60507, AD-60587, AD-60519, AD-60593, AD-60583, AD-60524, AD-60489, AD-60495, AD-60506, and AD-60582.
[0960] In the in vitro screen for which the results are shown in the table above, the siRNAs that provided the greatest ALAS1 mRNA suppression (greater than 30% suppression, such that less than 70% mRNA was remaining) at 0.1 nM concentration included AD-60592, AD-60591, AD-60593, AD-60587, AD-60583, AD-60589, AD-60501, AD-60507, AD-60585, AD-60489, AD-60513, AD-60582, AD-60519, AD-60541, AD-60570, AD-60584, AD-60569, AD-60558, AD-60573, AD-60556, AD-60495, AD-60523, AD-60566, and AD-60544.
[0961] As is shown in the table below, testing of further siRNAs revealed that the following duplexes provided greater than 80% suppression at 10 nM concentration: AD-60489, AD-60495, AD-60501, AD-60507, AD-60513, AD-60519, AD-60583, AD-60591, AD-60592, and AD-60593, and the following duplexes provided greater than 30% suppression at 0.1 nM concentration: AD-60489, AD-60495, AD-60501, AD-60507, AD-60513, AD-60519, AD-60583, AD-60591, AD-60592, and AD-60593.
TABLE-US-00034 TABLE 33 Sequences and in vitro screen results for AD-60489 and AD-60489 derivative siRNAs SEQ Target ID sites of SEQ NO: anti-sense Avg SD Avg SD ID NO: (anti- seq on Duplex 10 10 0.1 0.1 (sense) sense) NM_000688.4 Name Sense Sequence (5′-3′) Antisense (AS) Sequence (5′-3′) nM nM nM nM 4868 4869 871-893 AD-60489.1 CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 17.0 0.2 50.7 5.1 4870 4871 871-893 AD-60495.1 CfsasGfaAfaGfaGfuGfuCfuCfaucuuAfL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 17.1 5.9 63.6 18.6 4872 4873 871-893 AD-60501.1 CfsasGfaAfaGfaGfuGfuCfuCfaucuuAfL96 usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsgsu 11.9 0.7 45.2 8.9 4874 4875 871-893 CfsasGfaAfaGfaGfuGfuCfuCfaucuuAfL96 usAfsAfGfaugAfgAfcAfcucuuucugsgsu 4876 4877 871-893 CfsasGfaAfaGfaGfuGfuCfuCfaucuuAfL96 usAfsAfGfadTgAfgAfcAfcdTcuudTcugsgsu 4878 4879 871-893 CfsasGfaAfaGfaGfuGfuCfuCfaucuuAfL96 usAfsaGfadTgAfgAfcAfcdTcuudTcugsgsu 4880 4881 871-893 CfsasGfaAfaGfaGfuGfuCfuCfaucuuAfL96 usAfsAfGfadTgAfgAfcacdTcuudTcugsgsu 4882 4883 871-893 AD-60507.1 CfsasgaaaGfaGfuGfuCfuCfaucuuAfL96 usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsgsu 14.6 7.8 48.5 19.6 4884 4885 871-893 CfsasgaaaGfaGfuGfuCfuCfaucuuAfL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 4886 4887 871-893 CfsasgaaaGfaGfuGfuCfuCfaucuuAfL96 usAfsAfGfaugAfgAfcAfcucuuucugsgsu 4888 4889 871-893 CfsasgaaaGfaGfuGfuCfuCfaucuuAfL96 usAfsAfGfadTgAfgAfcAfcdTcuudTcugsgsu 4890 4891 871-893 CfsasgaaaGfaGfuGfuCfuCfaucuuAfL96 usAfsaGfadTgAfgAfcAfcdTcuudTcugsgsu 4892 4893 871-893 CfsasgaaaGfaGfuGfuCfuCfaucuuAfL96 usAfsAfGfadTgAfgAfcacdTcuudTcugsgsu 4894 4895 871-893 AD-60513.1 CfsasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsgsu 14.4 2.4 51.0 7.0 4896 4897 871-893 CfsasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 4898 4899 871-893 CfsasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsAfGfaugAfgAfcAfcucuuucugsgsu 4900 4901 871-893 CfsasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsAfGfadTgAfgAfcAfcdTcuudTcugsgsu 4902 4903 871-893 CfsasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsaGfadTgAfgAfcAfcdTcuudTcugsgsu 4904 4905 871-893 CfsasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsAfGfadTgAfgAfcacdTcuudTcugsgsu 4906 4907 871-893 AD-60519.1 csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsgsu 14.7 4.9 51.7 7.7 4908 4909 871-893 csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 4910 4911 871-893 csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsAfGfaugAfgAfcAfcucuuucugsgsu 4912 4913 871-893 csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsAfGfadTgAfgAfcAfcdTcuudTcugsgsu 4914 4915 871-893 csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsaGfadTgAfgAfcAfcdTcuudTcugsgsu 4916 4917 871-893 csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsAfGfadTgAfgAfcacdTcuudTcugsgsu 4918 4919 871-893 AD-60499.1 csasgaaaGfAfGfugucucaucuuaL96 usAfsAfGfadTgAfgAfcAfcdTcuudTcugsgsu 35.9 13.8 77.5 6.7 4920 4921 871-893 csasgaaaGfAfGfugucucaucuuaL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 4922 4923 871-893 csasgaaaGfAfGfugucucaucuuaL96 usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsgsu 4924 4925 871-893 csasgaaaGfAfGfugucucaucuuaL96 usAfsAfGfaugAfgAfcAfcucuuucugsgsu 4926 4927 871-893 csasgaaaGfAfGfugucucaucuuaL96 usAfsaGfadTgAfgAfcAfcdTcuudTcugsgsu 