AN ENGINEERED TWO-PART CELLULAR DEVICE FOR DISCOVERY AND CHARACTERISATION OF T-CELL RECEPTOR INTERACTION WITH COGNATE ANTIGEN
20200115432 ยท 2020-04-16
Assignee
Inventors
- Reagan Micheal Jarvis (Karlskrona, SE)
- Ryan Edward HILL (Karlskrona, SE)
- Luke Benjamin PASE (Karlskrona, SE)
Cpc classification
A61K2039/5154
HUMAN NECESSITIES
C12N2015/859
CHEMISTRY; METALLURGY
G01N33/6845
PHYSICS
C12N15/1093
CHEMISTRY; METALLURGY
C12N15/90
CHEMISTRY; METALLURGY
International classification
C12N15/10
CHEMISTRY; METALLURGY
C12N15/90
CHEMISTRY; METALLURGY
Abstract
The present invention relates to a two-part device, wherein a first part is an engineered antigen-presenting cell system (eAPCS), and a second part is an engineered TCR-presenting cell system (eTPCS).
Claims
1.-22. (canceled)
23. A two-part cellular device comprising (A) an engineered antigen-presenting cell system (eAPCS) comprising one or more of: (i) an engineered antigen presenting cell-p (eAPC-p) that is an engineered cell containing a genomic receiver site and a genetic donor vector for delivery of an open reading frame (ORF) encoding an antigen-presenting complex (aAPX), wherein the engineered cell lacks endogenous surface expression of at least one family of an aAPX and/or an analyte antigenic molecule (aAM), wherein the ORF is integrated into the genomic receiver site, and wherein the eAPC-p expresses the aAPX on its surface; (ii) an engineered antigen presenting cell-a (eAPC-a) that is an engineered cell containing a genomic receiver site and a genetic donor vector for delivery of an ORF encoding an analyte antigenic molecule (aAM) or a cargo molecule (CM), wherein the engineered cell lacks endogenous surface expression of at least one family of an aAPX and/or an analyte antigenic molecule (aAM), wherein the ORF is integrated into the genomic receiver site, and wherein the eAPC-a expresses the aAM or CM on its surface; and (iii) an engineered antigen presenting cell-pa (eAPC-pa) that is an engineered cell containing one or more genomic receiver sites and one or more genetic donor vectors for delivery of one or more ORFs encoding (a) at least one antigen-presenting complex (aAPX); and (b) at least one analyte antigenic molecule (aAM) or at least one cargo molecule (CM), wherein the engineered cell lacks endogenous surface expression of at least one family of an aAPX and/or an analyte antigenic molecule (aAM), wherein the one or more ORFs are integrated into the one or more genomic receiver sites, and wherein the eAPC-pa expresses (a) the aAPX and aAM; (b) a (d) a complex comprising the aAPX and CM (aAPX:CM) on its surface; and (B) an engineered T-cell receptor (TCR)-presenting cell system (eTPCS) comprising one or more of: (i) an engineered TCR presenting cell x (eTPC-x) that is an engineered cell containing a genomic receiver site and genetic donor vector for delivery of an ORF encoding an analyte TCR chain, wherein the engineered cell lacks endogenous expression of TCR chains alpha, beta, delta and gamma, wherein the engineered cell expresses CD3 proteins, wherein the ORF is integrated into the genomic receive site, and wherein the eTPC-x expresses the analyte TCR chain intracellularly; and (ii) an engineered TCR-presenting cell t (eTPC-t) that is an engineered cell containing one or more genomic receiver sites and one or more genetic donor vectors for delivery of one or more ORFs encoding at least two analyte TCR chains, wherein the engineered cell lacks endogenous expression of TCR chains alpha, beta, delta and gamma, wherein the engineered cell expressed CD3 proteins, wherein the one or more ORFs are integrated into the one or more genomic receiver sites, wherein at least two analyte TCR chains are complementary, and wherein expression of the complementary analyte TCR chains results in expression of a TCR surface protein (TCRsp) on the surface of the eTPC-t.
24. The two-part cellular device of claim 23, wherein the eAPCS comprises a plurality of eAPC-ps, eAPC-as, and/or eAPC-pas.
25. The two-part cellular device of claim 23, wherein the eTPCS comprises a plurality of eTPC-xs and/or eTPC-ts.
26. The two-part cellular device of claim 23, wherein the TCRsp is expressed as a complex with a CD3 molecule on the surface of the eTPC-t.
27. The two-part cellular device of claim 23, wherein the eTPC-t further comprises an ORF encoding a synthetic TCR signal response element.
28. The two-part cellular device of claim 27, wherein the synthetic TCR signal response element is expressed upon an interaction between (a) the eTPC-t; and (b) the eAPC-p, eAPC-a, and/or eAPC-pa.
29. A method for selecting one or more engineered TCR presenting cells t (eTPC-ts), comprising (A) combining one or more eTPC-ts with one or more of engineered antigen presenting cells (eAPCs), wherein: (i) the eTPC-t is an engineered cell containing one or more genomic receiver sites and one or more genetic donor vectors for delivery of one or more ORFs encoding at least two analyte TCR chains, wherein the engineered cell lacks endogenous expression of TCR chains alpha, beta, delta and gamma, wherein the engineered cell expressed CD3 proteins, wherein the one or more ORFs are integrated into the one or more genomic receiver sites, wherein at least two analyte TCR chains are complementary, and wherein expression of the complementary analyte TCR chains results in expression of a TCR surface protein (TCRsp) on the surface of the eTPC-t, (ii) the eAPCs are selected from one or more of: an eAPC-p that is an engineered cell containing a genomic receiver site and a genetic donor vector for delivery of an open reading frame (ORF) encoding an antigen-presenting complex (aAPX), wherein the engineered cell lacks endogenous surface expression of at least one family of an aAPX and/or an analyte antigenic molecule (aAM), wherein the ORF is integrated into the genomic receiver site, and wherein the eAPC-p expresses the aAPX on its surface; an eAPC-a that is an engineered cell containing a genomic receiver site and a genetic donor vector for delivery of an ORF encoding an analyte antigenic molecule (aAM) or a cargo molecule (CM), wherein the engineered cell lacks endogenous surface expression of at least one family of an aAPX and/or an analyte antigenic molecule (aAM), wherein the ORF is integrated into the genomic receiver site, and wherein the eAPC-a expresses the aAM or CM on its surface; and eAPC-pa that is an engineered cell containing one or more genomic receiver sites and one or more genetic donor vectors for delivery of one or more ORFs encoding (a) at least one antigen-presenting complex (aAPX); and (b) at least one analyte antigenic molecule (aAM) or at least one cargo molecule (CM), wherein the engineered cell lacks endogenous surface expression of at least one family of an aAPX and/or an analyte antigenic molecule (aAM), wherein the one or more ORFs are integrated into the one or more genomic receiver sites, and wherein the eAPC-pa expresses (a) the aAPX and aAM; (b) a complex comprising the aAPX and aAM (aAPX:AM); (c) the aAPX and CM; and/or (d) a complex comprising the aAPX and CM (aAPX:CM) on its surface; (B) detecting the presence or absence of expression of the synthetic TCR signal response element; and (C) selecting one or more eTPC-ts upon detection of the presence of expression of the synthetic TCR signal response element.
30. The method of claim 29, wherein selecting the eTPC-t is perfoimed by single cell sorting.
31. The method of claim 29, further comprising culturing one or more selected eTPC-t to obtain a population of eTPC-t.
32. The method of claim 31, wherein each eTPC-t in the population express the same TCRsp.
33. The method of claim 31, wherein at least two eTPC-ts in the population express different TCRsps.
Description
LEGENDS TO FIGURES
[0494] The invention is illustrated in the following non-limiting figures.
[0495]
[0496]
[0497]
[0498]
[0499]
[0500] A genetic donor vector and genomic receiver site form an integration couple, wherein one or more ORFs encoded within the genetic donor vector can integrated specifically to its coupled genomic receiver site. Step 1 in operation of the integration couple is to introduce one or more target ORFs to the donor vector. The initial donor vector is denoted X, and is modified to a primed donor vector X, by introduction of target ORF(s). Step 2 entails combination of the primed donor vector, X, with a cell harbouring a genomic receiver site, Y. Introduction of the ORF encoded by the primed donor vector into the receiver site results in the creation of a cell harbouring an integrated site, Y.
[0501]
[0502] eAPC 1A contains genomic receiver site 1B. Primed genetic donor vector 1C is coupled to 1B and encodes an aAPX. When the 1A eAPC is combined with the 1C donor vector. The resulting cell has the ORF of 1C exchanged to the 1B genomic receiver site to create site 1B and introduce aAPX expression. This results in expression of the aAPX on the cell surface and creation of an eAPC-p.
[0503]
[0504] eAPC 1A contains genomic receiver sites 1B and 1D. Primed genetic donor vector 1C is coupled to 1B and encodes an aAPX. When the 1A eAPC is combined with the 1C donor vector. The resulting cell has the ORF of 1C exchanged to the 1B genomic receiver site to create site 1B and introduce aAPX expression. This results in expression of the aAPX on the cell surface and creation of an eAPC-p. Genomic receiver site 1D remains unused.
[0505]
[0506] eAPC 1A contains genomic receiver site 1B. Primed genetic donor vector 1C is coupled to 1B and encodes an aAM. When the 1A eAPC is combined with the 1C donor vector. The resulting cell has the ORF of 1C exchanged to the 1B genomic receiver site to create site 1B and introduce aAM expression. This results in one of two forms of eAPC-a, expressing aAM at the cell surface or intracellularly.
[0507]
[0508] eAPC 1 A contains genomic receiver sites 1B and 1D. Primed genetic donor vector 1C is coupled to 1B and encodes an aAM. When the 1A eAPC is combined with the 1C donor vector. The resulting cell has the ORF of 1C exchanged to the 1B genomic receiver site to create site 1B and introduce aAM expression. This results in one of two forms of eAPC-a, expressing aAM at the cell surface or intracellularly. Genomic receiver site 1D remains unused.
[0509]
[0510] eAPC 1A contains genomic receiver site 1B. Genetic donor vector 1C is coupled to 1B. Donor vector 1C encodes an aAPX as well as an aAM. The 1A eAPC is combined with donor vectors 1C. The resulting cell has the ORFs 1C exchanged to the 1B genomic receiver site to create site 1B and deliver an ORF for an aAPX and an aAM. This results in expression of the aAPX on the cell surface, aAM intracellularly, and thus loading of the aAM as cargo in the aAPX in formation of the aAPX:aAM complex at the cell surface.
[0511]
[0512] eAPC 1A contains distinct genomic receiver sites 1B and 1D. Genetic donor vector 1C is coupled to 1B. Donor vector 1C encodes an aAPX as well as an aAM. The 1A eAPC is combined with donor vectors 1C. The resulting cell has the ORFs 1C exchanged to the 1B genomic receiver site to create site 1B and deliver an ORF for an aAPX and an aAM. Genomic receiver site 1D remains unused. This results in expression of the aAPX on the cell surface, aAM intracellularly, and thus loading of the aAM as cargo in the aAPX in formation of the aAPX:aAM complex at the cell surface. This creates an eAPC-pa cell line. Genomic receiver site 1D remains unused.
[0513]
[0514] eAPC 1A contains distinct genomic receiver sites 1B and 1D. Distinct genetic donor vectors 1C and 1E are independently coupled to 1B and 1D, respectively. Donor vector 1C encodes an aAPX and donor vector 1E encodes an aAM. The 1A eAPC is combined with donor vectors 1C and 1E simultaneously. The resulting cell has the ORF 1C exchanged to the 1 B genomic receiver site to create site 1B and deliver an ORF for an aAPX. Simultaneously, the ORF of 1E exchanged to the 1D genomic receiver site to create site 1D and deliver an ORF for an aAM. This results in expression of the aAPX on the cell surface, aAM intracellularly, and thus loading of the aAM as cargo in the aAPX in formation of the aAPX:aAM complex at the cell surface. This creates an eAPC-pa cell line.
[0515]
[0516] eAPC 1 A contains distinct genomic receiver sites 1B and 1D. Distinct genetic donor vectors 1C and 1 E are independently coupled to 1B and 1D, respectively. Donor vector 1C encodes an aAPX and donor vector 1E encodes an aAM. In STEP1 the 1A eAPC is combined with the 1C donor vector. The resulting cell has insert 1C exchanged to the 1B genomic receiver site to create site 1B and deliver an ORF for an aAPX. This results in expression of the aAPX on the cell surface and creation of an eAPC-p. Genomic receiver site 1D remains unused. In STEP2 the eAPC-p created in STEP1 is combine with the 1E donor vector. The resulting cell has insert 1E exchanged to the 1D genomic receiver site to create site 1D and deliver an ORF for an aAM. This results in expression of the aAM on the cell surface as cargo of the expressed aAPX, and creation of an eAPC-pa.
[0517]
[0518] eAPC 1A contains distinct genomic receiver sites 1B and 1D. Distinct genetic donor vectors 1C and 1E are independently coupled to 1B and 1D, respectively. Donor vector 1C encodes an aAM and donor vector 1E encodes an aAPX. In STEP1 the 1A eAPC is combined with the 1C donor vector. The resulting cell has insert 1C exchanged to the 1B genomic receiver site to create site 1B and deliver an ORF for an aAM. This results in expression of the aAM on the cell surface and creation of an eAPC-a. Genomic receiver site 1D remains unused. In STEP2 the eAPC-a created in STEP1 is combine with the 1E donor vector. The resulting cell has insert 1E exchanged to the 1D genomic receiver site to create site 1D and deliver an ORF for an aAPX. This results in expression of the aAPX on the cell surface with the aAM as cargo and creation of an eAPC-pa.
[0519]
[0520] The eAPC-p contains the exchanged genomic receiver site 1B expressing an aAPX and the distinct genomic receiver site 1D. The pool of genetic donor vectors 1E i-iii are coupled to 1D. Donor vectors 1E i-iii each encode a single aAM gene. The eAPC-p is combined with donor vectors 1E i, 1 E ii, 1E iii simultaneously. The resulting cell pool has either of inserts 1E i-iii exchanged to the 1D genomic receiver site in multiple independent instances to create sites 1D i-iii each delivering a single ORF for an aAM gene. The resulting eAPC-pa cell pool comprises a mixed population of three distinct cell cohorts each expressing a discrete combination of 1B presenting as aAPX:aAM either of the aAM genes contained in the initial vector library.
[0521]
[0522]
[0523] eAPC 1 A contains distinct genomic receiver sites 1B and 1D. Distinct genetic donor vectors 1C and 1E are coupled to 1B and 1D, respectively. Donor vectors 1C i and 1C ii each encode a single aAM gene, and donor vectors 1E i and 1E ii each encode a single aAPX gene. The eAPC 1A is combined with donor vectors 1C i, 1C ii, 1E i and 1E ii simultaneously. The resulting cell pool has insert 1C i or 1C ii exchanged to the 1B genomic receiver site multiple independent instances to create sites 1B i and 1B ii, each delivering a single ORF for an aAM. The resulting cell pool further has insert 1E i or 1E ii exchanged to the 1D genomic receiver site multiple independent instances to create sites 1E i and 1E ii, each delivering a single ORF for an APX gene. The resulting eAPC-pa cell pool comprises a mixed population of four distinct cell cohorts each expressing a discrete randomised aAPX:aAM pair at the surface comprised of one of each gene contained in the initial vector library.
[0524]
[0525]
[0526]
[0527]
[0528]
[0529] eTPC 2A contains distinct genomic receiver sites 2B and 2D. The genetic donor vectors 2C is coupled to 2D. Donor vector 2C encodes a TCR chain pair. The eTPC 2A further contains a TCR signal response element 2F. The eTPC 2A is combined with donor vector 2C. The resulting cell has insert 2C exchanged to the 2B genomic receiver site to create site 2B and deliver the two ORFs for a TCR chain pair. Genomic receiver site 2D remains unused. This cell is capable of presenting a TCRsp at the surface, and thus designated a eTPC-t.
