ROOM TEMPERATURE NUCLEIC ACID AMPLIFICATION REACTION

Abstract

The present invention provides an application of a cold-active bacteriophage protein in a room temperature nucleic acid amplification reaction; the cold-active bacteriophage is selected from vB_EcoM-VR5, vB_EcoM-VR7, and vB_EcoM-VR20,vB_EcoM-VR25, or vB_EcoM-VR26, and the cold-active bacteriophage protein is a uvsX protein, a uvsY protein and a gp32 protein and/or a variant protein having corresponding functions. Preferably, the uvsX protein and the variant protein thereof are selected from any sequence of SEQ ID Nos. 1-23 or 30, the uvsY protein and the variant protein thereof are selected from any sequence of SEQ ID Nos.27-29 or 32, and the gp32 protein and the variant protein thereof are selected from any sequence of SEQ ID Nos.24-26 or 31. The present invention further provides a room temperature nucleic acid amplification reaction system containing the cold-active bacteriophage protein.

Claims

1-10. (canceled)

11. A room temperature nucleic acid amplification reaction system, wherein the system comprises: a cold-active bacteriophage uvsX protein, a uvsY protein or a gp32 protein; and/or a variant protein having the same function with the cold-active bacteriophage uvsX protein, the cold-active bacteriophage uvsY protein or the cold-active bacteriophage gp32 protein respectively.

12. The room temperature nucleic acid amplification reaction system according to claim 11, wherein the cold-active bacteriophage uvsX protein is selected from any sequence of SEQ ID Nos. 21-23 and 30 or a sequence having 98% and more homology to the above sequence.

13. The room temperature nucleic acid amplification reaction system according to claim 11, wherein the uvsX variant protein is selected from any sequence of SEQ ID Nos. 1-20 or a sequence having 98% and more homology to the above sequence.

14. The room temperature nucleic acid amplification reaction system according to claim 11, wherein the cold-active bacteriophage uvsY protein is selected from any sequence of SEQ ID Nos. 27-29 and 32 or a sequence having 98% and more homology to the above sequence.

15. The room temperature nucleic acid amplification reaction system according to claim 11, wherein the cold-active bacteriophage gp32 protein is selected from any sequence of SEQ ID Nos. 24-26 and 31 or a sequence having 98% and more homology to the above sequence.

16. The room temperature nucleic acid amplification reaction system according to claim 11, wherein the system further comprises a polymerase, a nuclease, dNTP, a crowding agent, an energy substance, a creatine kinase and/or a salt ion.

17. The room temperature nucleic acid amplification reaction system according to claim 16, wherein the polymerase is selected from any one or a combination of more than one of an Escherichia coli polymerase klenow fragment (exo-), a Staphylococcus aureus polymerase I klenow fragment (exo-), a Bacillus subuilis polymerase I klenow (exo-), a Pseudomonas fluorescens polymerase I klenow (exo-), and variants or klenow fragments of these enzymes.

18. The room temperature nucleic acid amplification reaction system according to claim 16, wherein the crowding agent is selected from any one or a combination of more than one of polyethylene glycol, polyvinyl alcohol, dextran or polysucrose.

19. The room temperature nucleic acid amplification reaction system according to claim 18, wherein the polyethylene glycol is selected from one or more of PEG1450, PEG3000, PEG8000, PEG10000, PEG14000, PEG20000, PEG25000 and PEG30000.

20. The room temperature nucleic acid amplification reaction system according to claim 16, wherein the energy system is selected from a combination of ATP or ATP, phosphocreatine or creatine kinase.

21. The room temperature nucleic acid amplification reaction system according to claim 16, wherein the salt ion is selected from any one or a combination of more than one of Tris, magnesium ion or potassium ion.

22. The room temperature nucleic acid amplification reaction system according to claim 16, wherein in the system, the polymerase is the Staphylococcus aureus polymerase I klenow fragment (exo-), the Bacillus subtilis polymerase I klenow fragment (exo-), the Pseudomonas fluorescens polymerase I klenow fragment (exo-), or a combination thereof.

23. The room temperature nucleic acid amplification reaction system according to claim 16, wherein in the system, the creatine kinase is preferably a variant on which G in position 268 is mutated into N.

24. The room temperature nucleic acid amplification reaction system according to claim 11, wherein in the system, the system has a reaction temperature of 20-40° C.

25. The room temperature nucleic acid amplification reaction system according to claim 11, wherein a reaction temperature is 25-37° C., and a reaction time is 20-40 min.

26. The room temperature nucleic acid amplification reaction system according to claim 11, wherein the system further comprises a primer sequence and a template sequence.

27. The room temperature nucleic acid amplification reaction system according to claim 11, wherein the system further comprises a fluorescent probe sequence.

28. The room temperature nucleic acid amplification reaction system according to claim 12, wherein the protein sequence is encoded by a corresponding nucleotide sequence.

29. A protein as shown in any one of SEQ ID Nos. 1-20 or a protein having the same function therewith and 98% and more homology thereto.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0023] FIG. 1 shows efficiency of plating tests VR5, VR7, VR20 and T4 (control) at different temperatures.

[0024] FIG. 2 shows phylogenetic analysis of genome Geneious v5.5.

[0025] FIG. 3 shows uvsX sequence alignment between different species.

[0026] FIG. 4 is a curve graph showing isothermal amplification performed by an Enterobacteria phage vB_EcoM_VR5 amplification system.

[0027] FIG. 5 shows a curve graph showing isothermal amplification performed by an Enterobacteria phage vB_EcoM_VR7 amplification system.

[0028] FIG. 6 shows a curve graph showing isothermal amplification performed by a mixed protein amplification system derived from different species.

[0029] FIG. 7 shows electrophoretogram of an amplified product obtained by low temperature amplification by means of Enterobacteria phage vB_EcoM_VR5 amplification system and RPA (Recombinase polymerase amplification ) technology; strips 1, 2 and 3 are results respectively amplified by means of a RPA amplification reagent (TALQBAS01) at 20° C.; strips 4, 5 and 6 are results respectively amplified by means of a RPA amplification reagent (TALQBAS01) at 25° C.; strips 7, 8 and 9 are results respectively amplified by means of an Enterobacteria phage vB_EcoM_VR5 bacteriophage protein at 20° C.; and strips 10, 11 and 12 are results respectively amplified by means of an Enterobacteria phage vB_EcoM_VR5 bacteriophage at 25° C.