4928 4929 871-893 csasgaaaGfAfGfugucucaucuuaL96 usAfsAfGfadTgAfgAfcacdTcuudTcugsgsu 4930 4931 871-893 csasgaaaGfAfGfugucuca(Tgn)cuuaL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 4932 4933 871-893 csasgaaaGfAfGfugucuca(Tgn)cuuaL96 usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsgsu 4934 4935 871-893 csasgaaaGfAfGfugucuca(Tgn)cuuaL96 usAfsAfGfaugAfgAfcAfcucuuucugsgsu 4936 4937 871-893 csasgaaaGfAfGfugucuca(Tgn)cuuaL96 usAfsAfGfadTgAfgAfcAfcdTcuudTcugsgsu 4938 4939 871-893 csasgaaaGfAfGfugucuca(Tgn)cuuaL96 usAfsaGfadTgAfgAfcAfcdTcuudTcugsgsu 4940 4941 871-893 csasgaaaGfAfGfugucuca(Tgn)cuuaL96 usAfsAfGfadTgAfgAfcacdTcuudTcugsgsu 4942 4943 871-893 AD-60583.1 CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfu(Agn)L96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 15.3 4.8 42.0 9.5 4944 4945 871-893 AD-60591.1 CfsasGfaAfaGfaGfUfGfuCfuCfa(Tgn)cUfuAfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 13.7 0.0 36.4 16.9 4946 4947 871-893 AD-60592.1 CfsasGfaAfaGfaGfUfGfuCfuCf(Agn)UfcUfuAfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 13.4 4.1 35.4 11.4 4948 4949 871-893 AD-60593.1 CfsasGfaAfaGfaGfUfGfuCfu(Cgn)aUfcUfuAfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 15.1 0.3 40.0 19.4 4950 4951 871-893 AD-60489.1 CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 17.0 0.2 50.7 5.1 4952 4953 871-893 CfsasGfaAfaGfaGfdTGfuCfuCfaUfcUfuAfL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 4954 4955 871-893 CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 usAfsaGfaUfgAfgAfcacUfcdTuUfcUfgsgsu 4956 4957 871-893 CfsasGfaAfaGfaGfdTGfuCfuCfaUfcUfuAfL96 usAfsaGfaUfgAfgAfcacUfcdTuUfcUfgsgsu 4958 4959 871-893 CfsasGfaAfaGfaGfdTGfuCfuCfaUfscUfsuAfsL96 usAfsaGfaUfgAfgAfcacUfcdTuUfcUfgsgsu 4960 4961 871-893 CfsasGfaAfaGfaGfdTGfuCfuCfaUfscusuAfsL96 usAfsAfGfaUfgAfgAfcacUfcdTuUfcUfgsgsu 4962 4963 871-893 AD-60591.1 CfsasGfaAfaGfaGfUfGfuCfuCfa(Tgn)cUfuAfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 13.7 0.0 36.4 16.9 4964 4965 871-893 CfsasGfaAfaGfaGfdTGfuCfuCfa(Tgn)cUfuAfL96 asAfsgAfaGfaUfgAfg acAfcUfcUfuUfcsusg 4966 4967 871-893 CfsasGfaAfaGfaGfUfGfuCfuCfa(Tgn)cUfuAfL96 usAfsaGfaUfgAfgAfcacUfcdTuUfcUfgsgsu 4968 4969 871-893 CfsasGfaAfaGfaGfdTGfuCfuCfa(Tgn)cUfuAfL96 usAfsaGfaUfgAfgAfcacUfcdTuUfcUfgsgsu 4970 4971 871-893 CfsasGfaAfaGfaGfdTGfuCfuCfa(Tgn)scUfsuAfsL96 usAfsaGfaUfgAfgAfcacUfcdTuUfcUfgsgsu 4972 4973 871-893 CfsasGfaAfaGfaGfdTGfuCfuCfa(Tgn)scusuAfsL96 usAfsAfGfaUfgAfgAfcacUfcdTuUfcUfgsgsu 4974 4975 871-893 AD-60592.1 CfsasGfaAfaGfaGfUfGfuCfuCf(Agn)UfcUfuAfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 13.4 4.1 35.4 11.4 4976 4977 871-893 CfsasGfaAfaGfaGfdTGfuCfuCf(Agn)UfcUfuAfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 4978 4979 871-893 CfsasGfaAfaGfaGfUfGfuCfuCf(Agn)UfcUfuAfL96 usAfsaGfaUfgAfgAfcacUfcdTuUfcUfgsgsu 4980 4981 871-893 CfsasGfaAfaGfaGfdTGfuCfuCf(Agn)UfcUfuAfL96 usAfsaGfaUfgAfgAfcacUfcdTuUfcUfgsgsu 4982 4983 871-893 CfsasGfaAfaGfaGfdTGfuCfuCf(Agn)UfscUfsuAfsL96 usAfsaGfaUfgAfgAfcacUfcdTuUfcUfgsgsu 4984 4985 871-893 CfsasGfaAfaGfaGfdTGfuCfuCf(Agn)UfscusuAfsL96 usAfsAfGfaUfgAfgAfcacUfcdTuUfcUfgsgsu 4986 4987 871-893 CfsasGfaAfaGfaGfdTGfuCfuCfs(Agns)UfscUfsuAfs usAfsaGfaUfgAfgAfcacUfcdTuUfcUfgsgsu L96 4988 4989 871-893 CfsasGfaAfaGfaGfdTGfuCfuCfs(Agns)UfscusuAfsL96 usAfsAfGfaUfgAfgAfcacUfcdTuUfcUfgsgsu
TABLE-US-00035 TABLE 34 Further sequences of AD-60489 derivative siRNAs SEQ Target ID sites of SEQ NO: antisense ID NO: (anti- sequence on Duplex (sense) sense) NM_000688.4 Name Sense Sequence (5′-3′) Antisense Sequence (5′-3′) 4990 4991 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCfaUfcU usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 60489 fuAfL96 4992 4993 871-893 AD- CfsasGfaAfaGfaGfuGfuCfuCfaucuuA usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsg 60501.1 fL96 su 4994 4995 871-893 AD- CfsasGfaAfaGfaGfuGfuCfuCfaucuuA usAfsAfGfadTgAfgAfcAfcdTcuudTcugsgsu 60900.1 fL96 4996 4997 871-893 AD- csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsg 60519.1 su 4998 4999 871-893 AD- csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsAfGfadTgAfgAfcAfcdTcuudTcugsgsu 60905.1 5000 5001 871-893 AD- csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 60901.1 5002 5003 871-893 AD- csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 60495.2 5004 5005 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCfaUfcU usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsg 60935.1 sufuAfL96