[0530]
[0531] eTPC 2A contains distinct genomic receiver sites 2B and 2D. The eTPC 2A further contains a TCR signal response element 2F. Distinct genetic donor vectors 2C and 2E are independently coupled to 2B and 2D, respectively. Donor vector 2C encodes a single TCR chain, and donor vector 2E encodes a second reciprocal TCR chain. The eTPC 2A is combined with donor vectors 2C and 2E. The resulting cell has insert 2C exchanged to the 2B genomic receiver site to create site 2B and deliver an ORF for a first TCR chain. In addition, the resulting cell line has insert 2E exchanged to the 2D genomic receiver site to create site 2D and deliver an ORF for a second TCR chain. This cell is capable of presenting a TCRsp at the surface, and is thus designated a eTPC-t.
[0532]
[0533]
[0534]
[0535] eTPC 2A contains a genomic receiver site 2B. The genetic donor vectors 2C is coupled to 2B. Donor vector 2C i, 2C ii and 2C iii encode a distinct TCR chain pair and constitutes a mixed vector library of discrete TCR chain pairs. The eTPC 2A further contains a TCR signal response element 2F. The eTPC 2A is combined with donor vectors 2C i, 2C ii and 2C iii simultaneously. The resulting cell pool has insert 2C exchanged to the 2B genomic receiver site multiple independent instances to create site 2B i, 2B ii and 2B iii delivering two ORFs for each discrete TCR chain pair contained in the initial vector library. This eTPC-t cell pool comprises a mixed population of three distinct cell clones each expressing a distinct TCR chain pairs, denoted TCRsp i, ii and iii, forming an eTPC-t pooled library.
[0536]
[0537]
[0538] eTPC 2A contains distinct genomic receiver sites 2B and 2D. Distinct genetic donor vectors 2C and 2E are independently coupled to 2B and 2D, respectively. Donor vectors 2C i and 2C ii each encode a single TCR chain, and donor vectors 2E i and 2E ii each encode a reciprocal single TCR chain. The eTPC 2A further contains a TCR signal response element 2F. The eTPC 2A is combined with donor vectors 2C i, 2C ii, 2E i and 2E ii simultaneously. The resulting cell pool has insert 2C i or 2C ii exchanged to the 2B genomic receiver site multiple independent instances to create sites 2B i and 2B ii, each delivering a single ORF for a TCR chain. The resulting cell pool further has insert 2E i or 2E ii exchanged to the 2D genomic receiver site multiple independent instances to create sites 2E i and 2E ii, each delivering a single ORF for a TCR chain reciprocal to those at sites 2Ci and 2Cii. The resulting eTPC-t cell pool comprises a mixed population of four distinct cell cohorts each expressing a discrete randomised TCRsp at the surface comprised of one of each reciprocal TCR chain contained in the initial vector library.
[0539]
[0540] eTPC-x contains the exchanged genomic receiver site 2B expressing a single TCR chain and the distinct genomic receiver site 2D. Distinct genetic donor vectors 2E i and 2E ii are coupled to 2D, respectively. Donor vectors 2E i and 2E ii each encode a single TCR chain. The eTPC-x further contains a TCR signal response element 2F. The eTPC-x is combined with donor vectors 2E i and 2E ii simultaneously. The resulting cell pool has insert 2E i or 2E ii exchanged to the 2D genomic receiver site multiple independent instances to create sites 2E i and 2Eii, each delivering a single ORF for a TCR chain. The resulting eTPC-t cell pool comprises a mixed population of 2 distinct cell cohorts expressing a discrete TCRsp at the surface comprised of the TCR chain expressed from 2B paired with one of each TCR chain contained in the initial vector library.
[0541]
[0542] The analyte eAPC contains sites 1C and 1 E integrated with one ORF each to encode one aAPX and one aAM, with the aAM loaded as cargo in aAPX at the cell surface.
[0543] The analyte eTPC contains sites 2C and 2E each integrated with one ORF encoding a reciprocal TCRsp at the surface. The eTPC-t further contains a TCR signal response element 2F. When eTPC-t and eAPC-pa populations are contacted, four eTPC-t response states can be achieved, one negative and three positive. The negative state is the resting state of the eTPC-t, with no signal strength at the 2F element, denoting failure of the eAPC aAPX:aAM complex to stimulate the eTPC-t presented chain pair. Three positive states show increasing signal strength from the 2F. States 2F+, 2F++ and 2F+++ denote low, medium and high signal strength, respectively. The gene product of 2F denoted as hexagons accumulates to report signal strength of each cell state, as denoted by darker shading of the cells. This indicates a graded response of analyte TCRsp expressed by eTPC-t population towards analyte aAPX:aAM presented by the eAPC-pa.
[0544]
[0545] The analyte eAPC-pa contains sites 1C and 1 E integrated with one ORF each to encode one aAPX and one aAM, with the aAM loaded as cargo in aAPX at the cell surface. The analyte eTPC contains sites 2C and 2E each integrated with one ORF encoding a reciprocal TCRsp at the surface. The eTPC-t further contains a TCR signal response element 2F. When analyte eTPC and eAPC-pa populations are contacted, four eAPC response states can be achieved, one negative and three positive. The negative state is the resting state of the analyte eAPC, denoting failure of the TCRsp chain pair to stimulate the aAPX:aAM complex presented by the analyte eAPC. Three positive states show increasing signal strength from the contacted aAPX:aAM. The reported signal strength of each cell state, is denoted by *, ** and **, and also denoted by darker shading of the cells. This indicates a graded response of analyte aAPX:aAM towards the analyte TCRsp chain pair.
[0546]
[0547] The eTPC-t pool contains cells harboring sites 2C i, ii or ii, wherein each integrated with two ORFs encoding a reciprocal TCR chain pair, and thus each cell cohort in the population expresses a discrete TCRsp at the surface. The eTPC-t further contains a TCR signal response element 2F. The analyte eAPC contain sites 1C and 1E integrated with a distinct set of ORF to encode one aAPX and one aAM, with the aAM loaded as cargo in aAPX at the cell surface. In the present example, only the TRC chain pair expressed from 2C i is specific for the aAPX:aAM presented by the analyte APC, such that when eTPC-t pool and analyte APC population are contacted, only the cell cohort of the eTPC-t that bears 2C i reports TCRsp engagement through state 2F.
[0548]
[0549] The analyte eAPC contain sites 1C and 1 E integrated with a distinct set of ORF each to encode one aAPX and one aAM, with the aAM loaded as cargo in aAPX at the cell surface. The analyte eTPC contain the exchanged genomic receiver site 2C expressing a TCRsp at the surface. It further contains a TCR signal response element 2F. In the present example, only the complex aAPX:aAM i is specific for the TCR presented by the analyte eTPC, such that when analyte eAPC pool and analyte eTPC population are contacted, only the cell cohort expressing aAM i express a distinct signal *.
[0550]
[0551] eAPC-p contains the exchanged genomic receiver site 1 B expressing an aAPX. A soluble, directly presentable antigen aAM is combined with the eAPC-p. This results in the formation of the aAPX:aAM complex on the cell surface and the generation of a eAPC-p+aAM.
[0552]
[0553]
[0554] eAPC-p+aAM contains the exchanged genomic receiver site 1B expressing an aAPX as well as internalized aAM that is presented on the surface as aAPX:aAM complex.The aAM is released from the aAPX:aAM surface complex through incubation and the released aAM available for identification.
[0555]
[0556] eAPC-p+aAM contains the exchanged genomic receiver site 1B expressing an aAPX as well as internalized aAM that is presented on the surface as aAPX:aAM complex. The aAPX:aAM surface complex is captured for identification of loaded aAM.
[0557]
[0558] a) GFP fluorescence signal in two independent cell populations 48 hours after transfection with plasmids encoding Cas9-P2A-GFP and gRNAs targeting the HLA-A, HLA-B and HLA-C loci (grey histogram) compared to HEK293 control cells (dashed lined histogram). Cells that had a GFP signal within the GFP subset gate were sorted as a polyclonal population. b) Cell surface HLA-ABC signal observed on the two sorted polyclonal populations when labelled with a PE-Cy5 anti-HLA-ABC conjugated antibody (grey histogram). Single cells that showed a low PE-Cy5 anti-HLA-ABC signal and were displayed within the sort gate were sorted to establish monoclones. Non-labelled HEK293 cells (dashed line histogram) and PE-Cy5 anti-HLA-ABC labelled HEK293 cells (full black lined histogram) served as controls.
[0559]
[0560]
[0561]
[0562] a) GFP fluorescence signal 48 hours after transfection with plasmids encoding Cas9-P2A-GFP, gRNAs targeting the AAVS1 locus and component B genetic elements flanked by AAVS1 left and right homology arms (grey histogram). HEK293 cells server as a GFP negative control (dashed line histogram). Cells that had a GFP signal within the GFP+gate were sorted as a polyclonal population. b) GFP fluorescence signal 48 hours after transfection with plasmids encoding Cas9-P2A-GFP, gRNAs targeting the AAVS1 locus and component B and D, both flanked by AAVS1 left and right homology arms (grey histogram). HEK293 cells server as a GFP negative control (dashed line histogram). Cells that had a GFP signal within the GFP+ gate were sorted as a polyclonal population c) Maintained BFP but no detectable RFP signal observed in the D1 sorted polyclonal population. Single cells that showed high BFP signal in quadrant Q3 were sorted to establish eAPC containing synthetic component B monoclones. d) Maintained BFP and RFP signal observed in the D2 sorted polyclonal population. Single cells that showed high BFP and RFP signals in quadrant Q2 were sorted to establish eAPC monoclones containing synthetic component B and synthetic component D.
[0563]
[0564]
[0565] a) PCR amplicons were generated with primers that prime within component B and/or D and size determined by electrophoresis. The expected size of a positive amplicon is 380bp indicating stable integration of component B and/or D. b) PCR amplicons were generated with primers that prime on AAVS1 genomic sequence distal to region encoded by the homologous arms and the SV40 pA terminator encoded by component B and/or D and size determined by electrophoresis. The expected size of a positive amplicon is 660 bp indicating integration of component B and/or D occurred in the AAVS1 site.
[0566]
[0567] a) GFP fluorescence signal 48 hours after transfection with plasmids encoding Cas9-P2A-GFP, gRNAs targeting the AAVS1 locus and component C.sup.HLA-A*24:02 (left panel) or component C.sup.HLA-B*-07:02 (right panel). Cells that had a GFP signal within the GFP+ gate were sorted as a polyclonal population ACL-303 or ACL-305.
[0568] b) Analyte HLA cell surface expression observed on the two sorted polyclonal populations when labelled with a PE-Cy5 anti-HLA-ABC conjugated antibody (grey histogram). Single cells that showed a high PE-Cy5 anti-HLA-ABC signal and were displayed within the right sort gate were sorted to establish monoclones. Signal detected from PE-Cy5 anti-HLA-ABC labelled ACL-128, the HLA-ABC.sup.null and HLA-DR,DP,DQ.sup.null eAPC cell line (dashed line histogram) served as controls.
[0569]
[0570] Monoclone populations were stained with the PE-Cy5 anti-HLA-ABC conjugate antibody, and were analysed by flow cytometry (grey histogram). ACL-128, the HLA-ABC.sup.null and HLA-DR,DP,DQ.sup.null eAPC cell line (dashed line histogram) served as controls. ACL-321 and ACL-331 monoclone cell lines showed a stronger fluorescent signal compared to the HLA-ABC.sup.null and HLA-DR,DP,DQ.sup.null eAPC cell line control, demonstrating that each line expresses their analyte aAPX, HLA-A*24:02 or HLA-B*-07:02 ORF, respectively, and therefore are eAPC-p cell lines.
[0571]
[0572] a) PCR amplicons confirm the presence of HLA insert, a band of 810 bp indicated correct CMV promoter amplicon and 380 bp is the amplicon generated from SV40pA terminator. b) PCR amplicons were generated with two set of primers that primed on AAVS1 genomic sequence distal to region encoded by the homologous arms and a primer that is unique to the SV40 pA terminator linked to the analyte HLA ORF. The expected size of a positive amplicon 1 kb and 1.1 kb indicate generation of component B.
[0573]
[0574] a) GFP fluorescence signal 48 hours after transfection with plasmids encoding Cas9-P2A-GFP, gRNAs targeting the AAVS1 locus and component C.sup.HLA-DRA*01:01/HLA-DRB1*01:01 (left panel) or component C.sup.HLA-DPA1*01:03/HLA-DPB1*04:01 (right panel). Cells that had a GFP signal within the GFP+ gate were sorted as a polyclonal population.
[0575] b) Analyte HLA cell surface expression observed on the two sorted polyclonal populations when labelled with an Alexa 647 anti-HLA-DR,DP,DQ conjugated antibody (grey histogram). Single cells that showed a high Alexa 647 anti-HLA-ABC signal and were displayed within the right sort gate were sorted to establish monoclones. Signal detected from Alexa 647 anti-HLA-ABC labelled ACL-128 (HLA-ABC.sup.null and HLA-DR,DP,DQ.sup.null eAPC cell line) (dashed line histogram) and ARH wild type cell line (full black lined histogram) served as controls
[0576]
[0577] Monoclone populations were stained with a Alexa 647 anti-HLA-DR,DP,DQ conjugated antibody, and analysed by flow cytometry (grey histogram). ACL-128 (HLA-ABC.sup.null and HLA-DR,DP,DQ.sup.null eAPC cell line) (dashed line histogram) and ARH wild type cell line (full black lined histogram) served as controls. ACL-341 and ACL-350 monoclone cell lines showed a stronger fluorescent signal compared to the HLA-ABC.sup.null and HLA-DR,DP,DQ.sup.null eAPC cell line control, demonstrating that each line expressed their analyte aAPX, HLA-DRA*01:01/HLA-DRB1*01:01 or HLA-DPA1*01:03/HLA-DPB1*04:01, respectively, and therefore are eAPC-p cell lines.
[0578]
[0579] a) eAPC-p monoclone populations ACL-421 and ACL-422 lost BFP fluorescence (grey histogram). Their parent eAPC cell line ACL-385 (full black line histogram) and the BFP negative ARH wild type cell line (dash line histogram) served as a control
[0580] b) eAPC-p monoclone populations ACL-421 and ACL-422 gained HLA-A*02:01 expression when stained with the PE-Cy5 anti-HLA-ABC conjugate antibody (grey histogram). Their parent ACL-385 HLA-ABC.sup.null and HLA-DR,DP,DQ.sup.null eAPC cell line (dash line histogram) and ARH wild type cell line (full black line histogram) served as negative and positive PE-Cy5 anti-HLA-ABC labeling control, respectively.
[0581] These results strongly indicated a successful RMCE occurred between the BFP ORF and HLA-A*02:01 ORF in both ACL-421 and ACL-422 cell lines.
[0582]
[0583] An amplicon of 630 bp indicated presence of HLA-A2 in monclones ACL-421 and 422 but not in the control line, ACL-128.
[0584]
[0585] a) eAPC-p Monoclone populations were stained with the PE-Cy5 anti-HLA-ABC conjugated antibody, and were analysed by flow cytometry (grey histogram). ACL-128, the HLA-ABC.sup.null and HLA-DR,DP,DQ.sup.null eAPC cell line (dashed line histogram) served as control. ACL-321 and ACL-331 monoclone cell lines showed stronger fluorescent signal compared to controls demonstrating that each line expressed their analyte aAPX, HLA-A*02:01 or HLA-B*35:01 ORF, respectively, and therefore were eAPC-p cell lines. b) eAPC-pa Monoclone populations were assessed for GFP fluorescence by flow cytometry (grey histogram). ACL-128, the HLA-ABC.sup.null and HLA-DR,DP,DQ.sup.null eAPC cell line (dashed line histogram) served as control. ACL-391 and ACL-395 monoclone cell lines showed a stronger fluorescent signal compared to controls demonstrating that each line expresses analyte aAM selection marker and therefore inferred aAM expression, in a cell line which also expressing HLA-LA-A*02:01 or HLA-B*35:01 ORF, respectively. Therefore ACL-391 and ACL-395 were eAPC-pa lines.
[0586]
[0587] Two tables are presented summarising the genetic characterisation of eAPC generated to contain Component 1B, or Component 1B and 1D, respectively.
