METHOD FOR PREDICTING THE ATHLETIC PERFORMANCE POTENTIAL OF A SUBJECT
20200115751 ยท 2020-04-16
Inventors
- Emmeline HILL (Dublin, IE)
- David MacHUGH (Dublin, IE)
- JingJing GU (Dublin, IE)
- Beatrice McGIVNEY (County Roscommon, IE)
Cpc classification
C12Q1/6888
CHEMISTRY; METALLURGY
A01K15/02
HUMAN NECESSITIES
C12Q1/6876
CHEMISTRY; METALLURGY
International classification
C12Q1/6876
CHEMISTRY; METALLURGY
A01K15/02
HUMAN NECESSITIES
Abstract
A method for predicting the athletic performance potential of a subject comprising the step of assaying a biological sample from a subject for a genetic variant in linkage disequilibrium with MSTN-66493737 (T/C) SNP. The invention also provides an assay for determining the athletic performance potential of a subject.
Claims
1-18. (canceled)
19. A method of training a Thoroughbred race horse for optimal racing distance, comprising the steps of: a) identifying a Thoroughbred race horse that is or may become sufficiently developed for race training, b) obtaining a biological sample from the horse, c) obtaining DNA from the sample and conducting a genotypic analysis to identify a genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism) in the biological sample from the horse, and d) training the horse based on results of the analysis; wherein the genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism) comprises a single nucleotide polymorphism (SNP) selected from one or more of MSTN66493737 (T/C), BIEC2-417372 (A/G), BIEC2-417308 (T/G), BIEC2-417306 (T/C), or BIEC2-417333 (G/A) wherein: i) the horse has a homozygous genotype for the genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism) and is trained to race as a sprinter, ii) the horse has a heterozygous genotype for the genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism) and is trained to race over middle distances, or iii) the horse does not have the genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism) and is trained to race as a stayer.
20. The method of claim 19, wherein the horse is a two-year old.
21. The method of claim 19, further comprising a genetic variant in the MSTN gene region.
22. The method of claim 21, wherein the genetic variant is in the MSTN gene flanking region.
23. The method of claim 19, wherein the DNA from the sample is genomic DNA.
24. The method of claim 19, wherein the biological sample is one or more of blood, saliva, skeletal muscle, hair, semen, bone marrow, soft tissue, internal organ biopsy sample, or skin of the horse.
25. The method of claim 19, further comprising the steps of: a) extracting or releasing DNA from the biological sample, b) amplifying a target sequence or region in the DNA, c) identifying a genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism) comprising a single nucleotide polymorphism (SNP) selected from one or more of MSTN66493737 (C/T), BIEC2-417372 (A/G), BIEC2-417308 (T/G), BIEC2-417306 (T/C), or BIEC2-417333 (G/A), and d) identifying a Chr18g.66495327Ins227 bp66495326 insertion polymorphism, wherein the target sequence or region comprises the MSTN gene region and/or the MSTN gene flanking region, wherein i) the horse has a homozygous genotype for both the genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism) and the insertion polymorphism and is trained to race as a sprinter, ii) the horse has a heterozygous genotype for both the genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism) and the insertion polymorphism and is trained to race over middle distances, iii) the horse has a homozygous genotype for the genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism) and a heterozygous phenotype for the insertion polymorphism and is trained to race as a sprinter or over middle distances, iv) the horse has a heterozygous genotype for the genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism) and a homozygous phenotype for the insertion polymorphism and is trained to race as a sprinter or over middle distances, or v) the horse does not have the genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism) or the insertion polymorphism and is trained to race as a stayer.
26. A method of breeding a Thoroughbred race horse with elite athletic performance potential, comprising the steps of: a) obtaining a DNA sample from a Thoroughbred broodmare and conducting a genotypic analysis to identify a genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism) in the DNA sample from the Thoroughbred broodmare, b) obtaining a DNA sample from a Thoroughbred stallion and conducting a genotypic analysis to identify a genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism) in the DNA sample from the Thoroughbred stallion, and c) mating the broodmare with the stallion to produce a Thoroughbred offspring, wherein the genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism) in the broodmare and in the stallion comprises a single nucleotide polymorphism (SNP) selected from one or more of a MSTN66493737 (C/T), BIEC2-417372 (A/G), BIEC2-417308 (T/G), BIEC2-417306 (T/C), or BIEC2-417333 (G/A) SNP, and wherein: i) the broodmare and the stallion each have a homozygous genotype for the genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism) and the offspring is bred to have elite sprinting performance potential, ii) the broodmare and the stallion each do not have the genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism) and the offspring is bred to have stamina performance potential, iii) one of the broodmare and the stallion has a homozygous genotype for the genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism) and the other horse in the mating pair has a heterozygous genotypes for the genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism), and the offspring is bred to have either elite sprinting performance potential or middle distance racing performance potential, iv) one of the broodmare and stallion has a homozygous genotype for the genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism) and the other horse in the mating pair does not have the genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism), and the offspring is bred to have middle distance racing performance potential, or v) the broodmare and the stallion each have a heterozygous genotype for the genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism), and the offspring is bred to have elite sprinting performance potential, middle distance racing performance potential, or stamina performance potential.
27. The method of claim 26, further comprising a genetic variant in the MSTN gene region.
28. The method of claim 27, wherein the genetic variant is in the MSTN gene flanking region.
29. The method of claim 26, wherein the DNA sample comprises genomic DNA.
30. The method of claim 26, wherein the DNA sample of the broodmare and/or stallion is isolated from one or more of blood, saliva, skeletal muscle, hair, semen, bone marrow, soft tissue, internal organ biopsy sample, or skin of the horse.
31. The method of claim 26, further comprising the steps of: a) amplifying a target sequence or region in the DNA sample of the broodmare and/or stallion, b) identifying a genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism) comprising a single nucleotide polymorphism (SNP) selected from one or more of MSTN66493737 (C/T), BIEC2-417372 (A/G), BIEC2-417308 (T/G), BIEC2-417306 (T/C), or BIEC2-417333 (G/A), and c) identifying a Chr18g.66495327Ins227 bp66495326 insertion polymorphism, wherein the target sequence or region comprises the MSTN gene region and/or the MSTN gene flanking region, wherein i) the horse has a homozygous genotype for both the genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism) and the insertion polymorphism, and the offspring has elite sprinting performance potential, ii) the horse has a heterozygous genotype for both the genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism) and the insertion polymorphism, and the offspring has elite middle-distance racing potential, ii) the horse has a homozygous genotype for the genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism) and a heterozygous phenotype for the insertion polymorphism, and the offspring has either elite sprinting performance potential or middle-distance racing potential, iv) the horse has a heterozygous genotype for the genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism) and a homozygous phenotype for the insertion polymorphism, and the offspring has either elite sprinting performance potential or middle-distance racing potential, or v) the horse does not have the genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism) or the insertion polymorphism, and the offspring has stamina performance potential.
32. The method of claim 26, further comprising obtaining a DNA sample from the offspring and conducting a genotypic analysis to identify a genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism) comprising one or more of the single nucleotide polymorphisms (SNPs) MSTN66493737 (C/T), BIEC2-417372 (A/G), BIEC2-417308 (T/G), BIEC2-417306 (T/C), or BIEC2-417333 (G/A) in the DNA sample from the offspring, wherein: i) the offspring has a homozygous genotype for the genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism) and is trained to race as a sprinter, ii) the offspring has a heterozygous genotype for the genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism) and is trained to race over middle distances, or iii) the offspring does not have the genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism) and is trained to race as a stayer.
33. The method of claim 26, further comprising the steps of: a) extracting or releasing DNA from the offspring, b) amplifying a target sequence or region in the DNA, c) identifying a genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism) comprising a single nucleotide polymorphism (SNP) selected from one or more of selected from one or more of MSTN66493737 (C/T), BIEC2-417372 (A/G), BIEC2-417308 (T/G), BIEC2-417306 (T/C), or BIEC2-417333 (G/A), and d) identifying a Chr18g.66495327Ins227 bp66495326 insertion polymorphism, wherein the target sequence or region comprises the MSTN gene region and/or the MSTN gene flanking region, wherein i) the offspring has a homozygous genotype for both the genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism) and the insertion polymorphism and is trained to race as a sprinter, ii) the offspring has a heterozygous genotype for both the genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism) and the insertion polymorphism and is trained to race over middle distances, ii) the offspring has a homozygous genotype for the genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism) and a heterozygous phenotype for the insertion polymorphism and is trained to race as a sprinter or over middle distances, iv) the offspring has a heterozygous genotype for the genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism) and a homozygous phenotype for the insertion polymorphism and is trained to race as a sprinter or over middle distances, or v) the offspring does not have the genetic variant that is linked to a functional variant (Chr18g.66495327Ins227 bp66495326 insertion polymorphism) or the insertion polymorphism and is trained to race as a stayer.
34. The method of claims 32-33, wherein the DNA sample of the offspring is isolated from one or more of blood, saliva, skeletal muscle, hair, semen, bone marrow, soft tissue, internal organ biopsy sample, or skin of the horse.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0105] The invention will be more clearly understood from the following description of an embodiment thereof, given by way of example only, with reference to the accompanying drawings, in which:
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
DETAILED DESCRIPTION
[0113] Intense selection for elite racing performance in the Thoroughbred horse (Equus caballus) has resulted in a number of adaptive physiological phenotypes relevant to exercise, however the underlying molecular mechanisms responsible for these characteristics are not well understood.
[0114] Thoroughbred horses have been selected for structural and functional variation contributing to speed and stamina during the three century development of the breed. The International Federation of Horseracing Authorities recognizes five distance categories: Sprint (5-6.5 furlongs [f], 1,300 m), Mile (6.51-9.49 f, 1,301-1.900 m), Intermediate (9.5-10.5 f, 1,901-2,112 m). Long (10.51-13.5 f, 2,114-2,716 m) and Extended (>13.51 f, >2,717 m) races (www.horseracingintfed.com) and it is widely recognized among horse breeders that variation in physical and physiological characteristics are responsible for variation in individual aptitude for race distance (Willett 1981). Although environment and training may contribute to the race distance for which a horse is best suited, the genetic contribution to the ability to perform optimally at certain distances is large; the heritability of best distance among Australian racehorses has been estimated as 0.940.03 (Williamson & Beilharz 1998).
[0115] A principal characteristic contributing to the ability of a Thoroughbred to perform well in short distance, sprint races is the extent and maturity of the skeletal musculature. Sprinters are generally shorter, stockier animals with greater muscle mass than animals suited to endurance performance, and generally mature earlier. Performance aptitude for speed and stamina has also been associated with muscle fibre type phenotypes (Rivero et al 1993; Barrey et al 1999) and metabolic adaptations to training (Rivero & Piercy 2008). Variation in cardiovascular function contributing to aerobic capacity may also play a role in distinguishing individuals suited to shorter or longer distance races.
[0116] We have previously reported a sequence polymorphism (g.66593737C>T) in the equine myostatin (MSTN) gene strongly associated (P=4.8510.sup.8) with optimum racing distance in Thoroughbred racehorses (Hill et al 2010, the entire contents of which is incorporated herein by reference). In several mammalian species, including cattle, sheep, dogs and horses, muscle hypertrophy phenotypes are associated with sequence variants in the MSTN gene (Grobet et al. 1997; McPherron et al 1997; McPherron & Lee 1997; Schuelke et al 2004; Mosher et al 2007).