TABLE-US-00036 TABLE 35 Further sequences and IC50s of AD-60489 and AD-60489 derivative siRNAs Target sites SEQ of anti-sense ID NO: SEQ ID NO: seq on Duplex (sense) (anti-sense) NM_000688.4 Name* Sense Sequence (5′-3′) Antisense (AS) Sequence (5′-3′) IC50 5006 5007 871-893 AD CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 0.010 60489.3 5008 5009 871-893 AD CfsasGfaAfaGfaGfuGfuCfuCfaucuuAfL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 0.254 60495.2 5010 5011 871-893 AD CfsasGfaAfaGfaGfuGfuCfuCfaucuuAfL96 usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsgsu 0.006 60501.2 5012 5013 871-893 AD CfsasGfaAfaGfaGfuGfuCfuCfaucuuAfL96 usAfsAfGfaugAfgAfcAfcucuuucugsgsu na 60898.1 5014 5015 871-893 AD CfsasGfaAfaGfaGfuGfuCfuCfaucuuAfL96 usAfsAfGfadTgAfgAfcAfcdTcuudTcugsgsu 0.151 60900.1 5016 5017 871-893 AD CfsasGfaAfaGfaGfuGfuCfuCfaucuuAfL96 usAfsaGfadTgAfgAfcAfcdTcuudTcugsgsu 0.033 60851.1 5018 5019 871-893 AD CfsasGfaAfaGfaGfuGfuCfuCfaucuuAfL96 usAfsAfGfadTgAfgAfcacdTcuudTcugsgsu 0.065 60855.1 5020 5021 871-893 AD CfsasgaaaGfaGfuGfuCfuCfaucuuAfL96 usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsgsu 0.029 60507.2 5022 5023 871-893 AD CfsasgaaaGfaGfuGfuCfuCfaucuuAfL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 0.024 60902.1 5024 5025 871-893 AD CfsasgaaaGfaGfuGfuCfuCfaucuuAfL96 usAfsAfGfaugAfgAfcAfcucuuucugsgsu na 60904.1 5026 5027 871-893 AD CfsasgaaaGfaGfuGfuCfuCfaucuuAfL96 usAfsAfGfadTgAfgAfcAfcdTcuudTcugsgsu 0.011 60894.1 5028 5029 871-893 AD CfsasgaaaGfaGfuGfuCfuCfaucuuAfL96 usAfsaGfadTgAfgAfcAfcdTcuudTcugsgsu 0.249 60860.1 5030 5031 871-893 AD CfsasgaaaGfaGfuGfuCfuCfaucuuAfL96 usAfsAfGfadTgAfgAfcacdTcuudTcugsgsu 1.899 60864.1 5032 5033 871-893 AD CfsasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsgsu 0.019 60513.2 5034 5035 871-893 AD CfsasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 0.034 60896.1 5036 5037 871-893 AD CfsasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsAfGfaugAfgAfcAfcucuuucugsgsu na 60899.1 5038 5039 871-893 AD CfsasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsaGfadTgAfgAfcAfcdTcuudTcugsgsu 0.249 60868.1 5040 5041 871-893 AD CfsasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsAfGfadTgAfgAfcacdTcuudTcugsgsu 0.014 60872.1 5042 5043 871-893 AD csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsgsu 0.026 60519.2 5044 5045 871-893 AD- csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsaGfaUfgAfgAfcacUtUfuUtUfgsgsu 0.080 60901.1 5046 5047 871-893 AD- csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsAfGfaugAfgAfcAfcucuuucugsgsu na 60903.1 5048 5049 871-893 AD- csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsAfGfadTgAfgAfcAfcdTcuudTcugsgsu 0.018 60905.1 5050 5051 871-893 AD- csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsaGfadTgAfgAfcAfcdTcuudTcugsgsu 0.091 60876.1 5052 5053 871-893 AD- csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsAfGfadTgAfgAfcacdTcuudTcugsgsu 0.131 60880.1 5054 5055 871-893 AD- csasgaaaGfAfGfugucucaucuuaL96 usAfsAfGfadTgAfgAfcAfcdTcuudTcugsgsu na 60499.2 5056 5057 871-893 AD- csasgaaaGfAfGfugucucaucuuaL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu na 60895.1 5058 5059 871-893 AD- csasgaaaGfAfGfugucucaucuuaL96 usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsgsu na 60897.1 5060 5061 871-893 AD- csasgaaaGfAfGfugucucaucuuaL96 usAfsAfGfaugAfgAfcAfcucuuucugsgsu na 60526.2 5062 5063 871-893 AD- csasgaaaGfAfGfugucucaucuuaL96 usAfsaGfadTgAfgAfcAfcdTcuudTcugsgsu 4.970 60852.1 5064 5065 871-893 AD- csasgaaaGfAfGfugucucaucuuaL96 usAfsAfGfadTgAfgAfcacdTcuudTcugsgsu na 60856.1 5066 5067 871-893 AD- csasgaaaGfAfGfugucuca(Tgn)cuuaL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 0.019 60861.1 5068 5069 871-893 AD- csasgaaaGfAfGfugucuca(Tgn)cuuaL96 usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsgsu 0.061 60865.1 5070 5071 871-893 AD- csasgaaaGfAfGfugucuca(Tgn)cuuaL96 usAfsAfGfaugAfgAfcAfcucuuucugsgsu na 60869.1 5072 5073 871-893 AD- csasgaaaGfAfGfugucuca(Tgn)cuuaL96 usAfsAfGfadTgAfgAfcAfcdTcuudTcugsgsu 0.009 60873.1 5074 5075 871-893 AD- csasgaaaGfAfGfugucuca(Tgn)cuuaL96 usAfsaGfadTgAfgAfcAfcdTcuudTcugsgsu 0.008 60877.1 5076 5077 871-893 AD- csasgaaaGfAfGfugucuca(Tgn)cuuaL96 usAfsAfGfadTgAfgAfcacdTcuudTcugsgsu 0.025 60881.1 5078 5079 