[0588]
[0589] An eAPC-p was created through RMCE by electroporation of the cell line ACL-402 with the plasmid that encodes expression of the Tyr-recombinase, Flp (V4.1.8), together with one Component 1C plasmid encoding an aAPX, selected from either HLA-A*02:01 (V4.H.5 or HLA-A*24:02 (V4.H.6). At 10 days post electroporation, individual cells positive for HLAI surface expression and diminished fluorescent protein signal, RFP, encoded by Component 1B selection marker, were sorted. Resulting monoclonal eAPC-p lines were analysed by flow cytometry in parallel with the parental eAPC line, and two examples are presented a) Individual outgrown monoclone lines (ACL-900 and ACL-963) were analysed by flow cytometry for loss of RFP, presence of BFP and gain of HLA-ABC (aAPX). Left-hand plots display BFP vs RFP, the parental cell has both BFP and RFP (Q2, top plot, 99.2%), whereas ACL-900 (Q3, middle plot, 99.7%) and ACL-963 (Q3, bottom plot, 99.9%) both lack RFP signal, indicating integration couple between Component 1B/1C has occured. Right-hand plots display BFP vs HLA-ABC (aAPX), wherein both ACL-900 (Q2, top plot, 99.2%) and ACL-963 (Q2, bottom plot, 99.2%) show strong signal for HLA-ABC (aAPX), further reinforcing that 1B/1C integration. Critically, both ACL-900 and ACL-963 have strong BFP signal, indicating that Component 1D remains open and isolated from the Component 1B/1C integration couple. b) To further characterize ACL-900 and ACL-963, and a third eAPC-p not presented in a) ACL-907, genomic DNA was extracted and PCR conducted using primers that target adjacent and internal of Component 1B (Table 5, 8.B.3, 15.H.2), thereby selectively amplifying only successful integration couple events. Comparison is made to an unmodified parental line, ACL-3 wherein the Component 1B is lacking. Amplicon products specific for Component 1 B were produced for all three eAPC-p monoclones whereas no product was detected in the ACL-3 reaction, confirming the specific integration couple event between Component 1B and Component 1C had occurred.
[0590]
[0591] Multiple eAPC-pa were constructed from a parental eAPC-p (ACL-905) in parallel, wherein the genomic receiver site, Component 1D, is targeted for integration by a primed genetic donor vector, Component 1E, comprising of a single ORF that encodes an aAM. The eAPC-p (ACL-900, example 8) was independently combined with a vector encoding expression of the RMCE recombinase enzyme (Flp, V4.1.8) and each Component 1E of either V9.E.6, V9.E.7, or V9.E.8 by electroporation. At 10 days post electroporation, individual eAPC-pa were selected and single cell sorted (monoclones) based on diminished signal of the selection marker of integration BFP, encoded by Component 1D. Resulting monoclonal eAPC-pa lines were analysed by flow cytometry in parallel with the parental eAPC line, and three examples are presented. In addition, resulting monoclones were also genetically characterized to confirm the integration couple event. a) Monoclones for eAPC-pa, ACL-1219, ACL-1227 and ACL-1233, were analysed and selected by flow cytometry for loss of BFP signal and retention of the HLA-ABC signal. Plots of BFP vs SSC are displayed with a BFP- gate. An increase in the number of BFP- events compared to parental eAPC-p is observed, indicating that an integration couple between Component 1D/1E has occurred. Single cells from the BFP- gate were selected, sorted and outgrown. b) Selected monoclones of ACL-1219, ACL-1227, ACL-1233 were analysed by flow cytometry to confirm loss of BFP and re-tention of HLA-ABC signals. Plots of BFP vs HLA-ABC are presented, wherein all three monoclones can be observed having lost the BFP signal in comparison to parental eAPC-p (right most plot), indicating a successful integration couple event. c) To demonstrate that the monoclones contained the correct fragment size for aAM ORF, a polymerase chain reaction was conducted, utlising primers targeting the aAM ORF and representative agarose gel is presented. Results from two monoclones representing each aAM ORF are shown. Lane 1: 2_log DNA marker, Lanes 2-3: pp28 ORF (expected size 0.8kb), Lane 4: 2_log DNA marker, Lanes 5-6: pp52 ORF (expected size 1.5 kb), Lane 7: 2_log DNA marker, Lanes 8-9: pp65 ORF (expected size 1.9 kb), Lane 10: 2_log DNA marker. All monoclones analysed had the expected amplicon size for the respective aAM, further indicating the integration couple had occurred.
[0592]
[0593] A pooled library of eAPC-pa were generated from a pool of primed Component 1E vectors (Component 1E) collectively encoding multiple aAM ORF (HCMVpp28, HCMVpp52 and HCMVpp65) by integration in a single step into the parental eAPC-p, wherein each individual cell integrates a single random analyte antigen ORF derived from the original pool of vectors, at Component 1D, such that each generated eAPC-pa expresses a single random aAM, but collectively the pooled library of eAPC-pa represents all of aAM ORF encoded in the original pooled library of vectors. The library of eAPC-pa was generated by electroporation by combing the eAPC-p (ACL-905, aAPX: HLA-A*02:01) with a pooled vector library comprised of individual vectors encoding an ORF for one of HCMVpp28, HCMVpp52 or HCMVpp65 (V9.E.6, V9.E.7, and V9.E.8), and being mixed at a molecular ratio of 1:1:1. Resulting eAPC-pa populations were analysed and selected by flow cytometry, in parallel with the parental eAPC-p line. a) At 10 days post electroporation putative eAPC-pa cells (Transfectants) were analysed and selected by flow cytometry, compared in parallel with the parental line (ACL-905). Plots display BFP vs SSC, gated for BFP- populations, wherein an increase in BFP- cells are observed in the BFP- gate compared to the parental line. Bulk cells were sorted form the transfectants based on BFP- gate, denoted ACL-1050. b) After outgrowth, ACL-1050 cells were analysed by flow cytometry for loss of BFP. Plots displayed are BFP vs SSC, wherein ACL-1050 has been enriched to 96.4% BFP- compared to parental line 4% BFP-. Subsequently, single cells were sorted from the BFP- pollution of ACL-1050. c) To demonstrate that the polyclone ACL-1050 was comprised of a mixture of HCMVpp28, HCMVpp52 and HCMVpp65 encoding cells, 12 monoclones were selected at random, outgrown and were used for genetic characterisation. Cells were characterised by PCR utilising primers targeted to the aAM ORF (Component 1D), to amplify and detect integrated aAM. All 12 monoclones screened by PCR have detectable amplicons and are of the expected size for one of pp28 (0.8kb), pp52 (1.5 kb) or pp65 (1.9 kb). In addition, all 3 aAMs were represented across the 12 monoclones. In comparison, amplicons from three discrete monoclones, wherein in the aAM was known, were amplified in parallel as controls; all three controls produced the correct sized amplicons of pp28 (0.8 kb), pp52 (1.5 kb) and pp65 (1.9 kb). Thus, it is confirmed that the pool is comprised of eAPC-pa wherein each cell has a single randomly selected aAM form the original pool of three vectors.
[0594]
[0595] HLA-A*02:01-NLVP) and analysed by flow cytometry and gated for live single cells. The parental eTPC line showed no positive staining for CD3 or TCR on the cell surface (c), and was also negative for staining with HLA multimer reagent (d). In contrast, the resulting monoclone showed positive staining for both CD3 and TCR on the cell surface (e) and showed positive staining with the multimer reagent specific for the expressed JG9-TCR. Percentage values represent the percentage of CD3/TCRab double positive cells in c) and e), and CD3/HLA-multimer double positive cells in d) and f). g) Genomic DNA was prepared from monoclonal eTPC-t ACL-851 and subjected to PCR with primers specific for the JG9-TCR-alpha chain encoded by Component 2D, or the JG9-TCR-beta chain encoded by Component 2B. PCR products were resolved by agarose gel and observed as expected band size. h) Genomic DNA was prepared from monoclonal eTPC-t ACL-851 and subjected to digital drop PCR with primers and probes specific for the JG9-TCR-alpha chain encoded by Component 2D, or the JG9-TCR-beta chain encoded by Component 2B. A reference amplicon primer/probe pair for an intron of the TCR alpha constant (TRAC) was included. The table presents ratios of reference to TCR alpha and TCR beta. A ratio of close to 0.33 indicates that a single copy of each TCR alpha and beta chain is present in the eTPC-t line ACL-851, which is a triploid line.
[0596]
[0597] A parental eTPC-t cell line ACL-851, expressing a TCR alpha and beta chain at site 2D and 2B, respectively was reverted to a eTPC-x line by exchanging Component 2D with a donor vector encoding GFP (Component 2Z). Component 2Z contained recombinase heterospecific F14/F15 sites flanking the GFP ORF, and was thus compatible with Component 2D. eTPC-t line ACL-851 was transfected with Component 2Z along with a construct encoding flp recombinase. 7 days after transfection, individual cells positive for GFP signals were sorted and grown as monoclones. Resulting monoclonal eTPC-x lines were analysed by flow cytometry in parallel with the parental eTPC-t, and a single example presented. a) and b) The monolcone eTPC-x (ACL-987) derived from parental eTPC-t ACL-851 was analysed by flow cytometry for GFP expression along with the parental line. Plots display SSC versus GFP parameters of gated live single cells. The parental cell line has no GFP expression (a), while the monoclone ACL-987 has gained GFP as expected (b), indicating exchange of the TCR alpha ORF for a GPF ORF. c) and d) The monolcone eTPC-x ACL-987 derived from parental ACL-851 along with the parental eTPC-t ACL-851 were stained with antibodies for CD3 and TCRab and analysed by flow cytometry. Plots display CD3 versus TCRab parameters gated on live single cells. The parental cell showed positive staining for both CD3 and TCRab (c), while the derived monoclone showed negative staining for both (d); confirming loss of TCR alpha ORF in the derived eTPC-x line.
[0598]
[0599] An eTPC-t pool was created from an eTPC-x parental line expressing a single TCR beta chain in Component 2B. The eTPC-x line expressed GFP as the reporter at available site 2D. A pool of 64 variant TCR alpha chains, including the parental chain, were constructed. The parental TCR chain pair represents the JG9-TCR with known specificity for a HCMV antigen presented in HLA-A*02:01. The Component 2E pool was transfected into the parental eTPC-x ACL-987 along with a construct encoding flp recombinase. A polyclonal line was selected by sorting for GFP positive cells 10 days after transfection. The resulting ACL-988 polyclonal eTPC-t was subsequently sorted on the basis of negative staining for GFP and positive or negative staining for HLA multimer reagent (DEX HLA-A*02:01-NLVP). Recovered single cells were sequenced to identify the encoded TCR-alpha chains and compared to a parallel analysis of each of the TCR-alpha chain variants paired with the native TCR-beta chain in terms of staining with an HLA multimer reagent specific for the parental TCR chain pair. a) and b) Parental eTPC-x ACL-987 line and resulting polyclone eTPC-t ACL-988 line were analysed by flow cytometry for GFP expression. Plots display SSC versus GFP parameters of live single cells. Parental cell line shows positive signal for GFP, indicating intact Component 2D (a). Derived polyclonal line shows half positive and half negative for GFP (b), indicating that half of the cells in the polyclonal population have potentially exchanged the GFP ORF at D for TCR alpha ORF to form Component 2D. c) and d) Parental eTPC-x ACL-987 line and resulting polyclone eTPC-t ACL-988 line were stained with and CD3 antibody and HLA multimer with specificity for the parental JG9-TCR (DEX HLA-A*02:01-NLVP), and analysed by flow cytometry. Plots display CD3 versus HLA multimer parameters of live single cells. The parental cell line is negative for both CD3 and HLA multimer staining (c). The left hand panel of d) displays gated GFP-negative events, and the right hand GFP-positive events. Only GFP-negative events, where the Component 2D is converted to D, shows CD3 positive staining, of which a subset shows positive staining for HLA multimer. Single cells from the gated HLA multimer negative and positive gate were sorted and the integrated ORF at Component 2D sequenced to determine identity of TCR alpha ORF. e) All 64 JG9-TCR-alpha variants were cloned into an expression construct that permitted each to be independently transfected to parental eTPC-x (ACL-987). Relative staining units (RSU) against the HLA-A*02:01-NLVP tetramer reagent was determined for each. RSU is calculated as the ratio of the mean fluorescence intensity (MFI) of HLA-A*02:01-NLVP tetramer signal for the CD3 positive population over the CD3 negative population, and is indicative of the binding strength of each TCR chain pair variant to the HLA multimer reagent. Each point plotted in Figure e) represents the observed RSU for each 64 variants. Open circles correlate to the sequenced cells recovered from the GFP-negative/HLA multimer-positive gate. Open triangles correlate to the sequenced cells recovered from the GFP-negative/HLA multimer-negative gate.
[0600]
[0601] The eTPC-t cell line carrying a Component 2F (ACL-1277), wherein the TCR chains at Component 2B and 2D encode a TCR pair that is specific for HMCV antigenic peptide NLVPMVATV presented in HLA-A*02:01. The Component 2F reporter was RFP. This eTPC-t was contacted for 24 hours with various eAPC lines of differing -p characteristics in the presence and absence of model peptide antigens, and the contact cultures analysed by flow cytometry. Flow cytometry histogram plots show event counts against RFP signal of viable single T-cells identified by antibody staining for a specific surface marker that was not presented by the eAPC. a) and b) eAPC-p cells expressing only HLA-A*02:01 (ACL-209) were pulsed with NLVPMVATV (a) or VYALPLKML (b) peptides and subsequently co-cultured with eTPC-t for 24 hrs. c) and d) eAPC-p cells expressing only HLA-A*24:02 (ACL-963) were pulsed with NLVPMVATV (c) or VYALPLKML (d) peptides and subsequently co-cultured with eTPC-t for 24 hrs. e) eAPC-p cells expressing only HLA-A*02:01 (ACL-209) were left without peptide pulsing and subsequently co-cultured with eTPC-t for 24 hrs. f) eAPC parental cells that express no HLA on the cell surface (ACL-128) were pulsed with NLVPMVATV and subsequently co-cultured with eTPC-t for 24 hrs. RFP signal was significantly increased in the eTPC-t ACL-1277 only in the presence of HLA-A*02:01 expressing eAPC-p pulsed with NLVPMVATV, representing the known target of the expressed TCR. Histogram gates and values reflect percentage of events in the RFP positive and RFP negative gates. This indicates the specific response of Component 2F to engagement of eTPC-t expressed TCRsp with cognate HLA/antigen (aAPX:aAM).
[0602]
[0603] The eTPC-t cell line carrying a Component 2F (ACL-1150), wherein the TCR chains at Component 2B and 2D encode a TCR pair that is specific for HMCV antigenic peptide NLVPMVATV presented in HLA-A*02:01. The Component 2F reporter was RFP. This eTPC-t was contacted for 24 hours with various eAPC lines of differing -pa characteristics in the absence of exogenous antigen.a) eAPC-pa line (ACL-1044) expressing HLA-A*02:01 and the full-length ORF for HCMV protein pp52. pp52 does not contain antigenic sequences recognised by the JG9-TCR. b) eAPC-pa line (ACL-1046) expressing HLA-A*02:01 and the full-length ORF for HCMV protein pp65. pp65 contains antigenic sequence recognised by the JG9-TCR, when presented in HLA-A*02:01. c) eAPC-pa line (ACL-1045) expressing HLA-B*07:02 and the full-length ORF for HCMV protein pp52. pp52 does not contain antigenic sequences recognised by the JG9-TCR.
[0604] d) eAPC-pa line (ACL-1048) expressing HLA-B*07:02 and the full-length ORF for HCMV protein pp65. pp65 contains antigenic sequence recognised by the JG9-TCR, when presented in HLA-A*02:01. After independent co-culture of each eAPC-pa line with the eTPC-t for 48 hrs, RFP expression in the eTPC-t was determined by flow cytometry. RFP signal was significantly increased in the eTPC-t ACL-1150 only when contacted with eAPC-pa ACL-1046. This was the only eAPC-pa with both the recognised antigenic peptide sequence encoded by the integrated aAM ORF, and the correct HLA restriction. Histogram gates and values reflect percentage of events in the RFP positive and RFP negative gates. This indicates the specific response of Component 2F to engagement of eTPC-t expressed TCRsp with cognate HLA/antigen (aAPX:aAM).
MATERIALS AND METHODS
[0605] All cell lines used in this application are either on the ARH or HEK293 background. They are denoted by ACL followed by a number. A summary of the cell lines used in this application is presented as Table 1.