[0117] Among horses that compete preferably in short distance (7 f) races requiring exceptional speed, the C allele OF G.66493737 C>T is twice as common than among horses that perform optimally in longer distance (>8 f) races that require more stamina (0.72 and 0.36 respectively). On average the optimum racing distance for C:C horses was 6.20.8 f, for C:T horses was 9.12.4 f and for T:T horses was 10.52.7 f. Furthermore, C:C horses have significantly greater muscle mass than T:T horses at two-years-old.
[0118] Skeletal muscle phenotypes clearly play a role in distinguishing distance aptitude, and there is a strong effect of MSTN genotype on distance (Hill el al. 2010, the entire contents of which is incorporated herein by reference. However, heretofore, the effects of additional nuclear gene variants that may contribute to equine performance-related phenotypes have not been investigated. Therefore, we performed a genome-wide SNP-association study using the EquineSNP50 Bead Chip genotyping array in a cohort of elite race winning Thoroughbred horses. Animals were separated into two distinct phenotypic cohorts comprising short distance (8 f) and middle-long distance (>8 f) race winners and genetic associations were evaluated using best race distance as a quantitative phenotype. This study was designed to identify additional genetic loci as indicators of race distance aptitude and to establish whether variation at the g.66493737C>T SNP was associated with inter-locus epistatic effects for race distance performance.
[0119] The present invention relates to a previously unknown relationship between sequence variants (such as SNPs and insertion polymorphism) in the MSTN gene and retrospective athletic performance (given as racecourse success i.e. Group winner or non-winner, handicap rating (RPR) and best race distance for Group winners) in Thoroughbred race horses. In some aspects, the invention relates to sequence variants in the MSTN gene and flanking sequences. In some aspects the invention relates to sequence variants in linkage disequilibrium with sequence variants in the MSTN gene.
MSTN
[0120] Myostatin is also known as growth/differentiation factor 8 precursor (GDF-8). In several mammalian species (including cattle, sheep and dogs), the double muscling trait is caused by mutations in the myostatin (MSTN) gene. In dogs, MSTN gene mutations in racing whippets have been associated with the bully phenotype and heterozygous individuals are significantly faster than individuals carrying the wild-type genotype (Mosher et al 2007). Mutations in the MSTN gene may be associated with athletic power.
[0121] We have analysed a number of polymorphisms (including SNPs and insertion polymorphisms) in the MSTN gene for association with athletic performance and have developed a simple DNA based method of predicting the athletic performance potential of a subject based on the novel polymorphisms.
[0122] A genome-wide SNP-association study for optimum racing distance was performed using the EquineSNP50 Bead Chip genotyping array in a cohort of n=118 elite Thoroughbred racehorses divergent for race distance aptitude. In a cohort-based association test we evaluated genotypic variation at 40,977 SNPs between horses suited to short distance (8 f) and middle-long distance (8 f) races. The most significant SNP was located on chromosome 18: BIEC2-417495 690 kb from the gene encoding myostatin (MSTN) [P.sub.unadj=6.9610.sup.6]. Considering best race distance as a quantitative phenotype, a peak of association on chromosome 18 (chr18:65809482-67545806) comprising eight SNPs encompassing a 1.7 Mb region was observed. Again, similar to the cohort-based analysis, the most significant SNP was BIEC2-417495 (P.sub.unadj.=1.6110.sup.9; P.sub.Bonf.=6.5810.sup.5). In a candidate gene study we have previously reported a SNP (g.6649373C>T) in MSTN associated with best race distance in Thoroughbreds; however, its functional and genome-wide relevance were uncertain. Additional re-sequencing in the flanking regions of the MSTN gene revealed four novel 3UTR SNPs and a 227bp SINE insertion polymorphism in the 5UTR promoter sequence. Linkage disequilibrium was highest between g.66493737C>T and BIFC2-417495 (r.sup.2=0.86).
[0123] Comparative association tests consistently demonstrated the g.66493737C>T SNP as the superior variant in die prediction of distance aptitude in racehorses (g.6649373C>T, P=1.0210.sup.10; BIEC2-417495, P.sub.unadj.=1.6110.sup.9). Functional investigations will be required to determine whether this polymorphism affects putative inscription-factor binding and gives rise to variation in gene and protein expression. Nonetheless, these data demonstrate that the g.66493737C>T SNP provides the most powerful genetic marker for prediction of race distance aptitude in Thoroughbreds.
[0124] The invention will be more clearly understood from the following examples.
EXAMPLES
Materials and Methods
Subjects
[0125] A Thoroughbred is a registered racehorse that can trace its ancestry to one of three foundation stallions and the approximately 30 foundation mares entered in The General Studbook, 1791 (Weatherby and Sons 1791). There are two types of Thoroughbred race: National Hunt races are run over hurdles or steeplechase fences over distances of up to 4.5 miles (7,200 m), while Flat races have no obstacles and are run over distances ranging from five furlongs ( mile or 1.006 m) to 20 furlongs (4,024 m). The highest standard and most valuable elite Flat races are known as Group (Europe and Australasia) or Stakes races (North America), The most prestigious of these races include The Breeders' Cup races (United States). The Kentucky Derby (United States;, The Epsom Derby (United Kingdom) el cetera.
[0126] Three hundred and fifty Group races are run in Europe (Britain, Ireland (incl. Northern Ireland), France, Germany, Italy) annually including 84 Group 1, 93 Group 2 and 173 Group 3 races. In the United Kingdom and Ireland 196 Group races are competed annually (43 Group 1, 50 Group 2 and 103 Group 3). Britain has the highest number of Group races (139) in Europe per annum, with 57% run over distances 1 mile (1609 meters) and 43% run over distances >1 mile. Australia has approximately 540-550 Group races per season from a total of almost 21,000 races and New Zealand hosts 78 Group races per season. After Group races, Listed races are the next highest grade of race.
[0127] Horses that compete over distances 1 mile are known as sprinters whereas horses that compete over distances >1 mile are known as stayers. Horses competing in 1 mile races (miters and middle distance) may be considered either sprinters or Stayers and the way in which a race is executed by the rider often reflects the trainers perceived ability (sprinter or stayer) of the horse. The International Federation of Horseracing Authorities recognizes five race distance categories: Sprint (5-6.5 f, 1.300 m). Mile (6.51-9.49 f, 1,301-1,900 m). Intermediate (9.5-10.5 f, 1,901-2,112 m), Long (10,51-13.5 f, 2,114-2,716 m) and Extended (>13.51 f, >2,717 m); S-M-I-L-E [Note: 1 furlong= mile=201.2 meters].
[0128] A repository of registered Thoroughbred horse blood or hair samples (n>1,400) was collected from stud farms, racing yards and sales establishments in Ireland. Great Britain and New Zealand during 1997 to 2008. Each sample was categorized based on retrospective racecourse performance records. Only horses with performance records in Flat races were included in the study. The study cohort comprised elite Thoroughbreds that had won at least one Group race (Group 1, Group 2 or Group 3) or a Listed racethe highest standard and most valuable elite Flat races are known as Group (Stakes) races and Listed races are the next in status. Only elite race winning horses were included as elite races are most likely to reflect the truest test for distance. Race records were derived from three sources [Europe race records: The Racing Post on-line database (www.racingpost.co.uk); Australasia and South East Asia race records: Arion Pedigrees (www.arion.co.nz); North America race records: Pedigree Online Thoroughbred database (www.pedigreequery.com)].
[0129] Each sample was assigned a best race distance which was defined as the distance (furlongs, f) of the highest grade of race won [note: 1 furlong=mile=201.2 meters]. When multiple races of the same grade were won, then the distance of the most valuable race, in terms of prize money, was used. A set of elite Thoroughbred samples (n=118) was selected from the repository , mostly comprising samples procured in Ireland and Great Britain (i.e. n=5 samples [n=38 f, n=2>8 f] were collected in New Zealand); though some had won their best race in North America. Animals with excessive consanguinity (within two generations) were avoided and over-representation of popular sires within the pedigrees was minimized as far as possible. One hundred and seven sires were represented in the total sample set.
[0130] For the case-control investigation we compared two cohorts: samples were subdivided into short (8 f, n=68) and middle-long (>8 f, n=50) distance elite race winning cohorts (Table 1 below).
TABLE-US-00001 TABLE 1 Description of phenotype cohorts. No. Mean Range Mean Range N sires RPR RPR BRD BRD All TBs 118 107 116 84-138 8.6 5-16 Short (8 f) 68 63 114 84-129 6.8 5-8 Middle-long 50 48 120 107-138 11.3 9-16 (>8 f)
[0131] All TBs (Thoroughbreds) were used for the quantitative association test analysis. Racing Post Ratings (RPR) represent handicap ratings (best lifetime RPR) that are indicative of performance ability. Best race distance (BRD) was the distance (f) of the highest grade of race (Group 1, 2, 3, Listed) won.
DNA Extraction
[0132] Genomic DNA was extracted from either fresh whole blood or hair samples using a modified version of a standard phenol/chloroform method (Sambrook & Russell 2001) or the Maxwell 16 automated DNA purification system (Promega, Wis., USA). DNA samples were quantified using Quant-iT PicoGreen dsDNA kits (Invitrogen, Carlsbad, Calif.) according to the manufactures instructions and the DNA concentrations were adjusted to 20 ng/l.
Detection of Polymorphism
[0133] The sequence variant may be determined by any genotyping method including for example the following non limiting methods: direct DNA sequencing; allele size discrimination using gel based assays; single-strand conformation polymorphisms; high-resolution melting of PGR amplicons; matrix-assisted laser-desorption-ionization mass spectrometry.
Genotyping and Quality Control
[0134] Samples were genotyped using EquineSNP50 Genotyping BeadChips (Illumina, San Diego, Calif.). This array contains approximately 54,000 SNPs ascertained from the EquCab2 SNP database of the horse genome (Wade et al. 2009) and has an average density of one SNP per 43.2 kb. Genotyping was performed by AROS Applied Biotechnology AS, Denmark. The samples that were genotyped for this study were a subset of n=187 samples genotyped in two separate batches (Batch 1, n=96; Batch 2, n=91). We included four pairs of duplicate samples in Batch 2 for QC purposes and observed greater than 99.9% concordance in the four pairs. In total, we successfully genotyped 53,795 loci. All samples had a genotyping rate of greater than 90%. We omitted SNPs which had a genotyping completion rate of less than 90%, were monomorphic or had minor allele frequencies (MAP) less than 5% in our samples from further analysis. We omitted 12,818 SNPs leaving 40,977 SNPs in our working build of the data and the overall genotype completion rate was 99.8%.
Re-Sequencing MSTN Flanking Sequences
[0135] PCR primers were designed to cover 2 kb of the 5UTR and 2 kb of the 3UTR of MSTN genomic sequence using the PCR Suite extension to the Primer3 web-based primer design tool (Rozen & Skaletsky 2000; van Baren & Heutink 2004) (Table 2 below). Fifteen unrelated Thoroughbred DNA samples (g.66493737C>T, n=4 C:C; n=5 C:T, n=5 T:T) were included in a re-sequencing panel to identify novel sequence variants. Bidirectional DNA sequencing of PCR products was performed by Macrogen Inc. (Seoul, Korea) using AB 37301 sequencers (Applied Biosystems, Foster City, Calif.), Sequence variants were detected by visual examination of sequences following alignment using Consed version 19.0 (Gordon et al 1998).