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfu(Agn)L96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 0.022 60583.2 5080 5081 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCfa(Tgn)cUfuAfL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 0.031 60591.3 5082 5083 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCf(Agn)UfcUfuAfL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 0.010 60592.3 5084 5085 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfu(Cgn)aUfcUfuAfL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 0.006 60593.2 5086 5087 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 0.011 60489.4 5088 5089 871-893 AD- CfsasGfaAfaGfaGfdTGfuCfuCfaUfcUfuAfL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 0.019 60857.1 5090 5091 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCfaUfcUfuAfL96 usAfsaGfaUfgAfgAfcacUfcdTuUfcUfgsgsu 0.012 60862.1 5092 5093 871-893 AD- CfsasGfaAfaGfaGfdTGfuCfuCfaUfcUfuAfL96 usAfsaGfaUfgAfgAfcacUfcdTuUfcUfgsgsu 0.015 60866.1 5094 5095 871-893 AD- CfsasGfaAfaGfaGfdTGfuCfuCfaUfscUfsuAfsL96 usAfsaGfaUfgAfgAfcacUfcdTuUfcUfgsgsu 0.012 60870.1 5096 5097 871-893 AD- CfsasGfaAfaGfaGfdTGfuCfuCfaUfscusuAfsL96 usAfsAfGfaUfgAfgAfcacUfcdTuUfcUfgsgsu 0.003 60874.1 5098 5099 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCfa(Tgn)cUfuAfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 0.014 60591.2 5100 5101 871-893 AD- CfsasGfaAfaGfaGfdTGfuCfuCfa(Tgn)cUfuAfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 0.008 60878.1 5102 5103 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCfa(Tgn)cUfuAfL96 usAfsaGfaUfgAfgAfcacUfcdTuUfcUfgsgsu 0.003 60882.1 5104 5105 871-893 AD- CfsasGfaAfaGfaGfdTGfuCfuCfa(Tgn)cUfuAfL96 usAfsaGfaUfgAfgAfcacUfcdTuUfcUfgsgsu 0.007 60853.1 5106 5107 871-893 AD- CfsasGfaAfaGfaGfdTGfuCfuCfa(Tgn)scUfsuAfsL96 usAfsaGfaUfgAfgAfcacUfcdTuUfcUfgsgsu 0.013 60858.1 5108 5109 871-893 AD- CfsasGfaAfaGfaGfdTGfuCfuCfa(Tgn)scusuAfsL96 usAfsAfGfaUfgAfgAfcacUfcdTuUfcUfgsgsu 0.002 60863.1 5110 5111 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCf(Agn)UfcUfuAfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 0.013 60592.2 5112 5113 871-893 AD- CfsasGfaAfaGfaGfdTGfuCfuCf(Agn)UfcUfuAfL96 asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 0.084 60867.1 5114 5115 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCf(Agn)UfcUfuAfL96 usAfsaGfaUfgAfgAfcacUfcdTuUfcUfgsgsu 0.008 60871.1 5116 5117 871-893 AD- CfsasGfaAfaGfaGfdTGfuCfuCf(Agn)UfcUfuAfL96 usAfsaGfaUfgAfgAfcacUfcdTuUfcUfgsgsu 0.004 60875.1 5118 5119 871-893 AD- CfsasGfaAfaGfaGfdTGfuCfuCf(Agn)UfscUfsuAfsL96 usAfsaGfaUfgAfgAfcacUfcdTuUfcUfgsgsu 0.001 60879.1 5120 5121 871-893 AD- CfsasGfaAfaGfaGfdTGfuCfuCf(Agn)UfscusuAfsL96 usAfsAfGfaUfgAfgAfcacUfcdTuUfcUfgsgsu 0.004 60883.1 5122 5123 871-893 AD- CfsasGfaAfaGfaGfdTGfuCfuCfs(Agns)UfscUfsuAfsL96 usAfsaGfaUfgAfgAfcacUfcdTuUfcUfgsgsu 0.002 60854.1 5124 5125 871-893 AD- CfsasGfaAfaGfaGfdTGfuCfuCfs(Agns)UfscusuAfsL96 usAfsAfGfaUfgAfgAfcacUfcdTuUfcUfgsgsu 0.002 60859.1
[0962] As is shown in the table above, a number of duplexes showed efficacy in suppressing ALAS1 mRNA. The following duplexes had an IC50 of less than 0.01 nM: AD-60879, AD-60859, AD-60863, AD-60854, AD-60882, AD-60874, AD-60883, AD-60875, AD-60501, AD-60593, AD-60853, AD-60877, AD-60878, AD-60871, and AD-60873. The following duplexes had an IC50 of less than 0.02 nM: AD-60879, AD-60859, AD-60863, AD-60854, AD-60882, AD-60874, AD-60883, AD-60875, AD-60501, AD-60593, AD-60853, AD-60877, AD-60878, AD-60871, AD-60873, AD-60489, AD-60592, AD-60894, AD-60489, AD-60870, AD-60862, AD-60858, AD-60592, AD-60591, AD-60872, AD-60866, AD-60905, AD-60857, AD-60513, and AD-60861. The following duplexes had an IC50 of less than 0.05 nM: AD-60879, AD-60859, AD-60863, AD-60854, AD-60882, AD-60874, AD-60883, AD-60875, AD-60501, AD-60593, AD-60853, AD-60877, AD-60878, AD-60871, AD-60873, AD-60489, AD-60592, AD-60894, AD-60489, AD-60870, AD-60862, AD-60858, AD-60592, AD-60591, AD-60872, AD-60866, AD-60905, AD-60857, AD-60513, AD-60861, AD-60583.2, AD-60902.1, AD-60881.1, AD-60519.2, AD-60507.2, AD-60591.3, AD-60851.1, AD-60896.1, and AD-60537.2.
Example 29: In Vivo Structure Activity Relationship Studies of AD-60489
[0963] Derivatives of the AD-60489 parent siRNA were generated and screened in vivo in rats.
[0964] In Vivo Screen 1 of AD-60489 Derivatives
[0965] The sequences of the siRNAs that were screened are provided in the table below.