[0030] FIG. 8 shows a curve graph showing isothermal amplification performed by a variant-type creatine kinase and wild-type creatine kinase amplification system.

[0031] FIG. 9 shows a curve graph showing isothermal amplification performed by different polymerases in the reaction system.

[0032] FIG. 10 shows a detection curve graph of sensitivity.

[0033] FIG. 11 is a curve graph showing isothermal amplification performed by different uvsX variants respectively in the reaction system.

[0034] FIG. 12 shows influences of different temperatures on the amplification efficiency of a cold-active bacteriophage protein amplification system.

[0035] FIG. 13 is a curve graph showing isothermal amplification of a cell mycoplasma-contaminated sample detected by 450ng/uVRX_Variant1, 550ng/uI VR5G_NHis, 60ng/uI VR5Y_NHisamplification system.

DETAILED DESCRIPTION OF THE EMBODIMENTS

[0036] To describe the objective, technical solution and advantages of the present invention more clearly and apparently, the present application will be further described specifically by reference to the drawings and detailed embodiments. The following examples are only used to describe the present invention, but not intended to limit the scope of the present invention.

Example I Construction of a Recombinant Protein Expression Vector, Protein Expression and Purification

[0037] The corresponding gene sequences were designed and synthesized respectively according to the NCBI genome sequences (Enterobacteria phage vB_EcoM_VR5, Accession: KP007359.1; vB_EcoM-VR7, Accession: HM563683.1; vB_EcoM_VR20, Accession: KP007360.1; vB_EcoM_VR25, Accession: KP007361.1; vB_EcoM_VR26, Accession: KP007362.1), and cloned onto a pET22b expression vector respectively by double enzyme digestion Nde I and EcoR I, where if a C terminal of the corresponding protein of the gene sequence was fused with 6 histidine-tag, gene+Chis was named, if an N terminal was was fused with 6 histidine-tag, gene+NHis was named; gene number was added simultaneously when the amino acid sequences were consistent among different virus strains, e.g., VR7_25_26Y_CHis, showing that the uvsY amino acid sequences of the three vB_EcoM_VR7, vB_EcoM_VR25 and vB_EcoM_VR26 were consistent, and the protein corresponding to the number was the protein with the addition of 6XHis tags on the C terminal. The expressed proteins were constructed and synthesized, including VR5X_NHis, VR7_25X_NHis, VR20_26X_NHis, VR5G_NHis, VR7G_NHis, VR25G_NHis, VR5Y_NHis, VR7_25_26Y_NHis, VR20Y_NHis, VR7_25X_CHis, VR7G_CHis, VR7_25_26Y_CHis and other corresponding plasmid vectors. A host cell BL21(DE3) was transformed according to molecular cloning technique, and induced with IPTG for expression, then repeatedly frozen and lyzed, and purified [28] by a Ni column to obtain a high-purity protein, and the high-purity protein was subjected to amplification test.

Example II Construction of an Enterobacteria Phage vB_EcoM VR5 Amplification System

[0038] The reaction reagent and concentration thereof were as follows: 30 mMtris(hydroxymethyl) aminomethane-acetic acid buffer solution, 60 mM potassium acetate, 20 mM magnesium acetate, 2 mMdithiothreitol, 5% polyethylene glycol (molecular weight: 1450-20000), 3 mM ATP, 30 mM phosphocreatine, 90 ng/ulcreatine kinase, 200-600 ng/uI VR5X_NHis protein, 200-1000 ng/uI VR5G_NHis protein, 60 ng/uI VR5Y NHis protein, 8 Units Staphylococcus aureus polymerase I klenow fragment (exo-), 450 uMdNTP, 250 nM forward primer: peu-F:5′-GCGAACGGGTGAGTAACACGTATCCAATCT-3′ (SEQ ID NO. 39, 250 nM reverse primer: peu-R1:5′-AGCCATTACCTGCTAAAGTCATTCTTCCCAAA-3′ (SEQ ID NO. 40), and 10 ng/uI Mycoplasma pneumoniae genome DNA template, and the Sybr Green I had a final concentration of 0.4x. Reaction conditions were as follows: 20 uI, amplification temperature was 30° C. GenDx thermostatic fluorescence amplifier (specification: GS8) (http://www.gendx.cn/goods.php?id=64) was taken. The amplified result was real-timely detected by Sybr green I at the reaction endpoint. Amplification time: 30 min.

[0039] The amplified result was shown in FIG. 4.

[0040] S1: VR5G_NHis protein, 1000 ng/uI VR5X_NHis protein, 300 ng/ul

[0041] S2: VR5G_NHis protein, 800 ng/uI VR5X_NHis protein, 400 ng/ul

[0042] S3: VR5G_NHis protein, 600ng/uI VRSX_NHis protein, 300 ng/ul

[0043] S4: VR5G_NHis protein, 400 ng/uI VR5X_NHis protein, 200 ng/ul

[0044] S5: VR5G_NHis protein, 200 ng/uI VR5X_NHis protein, 600 ng/uI

[0045] VR5Y NHis protein, 60 ng/uI, and other reagent components were consistent in this example.

[0046] The result shows that low temperature protein may be amplified directed to a specific template and be chimeric onto double strands by Sybr Green I, then a fluorescence signal was gave out to read and obtain the amplification curve by the fluorescence signal. The low temperature protein had inconsistent amplification efficiency at different concentrations in the solution.

Example III Construction of an Enterobacteria Phage vB_EcoM VR7 Amplification System

[0047] The reaction reagent and concentration thereof were as follows: 100 mMtris(hydroxymethyl) aminomethane-acetic acid buffer solution, 120 mM potassium acetate, 15 mM magnesium acetate, 6 mMdithiothreitol, 6% polyethylene glycol (molecular weight: 1450-20000), 2 mM ATP, 40 mM phosphocreatine, 75 ng/ulcreatine kinase, 400 ng/uI VR7_25X_NHis or VR7_25X_CHis protein, 480 ng/uI VR7G_NHis or VR7G_CHis protein, 80 ng/uI VR7_25_26Y NHis or VR7_25_26Y_CHis protein, 8 Units Bacillus subtilis polymerase I klenow fragment (exo-), 450 uMdNTP, 50 ng/ulexo excision enzyme III, 250 nM forward primer ARMP-F, 250 nM reverse primer ARMP-R,120 nM fluorescent probe, about 25 ng/uI arginine mycoplasma genome DNA template, and primer and probe sequences were respectively as follows:

TABLE-US-00006 ARMP-F: (SEQ ID NO. 41) 5′-AGCATGTGGTTTAATTTGATGTTACGCGG-3′ ARMP-R:  (SEQ ID NO. 42) 5′-CCATGCACCATCTGTCACTCCGTTAACCTCCG-3′ ARMP-PB: (SEQ ID NO. 43) 5′-TGTTACGCGGAGAACCTTACCCAC(Fam-dT)(THF)T(BHQ1-dT) GACATCCTTCGCAAT-3′

[0048] Reaction conditions were as follows: 50 uI, amplification temperature was 40° C.