TABLE-US-00002 TABLE2 PCRandsequencingprimersforre-sequencingMSTNflankingsequences ForwardandreverseprimersforMSTN3UTRPCRandsequencing OligonucleotidePrimerSequence SEQID OligonucleotideName 5-3 No PCRPrimer3UTR(Forward) TACTCCCACAAAGATGTCTCCAAT 1 PCRPrimer3UTR(Reverse) TGAATCACCTCCTGCATTAGACT 2 SequencingPrimer13UTR(Forward) GAATGGCTGATGTCATCAGG 3 SequencingPrimer23UTR(Reverse) CCTGATGACATCAGCCATTC 4 SequencingPrimer23UTR(Forward) CAAATCTCAACGTTCCATTG 5 SequencingPrimer23UTR(Reverse) CAATGGAACGTTGAGATTTG 6 ForwardandreverseprimersforMSTN5UTRPCRandsequending OligonucleotidePrimerSequence SEQID OligonucleotideName 5-3 No Structure PCRPrimer5UTR(Forward) CTGGTTTGTGTCTGGTTTTC 7 PCRPrimer5UTR(Reverse) CTTTTCCTTCCTGCTTACATAC 8 SequencingPrimer15UTR(Forward) AACAAAACAAACAGGCACCC 9 5upstream SequencingPrimer15UTR(Reverse) GGGTGCCTGTTTGTTTGTT 10 5upstream SequencingPrimer25UTR(Forward) GTCAGGAAAACAAGTTTCTCAAA 11 5upstream SequencingPrimer25UTR(Reverse) TTTGAGAAACTTGTTTTCCTGAC 12 5upstream SequencingPrimer35UTR(Forward) GACAGCGAGATTCATTGTGG 13 5upstream+partExon 1 SequencingPrimer35UTR(Reverse) CCACAATGAATCTCGCTGTC 14 5upstream+partExon 1 SequencingPrimer45UTR(Forward) CCTGTTTGTGCTGATTCTTG 15 5upstream+partExon 1 SequencingPrimer45UTR(Reverse) CAAGAATCAGCACAAACAGG 16 5upstream+partExon 1
Bioinformatics
[0136] The software tool MatInspector (Cartharius et al 2005) was used to search for transcription factor binding site consensus sequences present in 300 bp of the MSTN 5UTR region in which a novel SINE insertion (Ins227bp) polymorphism was detected. To investigate possible microRNA (miRNA) regulation of MSTN gene expression we screened the equine MSTN gene and flanking sequences for putative miRNA binding sites. A list of 407 predicted equine miRNAs (Zhou et al. 2009) were inputted into the online tool DIANA microtest (http://diana.pcbi.upenn.cdu/cgi-bin/micro_j.cgi) and a 14.7 kb segment containing the equine MSTN gene and 5 kb of upstream and downstream sequence was inputted as the target sequence. SNPInspector (Cartharius et al. 2005) was used to investigate transcription factor binding sites at the g.66493737C>T locus.
Genotyping the Chr18g.66495327Ins227bp66493326 (Ins227bp) Polymorphism
[0137] A PCR-based assay for allele size discrimination was used to genotype the Ins227bp polymorphism in n=165 samples. The following primers were used: forward 5-ATCAGCTCACCCTTGACTGTAAC-3 (SEQ ID No. 17) and reverse 5-TCATCTCTCTGGACATCGTACTG-3 (SEQ ID No. 18). Alleles were determined as follows: Normal allele600 bp; and Insertion227bp allele827 bp.
Statistical Analyses
[0138] All statistical analyses, including tests of association were performed using PLINK Version 1.05 (Purcell el al. 2007). We compared genotype frequencies in short and middle-long distance cohorts, testing for trait association using .sup.2 tests with two degrees of freedom. To test for population stratification, the pairwise identity-by-state (IBS) distance was calculated for all individuals. A permutation lest was performed to investigate IBS differences among the short and middle-long distance cohorts. The linear regression model was used to evaluate quantitative trait association using best race distance (f) as the phenotype. We report uncorrected P-values (P.sub.unadj.) and P-values following correction for multiple testing using the Bonferroni method (P.sub.Bonf.). Manhattan and Q-Q plots were generated in R using a modified version of code. The regional association plot was generated in R using a modified version of code available at http://www. broadinstitute.org.
[0139] Cohort-based association (short vs middle-long distance) and quantitative trait association, tests were also performed for the g.66493737C>T SNP (Hill et al 2010) and a novel 5UTR MSTN SINE insertion (Ins227bp) polymorphism identified in this study. In addition, an analysis of genome-wide epistasis was performed in which the g.66493737C>T SNP was tested against all SNPs on the EquineSNP50 Genotyping BeadChip for epistatic interactions influencing best race distance. This test involved a linear regression analysis to investigate whether gene by gene interactions had a significant influence on best race distance. Linkage disequilibrium (LD) between g.66493737C>T and Ins227bp and between g.66493737C>T and all chromosome 18 SNPs on the EquineSNP50 Genotyping BeadChip was quantified as r.sup.2. A visual representation of haplotype blocks across a 1.7 Mb region on chromosome 18 was generated using Haploview (
Ethics
[0140] This work has been approved by the University College Dublin, Ireland. Animal Research Ethics Committee.
Example 1
Genome-Wide SNP-Association Study & Candidate Performance-Associated Genes
Genome-Wide SNP-Association Study
[0141] We have previously described an association between optimum racing distance and a SNP (g.66493737C>T) in the equine MSTN gene in Thoroughbred Flat racehorses (Hill et al 2010, the entire contents of which is incorporated herein by reference). Candidate gene approaches are designed considering a priori hypotheses and do not allow the opportunity for evaluation of the effect of the gene in the context of the entire genome, nor do they allow for the identification of other genes contributing to the phenotype (Tabor et al 2002; Jorgensen et al 2009). Therefore, employing a hypothesis-free approach we investigated genome-wide influences on optimum racing distance by conducting a genome-wide SNP-association study in a cohort of elite Thoroughbred racehorses.
[0142] In a cohort based genotype phenotype investigation we compared two cohorts: short (8 f) and middle-long (>8 f) distance elite race winners. The genome-wide association study (GWAS) results, sorted by chromosome, are shown in
[0143] The SNPs identified in chromosome 18 during the horse genome sequencing project and those that are found on the EquineSNP50 BeadChip can be viewed at http://www.broadinstitute.org/ftp/distribution/horse_snp_release/v2/(fileequcab2.0_chr18_snps.xls), the entire contents of which is incorporated herein by reference. Pairwise IBS values were used to investigate population stratification between the short and middle-long cohorts. While on average phenotypically concordant pairs of individuals were more similar than phenotypically discordant pairs (P=0.034), the overall difference between the two groups was negligible (<0.0002).
[0144] Using the linear regression model we considered best race distance as a quantitative phenotype and observed the same peak of association on chromosome 18 (chr18:65809482-67545806) (FIG. 4). The unadjusted and FDR corrected P values for quantitative association test result for best race distance are given in additional file 1 which can be downloaded at http://www.biomedcentral.com/1471-2164/11/552, the entire contents of which are incorporated herein by reference. The top eight SNPs encompassed a 1.7 Mb region on chromosome 18 (
Candidate Performance-Associated Genes
[0145] We investigated candidate genes in the 1.7 Mb (Chr18:65809482-67545806) region on chromosome 18 that encompassed the seven SNPs that reached genome-wide significance. Eleven protein coding genes were identified, including the myostatin gene (MSTN) and the NGFI-A binding protein 1 (EGR1 binding protein 1) gene (NAB1).
[0146] The genomic region on chromosome 18 containing the MSTN gene was the highest ranked region in the GWAS for best racing distance, reaching genome-wide significance for a set of seven SNPs within a 1.7 Mb region. The best SNP (BIEC2-417495) and the second best SNP (BIEC2-417372) were 692 kb and 28 kb from the MSTN gene, respectively. We searched the region for other plausible candidate genes and identified the NGFI-A binding protein 1 (EGR1 binding protein 1) gene (NAB1) located 170 kb from BIEC2-417495. The product of the NABI gene is highly expressed in cardiac muscle and has been reported to be a transcriptional regulator of cardiac growth (Buitrago et al 2005). Its principal role is in its interaction with the early growth response 1 (EGR-1) transcriptional activator that is involved in regulation of cellular growth and differentiation (Thiel et al. 2000).
[0147] We considered NABI as a strong candidate gene to influence an athletic performance phenotype as we have previously identified EGR-1 mRNA transcript alterations (1.5-fold, P=0.014) in skeletal muscle immediately following a bout of treadmill exercise in untrained Thoroughbred horses (McGivney et al 2009). Twelve SNPs located within the NABI genomic sequence (chr18:g.66995249-67021729) are documented in the EquCab2 SNP database, and three are contained on the EquineSNP50 Genotyping BeadChip. After correction for multiple testing, there were no detectable associations between the three NABI SNPs and the trait (BIEC2-417453, P.sub.unadj.=0.0007, rank 144; BIEC2-417454, P.sub.unadj.=0.0012, rank 210; and BIEC2-417458, P.sub.unadj=0.0032, rank 421). Therefore, we did not further consider NABI as a potential major contributor to variation in optimum racing distance.
Example 2
Polymorphism Detection in Equine MSTN Flanking Sequences
[0148] We have previously identified SNPs in intron 1 of the equine MSTN gene by re-sequencing the coding and intronic sequence [PCT/IE2009/000062 and Hill et al 2010, the entire contents of which are incorporated herein by reference]. Details of two of the SNPs identified in intron 1 are shown in Table 3 below.
TABLE-US-00003 TABLE3 SNPsinintron1oftheMSTNgene Location(bp) onECA18 SNPID SNP (EquCab2) Structure FlankingSequence MSTN- T:C 66493737 Intron1 AGCTAAGCAAGTAATTAGCACAAAAA 66493737 TTTGAATGTTATATTCAGGCTATCTCA (T/C) AAAGTTAGAAAATACTGTCTTTAGAGC SNP CAGGCTGTCATTGTGAGCAAAATCACT AGCAATTTCTTTTATTTTGGTTCCCCAA GATTGTTTATAAATAAGGTAAATCTAC TCCAGGACTATTTGATAGCAGAGTCAT AAAGGAAAATTA[T/C]TTGGTGCATTA TAACCTGATTACTTAATAAGGAGAAC AATATTTTGAAACTGTTGTGTCCTGTT TAAAGTAGATAAAGCACTGGGTAAAG CAGGATCGCAGACACATGGCACAGAA TCTTCCGTGTCATGCCTTCTCTGTGAA GGTGTCTGTCTCCCTTTCCTTGAGTGT AGTTATGAACTGACTGCAAAAAGAAT ATATG(SEQIDNo.19) MSTN- A:C 66494218 Intron1 AGGAGATTATTAAGCAATGTGCCTGCC 66494218 TGGAAATGTGCACCCCGGGTGCTCTCA (A/C) ACAATAGTACTATGGTCAAGGTGTAA SNP GCAGGACTCTGAGCTATAACCTCTTTG ATTAAAATGTTTATTTATTAGGCATTT TATGATAATTAGCTCATGATTATCATT ATGCTATGTTTACTTCATCATTTTTCTT ACTAATACATTA[A/C]ATTTAAAAAA TATTTTTCTAATCTCCAGGGGAATAAC TTTCAAAATCTAATATGTTAATTTGTG AAGAACATAAAAAACACTATGAGAAAT AGTTTTGAGTAACAGAAGTCATTTTGG TGTTCAGCAAATGCTCAAATGACCTAA ACGTCTACAAATTTCTTCCTTCTCTATT ATTAGTGAAAAAAACTTGTTATTATAA (SEQIDNo.20)
[0149] Details of two SNPs in the genomic region on chromosome 18 containing the MSTN gene that ranked highly in the GWAS for best racing distance are shown in Table 4 below.