TABLE-US-00037 TABLE 36 Sequences of ALAS1 siRNA Duplexes Target SEQ sites of SEQ ID antisense ID NO: sequence NO: (anti- on Duplex (sense) sense) NM_000688.4 Name Sense Sequence (5′-3′) Antisense Sequence (5′-3′) 5126 5127 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCfaUfcU usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 60489 fuAfL96 5128 5129 871-893 AD- CfsasGfaAfaGfaGfuGfuCfuCfaucuuA usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsg 60501.2 L96 su 5130 5131 871-893 AD- csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsg 60519.2 su 5132 5133 871-893 AD- csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 60901.1 5134 5135 871-893 AD- CfsasGfaAfaGfaGfuGfuCfuCfaucuu usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 60495.2 AL96 5136 5137 871-893 AD- CfsasGfaAfaGfaGfuGfuCfuCfaucuu usAfsAfGfadTgAfgAfcAfcdTcuudTcugsgsu 60900.1 AL96 5138 5139 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCfaUfc usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsg 60935.1 UfuAL96 su 5140 5141 871-893 AD- csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsAfGfadTgAfgAfcAfcdTcuudTcugsgsu 60905.1
[0966] Rats were administered a single dose of 3 mg/kg of siRNA. At 5 days following administration of the siRNA, mRNA measurements of rat ALAS1 (rALAS1) mRNA and rat GAPDH (rGAPDH) mRNA were made using bDNA assay, and tissue levels of drug (siRNA) were determined using qPCR.
[0967] As is shown in
[0968] At least for the duplexes AD-60489, AD-60519, and AD-60901, efficacy correlated with liver levels of the siRNA (see
[0969] In Vivo Screen 2 of AD-60489 Derivatives
[0970] The sequences of the siRNAs that were screened are provided in the table below.
TABLE-US-00038 TABLE 37 Sequences of ALAS1 siRNA Duplexes Target SEQ sites of SEQ ID antisense ID NO: sequence NO: (anti- on Duplex (sense) sense) NM_000688.4 Name Sense Sequence (5′-3′) Antisense Sequence (5′-3′) 5142 5143 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCfaUfcU usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 60489 fuAfL96 5144 5145 871-893 AD- CfsasGfaAfaGfaGfdTGfuCfuCf(Agn)U usAfsaGfaUfgAfgAfcacUfcdTuUfcUfgsgsu 60879 fscUfsuAfsL96 5146 5147 871-893 AD- CfsasGfaAfaGfaGfdTGfuCfuCf(Agn)U usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsg 61190 fscUfsuAfsL96 su 5148 5149 871-893 AD- CfsasGfaAfaGfaGfdTGfuCfuCf(Agn)U usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsg 61191 fscUfsuAfsL96 su 5150 5151 871-893 AD- csasgaaaGfAfGfugucuca(Tgn)cuuaL96 usAfsaGfadTgAfgAfcAfcdTcuudTcugsgsu 60877 5152 5153 871-893 AD- csasgaaaGfAfGfugucuca(Tgn)cuuaL96 usAfsaGfadTgAfgAfcAfcdTcuudTcugsgsu 61192 5154 5155 871-893 AD- csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsaGfadTgAfgAfcAfcdTcuudTcugsgsu 60865 5156 5157 871-893 AD- csasgaaaGfAfGfugucuca(Tgn)cuuaL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 60861 5158 5159 871-893 AD- csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsaGfadTgAfgAfcAfcdTcuudTcugsgsu 60876 5160 5161 871-893 AD- csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsaGfaUfgAfgAfcacUfcdTuUfcUfgsgsu 61193 5162 5163 871-893 AD- csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsg 60519 su
[0971] Rats were administered a single dose of 2.5 mg/kg of siRNA. At 5 days following administration of the siRNA, mRNA measurements of rat ALAS1 (rALAS1) mRNA and rat GAPDH (rGAPDH) mRNA were made using bDNA assay.
[0972] As is shown in
Example 30: Multidosing Improves Potency
[0973] To investigate the effects of administering multiple doses of siRNA, rats (n=3 per group) were administered PBS or an siRNA (AD-58632, AD-60925, AD-60419, AD-60445, AD-60892, AD-60489, AD-60519, or AD-60901) at a dose of 2.5 mg/kg twice per week for 2 weeks. The levels of rat ALAS1 (rALAS1) mRNA and rat GAPDH (rGAPDH) mRNA were assessed using bDNA assay.
TABLE-US-00039 TABLE 38 Sequences of ALAS1 siRNA Duplexes Target SEQ sites of SEQ ID antisense ID NO: sequence NO: (anti- on Duplex (sense) sense) NM_000688.4 Name Sense Sequence (5′-3′) Antisense Sequence (5′-3′) 5164 5165 873-895 AD- GfsasAfaGfaGfuGfUfCfuCfaUfc asAfsgAfaGfaUfgAfgacAfcUfcUfuUfcsusg 58632 UfuCfuUfL96 5166 5167 873-895 AD- GfsasAfaGfAfGfuGfucucauc(Tgn) asAfsGfAfaGfaUfgAfgAfcAfcUfcUfuUfcsu 60925 ucuuL96 sg 5168 5169 873-895 AD- GfsasAfaGfAfGfuGfdTcucaucuu asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 60419 cuuL96 5170 5171 873-895 AD- GfsasAfaGfAfGfuGfucucauc(Tgn) asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 60445 ucuuL96 5172 5173 873-895 AD- gsasaagaGfuGfuCfucaucuucuuL96 asAfsGfAfaGfaugAfgAfcAfcucuuucsusg 60892 5174 5175 871-893 AD- CfsasGfaAfaGfaGfUfGfuCfuCfaUf usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 60489 cUfuAfL96 5176 5177 871-893 AD- csasgaaaGfaGfuGfuCfuCfaucuua usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsg 60519.2 L96 su 5178 5179 871-893 AD- csasgaaaGfaGfuGfuCfuCfaucuua usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 60901.1 L96
[0974] As is shown in
Example 31: Multidosing Studies with AD-60519 and AD-60489
[0975] The therapeutic efficacy of AD-60519 was investigated in a rat AIP model. The experimental design is shown in
[0976] The results are shown in
[0977] In further studies using the same experimental design but in a mouse model (see schematic at top of
[0978] Because treatments in this example were administered prior to the phenobarbital induction, these results indicate that AD-60519 and AD-60489 have prophylactic effects.
Example 32: Further siRNA Sequences
[0979] The following AD-58632 derivative (Table 39) and AD-60489 derivative (Table 40) siRNA sequences have also been generated.