[0049] GenDx thermostatic fluorescence amplifier (specification: GS8) was taken. The amplified result was shown in FIG. 5.

[0050] S1/S2 reaction well: 400 ng/uI VR7_25X_NHis protein, 480 ng/uI VR7G_NHis protein; 80 ng/uI VR7_25_26Y_NHis protein.

[0051] S3/S4 reaction well: 400 ng/uI VR7_25X_CHis protein,480ng/uI VR7G_CHis protein, 80 ng/uI VR7_25_26Y_CHis protein.

[0052] S5 reaction well: 400 ng/uI VR7_25X_NHis protein, 480 ng/uI VR7G_CHis protein, 80 ng/uI VR7_25_26Y_NHis protein.

[0053] S6 reaction well: 400 ng/uI VR7_25X_CHis protein, 480 ng/uI VR7G_CHis protein, 80 ng/uI VR7_25_26Y_NHis protein.

[0054] The amplification result shows that even through the amplified fluorescence signal height value has certain differences, the detection threshold of the fluorescent amplification signal (the response time of the change of the fluorescence signal value might be monitored, TT, Threshold Time) was basically consistent. It is proved that the His protein tag has no obvious difference on the protein activity influence at the N-terminal or C-terminal of the fusion protein under the same protein concentration.

Example IV Construction of a Mixed Protein Amplification System Derived from Different Species

[0055] Protein sequences derived from five different virus strains were mixed to test whether the mixed protein derived from different strains could be amplified. The reaction reagent and concentration thereof were as follows: 50 mMtris(hydroxymethyl) aminomethane-acetic acid buffer solution, 80 mM potassium acetate, 20 mM magnesium acetate, 2 mMdithiothreitol, 6% polyethylene glycol (molecular weight: 1450-20000), 2 mM ATP, 30 mM phosphocreatine, 60 ng/ulcreatine kinase, 400 ng/uI VR5X_NHis, VR7_25X_NHis or VR20_26X_NHis protein, 600 ng/uI VR7G_NHis or VR25G_NHis protein, 55 ng/uI VR7_25_26Y_NHis or VR20Y_NHis protein, 8 Units Staphylococcus aureus polymerase I klenow fragment (exo-), 450 uMdNTP, 50 ng/ulexo excision enzyme III, 400 nM forward primer susF, 400 nM reverse primer susR,120 nM fluorescent probe susPB, about 15 ng/uI swine genome DNA template (or NTC as control, replaced by the same volume of ddH2O); the reaction conditions were as follows: 50 uI, amplification temperature: 36° C. GenDx thermostatic fluorescence amplifier (specification: GS8) was taken.

[0056] Primer and probe sequences were as follows:

TABLE-US-00007 susF: (SEQ ID NO. 44) 5′-AGAGATCGGGAGCCTAAATCTCCCCTCAATGG-3′ susR: (SEQ ID NO. 45) 5′-TCGAGATTGTGCGGTTATTAATGAGTCGTTTGGG-3′ susPB: (SEQ ID NO. 46) 5′-TGCCACAACTAGATACATCCACATGATTCAT(FAM-dT)(THF) CAA(BHQ1-dT)TACATCAATAAT(C3-SPACER)- 3′

[0057] The result was shown in FIG. 6. The amplification result proves that the uvsX protein, uvsY protein, and GP32 protein derived from different strains are added to the reaction according to a certain ratio; proteins from different sources may also be interacted to participate in primer binding and melting; under the action of polymerase, amplification is performed directed to a specific template. The protein concentration is consistent, but there are large differences in the amplification efficiency, which proves that proteins from different sources have inconsistent interaction ability.

TABLE-US-00008 S1/S2: VR5X_NHis VR25G_NHis VR7_25_26Y_NHis S3/S4: VR5X_NHis VR25G_NHis VR20Y_NHis S5/S6: VR7_25X_NHis VR25G_NHis VR7_25_26Y_NHis S7/S8: VR20_26X_NHis VR25G_NHis VR20Y_NHis

[0058] S1/S3/S5/S7 was a template with the addition of genome DNA. S2/S4/S6/S8 was NTC negative control. (FIG. 6a)

TABLE-US-00009 S1/S2: VR5X_NHis VR7G_NHis VR7_25_26Y_NHis S3/S4: VR5X_NHis VR7G_NHis VR20Y_NHis S5/S6: VR5X_NHis VR25G_NHis VR7_25_26Y_NHis S7/S8: VR20_26X_NHis VR25G_NHis VR7_25_26Y_NHis

[0059] S1/S3/S5/S7 was NTC negative control. S2/S4/S6/S8 was a template with the addition of genome DNA. (FIG. 6b)

Example V Influence of Different Temperatures on Amplification Efficiency Tested by the Enterobacteria Phage vB_EcoM VR5 Amplification System