[0606] Transfection of Cells
[0607] One day prior to transfection/ electroporation, cells were seeded at a density of 1.2-1.410.sup.6 cells/60 mm dish in 90% DMEM+2 mML-glutamine+10% HI-FBS (Life Technologies). The following day, cells with 65% confluency were transfected with a total amount of 5 ug DNA and jetPEl 6 (Polyplus transfection reagent, Life Technologies) at a N/P ratio of 6. Stock solutions of DNA and jetPEl 6 were diluted in sterile 1M NaCI and 150 mM NaCl respectively. The final volume of each solution was equivalent to 50% of the total mix volume. The PEI solution was then added to the diluted DNA and the mixture was incubated at room temperature for 15 min. Finally, the DNA/PEI mixtures were added to the 60-mm dishes, being careful not to disrupt the cell film. The cells were incubated for 48 hours at (37 C., 5% CO2, 95% relative humidity) prior to DNA delivery marker expression analysis. The medium was replaced before transfection.
[0608] Fluorescence Activated Cell Sorting (FACS)
[0609] Single cell sorting or polyclone sorting was achieved through standard cell sorting methodologies using a BDInflux instrument. Briefly, ACL cells were harvested with TrypLE Express Trypsin (ThermoFisher Scientific) and resuspended in a suitable volume of DPBS 1 (Life Technologies) prior to cell sorting, in DMEM 1 medium containing 20% HI-FBS and Anti-Anti 100X (Life Technologies). Table 2 summarises the antibodies and multimers used in this application for FACS.
TABLE-US-00001 TABLE 2 BD Influx filters Protein Fluorochrome Filter Cas9/GFP GFP 488-530/40 HLA-A, B, C PE-Cy5 561-670/30 BFP BFP 405-460/50 RFP RFP 561-585/29 TCRab (R63) APC 640-670/30 CD3 (R78) APC-H7 640-750LP CD3 (R71) APC 640-760/30 DEX HLA-A*02:01-NLVP PE 561-585/29
TABLE-US-00002 TABLE 1 Table of ACL cell lines, components and if applicable ORF integrated at Component 1B/1B or 2B/2B and Component 1D/1D or 2D/2D Gene of interest Gene of interest ID Components (B or B) (D or D) Designation ACL-3 None NA NA ACL-128 None NA NA ACL-191 1B, 1D HLA-A*02:01 eAPC-p ACL-209 1B, 1D HLA-A*02:01 eAPC-p ACL-341 1B, 1D HLA-DRB1*01.01 eAPC-p ACL-390 1B, 1D HLA-A*02:01 pp65 ORF eAPC-pa ACL-402 1B, 1D RFP BFP eAPC ACL-488 1B, 1D BFP RFP ACL-851 1B, 1D JG9-TCR-beta JG9-TCR-alpha eTPC-t ACL-900 1B, 1D HLA-A*02:01 BFP eAPC-p ACL-905 1B, 1D HLA-A*02:01 BFP eAPC-p ACL-963 1B, 1D HLA-A*24:02 BFP eAPC-p ACL-987 1B, 1D JG9-TCR-beta GFP eTPC-x ACL-988 1B, 1D JG9-TCR-beta JG9-TCR-alpha eTPC-t (pool) 64x variants ACL-1050 1B, 1D HLA-A*02:01 pp28, pp52, pp65 eAPC-pa (pool) ACL-1043 1B, 1D HLA-A*02:01 pp28 ORF eAPC-pa ACL-1044 1B, 1D HLA-A*02:01 pp52 ORF eAPC-pa ACL-1045 1B, 1D HLA-B*07:02 pp52 ORF eAPC-pa ACL-1046 1B, 1D HLA-A*02:01 pp65 ORF eAPC-pa ACL-1048 1B, 1D HLA-B*07:02 pp65 ORF eAPC-pa ACL-1063 2B, 2D, 2F Selection Selection eTPC with marker 1 marker 2 response element ACL-1150 2B, 2D, 2F TCR-alpha TCR-beta eTPC-t, with response element ACL-1219 1B, 1D HLA-A*02:01 pp28 ORF eAPC-pa ACL-1227 1B, 1D HLA-A*02:01 pp52 ORF eAPC-pa ACL-1233 1B, 1D HLA-A*02:01 pp65 ORF eAPC-pa ACL-1277 2B, 2D, F TCR-alpha TCR-beta eAPC-t, with response element
[0610] Flp-Mediated Integration of HLA-A*02:01 Sequences in eAPC Cell Line
[0611] eAPC cells were electroporated with vectors encoding Flp, DNA encoding a marker to track delivery (vector encoding GFP) and a vector containing HLA-A*02:01. The HLA-A*02:01 sequence also encoded a linker and 3xMyc- tag at the 3end. The electroporation conditions used were 258 V, 12.5 ms, 2 pulses, 1 pulse interval. Ratio between each integrating vector and the Flp-vector was 1:3. Cells electroporated with only GFP-vector and no electroporated cells were used as controls respectively in order to set the gates for GFP sort after two days. On the following day (2 days after electroporation), cells were analyzed and sorted based on GFP expression. Cells were sorted using the BD Influx Cell Sorter.
[0612] At 3 days after electroporation, a sort based on GFP-expression was performed in order to enrich for electroporated cells. 7-8 days after electroporation, the cells were harvested and surface stained for HLA-ABC expression. BFP+ve RFPve HLA+ve cells were single cell sorted for monoclonal.
[0613] To genotype the cells, 100 ng of DNA was used as template to run a PCR reaction to check if integrations had occurred at the expected integration site. A forward primer targeting the integration cassettes (Pan_HLA_GT_F1) and a reverse primer (SV40pA_GT_R1) targeting just outside the integration site was used and the PCR product was run on a 1% agarose gel.
[0614] Flp-Mediated Integration of HCMV ORF Sequences in eAPC-p Cell Line
[0615] eAPC-p cells were electroporated with vectors encoding Flp, DNA encoding a marker to track delivery (vector encoding GFP) and vectors containing HCMV pp28, pp52 or pp65 aAM-ORF. The HCMV-ORF sequences also encoded a linker and 3xMyc-tag at the 3end. The electroporation conditions used were 258 V, 12.5 ms, 2 pulses, 1 pulse interval.
[0616] Ratio between each integrating vector and the Flp-vector was 1:3. Cells electroporated with only GFP-vector and no electroporated cells were used as controls respectively in order to set the gates for GFP sort after two days. On the following day (2 days after electroporation), cells were analyzed and sorted based on GFP expression. Cells were sorted using the BD Influx Cell Sorter.
[0617] Flp-Mediated Shotgun Integration of 3 HCMV ORF Sequences in eAPC-p Cell Line
[0618] eAPC-p cells were electroporated with vectors encoding Flp, DNA encoding a marker to track delivery (vector encoding GFP) and vectors containing HCMV pp28, pp52 or pp65 aAM-ORF. The HCMV-ORF sequences also encoded a linker and 3xMyc- tag at the 3end. The electroporation conditions used were 258 V, 12.5 ms, 2 pulses, 1 pulse interval. For the shotgun integration, the vectors containing HCMV-ORFs were pooled in a ratio 1:1:1 and the mixture was electroporated into the eAPC-p cell. The resulting eAPC-pa cells were polyclonal. Individual monoclone cells were sorted and genetically characterized to demonstrate that the polyclone was made up of cells containing all three HCMV-ORFs.
[0619] Genetic Characterization of the Monoclones
[0620] PCR Reactions to Assess the RMCE-Integration of the HCMV ORFs into Component D
[0621] Primers used to assess integration of the HCMV ORF annealed to the linker (forward primer 10.D.1) and EF1aplha promoter (reverse primer 15.H.4). Expected size was 0.8 kb for pp28, 1.5 kb for pp52, 1.9 kb for pp65. PCR products were run on a 1% Agarose gel in 1 TAE buffer, using the PowerPac Basic (Bio-Rad), stained with 10,000 dilution of sybersafe and analyzed with Fusion SL (Vilber Lourmat).
TABLE-US-00003 TABLE 3 PCR reagents for assess integration of the aAM ORF Reaction Component Volume per reaction 5xPhusion buffer 4 ul DNTPs 0.2 ul Phusion DNA polymerase 0.15 ul 10.D.1 0.5 ul 15.H.4 0.5 ul H20 up to 20 ul DNA (100 ng) 1 ul (100 ng/ul) DMSO 3% 0.6 ul
TABLE-US-00004 TABLE 4 PCR cycle conditions Step Temperature Time Initial Denaturation 98 C. 30 sec 30 cycles 98 C. 10 sec 60 C. 10 sec 72 C. 15 sec Final extension 72 C. 10 min
[0622] RMCE Between a Paired Integration Couple
[0623] For RMCE integration, cells were transfected with 0.6 g of DNA vectors encoding FLP, (V4.l.8), 2 g of Component C/Y, 2 g of Component E/Z, 0.4 g of DNA encoding a marker to track DNA delivery. 2 days after transfection cell positive for the DNA delivery marker, either GFP or RFP positive, were sorted by FACS. 4-10 days after transfection, individual cells displaying diminished fluorescent protein signal, encoded by Components D and B selection markers were sorted by FACS. The exception being for generating ACL-987 where individual cells displaying GFP positivity were sorted by FACS.
[0624] Transient Expression of TCR Chain Pairs to Characterization of Their RSU
[0625] For transient expression, cells were transfected with DNA vectors encoding FLP, (V4.l.8), JG9-TCR-alpha variant (VP.7751.RC1.A1 to VP.7751.RC1.H8), JG9-TCR-beta WT chain (V3.C.5), and DNA vector vehicle (V1.C.2). 2 days after transfection, all cells were stained with HLA-A*02:01-NLVP tetramer and anti-CD3 antibodies. RSU were calculated as the ratio of the mean fluorescence intensity (MFI) of HLA-A*02:01-NLVP tetramer signal for the CD3 positive population over the CD3 negative population, and was indicative of the binding strength of each TCR chain pair variant.
[0626] HLA Multimer Staining
[0627] Cells were stained with HLA-multimer reagent on ice for 10 mins, then with CD3 and/or TCRab antibodies. Detection of specific cell fluorescent properties by the BDInflux instrument are defined in table 6.
[0628] Sorting of single cells for monoclonal generation, the cells displaying the phenotype interest were deposited into 96-well plates, containing 200 ul of growth medium. One to two plates were sorted per sample. Polyclonal cell sorts were directed into FACS tubes, containing media, using the Two-way sorting setting in the cell sorter Influx (BD Biosciences).
[0629] Single cells sorts for molecular characterization of their JG9-TCR-alpha variant were sorted to PCR plate pre-loaded with 5 L of nuclease-free water. Specimens were snap-frozen until subsequent processing.
[0630] Genomic DNA extraction for genetic characterization DNA was extracted from 510.sup.6 cells using the QIAamp DNA Minikit (Qiagen). DNA was stored in 1 TE (10 mM Tris pH8.0 and 0.1 mM EDTA).
TABLE-US-00005 TABLE 5 Vectors ID Name V1.A.4 pcDNA3.1_GFP V1.A.6 pcDNA3.1_RFP V1.C.2 pMA-SV40pA V3.C.5 pMA-CS-JG9-TCRbeta V4.H9 pMA-F14-TurboGFP-F15 V7.A.3 pMA-F14-TCR-JG9-F15 V7.A.4 pMA-FRT-TCR-JG9-F3 V8.F.8 F14-TCRaF15 CDR3degen.64mix V4.I.8 CMVpro-Flp-sv40pA-V2 VP.7751.RC 64 individual vectors, each encode a different 1-A1 to H8 member of JG9-TRA CDR3 64 variants set V4.H.5 pMA_F14_HLA-A*02:01-6xHis_F15 V4.H.6 pMA_F14_HLA-A*24:02-6xHis_F15 V4.H.7 pMA_F14_HLA-B*07:02-6xHis_F15 V4.H.8 pMA_F14_HLA-B*35:01-6xHis_F15 V9.E.6 FRT_HCMVpp28-3xMYC_F3 V9.E.7 FRT_HCMVpp52-3xMYC_F3 V9.E.8 FRT_HCMVpp52-3xMYC_F3 V1.A.8 SpCas9-2A-GFP V2.A.1 HLA-A-sg-sp-opti1 V2.A.7 HLA-B-sg-sp-3 V2.B.3 HLA-C-sg-sp-4 V2.I.10 HLA-A-ex2-3_sg-sp-opti_1 V2.J.1 HLA-A-ex2-3_sg-sp-opti_2 V2.J.6 AAVSI_sg-sp-opti_3
[0631] PCR reactions to assess the RMCE- integration of the TRA-ORF and TRB-ORF into component 2B or 2D.
[0632] Primers used to assess integration of the TCR-alpha, annealed to the TRAC segment (forward primer 1.F.7) and the sv40pA terminator (Reverse primer 15.H.2) that is a pre-existing part of the genomic receiving sites. Expected size 566 bp. Primers used to assess integration of the TCR-beta, annealed to the TRBC segment (forward primer 1.F.9) and the sv40pA terminator (Reverse primer 15.H.2) that is a pre-existing part of the genomic receiving sites. Expected size 610 bp. PCR products were run on a 1% Agarose gel in 1 TAE buffer, using the PowerPac Basic (Bio-Rad), stained with 10,000 dilution of sybersafe and analyzed with Fusion SL (Vilber Lourmat).
TABLE-US-00006 TABLE 6 PCR reagents for assess integration of ORF encoding TCR-alpha and TCR-beta Volume per reaction Reaction Component (TCR-alpha) 5xPhusion buffer 4 ul DNTPs 0.2 ul Phusion DNA polymerase 0.15 ul 1.F.7: TRAC-GT-F1 0.5 ul 15.H.2: sv40pA-GT-R1 0.5 ul H20 up to 20 ul DNA (100 ng) 1 ul (100 ng/ul) Reaction Component (TCR Beta) 5xPhusion buffer 4 ul DNTPs 0.2 ul Phusion DNA polymerase 0.15 ul 1.F.9: TRBC2-GT-F1 0.5 ul 15.H.2: sv40pA-GT-R1 0.5 ul H20 up to 20 ul DNA (100 ng) 1 ul (100 ng/ul)
TABLE-US-00007 TABLE 7 PCR cycle conditions Step Temperature Time Initial Denaturation 98 C. 30 sec 30 cycles 98 C. 10 sec 60 C. 10 sec 72 C. 15 sec Final extension 72 C. 10 min
[0633] ddPCR Reactions to Assess the Copy Number of TRA-ORF and TRB-ORF in the Genome After DNA Delivery
[0634] DNA of selected ACL-851 monoclones was analysed by using specific primers and probed targeting the TCR ORF C segment (TRAC) of interest. Primers and probe used to assess TRA-ORF copy number, annealed to the TRAC segment (forward primer 1.F.7, Reverse primer 1.F.8 and probe 1.G.1). Primers and probe used to assess TRB-ORF copy number, annealed to the TRB-C segment (forward primer 1.F.9, Reverse primer 1.F.10 and probe 1.G.2)
[0635] In all cases, a reference gene (TRAC) was simultaneously screened to chromosome determine copy numbers, using primers 10.A.9 and 10.A.10 together with the fluorescent probe 10.6.6 conjugated with HEX. Integration copy number considered that HEK293 cells are triploid for reference gene (TRAC). Prior to Droplet Digital PCR, DNA was digested with Mfel (NEB) to separate tandem integrations. The reaction setup and cycling conditions were followed according to the protocol for ddPCRTM Supermix for Probes (No dUTP) (Bio-Rad), using the QX200 Droplet Reader and Droplet Generator and the C1000 Touch deep-well Thermal cycler (Bio-Rad). Data was acquired using the QuantaSoft Software, using Ch1 to detect FAM and Ch2 for HEX.
TABLE-US-00008 TABLE 8 ddPCR conditions Step Temperature Time Initial Denaturation 95 C. 10 min 40 cycles 98 C. 30 sec 60 C. 60 sec Final extension 72 C. 10 min (Option) Cooling 8 C.