TABLE-US-00004 TABLE4 SNPsfromEquineSNP50GenotypingBeadChipsthatrankedhighlyinthe GWASforbestracingdistance. Location (bp)on ECA18 SNPID SNP (EquCab2) Structure FlankingSequence BIEC2- C:T 67186093 Intergenic CATAAGGTCAAATATTTTTCCCATTTCCCTCTTTTATTA 417495 AAATACCACATTTATTTGGAAAATCATTACTCAGCTCT ATTGCTTACTAATTATTTTAAGATAGAAAAAATATTTT GTCGCAAAGAAAGATTTCAAGACATCTTTATGGCTAT ATAAATATTTATGCATCTTTTTAAATACCTTGATTGAT TGGTTTTAGA[C/T]TGTCTCAGATTCCAATCTGATTTCTC TGCCTCCCTGATAAACCTTCTTCAATCTCTGTTCCCTGG CCTATGAAGGTCACCTTCAAAATATTATCACCTTTATGT AATGATCAGACACAAAGTCTAACCATCATCTAAATTATT TCAATATGAAGCATGACTAATAAACCAGTATGAGTAGT TTTCAAAGTGAACAGGATTT (SEQIDNo.21) BIEC2- A:G 66539967 Intergenic GCCTGGATATGAAGCCCATAAGAAATGTCTGGCAGTG 417372 GTCTCTTGAGATCAGAAAGAGAATGGGAGATTAGGAA GTTAGAATAGGAAGCAAGTGAGGCAGCAGGTAGYGG AGGCTAGGTGGCCCATCTGTGAGTTTTTTCCTTCTGAA CTCCTTACAATTCTTTATAAAATTCCATGAAGGCCTCA TTTCAAGATAAAGG[G/A]GAAGAAAATATTTTCTCCTA AAAAAGCTTAAACTTAATATTCTACTTCTCAAAAAAAA TTCAAAGAGGCCTAATAGATTGACTGGAACTCTAACTG AAATTTGCCTCGCTTTCCCAAATTCTTACTGGAGAAGGG CAAGGCCTCGCCCCTCTCAGAACTCTTACATGAGATTGC TGCTTTCCTTAGTTTCTGATCACTGT (SEQIDNo.22)
[0150] The structure of the MSTN gene is predicted as follows (Ensembl data) (Table 5)
TABLE-US-00005 TABLE 5 Structure of the MSTN gene Length Start bp End bp bp 5 upstream 66,495,181 Exon 1 66,494,808 66,495,180 373 Intron 1 66,492,979 66,494,807 1829 Exon 2 66,492,605 66,492,978 374 Intron 2 66,490,589 66,492,604 2016 Exon 3 66,490,208 66,490,588 381 3 66,490,207 downstream
[0151] We re-sequenced 2.155 bp (chri8:66488052-66490207) Of the 3UTR sequence of MSTN sequence of the equine myostatin (MSTN) gene in 15 unrelated Thoroughbred horses and identified 4 novel SNPs. (Table 6)
TABLE-US-00006 TABLE 6 SNPs identified in 3 UTR sequence of MSTN Location Location (in the in Contig downstream Location on (full length of the protein ECA18 2139 bp) coding region (EquCab2) SNP ID SNP bp of MSTN) bp bp Structure SNP1 A:C 701 595 66,489,613 3 UTR SNP2 C:T 943 837 66,489,371 3 UTR SNP3 A:G 954 848 66,489,360 3 UTR SNP4 A:T 2001 1895 66,488,313 3 UTR
[0152] Polymorphisms in the 3UTR of the MSTN gene have been associated with muscle hypertrophy in sheep and are considered likely to function via creation of de novo target sites for the microRNAs (miRNA) miR-1 and mtR-206 (Clop et al. 2006 ). Therefore, using a set of equine miRNAs (n=407) described by Zhou and colleagues (Zhou et al. 2009) we investigated the presence of putative miRNA binding sites within 5 kb upstream and downstream flanking sequences of the MSTN gene. Five putative miRNA binding sites were identified, though none was polymorphic: i.e. no putative miRNA binding site was associated with any of the eight SNP alleles.
[0153] We re-sequenced 2,151 bp (chr18:66494683-66496834) of the 5UTR sequence of the equine myostatin (MSTN) gene in 15 unrelated Thoroughbred horses.
[0154] Re-sequencing was performed using four internal sequencing primers following PCR using the 5UTR PCR and sequencing primers listed in Table 2 above (SEQ ID No. 7-16).
[0155] Following re-sequencing in the 5UTR of the MSTN gene, we identified a 227 bp insertion polymorphism at chr18:66495327-[Insertion227bp]-66495326. located 146 bp from the start of Exon 1 (Exon 1 Start: 66495180).
[0156] The insertion sequence is as follows:
TABLE-US-00007 (SEQIDNo.23) GGGGCTGGCCCCGTGGCCGAGTGGTTAAGTTCGTGCGCTCCGCTGCAGGC GGCCCAGTGTTTCGTCGGTTCGAGTCCTGGGCGCGGACATGGCACTGCTC GTCGGACCACGCTGAGGCAGCGTCCCACATGCCACAACTAGAGGAACCCA CAACGAAGAATACACAACTATGTACCGGGGGGCTTTGGGGAGAAAAAGGA AAATAAAATCTTTAAAAAGCCACTTGG
[0157] A BLAST search identified the insertion sequence as a horse-specific repetitive DNA sequence element (SINE) known as ERE-1 (Sakagami et al J. Mol. Biol. 239 (5) 731-735 (1994). Also MatInspector analysis indicated that the insertion may disrupt on E-box motif.
Summary of Polymorphisms in the MSTN Flaking Region
[0158] We have identified five polymorphisms in the upstream and downstream untranslated (UTR) regions of the MSTN gene. We have identified four novel SNPs (i.e. not documented in the EquCab2.0 SNP database) and an insertion polymorphism (not previously documented). Details for these polymorphisms are provided in the Table 7 below.
TABLE-US-00008 TABLE7 DetailsofpolymorphismsidentifiedintheMSTNflankingregion. Location (bp)on ECA18 SNPID SNP (EquCab2) Structure Flankingsequences Insertion227 Insertion 66495327 5UTR TTGTGACAGACAGGGTTTTAACCTCTGACAGCG bp 227bp [Insertion227 AGATTCATTGTGGAGCAGGAGCCAATCATAGAT bp] CCTGACGACACTTGTCTCATCAAAGTTGGAATA 66495326 TAAAAAGCCACTTGG]GGGGCTGGCCCCGTGGC CGAGTGGTTAAGTTCGTGCGCTCCGCTGCAGGC GGCCCAGTGTTTCGTCGGTTCGAGTCCTGGGCG CGGACATGGCACTGCTCGTCGGACCACGCTGAG GCAGCGTCCCACATGCCACAACTAGAGGAACCC ACAACGAAGAATACACAACTATGTACCGGGGG GCTTTGGGGAGAAAAAGGAAAATAAAATCTTTA AAAAGCCACTTGG]AATACAGTATAAAAGATTC ACTGGTGTGGCAAGTTGTCTCTCAGACTGTACA GGCATTAAAATTTTGCTTGGCATTGCTCAAAAG CAAAAGAAAAGTAAAAGGAAGAAATAAGAGCA AGGAAAAAG(SEQIDNo.38) SNP1 A:C 66489613 3UTR TATATACCATCATTTTGATTATCCTTATACACTT GAATTTATATTGTATAATAGCATACTTGGTAAG ATGAAATTCCACAAAAATAGGAATGGTACACCA TATGCAAGTTTCCATTCCTATTGTGATTGATACA GTACATTAACAATCCACACCAATGGTGCTAATA CAAATAGGCTGAATGGCTGATGTCATCAGGTTT AT[C/A]AAATAAAAACATCCAATAAAATAATGT TTCTCCTTTCTTCAGGTGCATTTTCCAAATGGGG AATGGATTTTCTTTAATGAAAGAAGAATCATTT TTCTAGAGGTCAGGATTTAATTCTGTAGCATACT TGGAGAAACTGCATTACCTTAAAAGGCAGCCAA AAAGTATTCATTTTTATCAAAATTTCAAAATTGC AGCCTGCTTTTGCAACATTGCAGT(SEQIDNo. 24) SNP2 C:T 66489371 3UTR ATCCAATAAAATAATGTTTTCTCCTTTCTTCAGGT GCATTTTCCAAATGGGGAATGGATTTTCTTTAAT GAAAGAAGAATCATTTTTCTAGAGGTCAGGATT TAATTCTGTAGCATACTTGGAGAAACTGCATTA CCTTAAAAGGCAGCCAAAAAGTATTCATTTTTA TCAAAATTTCAAAATTGCAGCCTGCTTTTGCAA CATTGCAGTTTTATGATAAAATAATGGAAA[C/ T]GACTGATTCTGTCAATATTGTATAAAAAGACT TTGAGACAATTGCATTTATATAATATGTATACA ATATTGTTTTTGTAAATAAGCGTCTCCTTTTTTA TTTACTTTGGTATATTTTTACAGTCAGAACATTT CAAATTAAGTATTAAGGCACAAAGACATGTCAT GTATGACAGAAAAGCAACTGCTTATATTTCGGG GCAAATTAGCAGATTAAATAGTGGTCTTAAAAC TCCATATGCTAATGGTTAGA(SEQIDNo.25) SNP3 A:G 66489360 3UTR ATCCAATAAAATAATGTTTCTCCTTTCTTCAGGT GCATTTTCCAAATGGGGAATGGATTTTCTTTAAT GAAAGAAGAATCATTTTTCTAGAGGTCAGGATT TAATTCTGTAGCATACTTGGAGAAACTGCATTA CCTTAAAAGGCAGCCAAAAAGTATTCATTTTTA TCAAAATTTCAAAATTGCAGCCTGCTTTTGCAA CATTGCAGTTTTTATGATAAAATAATGGAAATG ACTGATTCT[G/A]TCAATATTGTATAAAAAGACT TTGAGACAATTGCATTTATATAATATGTATACA ATATTGTTTTTGTAAATAAGCGTCTCCTTTTTTA TTTACTTTGGTATATTTTTACAGTCAGAACATTT CAAATTAAGTATTAAGGCACAAAGACATGTCAT GTATGACAGAAAAGCAACTGCTTATATTTCGGG GCAAATTAGCAGATTAAATAGTGGTCTTAAAAC TCCATATGCTAATGGTTAGATGGTTATATTACA ATCATTTTATATTTTTTTACATTATTAACATTCA CTTATAGATTC(SEQIDNo.26) SNP4 A:T 66488313 3UTR TCAATTTCCAAATGCATTGCAGTTGGCAAGGGT ATATGGTCCTAGAGTTACAAGTTCTACTGAAGC CACAGGAACACAGGGAAGCTGCATCTTTTTTTC TAGCACTTAATGATACCAGCACATTTATCTGAG CTTTGGGGGTACCAATTTTCA[A/T]ATTGAATTG AAAAATAATCATAAAGTGCCTAGAAATTCTTAA GTGCAACACTGTACATAAATGTTTTTGAAGTGA ACTCTCTTCTCTACTGCTTATCAGTTTAGTAAGT TAGCTATAAAGCAGTGACTAAGTCTATGAG (SEQIDNo.27)
Example 3
MSTN Ins227bp Polymorphism (Chr18g.66493327Ins227b66495326)
[0159] This insertion polymorphism is located on Chromosome 18 of Equus caballus at position 66495327Ins227bp66495326 reverse strand of the Horse Genome Sequence (Equus caballus Version 2.0) which can be viewed at www.broad.mit.edu/mammals/horse/.