[0060] The Enterobacteria phage vB_EcoM_VR5 amplification system was used to test influences of different temperatures on amplification efficiency, and subjected to parallel comparison of amplification efficiency at low temperature with recombinase polymerase amplification (RPA). Enterobacteria phage vB_EcoM_VR5 amplification reaction reagent and concentration thereof were as follows: 20 mMtris(hydroxymethyl) aminomethane-acetic acid buffer solution, 120 mM potassium acetate, 10 mM magnesium acetate, 8 mMdithiothreitol, 5% polyethylene glycol (molecular weight: 20000), 3 mM ATP, 20 mM phosphocreatine, 30 ng/ulcreatine kinase, 350 ng/uI VR5X_NHis protein, 500 ng/uI VR5G_NHis protein, 50 ng/uI VR5Y_NHis protein, 10 Units Bacillus subtilis polymerase I klenow fragment (exo-), 450 uMdNTP, 250 nM forward primer: peu-F:5′-GCGAACGGGTGAGTAACACGTATCCAATCT-3′(SEQ ID NO. 47), 250 nM reverse primer: peu-R1:5′-AGCCATTACCTGCTAAAGTCATTCTTCCCAAA-3′(SEQ ID NO. 48), and about 100 pg/uI plasmid template carrying a segment of Mycoplasma pneumoniae 16srDNA gene sequence; the reaction conditions were as follows: 50 uI, and the amplification temperature was respectively configured into two temperatures: 20° C. and 25° C. A reagent TwistDx (www.twistdx.co.uk, Cat.No.: TALQBAS01) was used as control for the RPA technology; and products are used in strict accordance with the instruction. Three repeats were configured to each test. The reaction temperature was controlled by a water bath kettle; 1 h after reaction, the protein was inactivated immediately at a high temperature of 80° C.; the amplified product was precipitated by alcohol and then recycled, and dissolved by 20 uI TE; 10 uI recovered product was taken to detect the amplification result by gel electrophoresis, as shown in FIG. 7. The sequence carrying the Mycoplasma pneumoniae 16srDNA segment gene was as follows:

TABLE-US-00010 (SEQ ID NO. 49) 5′-AATACTTTAGAGGCGAACGGGTGAGTAACACGTATCCAATCTACCT TATAATGGGGGATAACTAGTTGAAAGACTAGCTAATACCGCATAAGAAC TTTGGTTCGCATGAATCAAAGTTGAAAGGACCTGCAAGGGTTCGTTATT TGATGAGGGTGCGCCATATCAGCTAGTTGGTGGGGTAACGGCCTACCAA GGCAATGACGTGTAGCTATGCTGAGAAGTAGAATAGCCACAATGGGACT GAGACACGGCCCATACTCCTACGGGAGGCAGCAGTAGGGAATTTTTCAC AATGAGCGAAAGCTTGATGGAGCAATGCCGCGTGAACGATGAAGGTCTT TAAGATTGTAAAGTTCTTTTATTTGGGAAGAATGACTTTAGCAGGTAAT GGCTAGAGTTTGACTGTACCATTTTGAATAAGTGACGACTAACTATGTG CCAGCAGTCGCGGTAATACATAGGTCGCAAGCGTTATCCGGATTTATTG GGCGTAAAGCAAGCGCAGGCGGATTGAAAAGTCTGGTGTTAAAGGCAGC TGCTTAACAGTTGTATGCATTGGAAACTATTA-3′

[0061] The sequence was cloned onto a pUC57 vector, and the terminal sites were cut by an EcoR V enzyme.

[0062] It can be seen from the comparison of the reaction diagram that the amplification efficiency of the enzyme derived from low temperature species is obviously higher than that of T4 bacteriophage at low temperature of 20° C. and 25° C.

[0063] Based on the electrophoretic results of the amplification, the protein amplification efficiency derived from Enterobacteria phage vB_EcoM_VR5 bacteriophage is obviously superior to the amplification efficiency derived from T4 bacteriophage.

Example VI Influence of a Creatine Kinase Protein Variant Site on the Amplification Reaction

[0064] The reaction reagent and concentration thereof were as follows: 30 mMtris(hydroxymethyl) aminomethane-acetic acid buffer solution, 60 mM potassium acetate, 8 mM magnesium acetate, 4 mMdithiothreitol, 3% polyethylene glycol (molecular weight: 1450-20000), 3 mM ATP, 50 mM phosphocreatine, 30-50 ng/uI RM-CK/RM-CK_G268N/Carp-M1-CK, 360 ng/uI VR7_25X_NHis protein, 500 ng/uI VR7G_NHis protein, 60 ng/uI VR7_25_26Y_NHis protein, 8 Units Bacillus subtilis polymerase I klenow fragment (exo-), 450 uMdNTP, 250 nM forward primer susF, 250 nM reverse primer susR, about 10 ng/uI pork tissue genome DNA template, a probe susPB was used for detection, nfo incision enzyme IV was used, and the final concentration was 130 ng/uI. Reaction conditions were as follows: 25 uI, amplification temperature was 32° C. The reaction was performed on a GenDx GS8 fluorescence amplifier, and the fluorescence scanning interval was 60 S, and the reaction time was 40 min. The result was shown in FIG. 8.

TABLE-US-00011 susF: (SEQ ID NO. 50) 5′-AGAGATCGGGAGCCTAAATCTCCCCTCAATGG-3′ susR: (SEQ ID NO. 51) 5′-TCGAGATTGTGCGGTTATTAATGAGTCGTTTGGG-3′ susPB: (SEQ ID NO. 52) 5′-TGCCACAACTAGATACATCCACATGATTCAT(FAM-dT)(THF) CAA(BHQ1-dT)TACATCAATAAT(C3-SPACER)-3′ S1: RM-CK_G268N/ 50 ng/μI S2: RM-CK_G268N/ 30 ng/μI S3: RM-CK/ 50 ng/μI S4: RM-CK/, 30 ng/μI; S5: Carp-M1-CK/ 50 ng/μI S6: Carp-M1-CK, 30 ng/μI

[0065] The test shows that in the reaction system using the enzyme of the present invention, the variant whose G is mutated into N in position 268 has amplification efficiency superior to the wild-type RM-CK.

Example VII Influence of Different Polymerases on Amplification Efficiency

[0066] The reaction system was as follows: 300 ng/uI VR7_25X_NHis protein, 400 ng/uI VR7G_CHis protein, 50 ng/uI VR7_25_26Y_NHis protein, 100 ng/uI polymerase (Staphylococcus aureus polymerase I klenow fragment (exo-)/Bacillus subtilis polymerase I klenow fragment (exo-)/Escherichia coli polymerase klenow fragment (exo-)/Pseudomonas fluorescens polymerase I klenow fragment (exo-); other reaction reagents and concentration thereof were the same as those in Example V, and Sybr Green I 0.4X was added additionally, and the amplification temperature was 33° C. The reaction was performed on a GenDx GS8 fluorescence amplifier, and the fluorescence scanning interval was 30 S, and the reaction time was 20 min.

[0067] The amplified result was shown in FIG. 9.