TABLE-US-00009 TABLE9 ddPCRPrimersandprobes ID Name Sequence 1.F.7 TRAC-GT-F1 ATGTGCAAACGCCTTCAAC 1.F.8 TRAC-GT-R1 TTCGGAACCCAATCACTGAC 1.G.1 TRAC-probe- TTTCTCGACCAGCTTGACATCACAGG FAM 1.F.9 TRBC2-GT-F1 GCTGTCAAGTCCAGTTCTACG 1.F.10 TRBC2-GT-R1 CTTGCTGGTAAGACTCGGAG 1.G.2 TRBC2-probe- CAAACCCGTCACCCAGATCGTCA FAM 10.A.9 TRAC-TCRA-ex1- CTGATCCTCTTGTCCCACAGATA F1 10.A.10 TRAC-TCRA-ex1- GACTTGTCACTGGATTTAGAGTCTCT F1 10.B.6 TRAC-probe ATCCAGAACCCTGACCCTGCCG (HEX) 21.I.1 HCMVpp65_GT_F2 TCGACGCCCAAAAAGCAC 21.I.2 HCMVpp28_GT_F1 TGCCTCCTTGCCCTTTG 21.I.3 HCMVpp52_GT_F1 CGTCCCTAACACCAAGAAG 20.H.10 Myc-Tag_GT_R1 AAGGTCCTCCTCAGAGATG 20.H.9 Linker-Myc_ CTTTTGTTCTCCAGATCCAGATCCACC Probe_Fam
[0636] Sequencing of TCR Alpha and Beta Chains from Single T-Cells
[0637] Individual FACS-sorted eTPC-t-cells were subjected to a two-step amplification process that entails a V-region specific primer collection for each TRA and TRB, followed by paired nested PCR reactions that create TRA and TRB amplicons for sequence analysis. This procedure is described previously (Han et. al. Nat Biotechnol. 2014 32(7): 684-692). The following materials were used in the described procedures:
TABLE-US-00010 TABLE 10 Single cell RT-PCR and nested PCR reagents Supplier Product Supplier Number 2x Reaction Mix Thermo Scientific 12574035 5X Phusion HF Buffer Thermo Fisher F-549S Scientific dNTPs Thermo Fisher 10297018 Scientific Nuclease free water Qiagen 129114 Phusion Hot Start II DNA Thermo Fisher F-549S Polymerase Scientific SuperScript III One- Step Thermo Scientific 12574035 RT-PCR System with Platinum Taq High Fidelity DNA Polymerase
[0638] Functional Demonstration of Component F
[0639] eTPC-t and eAPC cells were routinely cultured in RPMI+10% heat-inactivated Fetal Calf Serum (complete media) between 0.210{circumflex over ()}6-1.510{circumflex over ()}6 cells/ml, at 37C, 90% relative humidity and 5% CO2. Peptide NLVPMVATV were synthetized by Genescript, and received lyophilized. Peptide primary stocks were suspended in 10% DMSO and sorted at 80 C. Working stocks were prepared at the time of administration, at 50 M in complete media (50 concentrated). The following eAPC-p presenting HLA-A*02:01 (ACL-900) or HLA-B*07:02 (ACL-906) or eAPC-pa with aAPX and exogenous aAM, HLA-A*02:01+HCMVpp52 (ACL-1044) or HLA-A*02:01+HCMVpp65 (ACL-1046) or HLA-B*07:02+HCMVpp52 (ACL-1045) or HLA-B*07:02+HCMVpp65 (ACL-1048), or parent eAPC (ACL-128) were used. Two different eTPC-t cell lines were used; the first eTPC-t, ACL-1277, (Component A) was engineered with two unique genomic receiver sites, utilizing native CD3 expression, and harboring a genomic two-component, synthetic response element (Component F, RFP reporter) (See Example 14). The second eTPC-t, ACL-1150, (Component A) was engineered with two unique genomic receiver sites, utilizing native CD3 expression, and harboring a genomic one-component, synthetic response element (Component F, RFP reporter) (See Example 15). Both eTPC-t were loaded with the TCR chain ORF at Component 2B and 2E encoding a TCR pair that is specific for HLA-peptide complex (HLA), HLA-A*02:01-NLVPMVATV.
[0640] Antigen Pulsing Procedure
[0641] Actively growing cultures of eAPC cells (0.4-1.010{circumflex over ()}6 cells/nil) were suspended, sample taken and counted to determine cell concentration. Subsequently, 1 million cells were harvested, washed once with Dulbecco's phosphate buffered saline (DPBS, Gibco) followed by suspension in complete media with 1 M of peptide or no peptide at a cell concentration between 1 to 210{circumflex over ()}6 cells/ml. Cells were incubated for 2 h in standard culturing conditions, in a 24-well culture plate. After 2 h the cells were harvested, pelleted by centrifugation (400 rcf, 3 min), followed by 310 ml washes with DPBS. Cells were subsequently suspended at 0.210{circumflex over ()}6 cells/ml in complete media.
[0642] eTPC-t Harvesting
[0643] Actively growing cultures of eTPC-t cells (0.4-1.010{circumflex over ()}6 cells/nil) were suspended, sample taken and counted to determine cell concentration. Cells were harvested, washed once with DPBS and then suspended at a concentration of 0.410{circumflex over ()}6 (for endogenous assays) or 0.610{circumflex over ()}6 cells/ml (or exogenous assays) in complete media.
[0644] Contacting eTPC-t and eAPC in an eTPC:eAPC System with Exogenous Antigenic Molecules
[0645] To each well of a 96-well round-bottom plate, 50 l of complete media, 50 l of eAPC , followed by 50 l of eTPC-t were added. This equated to approximately 10,000 eAPC and 30,000 eTPC-t for a ratio of 1:3, at a total cell concentration of approximately 0.2710{circumflex over ()}6 cells/ml. The cell mixture was then incubated for approximately 24 hours at standard culturing conditions.
[0646] Contacting eTPC-t and eAPC in an eTPC:eAPC System with Endogenous Antigenic Molecules
[0647] To each well of a 96-well round-bottom plate, 50 l of complete media, 50 l of eAPC, followed by 50 I of eTPC-t were added. This equated to approximately 10,000 eAPC and 20,000 eTPC-t for a ratio of 1:2, at a total cell concentration of approximately 0.210{circumflex over ()}6 cells/ml. The cell mixture was then incubated for approximately 48 hours at standard culturing conditions.
[0648] Staining and Analysis
[0649] After 24 or 48 hours incubation, the cells were harvested, and transplanted into 0.75 ml V-bottom Micronic tubes, washed once with 500 l DPBS and subsequently stained with Dead Cell Marker (DCM-APC-H7) as follows; to each well 25 l of staining solution was added, cells suspended by mixing and then incubated for 15-20 min. The staining solution comprised of 0.5 l DCM-APC-H7 per 100 l staining solution. After incubation, cells were washed twice with 500 l DPBS+2% FCS (Wash Buffer). Cells were then stained for surface markers unique to the eTPC-t; to each well 30 l of staining solution was added, cells suspended by mixing and then incubated for 30-45 min. The staining solution comprised of 2.5 l anti-myc-AF647 per 100 l staining solution (clone 9E10, Santa Cruz Biotech). After incubation, cells were washed twice with 500 l Wash buffer, suspended in 200 l of Wash buffer and then analysed by FACS on a LSRFortessa (BD Biosciences).
EXAMPLES
Example 1
Deletion of an APX Gene Family by Targeted Mutagenesis
[0650] Herein describes how targeted mutagenesis of a family of antigen-presenting complex (APX) encoding genes was achieved to produce the first trait of an engineered antigen-presenting cell (eAPC). The said trait is the lack of surface expression of at least one member of the APX family.
[0651] In this example, the targeted APX comprised the three members of the major HLA class I family, HLA-A, HLA-B and HLA-C in the HEK293 cell line. HEK293 cells were derived from human embryonic kidney cells that showed endogenous surface expression of HLA-ABC. Cytogenetic analysis demonstrated that the cell line has a near triploid karyotype, therefore the HEK293 cells encoded three alleles of each HLA-A, HLA-B and HLA-C gene.
[0652] Targeted mutagenesis of the HLA-A, HLA-B and HLA-C genes was performed using an engineered CRISPR/Cas9 system, in which, Cas9 nuclease activity was targeted to the HLA-A, HLA-B and HLA-C loci by synthetic guide RNAs (gRNAs). 4 to 5 unique gRNAs were designed to target conserved nucleotide sequences for each HLA gene locus and the targeted sites were biased towards the start of the gene coding sequence as this was more likely to generate a null allele. The gRNAs efficiency to induce a mutation at their targeted loci was determined and the most efficient gRNAs were selected to generate the HLA-A, HLA-B and HLA-C null (HLA-ABC.sup.null) HEK293 cell line.
[0653] Plasmid that encoded the optimal gRNAs targeting the HLA-A, HLA-B and HLA-C loci, together with a plasmid that encoded Cas9-P2A-GFP were transfected into HEK293 cells as described in the methods. Cells positive for Cas9-P2A-GFP plasmid uptake were FAC sorted based on GFP fluorescence, 2 days after transfection (
[0654] HLA-ABC.sup.null monoclones were confirmed by lack of surface expression of HLA-ABC. It was demonstrated that a subset of monoclones lacked surface expression of HLA-ABC, of which three example monoclones, ACL-414, ACL-415 and ACL-416 are depicted in
[0655] In conclusion, the genetically modified HEK293 cell lines, including, ACL-414, ACL-415 and ACL-416, were demonstrated to lack surface expression of the HLA-ABC and therefore possessed the first trait of an engineered antigen-presenting cell (eAPC).
Example 2
Generation of an eAPC Containing Component 1 B
[0656] Herein describes how Component 1B was stably integrated into the HLA-ABC.sup.null monoclone line ACL-414 to produce the second trait of an eAPC. The said second trait contained at least one genomic receiver site for integration of at least one ORF, wherein the genomic receiver site was a synthetic construct designed for recombinase mediated cassette exchange (RMCE)
[0657] In this example, the genomic integration site, component 1B, comprised of selected genetic elements. Two unique heterospecific recombinase sites, FRT and F3, which flanked an ORF that encoded the selection marker, blue fluorescent protein (BFP). Encoded 5 of the FRT site, was an EF1a promoter and 3 of the F3 site was a SV40 polyadenylation signal terminator. The benefit of positioning the non-coding cis-regulatory elements on the outside of the heterospecific recombinase sites was so they are not required in the matched genetic donor vector, component 1C. Therefore, after cellular delivery of the genetic donor vector, no transient expression of the encoded ORF would be observed. This made the selection of successful RMCE more reliable as the cellular expression of the ORF from the genetic donor vector would mostly likely occur only after correct integration into component 1B as it now contained the appropriate cis-regulator elements (see example 6).
[0658] To promote the stable genomic integration of component 1B into the genomic safe harbour locus, AAVS1, a plasmid was constructed, wherein; the DNA elements of component 1B were flanked with AAVS1 left and right homology arms. Each arm comprised of >500 bp of sequence homologous to the AAVS1 genomic locus.
[0659] Stable integration of component 1B was achieved through the process of homology directed recombination (HDR) at the genomic safe harbour locus, AAVS1. The ACL-414 cell line was transfected with plasmid that encoded the optimal gRNAs targeting the AAVS1 locus, plasmid that encoded Cas9-P2A-GFP and the plasmid that encoded component 1B genetic elements flanked by AAVS1 left and right homology arms. Cells positive for Cas9-P2A-GFP plasmid uptake were FAC sorted based on GFP fluorescence, 2 days after transfection (
[0660] Individual monoclone lines were selected as an eAPC on the basis of their maintained BFP expression and for a single integration of component 1B into the desired AAVS1 genomic location. Cell lines ACL-469 and ACL-470 represented monoclones with maintained BFP expression (
[0661] In conclusion, the genetically modified ACL-469 and ACL-470 cell lines, were HLA-ABC.sup.null and contained a single copy of a synthetic genomic receiver site designed for RMCE and therefore demonstrated the creation of a eAPC with a single synthetic integration receiver site.
Example 3
Generation of an eAPC Containing Component 1B and Component 1D
[0662] Herein describes how Component 1B and Component 1D were stably integrated into the HLA-ABC.sup.null monoclone line ACL-414 to produce the second trait of an eAPC. The said second trait contains two genomic receiver sites for integration of at least one ORF, wherein the genomic receiver site was a synthetic construct designed for recombinase mediated cassette exchange (RMCE).
[0663] This example uses the same methods and components as described in example 2 but with the addition of a second genomic receiver site, Component 1D. Component 1D genetic elements comprised of two unique heterospecific recombinase sites, F14 and F15, which were different to component 1B. These sites flanked the ORF that encoded the selection marker, the red fluorescent protein (RFP). Encoded 5 of the F14 site was an EF1a promoter and 3 of the F15 site was a SV40 polyadenylation signal terminator. As in example 2, component 1D genetic elements were flanked with AAVS1 left and right homology arms, each comprised of >500 bp of sequence homologous to the AAVS1 genomic locus.
[0664] Component 1B and component 1D were integrated into the AAVS1 as described in example 2 but with the addition of the plasmid that encoded component 1D elements, to the transfection mix. Cells positive for Cas9-P2A-GFP plasmid uptake were FAC sorted based on GFP fluorescence, 2 days after transfection (
[0665] Individual monoclone lines were selected as an eAPC on the basis of their maintained BFP and RFP expression and for a single integration of component 1B and a single integration of component 1D into different AAVS1 alleles. Cell line ACL-472 was a representative monoclone with maintained BFP and RFP expression (
[0666] In conclusion, the genetically modified ACL-472 cell line, was HLA-ABC.sup.null and contained a single copies of the synthetic genomic receiver site component 1B and component 1D, designed for RMCE and therefore demonstrated the creation of an eAPC with two unique synthetic integration receiver sites.
Example 4
An eAPC-p Constructed in One Step with One Integration Couple wherein Component 1C encoded a single HLAI ORF
[0667] Herein describes how an eAPC-p was constructed in one step with one integration couple, wherein, the genomic receiver site, component 1B, is a native genomic site and the genetic donor vector, component 1C, comprised a single ORF that encoded one analyte antigen-presenting complex (aAPX).
[0668] In this example, the eAPC was a genetically modified ARH-77 cell line, designated ACL-128, wherein, two families of APX, major HLA class I family and HLA class II, were mutated. The founding cell line, ARH-77, is a B lymphoblast derived from a plasma cell leukemia that showed strong HLA-A,B,C and HLA-DR,DP,DQ cell surface expression. Cytogenetic analysis demonstrated that the founding ARH-77 cell line has a near diploid karyotype, but also displayed a chromosome 6p21 deletion, the region encoding the HLA locus. DNA sequencing of the ARH-77 locus confirmed that ARH-77 encoded only a single allele of HLA-A, HLA-B and HLA-C and HLA-DRA, HLA-DRB, HLA-DQA, HLA-DQB, HLA-DPA and HLA-DPB gene families.
[0669] The HLA-ABC.sup.null and HLA-DR,DP,DQ.sup.null cell line ACL-128, was generated by CRISPR/cas9 targeted mutagenesis with gRNA targeting the HLA-A, HLA-B and HLA-C and HLA-DRA, HLA-DRB, HLA-DQA, HLA-DQB, HLA-DPA and HLA-DPB gene families using the method described in Example 1. Surface labeling with a pan-anti-HLA-ABC or pan-anti-HLA-DR,DP,DQ confirmed that ACL-128 lacked surface expression of both APX families,
[0670] In this example, the genomic receiver site, component 1B, was the native AAVS1 genomic site, and the targeted integration was achieved through HDR. The genetic donor vector, component 1C, was matched to component 1B, by component 1C encoding the AAVS1 left and right homology arms, each comprised of >500 bp of sequence homologous to the AAVS1 genomic locus. Between the AAVS1 left and right homology arms, the plasmid encoded a CMV promoter and a SV40 terminator. The aAPX of interest was cloned between the promoter and the terminator, generating component 1C. In this example, component 1C comprised a single ORF that encoded one aAPX, the HLA-A*24:02 or HLA-B*-07:02, denoted component .sup.1CHLA-A*24:02 and component 1C.sup.HLA-B*-07:02 respectively.