[0160] The horse genome EquCab2 assembly is a Whole Genome Shotgun (WGS) assembly at 6.79x and was released in September 2007. A female Thoroughbred named Twilight was selected as the representative horse for genome sequencing. (Wade C. M., el al Science 326, 865-7).
[0161] The project coordination and genome sequencing and assembly is provided by the Broad Institute. The N50 size Is the length such that 50% of the assembled genome lies in blocks of the N50 size or longer. The N50 size of the contigs is 112.38 kb, and the total length of all contigs is 2.43 Gb. When the gaps between contigs in scaffolds are included, the total span of the assembly is 2.68 Gb. The horse EquCab2 was annotated using a standard Ensembl mammalian pipeline. Predictions from vertebrate mammals as well as horse proteins have been given priority over predictions from non-vertebrate mammals. The set of predictions was been compared to 1:1 homologues genes in human and mouse, and missing homologs in the horse annotation have been recovered using exonerate. Horse and human cDNAs have been used to add UTRs to protein based predictions. The final gene-set comprises 20,737 protein-coding genes, 2,863 identified as pseudogenes and 1,580 classified as retro-transposed genes.
[0162] Further details of the Ins227bp structural polymorphism are as follows: [0163] Polymorphism: 66495327Ins227bp66495326 [0164] EquCab2.0 SNP_ID: not detected in EquCab2.0 database. No report of insertion in on-line bioinformatics resources, [0165] Genomic location of polymorphism: 5UTR [0166] Polymorphism type: Insertion
PGR Gel-Based Assay
[0167] A PCR-based assay tor allele size discrimination may be designed using the following primers:
TABLE-US-00009 (SEQIDNo.17) MI_FATCAGCTCACCCTTGACTGTAAC (SEQIDNo.18) MI_RTCATCTCTCTGGACATCGTACTG
[0168] Normal alleleProduct Size 600 bp
[0169] Insertion227bp alleleProduct size 827 bp
Example 4
Polymorphisms in Linkage Disequilibrium With MSTN-66493737 SNP
3UTR MSTN SNPs
[0170] Four SNPs in the 3UTR of MSTN (SNPs 1 to 4sec Tables 6 and 7 above) are in linkage disequilibrium with MSTN 66493737 (T/C) and may be used as alternative predictive tests for racing performance, either alone or in combination with MSTN-66493737 and/or other polymorphisms.
Ins227bp Polymorphism
[0171] Pairwise tests of linkage disequilibrium (LD) were performed between MSTN-g.66493737C/T and Ins227bp.
[0172] The LD between MSTN-66493737 and Ins227bp was r.sup.2=0.73
[0173] In the example below, with one exception (Sample 12) the Ins227bp polymorphism was in complete linkage disequilibrium with the C-allele MSTN_66493737 (T/C). Sample 12 may represent the result of a recombination event (evidence from heterozygous state at SNP2).
TABLE-US-00010 TABLE 8 Linkage disequilibrium of 3UTR SNPs, and MSTN - 66493737(T/C) Sample MSTN_66493737 SNP1 SNP3 ID (T/C). (Real) SNP2 (Real) SNP4 Insertion 7 C:C C:C T:T A:A A:A Insertion 227 bp/Insertion 227 bp 8 C:C C:C T:T A:A A:A Insertion 227 bp/Insertion 227 bp 9 C:C C:C T:T A:A A:A Insertion 227 bp/Insertion 227 bp 11 C:C C:C T:T A:A A:A Insertion 227 bp/Insertion 227 bp 12 C:C C:C C:T A:A A:A Insertion 227 bp/Normal 3 C:T A:C T:T A:G A:A Insertion 227 bp/Normal 4 C:T A:C T:T A:G A:A Insertion 227 bp/Normal 10 C:T A:C T:T A:G A:A Insertion 227 bp/Normal 13 C:T A:C T:T A:G A:A Insertion 227 bp/Normal 14 C:T A:C T:T A:G A:A Insertion 227 bp/Normal 2 T:T A:A T:T G:G A:A Normal/Normal 5 T:T A:A T:T G:G A:A Normal/Normal 6 T:T A:A T:T G:G A:A Normal/Normal 15 T:T A:A T:T G:G A:A Normal/Normal 1 T:T A:C T:T A:G A:T Normal/Normal
[0174] In 14 of the 15 sequenced samples. the Ins22.71bp allele was in concordance with the C-allele at g.66493737C>T. As complete concordance was not observed, we genotyped a set of n=1.65 samples to determine the extent of concordance between the Ins227bp and g.66493737C>T. polymorphisms. We performed parallel association tests for the same set of samples to evaluate the relative performance of the two polymorphisms as predictors of optimum racing distance. The g.66491737C>T SNP performed better in an association test with best race distance 5.2410.sup.13) than the Ins227bp polymorphism (P=55410.sup.10). Analysts of the sequence surrounding g.66493737C>T indicated that alternate alleles may result in the gain of a putative Homeobox C8/Hox-3alpha transcription factor binding site and/or the disruption of putative Distal-less homeobox 3, E2F and Pdx1 transcription factor binding sites.
Chromosome 18 SNPs
[0175] Pairwise tests of linkage disequilibrium (LD) were performed between g.66493737C>T and the 1,373 chromosome 18 SNPs represented on the genotyping array (Equine SNP50 genotyping BeadChips). LD was highest between g.66493737C>T and BIEC2-417495 (r.sup.2=0.86). Seven discrete haplotype blocks were identified in the 1.7 Mb peak of association on chromosome 18. The g.66493737C>T SNP was included in block 3; BIEC2-417495 was included in block 6 (
SUMMARY
[0176] We focused on comprehensively evaluating variation in the XfSTN gene by re sequencing 2 kb of the 3 and 5 flanking sequences. Four novel 3UTR SNPs and a 227 bp SINE insertion (Ins227bp) polymorphism located 146 bp upstream of the coding region start site were identified (see Example 2 above). We investigated whether the 3UTR SNPs may abrogate existing or create de novo putative miRNA binding sites, as has been described for MSTN influenced phenotypic variation in Texel sheep (Clop et al 2006). However, there was no evidence for alterations in putative miRNA binding sites. Next, because of the close proximity to the transcriptional start site, we considered the Ins227bp polymorphism as a strong functional candidate contributing to variation in racing performance. However, a comparative evaluation of association using the same set of samples (n=165) demonstrated that the g.66403737C>T SNP displayed a stronger association (P=5.2410.sup.13) with best race distance than the Ins227bp polymorphism (P=5.5410.sup.10).
[0177] An evaluation of LD showed that the strongest association was between g.66493737C>T and the most significant. SNP in the GWAS study, BIEC2-417495. A comparison of trait association in the same set of samples (n=118) confirmed the superior power of the g.664937370T SNP (P=1.0210.sup.10) in the prediction of best race distance when compared with BIEC2-417495 (P.sub.unadj.=1.6110.sup.9). The significance values and genotype frequencies for the top SNPs in the GWAS and the g.6649373C>T SNP are shown in Table 9. In addition, we investigated whether g.66493737C>T may interact with other SNPs represented on the EquineSNP50 genotyping array; however, no significant interaction was observed to influence best race distance (P>0.0001 for all interactions). Therefore, the effect of genotype on racing phenotype is highly likely a result of the previously reported variation in the MSTN gene at locus g.66493737C>T.
TABLE-US-00011 TABLE 2 Significance values (unadjusted and Bonferroni corrected P values) for the top SNPs associated with optimum race distance. CHR SNP UNADJ P BONF. P A1 A2 A11 A12 A22 18 g.66493737C > T 1.02E10 N/A T C 0.1538 0.5962 0.2500 18 BIEC2-417495 1.61E09 6.58E05 T C 0.1709 0.5983 0.2308 18 BIEC2-417423 3.55E08 0.001454 G A 0.1017 0.5169 0.3814 18 BIEC2-417372 6.21E08 0.002545 G A 0.0932 0.5424 0.3644 18 BIEC2-417274 8.08E08 0.003312 T G 0.1864 0.6017 0.2119 18 BIEC2-417210 3.13E07 0.01281 C T 0.2119 0.5763 0.2119 18 BIEC2-417524 4.87E07 0.01995 G A 0.1186 0.5763 0.3051 18 BIEC2-417507 5.09E07 0.02086 C A 0.1368 0.5897 0.2735
[0178] A11: genotype frequency for homozygotes (allele 1) in the population (n=118); A12: genotype frequency for heterozygotes; A22 genotype frequency for homozygotes (allele 2). Correction for multiple testing was not applied for g.66493737C>T; however, the association remains stronger (P.sub.Bonf.=4.1810.sup.6) after application of a correction factor.
[0179] It is important to note that the sample size used for the present study is relatively small. However, the results of the quantitative trait GWAS demonstrate that the sample size used was sufficient to detect a major genetic effect such as that manifested at the MSTN locus. A lower sample size requirement for GWAS in the Thoroughbred is supported by population genomics analyses of this population in comparison to other horse breeds. These demonstrate that the extent of LD in the Thoroughbred is significantly greater than that measured in other horse populations, being comparable to LD estimates in inbred dog breeds (Wade et al 2009). The high LD in Thoroughbreds is a reflection of low effective population size, which enables detection of associations with smaller sample sizes.
Example 5
Haplotype Analysis in the Region of MSTN
[0180] Genotypes for a subset of n=182 (C/C n=102, T/T n=80) horses were extracted from data generated for a sample of n=368 Thoroughbred DNA samples genotyped using EquineSNP50 Genotyping BeadChips (Illumina, San Diego, Calif.). DNA was quantified using Quant-iT PicoGreen dsDNA kits (Invitrogen, Carlsbad, Calif.) according to the manufacturers instructions and the DNA concentrations were adjusted to 20 ng/l. The EquineSNP50 Genotyping BeadChip (Illumina, San Diego, Calif.) contains approximately 54,000 SNPs ascertained from the EquCab2 SNP database of the horse genome and has an average spacing of 43.2 kb between adjacent variants. Genotyping was performed by laboratories at AROS Applied Biotechnology. Denmark and GeneSeek, USA. The samples genotyped for the present study were a subset of samples genotyped in three separate batches (Batch 1, n=96; Batch 2, n=92; Batch 3, n=228), We included four pairs of duplicate samples between Batch 1 and Batch 2, two additional pairs of duplicate samples between Batch 2 and Batch 3 and two pairs of duplicate samples within Batch 3 for QC purposes and observed greater than 99.9% concordance in seven of the eight pairs. A parent offspring trio was also included to verify Mendelian transmission of SNPs. We successfully genotyped 53,922 loci. All samples had a genotyping rate >90%. We omitted SNPs which had a genotyping completion rate <90% were monomorphic or had minor allele frequencies (MAF) <5% in our samples. We omitted 18,109 SNPs leaving 35,813 SNPs in our working build of the data and the overall genotype completion rate was 99.9%.