[0068] S1/S2: Staphylococcus aureus polymerase I klenow fragment (exo-)

[0069] S3/S4: Bacillus subtilis polymerase I klenow fragment (exo-)

[0070] S5/S6: Escherichia coli polymerase klenow fragment (exo-)

[0071] S7/S8: Pseudomonas fluorescens polymerase I klenow fragment (exo-)

[0072] S1/S3/S5/S7 was a template with the addition of genome DNA. S2/S4/S6/S8 was NTC negative control.

[0073] Based on the reaction result, Escherichia coli polymerase klenow fragment (exo-) has slightly low amplification efficiency, while the other three DNA polymerases have higher amplification efficiency.

Example VIII Lower Limit of Detection of the Amplification Sensitivity Tested at a Low Temperature of 35° C.

[0074] The reaction reagent and concentration thereof were as follows: 50 mMtris(hydroxymethyl) aminomethane-acetic acid buffer solution, 100 mM potassium acetate, 16 mM magnesium acetate, 2 mMdithiothreitol, 6% polyethylene glycol (molecular weight: 1450-20000), 2.5 mM ATP, 30 mM phosphocreatine, 120 ng/ulcreatine kinase, 450 ng/uI VR7_25X_NHis protein, 700 ng/uI VR7G_NHis protein, 70 ng/uI VR7_25_26Y_NHis protein, 8 Units Staphylococcus aureus polymerase I klenow fragment (exo-), 450 uMdNTP, 250 nM forward primer, 250 nM reverse primer; the template was a plasmid sequence synthesized by Grass Carp Reovirus GCRV VP7 protein gene, and respectively diluted into 10,000,000 copies/uI, 1,000,000 copies/uI, 100,000 copies/uI,10,000 copies/uI, 1000 copies/uI,100 copies/uI,and 10 copies/uI; the negative control was NTC, and 1 uI template was added to the reaction system during reaction. A probe was used for detection, exoexcision enzyme III was used, and the final concentration was 50 ng/uI. Reaction conditions were as follows: 50 uI, amplification temperature was 28° C.

TABLE-US-00012 GCRV-I-F203: (SEQ ID NO. 53) 5′-CCCACGCCAACGTCAAGACCATTCAAGACTCC-3′ GCRV-I-PB: (SEQ ID NO. 54) 5′-CAAATGAAGCCATTCGCTCATTAGTCGAAG(Fam-dT) G(THF)G(BHQ1-dT)GACAAAGCGCAGACC(C3-SPACER)-3′ GCRV-I-R313: (SEQ ID NO. 55) 5′-TCCAATTCGTGATAGTCTACAGTACGGCTACC-3′

[0075] The sequence carrying Grass Carp Reovirus GCRV VP7 protein gene was as follows:

TABLE-US-00013 (SEQ ID NO. 56) 5′-ATTCTAGCTAGCATGCCACTTCACATGATTCCGCAAGTCGCCCACG CTATGGTGCGTGCAGCCGCTGCAGGACGCCTTACCTTATACACAAGAAC TAGAACTGAGACCACCAACTTTGATCACGCTGAGTACGTCACCTGCGGG CGGTACACCATCTGCGCCTTCTGCCTTACGACTCTGGCTCCCCACGCCA ACGTCAAGACCATTCAAGACTCCCACGCTTGTTCACGTCAACCAAATGA AGCCATTCGCTCATTAGTCGAAGTGAGTGACAAAGCGCAGACCGCCCTC GTCGGTAGCCGTACTGTAGACTATCACGAATTGGATGTGAAAGCTGGGT TCGTCGCCCCAACTGCCGATGAAACAATAGCCCCCTCTAAGGATATCGT CGAACTTCCGTTTCGCACCTGTGACTTGTACGATTCCTCTGCTACCGCT TGCGTCCGAAATCACTGCCAGGCCGGTCACGACGGCGTTATCCACCTCC CGATCCTTTCTGGAGATTTCAAATTGCCTAACGAGCATCCCACCAAACC GTTGGACGATACGCATCCCCACGACAAGGTGCTGACTCGCTGCCCCAAG ACTGGTCTCCTCCTCGTCCATGACACTCACGCACACGCCACCGCCGTAG TTGCCACCGCTGCTACGAGAGCTATCCTCATGCACGACCTCCTTACATC AGCGAACGCGGATGACGGCCATCAAGCACGTTCCGCTTGCTACGGTCCA GCGTTTAACAACCTGACCTTCGCTTGCCACTCCACCTGTGCTTCAGATA TGGCTCACTTCGACTGCGGCCAGATCGTTGGACTCGACTTGCATGTGGA GCCATCCGATTAACTCGAGCGGAAT-3′

[0076] The sequence was cloned onto a pUC57 vector, and the terminal sites were cut by an EcoR V enzyme.

[0077] The reaction was performed on a GenDx GS8 fluorescence amplifier, and the fluorescence scanning interval was 30 S, and the reaction time was 20 min.

[0078] S1: 10,000,000 copies/uI,

[0079] S2: 1,000,000 copies/uI,

[0080] S3: 100,000 copies/uI,

[0081] S4: 10,000 copies/uI,

[0082] S5: 1000 copies/uI,

[0083] S6: 100 copies/uI,

[0084] S7: 10 copies/uI,

[0085] S8: Negative control was NTC;

[0086] The test result (FIG. 10) shows that the S6 sample has very obvious amplification, while the S7 sample has slightly increased fluorescence signal. Therefore, the detection sensitivity may be not lower than 100 copies/uI, and close to the sensitivity detected by other molecular diagnostic techniques. By optimization directed to the primer and probe sequence, it should be expected to obtain more excellent effect, thus achieving the detection for the amplified fluorescence signal of a single copy.

Example IX Influence of a uvsX Variant Site on the Amplification Reaction

[0087] The reaction reagent and concentration thereof were as follows: 20 mMtris(hydroxymethyl) aminomethane-acetic acid buffer solution, 120 mM potassium acetate, 10 mM magnesium acetate, 6% polyethylene glycol (molecular weight: 1450-20000), 4 mM ATP, 45 mM phosphocreatine, 90 ng/ulcreatine kinase, 450 ng/uluvsX protein from 20 different variants, 550 ng/uI VR7G_CHis protein, 60 ng/uI VR7_25_26Y_NHis protein, 120 ng/uIStaphylococcus aureus polymerase I klenow fragment (exo-), 450 uMdNTP, 400 nM forward primer ARMP-F, 400 nM reverse primer ARMP-R, and about 3000 copies/uI plasmid template carrying a segment of Mycoplasma pneumoniae 16srDNA gene sequence; Sybr Green I had a concentration of 0.5X; the reaction conditions were as follows: 50 uI, and the amplification temperature was 34° C. The reaction was performed on an MolARRAY MA-6000 fluorescent quantitative PCR amplifier, and the fluorescence scanning interval was 30 S, and the reaction time was 20 min.