[0671] The process to construct an eAPC-p was via HDR induced integration of component 1C into component 1B to produce component 1B. The cell line ACL-128 was electroporated with plasmids that encoded the optimal gRNAs targeting the AAVS1 loci, Cas9-P2A-GFP and component 1C. Cells positive for Cas9-P2A-GFP plasmid uptake were FAC sorted based on GFP fluorescence, 2 days after electroporation (
[0672] Individual monoclone lines were selected as an eAPC-p on the basis of their maintained analyte HLA surface expression and the integration of the analyte ORF into the genomic receiver site, creating component 1 B. Cell lines ACL-321 and ACL-331 were representative monoclones with maintained analyte HLA surface expression of HLA-A*24:02 or HLA-B*-07:02 respectively (
[0673] In conclusion, the generation of the genetically modified ACL-321 and ACL-331 cell lines, which contained a copy of the aAPX HLA-A*24:02 or HLA-B*-07:02 ORF, respectively, within the genomic receiver site, component 1B, resulted in the said analyte aAPX to be the only major HLA class I member expressed on the cell surface. Therefore, this demonstrated the creation of two defined eAPC-p cell lines using the multi-component system.
Example 5
An eAPC-p Constructed in One Step with One Integration Couple, wherein Component 1C Encoded a Paired HLAII ORF
[0674] Herein describes how an eAPC-p was constructed in one step with one integration couple, wherein, the genomic receiver site, component 1B, was a native genomic site and the genetic donor vector, component 1C comprised a single ORF that encoded two aAPX chains.
[0675] This example used eAPC, ACL-128, and component 1B, both of which are defined in example 4. However component 1C comprised a single ORF that encoded an HLA-DRA*01:01 allele linked to an HLA-DRB1*01:01 allele by a viral self-cleaving peptide element, or HLA-DPA1*01:03 allele linked to an HLA-DPB1*04:01 allele by a viral self-cleaving peptide element, denoted component 1C.sup.HLA-DRA*01:01/H LA-DRB1*01:01 and component 1C.sup.HLA-DPA1*01:03/HLA-DPB1*04:01 respectively. The viral self-cleaving peptide element encoded a peptide sequence, that when transcribed resulted in self-cleavage of the synthesized peptide and produced two polypeptides defining each HLA chain.
[0676] Within example 4, described the process to construct an eAPC-p with the exception that identification of cells that gained expression of an analyte HLA on their surface were assed by cell surface labelling with a pan-anti-HLA-DR,DP,DQ antibody (
[0677] Individual monoclone lines were selected as an eAPC-p on the basis of their maintained analyte HLA surface expression and the integration of the analyte ORF into the genomic receiver site, creating component 1 B as described in example 4. Cell lines ACL-341 and ACL-350 were the representative monoclones with maintained analyte HLA surface expression of HLA-DRA*01:01/HLA-DRB1*01:01 or HLA-DPA1*01:03/HLA-DPB1*04:01 (
[0678] In conclusion, the generation of the genetically modified ACL-341 and ACL-350 cell lines, which contained a copy of the aAPX HLA-DRA*01:01/HLA-DRB1*01:01 or HLA-DPA1*01:03/HLA-DPB1*04:01 ORF, respectively, within the genomic receiver site, component 1 B, resulted in the said analyte aAPX to be the only major HLA class II member expressed on the cell surface. Therefore, this demonstrated the creation of two defined eAPC-p cell lines using the multicomponent system.
Example 6
An eAPC-p Constructed in One Step with One Integration Couple wherein Component 1B was a Synthetic Construct
[0679] Herein describes how an eAPC-p was constructed in one step with one integration couple, wherein, the genomic receiver site, component 1B, was a synthetic construct designed for RMCE genomic site and the genetic donor vector, component 1C comprised a single ORF that encoded one aAPX.
[0680] In this example, the genomic integration site, component 1B, comprised of selected genetic elements. Two unique heterospecific recombinase sites, FRT and F3, which flanked the ORF that encoded the selection marker, blue fluorescent protein (BFP). Encoded 5 of the FRT site, was an EF1a promoter and 3 of the F3 site was a SV40 poly-adenylation signal terminator. The genetic elements of component 1 B, were integrated in the cell line ACL-128 by electroporation with the same plasmids as described in example 2. Individual monoclone lines were selected on the basis of their maintained BFP expression and were genetically charaterised to contain a single integration of component 1B into the desired AAVS1 genomic location as described in example 2 (
[0681] The genetic donor vector, component 1C was matched to component 1B, as component 1C encoded the same heterospecific recombinase sites, FRT and F3. The aAPX ORF of interest, additionally encoded a kozak sequence just before the start codon, was cloned between the two heterospecific recombinase sites, and generated component 1C. In this example, component 1C comprised a single ORF that encoded one aAPX, the HLA-A*02:01, designated component 1C.sup.FRT:HLA-A*02:01:F3.
[0682] An eAPC-p was created through RMCE by electroporation of the cell line ACL-385 with plasmid that encoded the Tyr-recombinase, Flp, together with component 1C.sup.FRT:HLA- A*02:01:F3. 4-10 days after electroporation, individual cells positive for HLAI surface expression and negative/reduced for the fluorescent protein marker, BFP, encoded by component 1B selection marker, were sorted. Individual outgrown monoclone lines were selected on the basis of their maintained HLAI allele expression and loss of BFP florescence, which indicated that the expected RMCE occurred. To identify such monoclones, both phenotypic and genetic tests were performed. Firstly, all monoclone cell lines were screened for cell surface HLA-ABC expression and lack of BFP florescence (
[0683] In conclusion, the generation of the genetically modified ACL-421 and ACL-422 cell lines, which contained a copy of the aAPX HLA-A*02:01 ORF, respectively, within the synthetic genomic receiver site, component 1B, resulted in the said analyte aAPX to be the only major HLA class I member expressed on the cell surface. Therefore, this demonstrated the creation of two defined eAPC-p cell lines using the multicomponent system.
Example 7
An eAPC-pa Constructed in Two Steps with Two Integration Couples
[0684] Herein describes how an eAPC-pa was constructed in two steps. Step 1, wherein the genomic receiver site, component 1B, was the native genomic site and the genetic donor vector, component 1C comprised a single ORF that encoded one aAPX. Step 2 the genomic receiver site, component 1 D, was a second native genomic site and the genetic donor vector, component 1E comprised a single ORF that encoded one analyte antigen molecule (aAM).
[0685] In this example, step 1 was performed, wherein, the eAPC was ACL-128, the genomic receiver site, component 1B, was the mutated HLA-A allele genomic site, designated HLA-A.sup.null, and the targeted integration was achieved through HDR. The genetic donor vector, component 10 was matched to component 1B, by the component 1C encoding the HLA-A.sup.null left and right homology arms, each comprised of >500 bp of sequence homologous to the HLA-A.sup.null genomic locus. Between the HLA-A.sup.null left and right homology arms, the plasmid encoded a CMV promoter and SV40 terminator. The aAPX of interest was cloned between the promoter and terminator, generating component 1C. In this example, component 10 comprised a single ORF that encoded one aAPX, the HLA-A*02:01 or HLA-B*-35:01, denoted component 1C.sup.HLA-A*02:01 component 1C.sup.HLA-B*-35:01 respectively.
[0686] The integration of component 1C into component 1B, and selection of monoclone eAPC-p cell lines was as described in example 4, with the exception that a gRNA targeting the HLA.sup.null genomic locus was used to promote HDR integration of component 1C into component 1B. Monoclone eAPC-p ACL-191 and ACL-286 expressed HLA-A*02:01 or HLA-B*-35:01on the cell surface, respectively (
[0687] In this example, step 2 was performed, wherein, the genomic receiver site, component 1D, was the native AAVS1 genomic site, and the targeted integration was achieved through HDR. The genetic donor vector, component 1E was matched to component 1D, by the component 1E that encoded the AAVS1 left and right homology arms, each comprised of >500 bp of sequence homologous to the AAVS1 genomic locus. Between the AAVS1 left and right homology arms, the plasmid encoded a CMV promoter and SV40 terminator. The aAM of interest was cloned between the promoter and terminator, generating Component 1E. In this example, component 1E comprised a single ORF that encoded the selection marker, GFP, linked to the aAM ORF, encoding hCMV-pp65, denoted component 1E.sup.GFP:2A:pp63. The viral self-cleaving peptide element encoded a peptide sequence, that when transcribed resulted in self-cleavage of the synthesized peptide and produced two polypeptides, GFP and the intracellular hCMV-pp65 protein.
[0688] The integration of component 1E into component 1D, was as described in example 4. Individual monoclone lines, ACL-391 and ACL-395, were selected as an eAPC-pa on the basis of their maintained selection marker GFP expression (
[0689] In conclusion, the genetically modified ACL-391 and ACL-395 cell lines, which contained a copy of the aAPX HLA-A*02:01 or HLA-B*-35:01 ORF, respectively, within the genomic receiver site, component 1 B, and aAM ORF pp65 within the genomic receiver site component 1 D were generated. These genetic modifications resulted in the said aAPX to be the only major HLA class I member expressed on the cell surface of a cell that also expressed the said aAM. Therefore, this demonstrated the creation of two defined eAPC-pa cell lines using the multicomponent system.
Example 8
An eACP-p Constructed in One Step wherein Component 1C Encoded a Single HLAI ORF
[0690] Herein describes the conversion of an eAPC to an eAPC-p in one step, via a single integration couple event, to integrate a single HLAI ORF encoding analyte antigen-presenting complex (aAPX), and wherein the eAPC contains two synthetic genomic receiver sites Component 1B and Component 1 D designed for RMCE based genomic integration. The created eAPC-p has one genomic receiver site occupied by the HLAI ORF (Component 1B), while the remaining Component 1D is available for an additional integration couple event.
[0691] This example used the eAPC generated in example 3 (ACL-402) containing Components 1B and 1D, wherein Component 1B comprises two unique heterospecific recombinase sites, F14 and F15, which flank the ORF that encodes the selection marker, red fluorescent protein (RFP). Encoded 5 of the F14 site is an EF1a promoter and 3 of the F15 site is a SV40 polyadenylation signal terminator. Component 1D comprises of two unique heterospecific recombinase sites, FRT and F3, flanking the ORF that encodes the selection marker, blue fluorescent protein (BFP). Encoded 5 of the FRT site, is an EF1a promoter and 3 of the F15 site is a SV40 polyadenylation signal terminator.
[0692] This example utilizes a Component 1C genetic donor vector, comprising of heterospecific recombinase sites, F14 and F15 and thus is matched to Component 1B. Two independent Component 1C were generated from Component 1C, wherein one vector (V4.H.5) comprises of a Kozak sequence, start codon and aAPX ORF encoding HLA-A*02:01 between the F14/F15 sites, and wherein the second vector (V4.H.6) comprises a Kozak sequence, start codon and aAPX ORF encoding HLA-A*24:02 between the F14/F15 sites.
[0693] The eAPC (ACL-402) was independently combined with vector encoding expression of the RMCE recombinase enzyme (Flp, V4.1.8) and each Component 1C of either V4.H.5 or V4.H.6 by electroporation. Cells were cultured for 4-10 days, whereupon cells were selected and sorted based on loss of the selection marker of integration, RFP, and gain of HLAI on the surface of the cell. Subsequently, individual outgrown monoclone lines were characterized, confirmed and selected on the basis of the gain of HLAI surface expression and the loss of the RFP fluorescence, which indicated that the expected conversion of Component 1B to 1 B had occurred. Selected eAPC-p monoclones ACL-900 (V4.H.5, HLA-A*02:01) and ACL-963 (V4.H.6, HLA-A*24:02) are negative for RFP compared to the parental ACL-402 cell line and maintain HLAI surface expression (
[0694] In summary, this example demonstrates two specific examples of conversion of an eAPC to an eAPC-p, using the multicomponent system, wherein two different aAPX are individually delivered (Component 1C) and integrated into a single genomic receiver site (Component 1B) by RMCE genomic integration method, subsequently creating a limited library comprising two discrete eAPC-p. Furthermore, it was demonstrated that second genomic receiver site (Component 1D) was insulated and unaffected by the Component 1B/Component 1C integration couple.
Example 9
An eAPC-pa Constructed from eAPC-p in One Step, wherein Component 1D Encodes a Single Analyte Antigen Molecule (aAM) ORF.
[0695] The present example describes how multiple eAPC-pa are constructed from a parental eAPC-p (described in example 8) in parallel, wherein the genomic receiver site, Component 1D, is targeted for integration by a primed genetic donor vector, Component 1E, comprising of a single ORF that encodes an aAM.
[0696] In the present example, the parental eAPC-p line used was ACL-900, which expresses a single aAPX (HLA-A*02:01) that is integrated at Component 1B (described in example 8). The eAPC-p Component 1D remains open and comprises of two unique heterospecific recombinase sites, FRT and F3, which flank the ORF that encodes the selection marker, blue fluorescent protein (BFP). Encoded 5 of the FRT site, is an EF1a promoter, and 3 of the F15 site is a SV40 polyadenylation signal terminator. The genetic donor vector, Component 1E was used in this example and comprises of two heterospecific recombinase sites, F14 and F15, thus being matched to Component 1D. In this example, the Component 1 E was further primed with one aAM ORF of interest selected from HCMVpp28 (V9.E.6), HCMVpp52 (V9.E.7), or HCMVpp65 (V9.E.8), which also each encode a C-terminal glycine-serine rich linker and c-myc tag. Furthermore, each Component 1E further comprises of Kozak sequence and start codon immediately 5 of the aAM ORF. Thus, a small discrete library of Component 1E was created, comprising of three vectors.
[0697] The eAPC-p (ACL-900) was independently combined with a vector encoding expression of the RMCE recombinase enzyme (Flp, V4.1.8) and each Component 1E of either V9.E.6, V9.E.7, or V9.E.8 by electroporation. Cells were incubated for 4-10 days to allow for the integration couple to occur, whereupon, individual eAPC-pa were selected and single cell sorted (monoclones) based on diminished signal of the selection marker of integration BFP, encoded by Component 1D (
[0698] In summary, this example demonstrates three specific examples of conversion of an eAPC-p to an eAPC-pa, using the multicomponent system, wherein three different aAM are individually delivered (Component 1E) and integrated into a single genomic receiver site (Component 1D) by RMCE genomic integration method, subsequently creating a small library of three discrete eAPC-pa carrying three different aAM ORF. Furthermore, it was demonstrated that the prior loaded second genomic receiver site (Component 1B) was insulated and unaffected by the Component 1D/Component 1E integration couple.
Example 10
Shotgun Integration of Multiple Analyte Antigen Molecule ORF into eAPC-p to Create a Pooled eAPC-pa Library in a Single Step
[0699] Herein describes how a pool of primed Component 1E vectors (Component 1E) collectively encoding multiple aAM ORF (HCMVpp28, HCMVpp52 and HCMVpp65) were integrated in a single step into the parental eAPC-p (described in example 8) to create a pooled eAPC-pa library, wherein each individual cell integrates a single random analyte antigen ORF derived from the original pool of vectors, at Component 1D, such that each eAPC-pa expresses a single random aAM, but collectively the pooled library of eAPC-pa represents all of aAM ORF encoded in the original pooled library of vectors. This method of creating a pool of eAPC-pa each expressing a single random ORF from a pool of vectors is referred to as shotgun integration.
[0700] In this example, the parental eAPC-p line used was ACL-905 expressing an aAPX (HLA-A*02:01) on the cell surface (the construction of the cell line is described in example 8), Component 1D and Component 1E were as described in example 9. In this example, the individual Component 1E vectors of example 9, V9.E.6, V9.E.7, and V9.E.8, comprising of aAM ORFs encoding HCMVpp28, HCMVpp52 and HCMVpp65, respectively, were mixed together in a 1:1:1 molar ratio to create a vector pool. The eAPC-p (ACL-905) was combined with the vector pool and a vector encoding expression of the RMCE recombinase enzyme (Flp, V4.1.8) by electroporation. Cells were incubated for 4-10 days, whereupon, cells were bulk sorted on the basis of having diminished signal for the selection marker of integration, BFP, encoded by Component 1D (
[0701] To confirm that the eAPC-pa pool ACL-1050 was comprised of a mixture of eAPC-pa each encoding one of HCMVpp28, HCMVpp52 or HCMVpp65 at Component 1D, individual cells were single cell sorted from the polyclonal population and 12 were selected at random for genetic characterisation. Amplification of the Component 1 D was conducted using primers that span each aAM (10.D.1 and 15.H.4). In
[0702] In conclusion, this example demonstrates the use of the multicomponent system for conversion of an eAPC-p into a pooled library of eAPC-pa in a single step, by combining the eAPC-p with a pooled library of three vectors encoding three different analyte antigen molecules (Component 1E) and utilizing a RMCE based shotgun integration approach. Furthermore, this example demonstrates that each eAPC-pa within the generated pool of eAPC-pa has integrated a single random aAM ORF from the original vector pool by an integration couple event between Component 1D and Component 1 E, and that all three aAM ORF are represented within the generated pooled eAPC-pa library.