TABLE-US-00040 TABLE 39 AD-58632 derivative sequences Target SEQ sites of SEQ ID antisense ID NO: sequence NO: (anti- on Duplex (sense) sense) NM_000688.4 Name Sense Sequence (5′-3′) Antisense Sequence (5′-3′) 5180 5181 873-895 AD- GfsasAfaGfAfGfuGfucucauc(Tgn) asAfsgAfaGfaugAfgAfcAfcucuuucsusg 60802 ucuuL96 5182 5183 873-895 AD- GfsasAfaGfAfGfuGfucucauc(Tgn) asAfsgAfaGfaugAfgacAfcucuuucsusg 60824 ucuuL96 5184 5185 873-895 GfsasAfaGfAfGfuGfucucauc(Tgn) asAfsgAfaGfaUfgAfgAfcAfcUfcUfuUf ucuuL96 csusg 5186 5187 873-895 AD- GfsasAfaGfAfGfuGfdTcucaucuucuuL96 asAfsgAfaGfaugAfgAfcAfcucuuucsusg 60843 5188 5189 873-895 AD- GfsasAfaGfAfGfuGfdTcucaucuucuuL96 asAfsgAfaGfaugAfgacAfcucuuucsusg 60847 5190 5191 873-895 GfsasAfaGfAfGfuGfdTcucaucuucuuL96 asAfsgAfaGfaUfgAfgAfcAfcUfcUfuUf csusg 5192 5193 873-895 AD- GfsasAfaGfaGfuGfuCfuCfaucuuCfuuL96 asAfsgAfaGfaugAfgAfcAfcucuuucsusg 60819 5194 5195 873-895 AD- GfsasAfaGfaGfuGfuCfuCfaucuuCfuuL96 asAfsgAfaGfaugAfgacAfcucuuucsusg 60823 5196 5197 873-895 GfsasAfaGfaGfuGfuCfuCfaucuuCfuuL96 asAfsgAfaGfaUfgAfgAfcAfcUfcUfuUf csusg 5198 5199 873-895 GfsasAfaGfaGfuGfdTCfuCfaUfc(Tgn) asAfsgAfaGfaugAfgAfcAfcucuuucsusg uCfuUfL96 5200 5201 873-895 GfsasAfaGfaGfuGfdTCfuCfaUfc(Tgn) asAfsgAfaGfaugAfgacAfcucuuucsusg uCfuUfL96 5202 5203 873-895 GfsasAfaGfaGfuGfdTCfuCfaUfc(Tgn) asAfsgAfaGfaUfgAfgAfcAfcUfcUfuUf uCfuUfL96 csusg 5204 5205 873-895 AD- gsasaagaGfuGfuCfucaucuucuuL96 asAfsgAfaGfaugAfgAfcAfcucuuucsusg 60853 5206 5207 873-895 AD- gsasaagaGfuGfuCfucaucuucuuL96 asAfsgAfaGfaugAfgacAfcucuuucsusg 60839 5208 5209 873-895 gsasaagaGfuGfuCfucaucuucuuL96 asAfsgAfaGfaUfgAfgAfcAfcUfcUfuUf csusg 5210 5211 873-895 gsasaagaGfuGfdTCfucaucuucuuL96 asAfsgAfaGfaugAfgAfcAfcucuuucsusg 5212 5213 873-895 gsasaagaGfuGfdTCfucaucuucuuL96 asAfsgAfaGfaugAfgacAfcucuuucsusg 5214 5215 873-895 gsasaagaGfuGfdTCfucaucuucuuL96 asAfsgAfaGfaUfgAfgAfcAfcUfcUfuUf csusg
TABLE-US-00041 TABLE 40 AD-60489 derivative sequences Target SEQ sites of SEQ ID antisense ID NO: sequence NO: (anti- on Duplex (sense) sense) NM_000688.4 Name Sense Sequence (5′-3′) Antisense Sequence (5′-3′) 5216 5217 871-893 CfsasGfaAfaGfaGfdTGfuCfuCf(Agn) usAfsaGfadTgAfgAfcAfcdTcuudTcugsgsu UfscUfsuAfsL96 5218 5219 871-893 AD- CfsasGfaAfaGfaGfdTGfuCfuCf(Agn) usAfsaGfaUfgAfgAfcacUfcdTuUfcUfgsgsu 60879 UfscUfsuAfsL96 5220 5221 871-893 CfsasGfaAfaGfaGfdTGfuCfuCf(Agn) usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsg UfscUfsuAfsL96 su 5222 5223 871-893 CfsasGfaAfaGfaGfdTGfuCfuCf(Agn) usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu UfscUfsuAfsL96 5224 5225 871-893 AD- csasgaaaGfAfGfugucuca(Tgn)cuuaL96 usAfsaGfadTgAfgAfcAfcdTcuudTcugsgsu 60877 5226 5227 871-893 csasgaaaGfAfGfugucuca(Tgn)cuuaL96 usAfsaGfaUfgAfgAfcacUfcdTuUfcUfgsgsu 5228 5229 871-893 AD- csasgaaaGfAfGfugucuca(Tgn)cuuaL96 usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsg 60865 su 5230 5231 871-893 AD- csasgaaaGfAfGfugucuca(Tgn)cuuaL96 usAfsaGfaUfgAfgAfcacUfcUfuUfcUfgsgsu 60861 5232 5233 871-893 AD- csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsaGfadTgAfgAfcAfcdTcuudTcugsgsu 60876 5234 5235 871-893 csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsaGfaUfgAfgAfcacUfcdTuUfcUfgsgsu 5236 5237 871-893 AD- csasgaaaGfaGfuGfuCfuCfaucuuaL96 usAfsAfGfaUfgAfgAfcAfcUfcUfuUfcUfgsg 60519 su
Example 33: Further Multidose Studies with AD-60519
[0980] The therapeutic efficacy of AD-60519 was investigated in a rat AIP model like that used in Example 31. The experimental design is shown in
[0981] The results are shown in
[0982] Repeated weekly doses of AD-60519 were effective in suppressing ALAS1 mRNA expression and in reducing elevated levels of ALA and PBG associated with induced acute attacks in a rat AIP model. These treatment effects were dose dependent. These results illustrate that AD-60519 can act prophylactically when dosed prior to an attack.