TABLE-US-00014 peu-F: (SEQ ID NO. 57) 5′-GCGAACGGGTGAGTAACACGTATCCAATCT-3′ peu-R2: (SEQ ID NO. 58) 5′-CAAAGTTCTTATGCGGTATTAGCTAGTCTT-3′

[0088] The result was shown in 11 (a)-(e). In FIG. 11 (a):

TABLE-US-00015 S1: VRX_Variant1 450 ng/uI; VR5G_NHis 550 ng/ul; VR5Y_NHis 60 ng/uI; S2: VRX_Variant2 450 ng/uI; VR5G_NHis 550 ng/ul; VR5Y_NHis 60 ng/uI; S3: VRX_Variant3 450 ng/uI; VR5G_NHis 550 ng/ul; VR5Y_NHis 60 ng/uI; S4: VRX_Variant4 450 ng/uI; VR5G_NHis 550 ng/ul; VR5Y_NHis 60 ng/uI; S5: VR5X_NHis 450 ng/uI; VR5G_NHis 550 ng/ul; VR5Y_NHis 60 ng/ul; NTC: VR5X_NHis 450 ng/ul; VR5G_NHis 550 ng/ul; VR5Y_NHis 60 ng/uI;
there was no template.

[0089] In FIG. 11 (b):

TABLE-US-00016 S6: VRX_Variant5 450 ng/ul; VR7G_NHis 550 ng/ul; VR7_25_26Y_NHis 60 ng/ul; S7: VRX_Variant6 450 ng/ul; VR7G_NHis 550 ng/ul; VR7_25_26Y_NHis 60 ng/ul; S8: VRX_Variant7 450 ng/ul; VR7G_NHis 550 ng/ul; VR7_25_26Y_NHis 60 ng/ul; S9: VRX_Variant8 450 ng/ul; VR7G_NHis 550 ng/ul; VR7_25_26Y_NHis 60 ng/ul; S10: VR7_25X_NHis 450 ng/ul; VR7G_NHis 550 ng/ul; VR7_25_26Y_NHis 60 ng/ul; NTC: VR7_25X_NHis 450 ng/ul; VR7G_NHis 550 ng/ul; VR7_25_26Y_NHis 60 ng/ul;
there was no template.

[0090] In FIG. 11 (c):

TABLE-US-00017 S11: VRX_Variant9 450 ng/ul; VR25G_NHis 550 ng/ul; VR20Y_NHis 60 ng/ul; S12: VRX_Variant10 450 ng/ul; VR25G_NHis 550 ng/ul; VR20Y_NHis 60 ng/ul; S13: VRX_Variant11 450 ng/ul; VR25G_NHis 550 ng/ul; VR20Y_NHis 60 ng/ul; S14: VRX_Variant12 450 ng/ul; VR25G_NHis 550 ng/ul; VR20Y_NHis 60 ng/ul; S15: VR20_26X_NHis 450 ng/ul; VR25G_NHis 550 ng/ul; VR20Y_NHis 60 ng/ul; NTC: VR20_26X_NHis 450 ng/ul; VR25G_NHis 550 ng/ul; VR20Y_NHis 60 ng/ul;
there was no template.

[0091] In FIG. 11 (d):

TABLE-US-00018 S16: VRX_Variant13 450 ng/ul; VR7G_NHis 550 ng/ul; VR7_25_26Y_NHis 60 ng/ul; S17: VRX_Variant14 450 ng/ul; VR7G_NHis 550 ng/ul; VR7_25_26Y_NHis 60 ng/ul; S18: VRX_Variant15 450 ng/ul; VR7G_NHis 550 ng/ul; VR7_25_26Y_NHis 60 ng/ul; S19: VRX_Variant16 450 ng/ul; VR7G_NHis 550 ng/ul; VR7_25_26Y_NHis 60 ng/ul; S20: VR7_25X_NHis 450 ng/ul; VR7G_NHis 550 ng/ul; VR7_25_26Y_NHis 60 ng/ul; NTC: VR7_25X_NHis 450 ng/ul; VR7G_NHis 550 ng/ul; VR7_25_26Y_NHis 60 ng/ul;
there was no template.

[0092] In FIG. 11 (e):

TABLE-US-00019 S21: VRX_Variant17 450 ng/ul; VR25G_NHis 550 ng/ul; VR7_25_26Y_NHis 60 ng/ul; S22: VRX_Variant18 450 ng/ul; VR25G_NHis 550 ng/ul; VR7_25_26Y_NHis 60 ng/ul; S23: VRX_Variant19 450 ng/ul; VR25G_NHis 550 ng/ul; VR7_25_26Y_NHis 60 ng/ul; S24: VRX_Variant20 450 ng/ul; VR25G_NHis 550 ng/ul; VR7_25_26Y_NHis 60 ng/ul; S25: VR20_26X_NHis 450 ng/ul; VR25G_NHis 550 ng/ul; VR7_25_26Y_NHis 60 ng/ul; NTC: VR20_26X_NHis 450 ng/ul; VR25G_NHis 550 ng/ul; VR7_25_26Y_NHis 60 ng/ul;
ng/ul; there was no template.

[0093] The test result shows that the amplifiation efficiency of partial variants is obviously higher than the wild-type uvsX protein at different variant sites,such as, VRX_Variant1, VRX_Variant7, VRX_Variant11, VRX_Variant17, and VRX_Variant18. Moreover, it is presumed according to the above experiment that other variants may be also superior to the wild-type protein in combination with different gp32 and uvsY proteins.