[0181] SNPs spanning a 1.7 Mb region on ECA18 containing the MSTN gene were extracted from the data. Haploview was used to calculate pairwise measures of LD among the 47 SNPs and was employed to create a visual representation of the data. Using the default method, the region was divided into blocks of strong LD using a standard block definition (Gabriel et al, 2002) based on confidence intervals for strong LD and minor allele frequencies >0.05.
[0182] We re-constructed haplotypes in n=204 C-chromosomes and n=160 T-chromosomes in C/C and T/T Thoroughbreds only, for 46 SNPs (BIEC2-4I7187-BIEC2-417520) extracted from the Equine SNP50BeadChip and the MSTN g.66493737C/T variant. The 47 SNP-haplotypes (
[0183] Further haplotype analysis detected no background variation (MAF>0.05) on C-chromosomes (i.e. g.66493737C) between BIEC2-417333 and BIEC2-417372, i.e. an invariable 273096 kb haplotype block, containing both the Ins227bp polymorphism and g.66493737C>T SNP.
Example 6
Assays for Predicting the Athletic Performance Potential of a Subject
[0184] The test for speed/stamina described in PCT/IE2009/000062, the entire contents of which is incorporated herein by reference, may be designed alternatively using an assay for any genetic variants in linkage disequilibrium with locus MSTN_66493737 (T/C). For example, the Ins227bp polymorphism or BTFC2-417495. Alternatively, an assay for predicting the athletic performance potential of a subject may be based on a combination of more than one polymorphism.
[0185] Validation of a test for association may be performed by genotyping 192 samples for validation of linkage between Ins227bp and MSTN_66493737 (T/C) and association with retrospective racing performance traits (e.g. Best race distance). The Ins227bp genotypes will similarly be predictive of best race distance and may correlate with predictions based on the MSTN_66493737(T/C) SNP. Examples of prediction of phenotypes are given in
[0186] The Ins227bp polymorphism is located 1590 bp from the g.66493737C>T SNP.
[0187] The greater association between g.66493737C>T and best race distance than the Ins227bp polymorphism does not preclude the Ins227bp polymorphism being the functional variant. Functional studies will need to be performed to determine the functional variant.
[0188] Notwithstanding this, both/either of these polymorphisms may be used to predict best race distance.
[0189] Thoroughbred horses excel in both sprint (<1,500 m ) and longer distance (>1,800 m) races. Horses competing in middle distance races (miters and middle distance) may be considered either sprinters or stayers and the way in which a race is executed by the rider often reflects the trainer's perceived sprinting and endurance ability of the horse. Within the industry horses may be described as sprinters based on their conformation and usually have a stockier and more muscular stature and are faster maturing. They usually race as 2 year olds and over shorter distances as 3 year olds. Individuals perceived to be longer distance animals may be referred to as backward requiring more time to mature and running over longer distances as 3 year olds. In some regions (e.g. Australia) breeders attempt to breed only faster sprint type horses. For example, in the USA Group 1 races>10 f are limited (9% USA, 23% Australia, 28% Britain,) and in Australia 37% of Group 1 races are competed over distances 5-7 f compared to 20% in USA and just 12% in Britain. These selection pressures favour C-alleles, which is reflected in the distribution of genotypes among a sample of elite mares and stallions sampled in Australia (n=43; C/C, 0.41; C/T, 0.47; T/T, 0.12).
[0190] In some aspects, the invention provides a simple DNA based method (genotype test) for predicting the elite sprint race performance of a thoroughbred race horse based on the presence or absence of a SNP or other structural DNA variant (e.g. insertion polymorphism) in one or more exercise response gene. For example the genotype test may be based on a SNP or insertion polymorphism in the MSTN gene and flanking sequences. Details of the SNPs and insertion polymorphism that may be used to predict, the elite sprint race performance of a thoroughbred race horse are given in the appendices. It will be appreciated that the genotypic test may be based on a combination of any one or more of these polymorphisms.
Applications of the Assay
[0191] Considering the association between DNA variants such as Chr18g.66495327Ins227bp66495326 and MSTN 66493737 (T/C) the test may be applied in practice in the following ways:
[0192] 1. Young Stock (Foals and Yearlings)
[0193] Informed selection and sales decisions can lie made to: [0194] identify sprinters [0195] identify middle-distance/potential Derby winners with speed [0196] identify individuals with enhanced stamina
[0197] 2. Horses-In-Training
[0198] Operating costs can be reduced and racing strategy can be fine tuned by: [0199] identifying the most precocious two-year olds [0200] horses can be trained and raced for optimal racing distance
[0201] 3. Broodmares
[0202] Breeding outcomes can be optimised by: [0203] Focusing on optimal breeding mares [0204] selecting compatible stallions
[0205] 4. Stallions
[0206] A stallions potential can be promoted by: [0207] predicting stamina index for young stallions (5 year advantage) [0208] attracting compatible marcs to enhance stallion profile
[0209] For example, tor the Ins227bp polymorphism for foals, young stock and horses-in-training selection of individuals may be made for individuals most likely to perform well as two year olds (Ins227bp/Ins227bp and Ins22bp/Normal) and against backward individuals (industry terminology for less physically developed young Thoroughbreds) that may benefit from waiting to race until they are three years old (Normal/Normal). Breeding objectives may be more confidently met by selecting Ins227bp/Ins227bp individuals for short distance racing, Ins227bp/Normal individuals for middle-distance racing and Normal/Normal individuals for racing requiring greater stamina. For stallion owners, prediction of a stallion's genetic stamina index at the outset of a stud career (five years are required to estimate S.I. from retrospective three year old progeny racing performance) will immediately enhance a young stallion's profile and promote their genetic potential to marc owners. This in turn will enable mare owners, with targeted breeding strategics, to better select stallions to achieve specific breeding objectives. To eliminate uncertainty from a mating outcome (unless both sire and dam are homozygous) it will be necessary to genotype the foal, enabling selection of individuals for a targeted breeding outcome.
Example 7
Application of the Assay to Determine Speed Measured by GPS
[0210] We hypothesized that speed parameters measured using field technologies (GPS) in a cohort of horses-in-training may be influenced by g.66493737C>T genotypes at the myostatin locus.
Study Animals and Training Protocol
[0211] A subset of horses (n=85) from a group of Thoroughbred Flat racehorses in (n=102) previously evaluated from a single training stable for physiological performance parameters during training (March-November) in 2007 and 2008 (Fonseca et al., 2010) were included in the current study. The horses included were chosen based on their training stage and fitness in order to make up the most homogeneous group. The study cohort comprised of 55 two-year-olds (18 males and 37 females) and 30 three-year-olds (11 males and 19 females). The criteria for inclusion in the study cohort were each horse must have completed at least 2 WDs prior to the GPS recording (i.e. GPS recordings were taken for 3 accWD) and had for which satisfactory GPS and HR recordings for work days (WD, an exercise workout which simulates a nice) in the training period (March to November 2007 or March to November 2008); the GPS and HR data associated with the greatest number of accumulated WD (accWD) for each horse was used.
[0212] The training protocol for the horses has been described previously (Fonseca et al., 2010). Briefly, horses were trained six days per week on an outdoor all-weather gallop 1,500 m in length with a 2.7% incline for the final 800 m. The training program consisted of progressive stages gradually introducing fast workouts (WD) as training progressed. WD generally consisted of gallop distances 800-1,000 m. Training was modified and adapted to each individual animal based on soundness, fitness and aptitude. Following the onset of WD, horses were entered into competitive races dependant on their perceived fitness and performance. All decisions on the training and racing schedule were made by a single trainer.
Experimental Protocol and Data Collection
[0213] Measured data were only recorded for horses undergoing a WD which has been previously described (Fonseca et al. 2010). Each jockey carried a hand-sized GPS unit (GPSports Systems SP110). After data collection and at the end of each day the GPS data were downloaded to an equine-specific software programme (Race watch Software, GPSports Systems SP110). The GPS unit recorded variables including speed, time and distance as well as the exact map of each horse's exercise. Prior to the onset of the study, the entire gallop had been pre-recorded using one of the GPS units as previously described (Fonseca et al. 2010).
Phenotypes
[0214] All speed measurements were recorded from a distance of 800 m from the finish line as the total distance exercised on a WD differed slightly for each horse. Speed indices evaluated were based on previous work by Fonseca et al. (2010) and included maximal velocity duration at V.sub.max (V.sub.maxt), distance (m) travelled during six seconds before V.sub.max (V.sub.maxDGb), distance (m) travelled during six seconds after V.sub.max (V.sub.maxD6m) and distance (m) travelled during six seconds before and after V.sub.max (V.sub.maxD6).
DNA Extraction and MSTN Polymorphism Genotyping
[0215] Genomic DNA was extracted from fresh whole blood using the Maxwell 16 automated DNA purification system (Promega, Wis., USA). Genotyping was carried out using Taqman chemistry on the StepOnePlus Real-Time PCR System (Applied Biosystems, Calif., USA). The assay consisted of forward primer 5-CCAGGACTATTTGATAGCAGAGTCA (SEQ ID No. 28). reverse primer 3-GACACAACAGTTTCAAAATATTGTTCTCCTT (SEQ ID No. 29) and two allelic-specific fluorescent dye labeled probes (VIC-AATGCACCAACTAATTT (SEQ ID No. 30); 6-FAM-ATGCACCAAATAATTT) (SEQ ID No. 31).
Statistical Analyses
[0216] Tests of association were performed using the PLINK Version 1.05 software package (Purcell; Purcell et al 2007). The linear regression model was used to evaluate quantitative trait association at NSTNg.66493737C>T with the phenotypes: V.sub.max, V.sub.maxt, V.sub.maxD6a and V.sub.maxDG. The following were included as covariatcs in the analyses as they had all been found to contribute to variation in speed indices (Fonseca et al, 2010): Age, Sex, accWD, Jockey and Going.
Results
MSTN Genotypes
[0217] MSTNg.66493737C>T genotypes were determined for all individuals in the study. T here were 21 (24.7%) C/C, 44 (51.7%) C/T and 20 (23.5%) T/T individuals, representing a normal distribution of the genotypes previously observed among a large cohort of Flat racehorses (Hill et al., 2010, the entire contents of which is incorporated herein by reference).