Example 11
Demonstration of eTPC-t Generation in One Step
[0703] The present example describes the generation of eTPC-t in a standardised manner, wherein the parental eTPC contains distinct synthetic genomic receiver sites Components 2B and 2D. All eTPC parental lines described in this example and all further examples were generated with the same techniques as were the eAPC lines presented in above examples. The genetic donor vectors Components 2C and 2E comprised a single chain of a TCR pair (JG9-TCR) known to engage with the antigenic peptide NLVPMVATV (NLVP) derived from Human Cytomegalovirus polypeptide 65 (HCMV pp65) when presented in HLA-A*02 alleles. Components C and E are designed for RMCE, and derived from parental Components 2C and 2E.
[0704] This example uses a parental eTPC cell line ACL-488, which is TCR null, HLA null, CD4 null and CD8 null, and further containing Component 2B and 2D. Component 2B comprises two unique heterospecific recombinase sites, FRT and F3 that flank a Kozak sequence and ORF encoding the selection marker, blue fluorescent protein (BFP). Encoded 5 of the FRT site, is an EF1a promoter and 3 of the F3 site is a SV40 polyadenylation signal terminator. Component 2D comprises two unique heterospecific recombinase sites, F14 and F15, which were different to Component 2B. These sites flank a Kozak sequence and ORF that encodes the selection marker, the red fluorescent protein, (RFP). Encoded 5 of the F14 site is an EF1a promoter, and 3 of the F15 site is a SV40 polyadenylation signal terminator.
[0705] This example uses genetic donor vectors, Component 2C and Component 2E, each comprising of two heterospecific recombinase sites, FRT/F3 (2C) and F14/F15 (2E), thus being matched to Component 2B and 2D, respectively. Component 2C further comprises, between the FRT/F3 sites, of a Kozak sequence, start codon and TCR ORF encoding JG9-TCR-beta chain. Component 2E further comprises, between the F14/F15 sites, of a Kozak sequence, start codon and TCR ORF encoding JG9-TCR-alpha chain.
[0706] An eTPC-t was created through RMCE by electroporation ACL-488 (eTPC). Four to ten days after electroporation, individual cells displaying diminished fluorescent protein signal, BFP and RFP, encoded by Components 2D and 2B selection markers, were sorted by FACS. Individual monoclones were out grown and then phenotypically assessed. The resulting monoclone, ACL-851, was BFP and RFP negative (
[0707] In summary, an eTPC was converted to an eTPC-t, by use of an RMCE based integration method to integrate TCR ORF delivered in Component 2C and 2E, such that Components 2B and 2D were converted into Component 2B and 2D, and where by this eTPC-t expressed a functional TCRsp on the surface of the cell. Furthermore, this example demonstrates operation of a simple eTPC:A system, where a binary composition of an eTPC-t and analyte antigen were combined and the eTPC-t selected based on a complex formation between the soluble analyte antigen (HLA multimer: HLA-A*02:01-NLVPMVATV).
Example 12
Demonstration of Conversion of eTPC-t to an eTPC-x
[0708] The present example describes conversion of an eTPC-t to an eTPC-x, wherein the eTPC-x has component 2B encoding a TCR chain ORF and Component 2D is available for integration of complementary TCR chain ORF. Conversion of Component 2D of the eTPC-t to Component 2D of the eTPC-x is achieved by use of a genetic donor vector (Component 2Z) matched to Component 2D.
[0709] In this example, the parental eTPC-t cell line ACL-851 generated in example 11 was used. Component 2Z is a plasmid vector comprised of two heterospecific recombinase sites, F14/F15 matched to Component 2D, a Kozak sequence, start codon and an ORF encoding a green fluorescent protein (GFP) as a selection marker of integration.
[0710] The eTPC-t was combined with Component 2Z and a vector encoding RMCE recombinase enzyme by electroporation, whereupon the cells were subsequently selected for loss of CD3 presentation and gain of the GFP selection marker of integration. The monolcone ACL-987 was phenotypically characterised by FACS, and it was observed that the ACL-987 has gained GFP and lost CD3 and TCRab (
[0711] In summary, this example demonstrates conversion of an eTPC-t to an eTPC-x, with removal of the JG9-TCR-alpha TCR ORF at Component 2D in exchange for the GFP selection marker of integration thereby creating Component 2D, for further integration coupling events of alternative complementary TCR chain ORF. This conversion was conducted using the RMCE method for genomic integration.
Example 13
Demonstration of Shotgun Integration into eTPC-x to Create Pool of eTPC-t
[0712] The present example describes how a pool of vectors encoding 64 single JG9-TCR-alpha variants (as Component 2E) were integrated as a single step into a parental eTPC-x cell line (described in example 12) to create a pooled eTPC-t library wherein each individual cell integrated a single random TCR ORF encoding alpha chain from the original pool of vectors, such that each eTPC-t expresses a single random pair of TCR ORF as TCRsp. Combined together the individual eTPC-t comprises a pooled a library of eTPC-t wherein the pool of cells potentially represents all possible combinations of the 64 TCR-alpha paired with constant original TCR beta chain. Such a method is now referred to as shotgun integration. The 64 JG9-TCR-alpha variants have been created by modifying the CDR3 sequence which falls at the junction of the V and J fragments.
[0713] In this example, the parental eTPC-x cell line ACL-987 (see example 12), with non-surface expressed JG9-TCR-beta (Component 2B) and CD3 complex was used. Component 2D encodes GFP, a selection marker, as described in example 12. In this example, the 64 JG9-TCR-alpha variant fragments were cloned into the Component 2E donor vector, creating Component 2E, flanked by F14/ F15 sites, matching to Component 2D. The 64 vectors were subsequently combined into a single pool of vectors.
[0714] An eTPC-t pool was created via RMCE based genomic integration, wherein the eTPC-x (ACL-987) and 64 Components 2E and RMCE recombinase vector were combined by electroporation. Polyclones were selected on the basis of the GFP expression. The resulting polyclone, ACL-988, comprised of both GFP positive and GFP negative cell populations, unlike the parental line which comprised of only GFP positive cells (
[0715] In parallel, all 64 JG9-TCR-alpha variants were cloned into an expression construct that permitted transient transfection to a parental eTPC-x (ACL-987) and relative staining units (RSU) against the HLA-A*02:01-NLVP multimer reagent to a reference for each TCR pair presented in the above-described pooled eTPC-t expressing variant JG9-TCR were determined. RSU were calculated as the ratio of the mean fluorescence intensity (MFI) of HLA multimer signal for the CD3 positive population over the CD3 negative population, and was indicative of the binding strength of each TCR chain pair variant. After the independent transfection of the parental ACL-987 line with each JG9-TCR-alpha variant, the cells were stained with antibodies against CD3 and with the HLA-multimer reagent and analysed by flow cytometry. Each point plotted in
[0716] Individual cells from the pool of ACL-988 were single cell sorted, from the HLA-multimer positive population and the HLA-multimer negative population. The Component 2D encoding the variant JG9-TCR-alpha ORF for each single cell were amplified and sequenced and compared to the results of the transient expressions RSU units described above (
[0717] In conclusion, this example demonstrates use of the multi-component system for conversion of an eTPC-x and a pooled library of vectors (component 2E) into a pooled library of eTPC-t containing multiple different TCRsp. This was achieved in a single step using shotgun integration. Moreover, this example demonstrated that the pool of eTPC-t were combined with an analyte antigen (as a soluble affinity reagent) into an eTPC:A system, wherein it was demonstrated that single cells of the pool could be selected on the basis of complex formation with the analyte antigen (HLA-multimer) and wherein the subsequent TCR chain ORF encoded in Component 2D were extracted and DNA sequences obtained.
Example 14
Functional Demonstration of Component 2F in Combined eAPC:eTPC System with Exogenous aAM
[0718] Herein describes an eTPC cell line (ACL-1063, Component 2A) engineered with two unique genomic receiver sites (Components 2B, 2D), engineered to be HLA Null, utilizing native CD3 expression, and harbouring an engineered genomic two-component, synthetic response element (Component 2F). In this example, the eTPC cell line was converted to an eTPC-t cell line (ACL-1277) as described previously in example 11, wherein the TCR chain ORF at Component 2B and 2E encode a TCR pair that is specific for HLA-peptide complex (HLA), HLA-A*02:01-NLVPMVATV. This eTPC-t was combined with above-described eAPC-p in the presence of exogenous aAM in the form of soluble peptide to assemble a eAPC:eTPC systems. The readout of these combined systems was an RFP signal within the eTPC-t, which was the reporter from component 2F.
[0719] The response elements defined as Component 2F comprised of a Driver-Activator component and an Amplifier-Report component, wherein both units utilized synthetic promoters. The Driver is a synthetic promoter that is responsive to the native TCR signalling pathways, encoding three sets of tandem transcription factor binding sites for NFAT-AP1-NFkB (3xNF-AP-NB). Upon transcriptional activation, the Driver induces expression of the Activator protein, a synthetic designed transcription factor derived by fusion of the Herpes VP16 activation domain, the GAL4 DNA binding domain and two nuclear localization signals at the N- and C-terminals (NV16G4N), to which the cognate DNA recognition sequence is present 6 times in tandem in the Amplifier promoter. Both the Driver and Amplifier promoters utilized the core promoter sequence (B recognition element (BRE), TATA Box, Initiator (INR) and transcriptional start site) from HCMV 1E1 promoter, immediately 3 of the respective transcription factor binding sites. The Amplifier upon transcriptional activation drives expression of the reporter, red fluorescent protein (RFP).
[0720] The eTPC-t cell line was then challenged against eAPC-p presenting HLA-A*02:01 (ACL-209) or HLA-A*24:02 (ACL-963) or was HLA-null parental eAPC (ACL-128). Wherein analyte eAPC-pa were prepared by pulsing eAPC-p with analyte antigen of either peptide NLVPMVATV or VYALPLKML, or no peptide. Subsequently, an eTPC-t and analyte eAPC-pa were compiled into an eAPC:eTPC system consisting of 30,000 eTPC-t co-cultured with 10,000 eAPC-pa for 24 h. After 24 h the cells were harvested, washed, stained with markers specific for the eTPC-t and analyte eAPC-pa in order to distinguish the populations, and analysed by flow cytometry. Strong activation of the eTPC-t, Component 2F (was only observed in eTPC-t challenged with analyte eAPC-pa presenting the known cognate antigen pHLA complex, i.e. the eAPC-pa with HLA-A*02:01 and NLVPMVATV (
[0721] In conclusion, an eTPC-t cell line containing a functional component 2F was engineered, and subsequently used to create an eTPC-t. Upon interaction of the eTPC-t with analyte eAPC-pa presenting its cognate target T-cell antigen, provided as exogenous soluble aAM, a response was measurable as an increase in RFP expression. Conversely, when contacted with analyte eAPC or eAPC-p or eAPC-pa not presenting a cognate T-cell antigen and HLA, or no HLA, no measurable increase in RFP expression above background was exhibited by the eTPC-t. Furthermore, this example demonstrates an eAPC:eTPC system wherein analyte eAPC-pa and analyte eTPC-t are compiled in discrete binary compositions and the eTPC-t response is used to identify both the analyte eAPC-pa and eTPC-t wherein a co-operative complex between the TCRsp and analyte antigen occurs.
Example 15
Functional Demonstration of Component 2F in Combined eAPC:eTPC System with aAM ORF Integrated to eAPC-pa State
[0722] The present example describes the use of an eTPC-t (ACL-1150), (Component 2A) engineered with two unique genomic receiver sites, loaded with the TCR chain ORF at Component 2B and 2E encoding a TCR pair that is specific for HLA-peptide complex (HLA), HLA-A*02:01-NLVPMVATV, utilizing native CD3 expression, and harbouring a genomic one-component, synthetic response element (Component 2F), compiled into an eAPC:eTPC system with eAPC-pa that were generated by integration with aAM encoding ORF integrated at site 1D. In this example, four different eAPC-pa variants were assembled with two different HLA alleles, and two different aAM ORF derived from the HCMV genome; generating four distinct eAPC-pa lines.
[0723] The response elements defined as Component 2F comprised of a Driver-Reporter component. The Driver is a synthetic promoter that is responsive to the native TCR signalling pathways, encoding six sets of tandem transcription factor binding sites for NFAT-AP1 (6xNF-AP) and utilizes the core promoter sequence (B recognition element (BRE), TATA Box, Initiator (INR) and transcriptional start site) from HCMV 1E1 promoter, immediately 3 of the respective transcription factor binding sites. Upon transcriptional activation, the Driver induces expression of the reporter, red fluorescent protein (RFP).
[0724] The first eAPC-pa line (ACL-1046) expresses HLA-A*02:01 and the full-length ORF for HCMV protein pp65, wherein pp65 contains the antigenic peptide recognised by the eTPC-t TCRsp, when presented in HLA-A*02:01. The second eAPC-pa line (ACL-1044) expresses HLA-A*02:01 and the full-length ORF for HCMV protein pp52. The third eAPC-pa line ACL-1045 expresses HLA-B*07:02 and the full-length ORF for HCMV protein pp52. The fourth eAPC-pa line (ACL-1048) expresses HLA-B*07:02 and the full-length ORF for HCMV protein pp65. The second, third and fourth eAPC-pa express aAPX:aAM complexes not recognised by the eTPC-t TCRsp.
[0725] The eTPC-t cell line ACL-1150 was compiled into independent eAPC:eTPC system with each of the four eAPC-pa as described above. After 48 h the cells were harvested, washed, stained with markers specific for the eTPC-t and analyte eAPC-pa in order to distinguish the populations, and analysed by flow cytometry. Strong activation of the eTPC-t, Component 2F, was only observed in eTPC-t challenged with analyte eAPC-pa presenting the known cognate antigen pHLA complex, i.e. the eAPC-pa with HLA-A*02:01 and pp65 (
[0726] In conclusion, an eTPC-t cell line containing a functional component 2F was engineered, and subsequently used to create an eTPC-t. Upon interaction of the eTPC-t with analyte eAPC-pa presenting its cognate target T-cell antigen, provided as endogenous aAM ORF by integration, a response was measurable as an increase in RFP expression. Conversely, when contacted with analyte eAPC-pa not presenting a cognate T-cell antigen and HLA, no measurable increase in RFP expression above background was exhibited by the eTPC-t. Furthermore, this example demonstrates an eAPC:eTPC system wherein analyte eAPC-pa and analyte eTPC-t are compiled in discrete binary compositions and the eTPC-t response is used to identify both the analyte eAPC-pa and eTPC-t wherein a co-operative complex between the TCRsp and analyte antigen occurs.