Example X Detection on a Cell Mycoplasma-Contaminated Sample

[0094] The reaction reagent and concentration thereof were as follows: 30 mMtris(hydroxymethyl) aminomethane-acetic acid buffer solution, 60 mM potassium acetate, 8 mM magnesium acetate, 4mMdithiothreitol, 5% polyethylene glycol (molecular weight: 20000), 3 mM ATP, 50 mM phosphocreatine, 30 ng/ul RM-CK, 360 ng/ul VR7_25X_NHis protein, 500 ng/ul VR7G_NHis protein, 60 ng/ul VR7_25_26Y_NHis protein, 8 Units Bacillus subtilis polymerase I klenow fragment (exo-), 450 uMdNTP, 250 nM forward primer susF, 250 nM reverse primer susR, about 10 ng/ul pork tissue genome DNA template, a probe susPB was used for detection, and the probe susPB had a final concentration was 120 nM, and exonuclease III (exo III) had a final concentration of 70 ng/ul.Reaction conditions were as follows: 50 uI. Moreover, a reagent TwistDx (www.twistdx.co.uk, Cat.No.: TALQBASO1) was used for the RPA technology; exonuclease III (exo III) having a final concentration of 70 ng/uI was further added as control, and other amplificationconditions were consistent. The amplification temperature: 20-45° C., a temperature gradient every other 5° C. There were six groups of reaction (20, 25, 30, 35, 40, and 45° C.). The reaction was performed on a GenDx GS8 fluorescence amplifier, and the fluorescence scanning interval was 30 S, and the reaction time was 40 min.

[0095] The experiment result was shown in FIG. 12: left y-coordinate: change of fluorescence signal value; right y-coordinate: time of beginning to change of the scanningfluorescence value after reaction; x-coordinate denotes different temperatures (where, 45° C. was not listed since no amplification was detected for the two reagents). Bar graph: fluorescence signal change value after amplification at different temperature, where gray denotes low-temperature protein derived from VR7, black denotes a RPA amplification reagent of exonuclease III (exo III); broken line graph denotes change time of the fluorescence signal (TT), where gray denotes low-temperature protein derived from VR7, black denotesexonuclease III.

[0096] The amplification result proves that different from RPA amplification reagent, the low-temperature protein system derived from VR7 has more obvious amplification effect at a condition of 20-30° C., and the RPA amplification reagent has higher amplification efficiency at 35-40° C., which is consistent with the literature report. In this test, no amplified fluorescence signal change was detected for the RPA reagent at a condition of 20° C.

Example XI Detection on Whether there was Mycoplasma Contamination in a Cell Sample by Amplification of Combined Proteins VRX_Variant1, VR5G_NHis, VR5Y_NHis

[0097] The reaction reagent and concentration thereof were as follows: 100 mMtris(hydroxymethyl) aminomethane-acetic acid buffer solution, 120 mM potassium acetate, 15 mM magnesium acetate, 6mMdithiothreitol, 5% polyethylene glycol (molecular weight: 20000), 2 mM ATP, 40 mM phosphocreatine, 450 ng/uI VRX_Variant1,550 ng/uI VR5G_NHis,60 ng/uI VR5Y_NHis, 8 Units Bacillus subtilis polymerase I klenow fragment (exo-), 450 uMdNTP, and Sybr Green I 0.4X, 250 nM forward primer ARMP-F, 250 nM reverse primer ARMP-R, 120 nM fluorescent probe ARMP-PB; the primer and probe sequences were respectively as follows:

TABLE-US-00020 ARMP-F: (SEQ ID NO. 59) 5′-AGCATGTGGTTTAATTTGATGTTACGCGG-3′ ARMP-R: (SEQ ID NO. 60) 5′-CCATGCACCATCTGTCACTCCGTTAACCTCCG-3′

[0098] Reaction conditions were as follows: 50 uI, amplification temperature was 32° C. The sample was a cell culture fluid confirmed to be contaminated with mycoplasma; the fluorescence curve was detected after amplification.

[0099] Sample treatment: 500 μl cell supernatant (or the above cell suspension) was taken and centrifuged for 6 min at 14000 rpm; then supernatant was removed to collect precipitate (note: the supernatant may be absorbed by a sucker), and 50 I sterile water was added and vibrated evenly, heated in a 95° C. water bath for 3 min, then slightly vibrated and mixed evenly, after rapid centrifugation, a DNA template was released to the supernatant; during the reaction, 2.5 uI were taken and added to the system as a template.

[0100] The reaction was performed on a Bio-Rad Mini Opticon fluorescent quantitative PCR instrument, and the fluorescence scanning interval was 30 S, and the reaction time was 25 min.

[0101] The amplified result was shown in FIG. 13.

[0102] In FIG. 13:

[0103] S1: Sample No. 1

[0104] S2: Sample No. 2

[0105] S3: Sample No. 3

[0106] S4: Sample No. 4

[0107] S5: Sample No. 5 It is verified by amplification that the above samples may obtain positive amplification curves; according to different ct values, it is preliminarily presumed that No. 1 sample has more serious contamination.