Example 34: Multidose Effects of ALAS1 siRNA GalNAc Conjugates in Non-Human Primates
[0983] The effects of ALAS1 siRNA GalNAc conjugates in suppressing liver ALAS1 mRNA and circulating ALAS1 mRNA was investigated in a non-human primate (NHP) study. The GalNAc conjugates AD-58632, AD-60519, AD-61193, and AD-60819 were employed. The study design is shown in Table 41 and in
TABLE-US-00042 TABLE 41 NHP study design Dose Dose Dose Test Group Level Conc Dose Dose Volume Dose Article # N (mg/kg) (mg/mL) Frequency Days (mL/kg) Route AD-58632 1 3 2.5 1.25 QDx5 WK1, 1, 2, 3, 4, 2 SC BIW WK2-4 5, 8, 11, AD-60519 2 3 1.25 0.625 QDx5 WK1, 15, 18, BIW WK2-4 22, 25 3 3 2.5 1.25 QDx5 WK1, BIW WK2-4 4 3 2.5 1.25 QDx5 WK1, 1, 2, 3, 4, QW WK2-4 5, 11, 18, 5 3 5 2.5 QDx5 WK1, 25 QW WK2-4 AD-61193 6 3 2.5 1.25 QDx5 WK1, 1, 2, 3, 4, BIW WK2-4 5, 8, 11, 15, 18, 22, 25 AD-60819 7 3 2.5 1.25 QDx5 WK1, 1, 2, 3, , BIW WK2-4 5, 8, 11, 15, 18, 22, 25
[0984] Each group received multiple subcutaneous doses of an ALAS1 siRNA GalNAc conjugate at a dose volume of 2 mg/ml. Group 1 (n=3) received 2.5 mg/kg of 1.25 mg/ml AD-58632 on days 1, 2, 3, 4, 5, 8, 11, 15, 18, 22, and 25. Group 2 (n=3) received 1.25 mg/kg of 0.625 mg/ml AD-60519 on 1, 2, 3, 4, 5, 8, 11, 15, 18, 22, and 25. Group 3 (n=3) received 2.5 mg/kg of 1.25 mg/ml AD-60519 on days 1, 2, 3, 4, 5, 8, 11, 15, 18, 22, and 25. Group 4 (n=3) received 2.5 mg/kg of 1.25 mg/ml AD-60519 on days 1, 2, 3, 4, 5, 11, 18, and 25. Group 5 (n=3) received 5 mg/kg of 2.5 mg/ml AD-60519 on days 1, 2, 3, 4, 5, 11, 18, and 25. Group 6 (n=3) received 2.5 mg/kg of 1.25 mg/ml AD-61193 on days 1, 2, 3, 4, 5, 8, 11, 15, 18, 22, and 25. Group 7 (n=3) received 2.5 mg/kg of 1.25 mg/ml of AD-60819 on days 1, 2, 3, 4, 5, 8, 11, 15, 18, 22, and 25.
[0985] Serum samples for the circulating extracellular RNA detection (cERD) assay (see Example 21) were collected on days −3, 7, 13, 21, 27, 39, 46, and 60 (in
Suppression of ALAS1 mRNA Levels in Liver
[0986] The liver ALAS 1 mRNA levels at study day 21 are shown in
[0987] These results presented in
Suppression of Circulating Extracellular ALAS1 mRNA Levels
[0988]
[0989] The most pronounced suppression of circulating ALAS1 mRNA (maximal silencing of nearly 80%) was observed in Group 3 (2.5 mg/kg AD-60519 QDx5, BIWx3) and Group 5 (5 mg/kg AD-60519, QDx5, QWx3). Group 2 (1.25 mg/kg AD-60519, QDx5, BIWx3), Group 4 (2.5 mg/kg AD-60519, QDx5, QWx3), Group 7 (2.5 mg/kg AD-60819, QDx5, BIWx3), and Group 6 (2.5 mg/kg AD-61193, QDx5, BIWx3) also showed excellent suppression, with maximal silencing (day 27) of greater than 50%. In group 1, notable silencing (more than 30% on day 27) was also achieved.
[0990] These results are consistent with the liver ALAS1 mRNA results and confirm the potent activity of AD-60519. At dose levels as low as 1.25 mg/kg, AD-60519 provided 65-75% silencing.
Correlation Between Circulating and Liver ALAS1 mRNA Levels
[0991]
Example 35: Rat Single Dose Study of AD-60519 and AD-60589 Using a Urine cERD Assay to Monitor the Duration of ALAS1 mRNA Suppression
[0992] A single dose study was conducted in rats using the ALAS1 siRNA GalNAc conjugates AD-60489 and AD-60519. The efficacy of these GalNAc conjugates in inhibiting expression of ALAS1 mRNA was monitored using assessments of urine with a circulating extracellular RNA detection assay. The assay was similar to the assay used in Examples 21 and 34, except that urine samples were used. The urine samples were lyophilized to concentrate it. Lyophilized urine was resuspended in 4 ml dH2O and vortexed. Then the sample was centrifuged at 4,000×g for 10-20 minutes to pellet any debris. Remaining steps were similar to those described in Example 21.