MSTN Genotype Association With Speed Indices
[0218] MSTNg.66493737C>T genotypes were significantly associated with V.sub.maxD6 (P=0.0040), V.sub.maxt (P=0.0249), V.sub.max(P=0.0265) and V.sub.maxD6a(P=0.0317) (Table 10). For each speed index the C/C cohort out-performed the C/T and T/T cohorts (Table 11). The mean distance (m) travelled was 3.8 m and 1.2 m greater in the C/C (195.7 m; 98.2 m) than the T/T (191.9 m: 96.9) cohort during the 6 seconds before and after V.sub.max(V.sub.maxD6) and during the 6 seconds after V.sub.max(V.sub.maxD6a). V.sub.max was 0.31 m/s faster in the C/C (16.6 m/s) cohort than the T/T (16.29 m/s) cohort and was maintained (Y.sub.maxt) 2.05 s longer in the C/C (7.3 s) than the T/T (5.25 s) cohort
TABLE-US-00012 TABLE 10 Association test results between measured speed variables and the MSTNg.66493737C > T SNP TEST NMISS BETA STAT P Acc6b ADD 78 0.0074 0.5426 0.5893 GENO_2DF 78 0.2990 0.8611 Dist6 ADD 74 2.4790 3.1470 0.0026 GENO_2DF 74 11.0500 0.0040 Dist6a ADD 78 0.7972 1.9090 0.0608 GENO_2DF 78 6.9040 0.0317 Dist6b ADD 75 0.8968 0.1695 0.8660 GENO_2DF 75 1.3920 0.4985 Tvmax ADD 81 1.0640 2.1040 0.0392 GENO_2DF 81 7.3850 0.0249 Vmax ADD 85 0.1613 2.5260 0.0138 GENO_2DF 85 7.2620 0.0265
TABLE-US-00013 TABLE 11 Mean values for speed parameters for each genotype. GENO T/T T/C C/C CC:TT Dist6 (m) MEAN 191.9 194.7 195.7 3.8 Dist6a (m) MEAN 96.93 98.23 98.16 1.23 TVmax (s) MEAN 5.25 7.366 7.3 2.05 Vmax (m/s) MEAN 16.29 16.48 16.6 0.31
These data have demonstrated that genotypes at the MSTNg.66493737C>T locus have a significant influence in the determination of individual differences in speed
Example 8
MSTN Gene Expression in Resting Skeletal Muscle Before and After Training
[0219] The MSTNg.66493737C>T SNP has been found to be significantly associated with Thoroughbred horse racing phenotypes and significant reductions in Thoroughbred skeletal muscle gene expression for three 17 bp transcripts 400-1,500 base pairs downstream of the MSTN gene following a period of training have been observed (McGivney et al 2010 BMC Genomics, the entire contents of which is incorporated herein by reference). Together these findings demonstrate that the identified MSTN genotypes may influence MSTN gene expression. To investigate this. MSTN miRNA expression was measured in biopsies from the middle gluteal muscle from 60 untrained yearling Thoroughbreds (C/C, n=15; C/T, n=28; T/T, n=17) using two independent real time qRT-PCR assays. MSTN gene expression was also evaluated in a subset (n=33) of these animals using muscle RNA samples collected after a ten-month period of training. A significant association was observed between genotype and mRNA abundance for the untrained horses (assay I, P=0.0237: assay II, P=0.003559), with the C/C cohort having the highest MSTN mRNA levels, the T/T group the lowest levels and the OT group intermediate levels. Following training there was a significant decrease in MSTN mRNA (3.35-fold; P=6.910.sup.7) which was most apparent for the C/C cohort (5.88-fold, P=0.001). These results show a significant association between phenotype, genotype and gene expression at the MSTN gene in Thoroughbred racehorses.
MSTN Gene Expression
[0220] MSTN mRNA expression in two independent real-time qRT-PCR assays (Table 12) has been investigated in resting skeletal muscle (gluteus medius) from biopsy samples that had been collected for n=60 untrained yearlings (C/C, n=15; C/T, n=28: T/T, n=17).
TABLE-US-00014 TABLE12 PrimersequencesforqRT-PCRassaysforMSTNgeneexpressionandTTN referencegeneexpression PrimerName TargetGene Location Sequence TTN_FOR Titin(TTN) Exon357 gcatgacacaactggaaagc(SEQIDNo.32) TTN_REV Titin(TTN) Exon357 aactttgccctcatcaatgc(SEQIDNo.33) MSTN1-2_FOR Myostatin(MSTN) Exon1 tgacagcagtgatggctctt(SEQIDNo.34) MSTN1-2_REV Myostatin(MSTN) Exon2 ttgggttttccttccacttg(SEQIDNo.35) MSTN2-3_FOR Myostatin(MSTN) Exon2 ttcccaagaccaggagaaga(SEQIDNo.36) MSTN2-3_REV Myostatin(MSTN) Exon3 cagcatcgagattctgtgga(SEQIDNo.37)
[0221] We found a significant association with genotype for the MSTN 66493737 (T/C) SNP (P=0.003559). The C/C genotype cohort had higher MSTN mRNA levels (654.3354.3; 613.7327.0) than either of the C/T (405.7234.1; 368.6213.6) and T/T (350.1185.5; 348.1167.2) cohorts (
[0222] It was also found that MSTN gene expression is significantly down-regulated (4.2-fold, P=0.0043) following a period of training. In the Thoroughbred horse skeletal muscle transcriptorne the greatest reduction in gene expression following a period of training is MSTN gene expression.
[0223] Results from analyses of gene expression generated since our initial report [Hill et al, 2010, the entire contents of which is incorporated herein by reference] of an association between MSTN genomic variation and optimum racing distance in Thoroughbreds support the hypothesis that the MSTN gene is functionally relevant to racing performance variation, in a transcriptome-wide investigation using digital gene expression (DGE) technology, we identified the greatest alteration in mRNA abundance in transcripts from MSTN in Thoroughbred skeletal muscle following a ten-month period of exercise training. Seventy-four annotated transcripts were differentially expressed between pre- and post-training states and among the 58 genes with decreased expression. MSTN mRNA transcripts were the most significantly reduced (4.2-fold, P=0.0043) (McGivney et al 2010, the entire contents of which is incorporated herein by reference).
Example 9
[0224] The mechanism by which the g.66493737C>T sequence variant may affect the muscle phenotype in horses is not clear; however we propose a direct effect of the SNP on the control of myocyte development. Myostatin is a growth and differentiation factor (GDF8) that functions as a negative regulator of skeletal muscle mass development and results in hypertrophied muscle phenotypes in a range of mammalian species, including horse. Consistent with this role myostatin has been shown to repress the proliferation and differentiation of cultured myocytes (Thomas et al. 2000; Langley et al 2002; Joulia et al. 2003). The proliferation of myoblasts is determined by the control and progression of the cell cycle, a role which has been assigned to members of the E2F family of transcription factors (Polager & Ginsberg 2009). The g.66493737C>T SNP is located within the sequence of a putative E2F transcription factor binding site in intron I of the MSTN gene. It may therefore be plausible to propose a mechanism by which allele-specific binding of E2F to myostatin influences the growth and development of myocytes following signalling from upstream effector proteins such as retinoblastoma protein (Hallstrom & Nevins 2009). Genotype-specific gene expression studies will shed light on the allele-specific effect on function.
[0225] The predictive tests described herein may be applied to select individuals with high or low genetic potential for racing success. These tests can be performed on an individual at any stage in the life cycle e.g. Day 1 (birth), prior to sales (i.e. yearlings, 2 year olds etc), during racing career (i.e. from 2 years old), during breeding (i.e. up to approx 25 years). Also, the tests may be applied to select appropriate stallion mare matches for mating based on the genetic make-up of mare and stallion.
[0226] Modifications and additions can be made to the embodiments of the invention described herein without departing from the scope of the invention. For example, while the embodiments described herein refer to particular features, the invention includes embodiments having different combinations of features. The invention also includes embodiments that do not include all of the specific features described.
[0227] The invention is not limited to the embodiments hereinbefore described, which may be varied in construction and detail.
REFERENCES
[0228] Ballard J. W. & Dean M. D. (2001) The mitochondrial genome: mutation, selection and recombination. Curr Opin Genet Dev 11, 667-72.
[0229] Barrett J. C., Fry B., Maller J. & Daly M. J. (2005) Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics 21, 263-5.
[0230] Barrett J. C. (2009) Haploview: Visualization and analysis of SNP genotype data. Cold Spring Harb Protoc 2009, pdb ip71.
[0231] Barrey E., Valette J. P., Jouglin M., Blouin C. & Langlois B. (1999) Heritability of percentage of fast myosin heavy chains in skeletal muscles and relationship with performance. Equine Vet J Suppl 30,289-92.
[0232] Blier P. U., Dufresne F. & Burton R. S. (2001) Natural selection and the evolution of mtDNA-encoded peptides: evidence for intergenomic co-adaptation. Trends Genet 17, 400-6.
[0233] Bray M S, Hagberg J M, Prusse L, Rankinen T, Roth S M, Wolfarth B, Bouchard C. The human gene map for performance and health-related fitness phenotypes: the 2006-2007 update. Med Sci Sports Exerc. 2009 January; 41(1):35-73.
[0234] Buitrago M., Lorenz K., Maass A. H., Oberdorf-Maass S., Keller V., Schmitteckert E. M., Ivashchenko Y., Lohse M. J. & Engelhardt S. (2005) The transcriptional repressor Nab1 is a specific regulator of pathological cardiac hypertrophy, Nat Med 11, 837-44.
[0235] Cartharius K., Freeh K., Grole K., Klocke B., Haltmeier M., Klingenhoff A., Frisch M., Baverlein M. & Werner T. (2005) MatInspector and beyond: promoter analysis based on transcription factor binding sites. Bioinformatics 21, 2933-42.
[0236] Clop A., Marcq F., Takeda H., Pirottin D., Tordoir X., Bibe B., Bouix J., Caiment F., Risen J. M., Eychenne F., Larzul C., Laville E., Meish F., Milenkovic D., Tobin J., Charlier C. & Georges M. (2006) A mutation creating a potential illegitimate microRNA target site in the myostatin gene affects muscularity in sheep. Nat Genet 38. 813-8.
[0237] Cunningham E P. Dooley J J, Splan R K, Bradley D G. Microsatellite diversity, pedigree relatedness and the contributions of founder lineages to Thoroughbred horses. Anim Genet. 2001 December; 32(6):360-4.
[0238] Das J. (2006) The role of mitochondrial respiration in physiological and evolutionary adaptation. Bioessays 28,890-901.
[0239] Dempsey and Wagner 1999 Exercise-induced arterial hypoxemia J Appl Physiol. 1999 December; 87(6):1997-2006. Review. PMID: 10601141
[0240] Fukuda R, Zhang H, Kim J W, Shimoda L, Dang C V, Semenza GL.HIF-1 regulates cytochrome oxidase subunits to optimize efficiency of respiration in hypoxic cells. Cell, 2007 Apr. 6; 129(1):111-22.
[0241] Gordon D. Abajian C. Green P. Consed: a graphical tool for sequence finishing. Genome Res. 1998 March; 8(3):195-202.
[0242] Gramkow and Evans 2006 Gramkow H L, Evans D L. Correlation of race earnings with velocity at maximal heart rate during a field exercise test in Thoroughbred racehorses. Equine Vet J Suppl. 2006 August; (36):118-22. PMID: 17402405.
[0243] Grobet L., Martin L. J., Poncelet D., Pirottin D., Brouwers B., Riquet J., Schoeberlein A., Dunner S., Menissier F., Massabanda J., Fries R., Hanset R. & Georges M. (1997) A deletion in the bovine myostatin gene causes the double-muscled phenotype in cattle. Nat Genet 17, 71-4.
[0244] Gu J, Orr N, Park S D, Katz L M, Sulimova G, MacHugh D E, Mill E W. A genome scan for positive selection in thoroughbred horses. PLoS One. 2009 Jun. 2; 4(6):e5767.