REFERENCES

[0108] 1. Yan L, Zhou J, Zheng Y, et al. [0109] Isothermal amplified detection of DNA and RNA[J].Molecular Biosystems,2014,10(5):970-1003. [0110] 2. Sinha N K, Morris C F, Alberts B M.Efficient in vitro replication of double-stranded DNA templates by a purified T4 bacter iophage replication system [J].Journal of Biological Chemistry,1980,255(9):4290-4293. [0111] 3. Alberts B M, Frey L.T4 Bacteriophage Gene 32:A Structural Protein in the Replication and Recombination of DN A[J].Nature,1970,227(5265):1313-1318. [0112] 4. Formosa T, Burke R L, Alberts B M. [0113] Affinity purification of bacteriophage T4 proteins essential for DNA replication and genetic recomb ination.[J].Proceedings of the National Academy of Sciences of the United States of America,1983, 80(9):2442-2446. [0114] 5. Yonesaki T, Ryo Y, Minagawa T, Takahashi H. [0115] Purification and some of the functions of the products of bacteriophage T4 recombination genes, uvsX and uvsY Eur J Biochem.1985 Apr 1; 148(1):127-34. [0116] 6. Griffith J, Formosa T. [0117] The uvsX protein of bacteriophage T4 arranges single-stranded and double-stranded DNA into simil ar helical nucleoprotein filaments.[J].Journal of Biological Chemistry,1985,260(7):4484. [0118] 7. Formosa T, Alberts B M. [0119] Purification and characterization of the T4 bacteriophage uvsX protein.[J].Journal of Biological Che mistry,1986,261(13):6107-18. [0120] 8. Minagawa T, Fujisawa H, Yonesaki T, et al. Function of cloned T4 recombination genes, uvsX and uvsY, in cells of Escherichia coli.[J]. Molecular & General Genetics Mgg,1988,211(2):350-356. [0121] 9. Harris L D, Griffith J D. [0122] UvsY protein of bacteriophage T4 is an accessory protein for in vitro catalysis of strand exchange. J Mol Biol.1989 Mar 5; 206(1):19-27. [0123] 10. Morrical S W, Alberts B M. [0124] The UvsY protein of bacteriophage T4 modulates recombination-dependent DNA synthesis in vitro[J]. Journal of Biological Chemistry, 1990, 265(25): 15096-15103. [0125] 11. Beernink, H. T., and Morrical, S.W.(1999) RMPPs:recombination/replication mediator proteins,Trends Biochem. Sci.24, 385-389. [0126] 12. Sweezy, M. A., and Morrical, S.W.(1999) Biochemical interactions within a ternary complex of the bacteriophage T4 recombination proteins uvsY and gp32 bound to single-stranded DNA, Biochemistry 38, 936-944. [0127] 13. Beernink, H. T., and Morrical, S.W.(1998)The uvsY recombination protein of bacteriophage T4 forms hexamers in the presence an d absence of single-stranded DNA, Biochemistry 37, 5673-5681. [0128] 14. Jie Liu, Jeffrey P. Bond, §, and, Scott W. Morrical, §, . [0129] Mechanism of Presynaptic Filament Stabilization by the Bacteriophage T4 UvsY Recombination M ediator[J]. Biochemistry, 2006, 45(17):5493. [0130] 15. Pant K, Shokri L, Karpel R L, et al.Modulation of T4 gene 32 protein DNA binding activity by the recombination mediator protein UvsY[J]. Journal of Molecular Biology, 2008, 380(5): 799-811. [0131] 16. U.S. Pat. No. 5,223,414 to Zarling et al. [0132] 17. Formosa T, Alberts B M. DNA synthesis dependent on genetic recombination: characterization of a reaction catalyzed by purified bacteriophage T4 proteins[J]. Cell, 1986, 47(5): 793-806. [0133] 18. Morrical S W, Wong M L, Alberts B M. [0134] Amplification of snap-back DNA synthesis reactions by the uvsX recombinase of bacteriophage T4. [J]. Journal of Biological Chemistry, 1991, 266(21): 14031. [0135] 19. Salinas F, Jiang H, Kodadek T. [0136] Homology dependence of UvsX protein-catalyzed joint molecule formation.[J]. [0137] Journal of Biological Chemistry, 1995, 270(10): 5181-6. [0138] 20. Morel P, Cherny D, Ehrlich S D, et al. [0139] Recombination-dependent repair of DNA double-strand breaks with purified proteins from Escheric hia coli.[J]. Journal of Biological Chemistry, 1997, 272(27): 17091-6. [0140] 21. International patent application WO 02/086167, Benkovic and Salinas [0141] 22. Piepenburg, Olaf, Williams,Colin H.; Stemple,Derek L.; Armes, Niall A. (2006). “DNA Detection Using Recombination Proteins”. PLoS Biology. 4(7): e204. Doi: 10.1371/journal. [0142] Pbio. 0040204. PMC 1475771. PMID 16756388. [0143] 23. Comeau A M, Bertrand C, Letarov A, Te{acute over (t)}art F, Krisch H M (2007) Modular architecture of the T4 phage superfamily:a conserved core genome and a plastic periphery. [0144] Virology 362: 384-396. doi:10. 1016/J. virol.2 [0145] 24. Ackermann H-W, Krisch H M (1997) A catalogue of T4-type bacteriophages.Arch Virol 142:2329-2345 [0146] 25. Leclerc H, Mossel DAA, Edberg SC, Struijk CB (2001) Advances in the bacteriology of the coliform group:their suitability as markers of microbial water sa fety. Annu Rev Microbiol 55:201-234 [0147] 26. Fileé J, Te{acute over (t)}art F, Suttle C A, Krisch H M (2005) Marine T4-type bacteriophages, a ubiquitous component of the dark matter of the biosphere. Proc Natl Acad Sci USA 102: 12471-12476. [0148] 27. Seeley N D, Primrose S B (1980) The effect of temperature on the ecology of aquatic bacteriophages. J Gen Virol 46: 87-95 [0149] 28. J. Written by Sambrook, et al., and translated by Huang Peitang, et al. Molecular Cloning, Version III, Science Press. 2002 [0150] 29. YASUO IMAE, et al, Replication of T4 DNA In Vitro II. [0151] Assay System for and Some Properties of Gene Products Required for T4 DNA Replication. [0152] JOURNAL OF VIROLOGY, 1976, Vol. 19, No. 3 p.765-774 [0153] 30. Alberts, B.M., and L. Frey. 1970. T4 bacteriophage gene 32: [0154] a structural protein in the replication and recombination of DNA.Nature (London) 227: 1313-1318. [0155] 31. Fujisawa, H., Yonesaki, T.& Minagawa,T.(1985). Sequence of the T4 recombination gene, uvsX, and its comparison with that of the recA gene of Escherichia coli. Nucl. Acids Res. 13, 7473-7481. [0156] 32. Hinton, D. M. et al. [0157] Cloning of the bacteriophage T4 uvsX gene and purification and characterization of the T4 uvsX rec ombination protein. 1986, Vol. 261, No. 12, Issue of April 25, pp. 5663-5673 [0158] 33. et al. [0159] Inhibition of Holliday structure resolving endonuclease VII of bacteriophage T4 by recombination e nzymes UvsX and UvsY J. Mol. Biol. (1997) 267, 150-162 [0160] 34. Wu C L, Li Y H, Lin H C, Yeh Y H, Yan H Y, Hsiao C D, Hui C F, Wu J L. [0161] Activity and function of rabbit muscle-specific creatine kinase at low temperature by mutation at gl y268 to asn268. Comp Biochem Physiol B Biochem Mol Biol.2011 Mar; 158(3): 189-98. Doi: 10.1016/j. cbpb. 2010.11.009. Epub 2010 Dec 3. [0162] 35. Wu C L, Li B Y, Wu J L, Hui C F. [0163] The activity of carp muscle-specific creatine kinase at low temperature is enhanced by decreased hy drophobicity of residue 268. Physiol Biochem Zool. 2014 Jul-Aug; 87(4): 507-16. doi:10. 1086/676466. Epub 2014 Jun 3.