[0993] Groups of rats were administered a single dose of 10 mg/kg of AD-60489 or AD-60519. The normalized levels of ALAS1 mRNA at various timepoints throughout the study are shown in
[0994] As can be seen from the results shown in
Example 36: Pharmacological Effects of AD-60519 in Non-Human Primates
[0995] A further study of the effects of the ALAS1 siRNA GalNAc conjugate AD-60519 was conducted in a non-human primates. The study investigated the effect of weeky versus biweekly dosing, use of a loading dose versus no loading dose, and the kinetics of ALAS1 mRNA silencing following a single dose. The design of the study is shown in Table 42 and in
TABLE-US-00043 TABLE 42 Pharmacology Study Design for Study with AD-60519 Dose Material Dose Group Level Dose Needs Dose Vol Dose Conc Dose # N (mg/kg) Frequency (mg)* (mL/kg) Days (mg/mL) Route 1 3 2.5 QWx8Wks 210 0.125 1, 8, 15, 20 SC 2 3 5 QWx8Wks 420 0.25 22, 29, 36, 43, 50 3 3 Load- Load D1-D3, 525 0.25/25 1, 2, 3, QDx3@5 mg/ QWx7Wks 8, 15, kg, 22, 29, maint- 36, 43, 5 mg/kg 50 4 3 Load- Load D1-D3, 270 0.25/0.125 QDx3@5 mg/ QWx7Wks kg, maint- 2.5 mg/kg 5 3 5 BIWx8Wks 924 0.25 1, 4, 8, 11, 15, 18, 22 25, 29, 32, 36, 39, 43, 46, 50, 53 6 3 1 Single Dose 12 0.05 1 7 3 10 Single Dose 116 0.5 1
[0996] Each group received one or more subcutaneous doses of AD-60519 as provided in Table 42. Group 1 (n=3) received 2.5 mg/kg at a dose volume of 0.125 ml/kg once per week for 8 weeks (doses were administered on dose days 1, 8, 15, 22, 29, 36, 43, and 50). Group 2 (n=3) received 5 mg/kg at a dose volume of 0.25 mg/ml once per week for 8 weeks (doses were administered on dose days 1, 8, 15, 22, 29, 36, 43, and 50). Group 3 (n=3) received a loading dose of 5 mg/kg at a dose volume of 0.25 ml/kg once per day for three days followed by a maintenance dose of 5 mg/kg at a dose volume of 0.25 ml/kg once per week for 7 weeks (doses were administered on days 1, 2, 3, 8, 15, 22, 29, 36, 43, and 50). Group 4 (n=3) received a loading dose of 5 mg/kg at a dose volume of 0.25 ml/kg once per day for three days followed by a maintenance dose of 2.5 mg/kg at a dose volume of 0.125 ml/kg once per week for 7 weeks (doses were administered on days 1, 2, 3, 8, 15, 22, 29, 36, 43, and 50). Group 5 (n=3) received 5 mg/kg at a dose volume of 0.25 ml/kg twice per week for 8 weeks (doses were administered on dose days 1, 4, 8, 11, 15, 18, 22, 25, 29, 32, 36, 39, 43, 46, 50, and 53). Group 6 (n=3) received a single dose of 1 mg/kg at a dose volume of 0.05 ml/kg on day 1. Group 7 (n=3) received a single dose of 10 mg/kg at a dose volume of 0.5 ml/kg on day 1.
[0997] Serum samples (listed as “PD draws” in
TABLE-US-00044 TABLE 43 Sample Collection Schedule Urine for exploratory Serum for mRNA Detection Liver Biopsy mRNA Detection ** Plasma for PK Gps 1-4 Day −3, Groups Day Gps 1-5 Day −3, and Gp7 Day −3, and Days 1-5 24* Days 24*, and Day 5, 10, 17, 52 1 @ 24, 31, 38, 0.25, 0.5, 45, 52, 57, 1, 2, 4, 8, 64, 78, 92 12 hours Gps 5 Day −3, Groups Day 4* and Days and Days 6-7 2, 3, 4, 5, 3, 10, 17, 6, 8, 9, 24, 31, 38, 15, 22, 45, 52, 60, 29, 36 67, 81, 95 Gps 6-7 Day −3, Gps 6-7 Day −3, and and Days Days 4*, 36 2, 4, 6, 9, 15, 22, 29, 36 *All blood samples and urine were collected prior to the liver biopsy **First Morning Urine collection
[0998] The liver ALAS1 mRNA results are shown in
[0999] The serum ALAS1 mRNA results through day 22 are shown in
[1000] Results showing the kinetics of ALAS1 mRNA silencing after a single dose are shown in
[1001] The full time course of the serum ALAS mRNA up to 8 weeks after administration of the AD-60519 is shown in
Example 37: Production of an siRNA Drug Product
[1002] ALN-60519 (
[1003] AD-60519, also referred to herein as ALN-60519, was formulated as a solution for Injection for subcutaneous use, referred to herein as ALN-AS1. ALN-60519 was dissolved in water for injection (WFI) and the pH was adjusted (target 7.0). The concentration of ALN-60519 was determined and adjusted by adding WFI. The solution with a final concentration of approximately 200 mg/mL was then filter sterilized and filled into 2 mL Type I glass vials. A fill volume of approximately 0.55 mL was chosen to permit complete withdrawal of 0.5 mL of drug product.
Example 38: Measurement of Serum or Urine ALAS1 mRNA Levels in AIP Patients or Healthy Volunteers Using cERD Method
[1004] Non-human primate pharmacology studies with ALN-AS1 indicated that the circulating extracellular RNA detection (cERD) method for measuring the ALAS1 mRNA in serum or urine was robust and reproducible. The cERD assay was also used to measure ALAS1 mRNA levels in serum and urine from AIP patients and healthy volunteers. Serum ALAS1 mRNA levels were generally increased in AIP patients relative to healthy volunteers, consistent with the role ALAS1 induction plays in disease pathophysiology (
Example 39: Exemplary Clinical Studies
[1005] A human study can be conducted to determine the safety and tolerability of ALN-AS1 when administered as a single dose and multiple doses to AIP patients that are asymptomatic high excreters (ASHE) (patients who have elevated levels of ALA and/or PBG, as described herein) or AIP patients who have recurrent attacks.
[1006] Secondary objectives include the characterization of plasma and urine PK for ALN-AS1 as well as post-dose assessment of the impact of ALN-AS1 on both plasma and urinary ALA and PBG levels. The cERD assay that measures mRNA in exosomes is used to measure serum (or plasma) and urinary 5-aminolevulinate synthase (ALAS-1 mRNA).
[1007] In the asymptomatic high excreters, ALN-AS1 is administered at single doses, e.g., at 0.1, 0.35 1.0, or 2.5 mg/kg, or in repeated weekly doses, e.g., of 1 and 2.5 mg/kg, for several weeks (e.g., for 4 weeks). As a comparison, a control (e.g., placebo) treatment is administered.
[1008] The safety, pharmacokinetics and effects of the drug on ALA and PBG levels is assessed. A dose of ALN-AS1 that lowers ALA and PBG to within the normal reference range (e.g., a dose that normalizes ALA and/or PBG to levels below 2× the upper reference value) can be selected for subsequent studies, e.g., in AIP patients.
[1009] In the AIP patients, the attack rate and baseline symptoms are assessed during a pre-dosing run-in period (e.g., of 12 weeks). Patients are administered ALN-AS1, e.g., at a dose of 1-2.5 mg/kg weekly. The safety, pharmacokinetics and effects of the drug on ALA and PBG levels are assessed. In addition, changes in attack number, heme use, pain medication use, and hospitalization are monitored.
EQUIVALENTS
[1010] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.