[0245] Gunn H M. Muscle, bone and fat proportions and muscle distribution of thoroughbreds and quarter horses. In: Gillespie J R. Robinson N E eds. Equine exercise physiology 2. Davis, C A: ICEEP; 1987:253-264.
[0246] Gunn H. M. (1987) Muscle, bone and fat proportions and muscle distribution of thoroughbreds and quarter horses. In: Equine exercise physiology 2: Proceedings of the Second international Conference on Equine Exercise Physiology; San Diego, Calif. Aug. 7-11, 1986 (eds. By Gillespie J R & Robinson N R), pp. xiii, 810p. ICEEP Publications, Davis, Calif.
[0247] Harkins et al., 1993 Harkins J D, Hackctt H P, Ducharme N G. Effect of furosemide on physiologic variables in exercising horses. Am J Vet Res. 1993 December; 54(12):2104-9.PMID: 8116946
[0248] Hallstrom T. C. & Nevins J R. (2009) Balancing the decision of cell proliferation and cell fate. Cell Cycle 8, 532-5.
[0249] Hill E. W., McGivney B. A., Gu J., Whiston R. & Machugh D. E. (2010) A genome-wide SNP-association study confirms a sequence variant (g.66493737C>T) in the equine myostatin (MSTN) gene as the most powerful predictor of optimum racing distance for Thoroughbred racehorses. BMC Genomics 11, 552.
[0250] Hoppeier and Vogt, 2001 Muscle tissue adaptations to hypoxia.J Exp Biol 2001 September; 204(Pt 18):3133-9. Review.PMID: 11581327
[0251] Jorgensen T. J., Ruczinski I., Kessing B., Smith M. W., Shugart Y. Y. & Alberg A J. (2009) Hypothesis-driven candidate gene association studies: practical design and analytical considerations. Am J Epidemiol 170, 986-93.
[0252] Joulia D., Bernardi H., Garandel V., Rabenoelina F., Vernus B. & Cabello G. (2003) Mechanisms involved in the inhibition of myoblast proliferation and differentiation by myostatin, Exp Cell Res 286, 263-75.
[0253] Langley B., Thomas M., Bishop A., Shanna M., Gilmour S. & Kambadur R. (2002) Myostatin inhibits myoblast differentiation by down-regulating MyoD expression. J Biol Chem 277,49831-40.
[0254] Love S, Wyse C A, Stirk A J, Stear M J, Culver P, Voute L C, Mellor D J. Prevalence, heritability and significance of musculoskeletal conformational traits in Thoroughbred yearlings. Equine Vet J. 2006 November; 38(7):597-603.PMID: 17228572
[0255] Martin Flck 2006 Functional, structural and molecular plasticity of mammalian skeletal muscle in response to exercise stimuli. The Journal of Experimental Biology 209, 2239-2248
[0256] Matoba S. Kang J G, Patino W D, Wragg A, Boehm M, Gavrilova O, Hurley P J, Bunz F, Hwang P M. p53 regulates mitochondrial respiration. Science. 2006 Jun. 16:312(5780):1650-3. Epub 2006 May 25.
[0257] McGivney B. A., Eivers S. S., MacHugh D. E., MacLeod J. N., O'Gorman G. M., Park S. D., Katz L. M. & Hill E. W. (2009) Transcriptional adaptations following exercise in thoroughbred horse skeletal muscle highlights molecular mechanisms that lead to muscle hypertrophy. BMC Genomics 10, 638.
[0258] McGivney B. A., McGettigan P. A., Browne J. A., Evans A. C., Fonseca R. G., Loftus B. J., Lohan A., MacHugh D. E., Murphy B. A., Katz L. M. & Hill E. W. (2010) Characterization of the equine skeletal muscle transcriptome identifies novel functional responses to exercise training. BMC Genomics 11, 398.
[0259] McPherron A. C., Lawler A. M. & Lee S. J. (1997) Regulation of skeletal muscle mass in mice by a new TGF-beta superfamily member. Nature 387, 83-90.
[0260] McPherron A. C. & Lee S J. (1997) Double muscling in cattle due to mutations in the myostatin gene. Proc Natl Acad Sci USA 94. 12457-61.
[0261] Meiklejohn C D., Montooth K. L. & Rand D. M. (2007) Positive and negative selection on the mitochondrial genome. Trends Genet 23, 259-63.
[0262] Mosher D S, Quignon P. Bustamante C D, Sutter N B, Mellersh C S, Parker H G, Ostrander E A. A mutation in the myostatin gene increases muscle mass and enhances racing performance in heterozygote dogs. PLoS Genet. 2007 May 25;3(5):e79. Epub 2007 Apr. 30.
[0263] Polager S. & Ginsberg D. (2009) p53 and E2f: partners in life and death. Nat Rev Cancer 9, 738-48.
[0264] Purcell S. PLINK version 1.05. URL http://pngu.mgh.harvard.edu/purcell/plink/. Purcell S., Neale B., Todd-Brown K., Thomas L., Ferreira M. A., Bender D., Maller J., Sklar P., de Bakker P. I., Daly M. J. & Sham P. C. (2007) PLINK: a tool set for whole-genome association and population-based linkage analyses. Am J Hum Genet 81, 559-75.
[0265] Revington M. Haematology of the racing Thoroughbred in Australia 2: haematological values compared to performance. Equine Vet J. 1983 April, 15(2): 145-8. PMID: 6873047
[0266] Rivero J L, Ruz A, Marti-Korff S, Estepa J C, Aguilera-Tejero E, Workman J, Sobotta M, Lindner A. Effects of intensity and duration of exercise on muscular responses to training of Thoroughbred racehorses. J Appl Physiol. 2007 May; 102(5):1871-82. Epub 2007 Jan. 25.PMID:17255370.
[0267] Rivero J.-L., L, & Piercy R. J. (2008) Muscle physiology: responses to exercise and training. In: Equine exercise physiology: the science of exercise in the athletic horse (eds. by Hinchcliff K W, Kaneps A J & Geor R J), pp. ix, 463 p. Elsevier Saunders, Edinburgh.
[0268] Rivero J. L., Serrano A. L., Henckel P. & Aguera E. (1993) Muscle fiber type composition and fiber size in successfully and unsuccessfully endurance-raced horses. J Appl Physiol 75, 1758-66.
[0269] Rozen S. & Skaletsky H. (2000) Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol 132, 365-86.
[0270] Saleem A, Adhihetty P J, Hood D A. Role of p53 in mitochondrial biogenesis and apoptosis in skeletal muscle. Physiol Genomics. 2009 Mar. 3;37(1 ):58-66. Epub 2008 Dec. 23.Link
[0271] Sambrook, J. and D, Russell (2001). Molecular Cloning; A Laboratory Manual, Cold Spring Harbor Laboratory.
[0272] Schuelke M., Wagner K. R., Stolz L. E., Hubner C., Riebel T., Komen W., Braun T., Tobin J. F. & Lee S. J. (2004) Myostatin mutation associated with gross muscle hypertrophy in a child. N Engl J Med 350, 2682-8.
[0273] Seaman J, Erickson B K, Kubo K, Hiraga A, Kai M, Yamaya Y, Wagner P D. Exercise induced ventilation/perfusion inequality in the horse.Equine Vet J. 1995 March; 27(2):104 9/PMID: 7607141
[0274] Suzanne S. Eivers, Beatrice A. McGivney, Rita G. Fonseca. David E. MacHugh, Katie Menson. Stephen D. Park, Jose-Luis L. Rivero, Cormac T. Taylor, Lisa M Katz and Emmeline W. Hill* Exercise-induced skeletal muscle gene expression in unconditioned and conditioned Thoroughbred horses and associations with physiological variables. Physiological Genomics, In Preparation (2009)
[0275] Taylor C T, Colgan S P. Therapeutic targets for hypoxia-elicited pathways.Pharm Res, 1999 October; 16(10): 1498-505. Review. PMID: 10554089.
[0276] Tabor H. K., Risch N. J. & Myers R. M. (2002) Opinion: Candidate-gene approaches for studying complex genetic traits: practical considerations, Nat Rev Genet 3. 391-7.
[0277] Thiel G., Kaufmann K., Magin A., Lietz M., Bach K. & Cramer M. (2000) The human transcriptional repressor protein NAB1: expression and biological activity. Biochim Biophys Acta 1493, 289-301.
[0278] Thomas M., Langley B., Berry C., Sharma M, Kirk S., Bass J. & Kambadur R. (2000) Myostatin, a negative regulator of muscle growth, functions by inhibiting myoblast proliferation. J Biol Chem 275, 40235-43.
[0279] van Baren M. J. & Heutink P. (2004) The PCR suite. Bioinformatics 20, 591-3.
[0280] van Deurscn et al. 1993 Skeletal muslces of mice deficient in muscle creatine kinase lack burst activity Cell 74: 621-631.
[0281] Wade C. M., Giulotto E., Sigurdsson S., Zoli M., Gnerre S., Imsland F., Lear T. L., Adelson D. L., Bailey E., Bellone R. R., Blocker H., Distl O., Edgar R. C., Garber M., Leeb T., Maucefi E., MacLeod J. N., Penedo M. C., Raison J. M., Sharpe T., Vogel J., Andersson L., Antezak D. F., Biagi T., Binns M. M., Chowdhary B. P., Coleman S. J., Della Valle G., Frye S., Guerin G., Hasegasva T., Mill E. W., Jurka J., Kiialainen A., Lindgren G., Liu J., Magnani E., Mickelson J. R., Murray J., Nergadze S. G., Onofrio R., Pedroni S., Piras M. F., Raudsepp T., Rocchi M., Roed K. H., Ryder O. A., Searle S., Skow L., Swinburne J. E., Syvanen A. C., Tozaki T., Valberg S. J., Vaudin M., White J. R., Zody M. C., Lander E. S. & Lindblad-Toh K. (2009) Genome sequence, comparative analysis, and population genetics of the domestic horse. Science 326, 865-7.
[0282] Weatherby mid Sons (1791) An Introduction to a General Stud Book. Weatherby and Sons, London.
[0283] Weber K, Brck P, Mikes Z. Kpper J H, Klingenspor M, Wiesner R J. Glucocorticoid hormone stimulates mitochondrial biogenesis specifically in skeletal muscle. Endocrinology. 2002 January; 143(1):177-84.
[0284] Willett P. (1981) The classic racehorse. Stanley Paul, London.
[0285] Williamson S. A. & Beilharz R. G. (1998) The inheritance of speed, stamina and other racing performance characters in the Australian Thoroughbred. J Anim Breed Genet 115, 1-16.
[0286] Yang Q. Khoury M J, Botto L, Friedman J M, Flanders W D. Improving the prediction of complex diseases by testing for multiple disease-susceptibility genes. Am J Hum Genet. 2003 March; 72(3):636-49. Epub 2003 Feb. 14.
[0287] Young L E, Rogers K, Wood J L, Left ventricular size and systolic function in Thoroughbred racehorses and their relationships to race performance. J. Appl Physiol. 2005 October; 99(4):1278-85. Epub 2005 May 26.PMID: 15920096
[0288] Zhou M L, Wang Q., Sun J.,, Li X., Xu L., Yang H., Shi H., Ning S., Chen L., Li Y., He T. & Zheng Y. (2009) In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach. Genomics 94, 125-31.