[0727] Sequence Listing
[0728] <110> Genovie AB
[0729] <120> An engineered two-part cellular device for discovery and characterisation of T-cell receptor interaction with cognate antigen
[0730] <130> ANO15
[0731] <160> 104
[0732] <170> BiSSAP 1.3
[0733] <210>1<223> Analyte Antigenic Peptide
[0734] <210>2<223> Analyte Antigenic Peptide
[0735] <210>3<223> HCMV Antigen
[0736] <210>4<223> HCMV Antigen
[0737] <210>5<223> pcDNA3.1_GFP vector V1.A.4
[0738] <210>6<223> pcDNA3.1_RFP vector V1.A.6
[0739] <210>7<223> pMA-SV40pA vector V1.C.2
[0740] <210>8<223> pMA-CS-JG9-TCRbeta vector V3.C.5
[0741] <210>9<223> pMA-F14-GFP-F15 vector V4.H9
[0742] <210>10<223> pMA-F14-TCR-JG9-alpha-F15 vector V7.A.3
[0743] <210>11<223> pMA-FRT-TCR-JG9-beta-F3 vector V7.A.4
[0744] <210>12<223> F14-TCRaF15 CDR3degen.64mix vector V8.F.8
[0745] <210>13<223> CMVpro-Flp-sv40pA-V2 vector V4.l.8
[0746] <210>14<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_A1
[0747] <210>15<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_A2
[0748] <210>16<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_A3
[0749] <210>17<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_A4
[0750] <210>18<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_A5
[0751] <210>19<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_A6
[0752] <210>20<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_A7
[0753] <210>21<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_A8
[0754] <210>22<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_B1
[0755] <210>23<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_B2
[0756] <210>24<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_B3
[0757] <210>25<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_B4
[0758] <210>26<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_B5
[0759] <210>27<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_B6
[0760] <210>28<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_B7
[0761] <210>29<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_B8
[0762] <210>30<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_C1
[0763] <210>31<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_C2
[0764] <210>32<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_C3
[0765] <210>33<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_C4
[0766] <210>34<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_C5
[0767] <210>35<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_C6
[0768] <210>36<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_C7
[0769] <210>37<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_D1
[0770] <210>38<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_D2
[0771] <210>39<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_D3
[0772] <210>40<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_D4
[0773] <210>41<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_D5
[0774] <210>42<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_D6
[0775] <210>43<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_D7
[0776] <210>44<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_D8
[0777] <210>45<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_E1
[0778] <210>46<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_E2
[0779] <210>47<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_E3
[0780] <210>48<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_E4
[0781] <210>49<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_E5
[0782] <210>50<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_E6
[0783] <210>51<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_E7
[0784] <210>52<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_E8
[0785] <210>53<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_F1
[0786] <210>54<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_F2
[0787] <210>55<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_F3
[0788] <210>56<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_F4
[0789] <210>57<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_F5
[0790] <210>58<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_F6
[0791] <210>59<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_F7
[0792] <210>60<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_F8
[0793] <210>61<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_G1
[0794] <210>62<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_G2
[0795] <210>63<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_G3
[0796] <210>64<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_G4
[0797] <210>65<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_G5
[0798] <210>66<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_G6
[0799] <210>67<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_G7
[0800] <210>68<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_G8
[0801] <210>69<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_H1
[0802] <210>70<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_H2
[0803] <210>71<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_H3
[0804] <210>72<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_H4
[0805] <210>73<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_H5
[0806] <210>74<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_H6
[0807] <210>75<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_H7
[0808] <210>76<223> CDR3 sequence of a JG9-TRA 64 variant VP.7751.RC1_H8
[0809] <210>77<223> pMA_F14_HLA-A*02:01-6xHis_F15 vector V4.H.5
[0810] <210>78<223> pMA_F14_HLA-A*24:02-6xHis F15 vector V4.H.6
[0811] <210>79<223> pMA_F14_HLA-B*07:02-6xHis F15 vector V4.H.7
[0812] <210>80<223> pMA_F14_HLA-B*35:01-6xHis_F15 vector V4.H.8
[0813] <210>81<223> FRT_HCMVpp28-3xMYC_F3 vector V9.E.6
[0814] <210>82<223> FRT_HCMVpp52-3xMYC_F3 vector V9.E.7
[0815] <210>83<223> FRT_HCMVpp52-3xMYC_F3 vector V9.E.8
[0816] <210>84<223> SpCas9-2A-GFP Vector V1.A.8
[0817] <210>85<223> HLA-A-sg-sp-optil vector V2.A.1
[0818] <210>86<223> HLA-B-sg-sp-3 vector V2.A.7
[0819] <210>87<223> HLA-C-sg-sp-4 vector V2.B.3
[0820] <210>88<223> HLA-A-ex2-3_sg-sp-opti_1 vector V2.1.10
[0821] <210>89<223> HLA-A-ex2-3_sg-sp-opti_2 vector V2.J.1
[0822] <210>90<223> AAVSI_sg-sp-opti_3 vector V2.J.6
[0823] <210>91<223> TRAC-GT-F1 ddPCR primer/probe
[0824] <210>92<223> TRAC-GT-R1 ddPCR primer/probe 1.F.8
[0825] <210>93<223> TRAC-probe-FAM ddPCR primer/probe
[0826] <210>94<223> TRBC2-GT-F1 ddPCR primer/probe 1.F.9
[0827] <210>95<223> TRBC2-GT-R1 ddPCR primer/probe 1.F.10
[0828] <210>96<223> TRBC2-probe-FAM ddPCR primer/probe 1.G.2
[0829] <210>97<223> TRAC-TCRA-ex1-F1 ddPCR primer/probe 10.A.9
[0830] <210>98<223> TRAC-TCRA-ex1-F1 ddPCR primer/probe 10.A.10
[0831] <210>99<223> TRAC-probe(HEX) ddPCR primer/probe 10.6.6
[0832] <210>100<223> HCMVpp65_GT_F2ddPCR primer/probe 21.1.1
[0833] <210>101<223> HCMVpp28_GT_F1 ddPCR primer/probe 21.1.2
[0834] <210>102<223> HCMVpp52_GT_F1 ddPCR primer/probe 21.1.3
[0835] <210>103<223> Myc-Tag_GT_R1 ddPCR primer/probe 20.H.10
[0836] <210>104<223> Linker-Myc_Probe_Fam ddPCR primer/probe 20.H.9
[0837] List of Abbreviations
[0838] aAPX Analyte antigen-presenting complex
[0839] aAM Analyte antigenic molecule
[0840] aCT Analyte TCR
[0841] APC Antigen-presenting cell
[0842] APX Antigen-presenting complex
[0843] BFP Blue fluorescent protein
[0844] CAR-T CAR T-cell
[0845] CM Cargo molecules
[0846] CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
[0847] gRNA Cas9 guide RNA
[0848] CAR Chimeric antigen receptor
[0849] CDR Complementarity-determining regions
[0850] C-region Constant region
[0851] CMV Cytomegalovirus
[0852] DAMPS Danger associated molecular patterns
[0853] DC Dendritic cells
[0854] DNA Deoxyribonucleic acid
[0855] D-region Diversity region
[0856] eAPC Engineered antigen-presenting cell
[0857] eAPC-p Engineered antigen-presenting cell that present an analyte antigen-presenting complex
[0858] eAPC-pa Engineered antigen-presenting cell that presents an analyte antigen-presenting complex and analyte antigenic molecule
[0859] eAPC-a Engineered antigen-presenting cell expressing an analyte antigenic molecule
[0860] eAPCS Engineered antigen-presenting cell system
[0861] eTPC Engineered TCR-presenting cell
[0862] eTPCS Engineered TCR-presenting cell system
[0863] eTPC-t Engineered TCR-presenting cell that present full-length TCR pairs
[0864] FACS Fluorescence-activated cell sorting
[0865] GEM T-cells Germ line-encoded mycolyl-reactive T-cells
[0866] GFP Green fluorescent protein
[0867] HLAI HLA class I
[0868] HLAII HLA class II
[0869] HDR Homology directed recombination
[0870] HLA Human leukocyte antigen
[0871] IgSF Immunoglobulin superfamily
[0872] IRES Internal ribosome entry site
[0873] iNK T-cells Invariant natural killer T-cells
[0874] J-region Joining region
[0875] MACS Magnetic-activated cell sorting
[0876] MAGE Melanoma associated antigen
[0877] MAIT Mucosal-associated invariant T
[0878] NCBP Non-cell based particles
[0879] ORF Open reading frame
[0880] PAMPS Pathogen-associated molecular patterns
[0881] PCR Polymerase chain reaction
[0882] RMCE Recombinase mediated cassette exchange
[0883] RFP Red fluorescent protein
[0884] DNA Ribonucleic acid
[0885] SH2 Src homology 2
[0886] T-cells T lymphocytes
[0887] TCR T-cell Receptor
[0888] TRA TCR alpha
[0889] TRB TCR beta
[0890] TRD TCR delta
[0891] TCRsp TCR surface proteins in complex with CD3
[0892] TALEN Transcription activator-like effector nucleases
[0893] TRG TRC gamma
[0894] TAA Tumour-associated-antigens
[0895] V-region Variable region
[0896] 2M 2-microglobulin
[0897] ZAP-70 -chain-associated protein of 70 kDa
[0898] Definitions
[0899] A pair of complementary TCR chains: two TCR chains wherein the translated proteins are capable of forming a TCRsp on the surface of a TCR presenting cell
[0900] Affinity: Kinetic or equilibrium parameter of an interaction between two or more molecules or proteins
[0901] Affinity reagent: Any reagent designed with specific affinity for an analyte. Often used in the context of affinity for HLA-antigen complex
[0902] Allele: Variant form of a given gene
[0903] AM: Analyte antigenic molecule. Generally, a protein but could also be a metabolite that is expressed by a cell from their genomic DNA and/or a specific introduced genetic sequence. The AM is expressed in the cell and a fragment can then be presented on the cell surface by an APX as cargo or on its own. Either as cargo or not, the AM can then be the target of T-cell receptor bearing cells or related affinity reagents.
[0904] Amplicon: a piece of DNA or RNA that is the source and/or product of artificial amplification using various methods including PCR.
[0905] Analyte: an entity that is of interest to be identified and/or measured and/or queried in the combined system
[0906] Antibody: Affinity molecule that is expressed by specialized cells of the immune system called B-cells and that contains of two chains. B-cells express a very large and very diverse repertoire of antibodies that do generally not bind self proteins but can bind and neutralize pathogens or toxins that would threaten the host. Natural or artificially engineered antibodies are often used as affinity reagents.
[0907] Antigen: any molecule that may be engaged by a TCR and results in a signal being transduced within the T-cell, often presented by an antigen-presenting complex
[0908] Analyte antigen: collectively the eAPC:eTPC system representing any entity presenting an antigen for analytical determination
[0909] APC: Antigen-presenting cell. A cell baring on the surface of the cell an AM, APX, APX
[0910] APX: Antigen-presenting complex. A protein that is expressed and presented on the cell surface by nucleated cells from genes/ORF encoding genomic DNA and/or a specific introduced genetic sequence. The APX presents a cargo, being either a peptide or other metabolite molecules.
[0911] C-Region: Constant region. One of the gene segments that is used to assemble the T-cell receptor. The c-region is a distinct segment that rather than driving diversity of the TCR, defines its general function in the immune system.
[0912] Cargo-loading machinery: Cellular set of proteins that generate and load cargo molecules on APX from proteins or other presented molecules found in the cell.
[0913] CDR: complementarity-determining regions. Short sequences on the antigen-facing end of TCRs and antibodies that perform most of the target binding function. Each antibody and TCR contains six CDRs and they are generally the most variable part of the molecules allowing detection of a large number of diverse target molecules.
[0914] CM: Cargo molecules. peptide or metabolite that is presented by an antigen-presenting complex for example a HLA I or HLA II. The CM can be expressed by the cell intrinsically from the genomic DNA, introduced into the culture medium or expressed from a specifically introduced genetic sequence.
[0915] Copy-number: The whole number occurrence of a defined sequence encoded within the genome of a cell
[0916] Cytogenetic: The study of inheritance in relation to the structure and function of chromosomes, i.e. determine the karyotype of a cell
[0917] Cytotoxic/Cytotoxicity: Process in which a T-cells releases factors that directly and specifically damage a target cell.
[0918] D-region: Diversity region. One of the gene segments that is used to assemble the T-cell receptor. Each individual has a large number of different variations of these regions making it possible for each individual to arm T-cells with a very large variety of different TCR.
[0919] DNA: Desoxyribonucleic acid. Chemical name of the molecule that forms genetic material encoding genes and proteins.
[0920] eAPC system: eAPCS, the system by which eAPC-pa, eAPC-p and eAPC-a cells, or libraries thereof, are prepared for combination in the eAPC:eTPC system.
[0921] eTPC system: eTPCS, the system by which eTPC-t cells, or libraries thereof, are prepared for combination in the eAPC:eTPC system eAPC:eTPC system: the system by which analyte antigen presented by eAPC and analyte TCR presented by eTPC are combined
[0922] Endogenous: Substance that originated from within a cell
[0923] Engineered Cell: A cell whereby the genome has been engineered through genetic modification modified.
[0924] Eukaryotic conditional regulatory element: A DNA sequence that can influence the activity of a promoter, which may be induced or repressed under defined conditions
[0925] Eukaryotic Promoter: A DNA sequence that encodes a RNA polymerase biniding site and response elements The sequence of the promoter region controls the binding of the RNA polymerase and transcription factors, therefore promoters play a large role in determining where and when your gene of interest will be expressed.
[0926] Eukaryotic terminator/Signal terminator: A DNA sequence that are recognized by protein factors that are associated with the RNA polymerase II and which trigger the termination process of transcription. It also encodes the poly-A signal
[0927] FACS/Flow Cytometry: Fluorescence-activated cell sorting. Analytical technique by which individual cells can be analyzed for the expression of specific cell surface and intracellular markers. A variation of that technique, cell sorting, allows cells that carry a defined set of markers to be retrieved for further analysis.
[0928] Family of APX: A set of several similar genes that encode functionally related proteins, which constitute an antigen pressing complex
[0929] Fluorescent (protein) marker: Molecule that has specific extinction and emission characteristics and can be detected by Microscopy, FACS and related techniques.
[0930] Genetic Donor vector: A genetic based vector for delivery of genetic material to the genomic receiver site
[0931] Genomic Receiver Site: A site within the genome for targeted integration of donor genetic material encoded within a Genetic Donor Vector.
[0932] Heterospecific recombinase sites: A DNA sequence that is recognized by a recombinase enzyme to promote the crossover of two DNA molecules
[0933] HLA I: Human Leukocyte Antigen class I. A gene that is expressed in humans in all nucleated cells and exported to the cell surface where it presents as cargo short fragments, peptides, of internal proteins to T-cell receptors. As such it presents fragments of potential ongoing infections along with intrinsic proteins. The HLA I can additionally present as cargo peptides that are added to the culture medium, generated from proteins expressed form introduced genetic elements or generated from proteins that are taken up by the cell. HLA class I genes are polymorphic meaning that different individuals are likely to have variation in the same gene leading to a variation in presentation. Related to HLA class II.
[0934] HLA II: Human Leukocyte Antigen Class II. A gene that is expressed in humans in specific cells that are coordinating and helping the adaptive immune response for example dendritic cells. Related to HLA class I. HLA class II proteins are exported to the cell surface where they present as cargo short fragments, peptides, of external proteins to T-cell receptors. As such it presents fragments of potential ongoing infections along with intrinsic proteins. The HLA II can additionally present as cargo peptides that are added to the culture medium, generated from proteins expressed form introduced genetic elements or generated from proteins that are taken up by the cell. HLA class II genes are polymorphic meaning that different individuals are likely to have variation in the same gene leading to a variation in presentation.
[0935] Homologous arms: A stretch of DNA that has near identical sequence identity to a complement homologous arm and therefore promote the exchange of two DNA molecules by the cellular process, homology directed repair.
[0936] Immune surveillance: Process in which the immune system detects and becomes activated by infections, malignancies or other potentially pathogenic alterations.
[0937] Insulator: A DNA sequence that prevents a gene from being influenced by the activation or repression of nearby genes. Insulators also prevent the spread of heterochromatin from a silenced gene to an actively transcribed gene.
[0938] Integration: The physical ligation of a DNA sequence into a chromosome of a cell
[0939] Integration couple: A paired genetic donor vector and genomic receiver site
[0940] Internal ribosome entry site (IRES): A DNA sequence that once transcribed encodes a RNA element that allows the initiation of translation in a cap-independent manner
[0941] J-region: Joining region. One of the gene segments that is used to assemble the T-cell receptor. Each individual has a large number of different variations of these regions making it possible for each individual to arm T-cells with a very large variety of different TCR.
[0942] Karyotype: The chromosome composition of a cell
[0943] Kozak Sequence: Short sequence required for the efficient initiation of translation
[0944] Major HLA class I: a Family of APX that comprise of the genes HLA-A, HLA-B and HLA-C
[0945] Matched: When two components encode genetic elements that direct and restrict the interaction between the complemented components
[0946] Meganuclease recognition site: A DNA sequence that is recognized by a endodeoxyribonuclease, commonly referred to as a meganuclease
[0947] Metabolite: A molecule created or altered through metabolic pathways of the cell
[0948] Mobile genetic element: A DNA sequence that can permit the integration of DNA with the activity of transposases enzymes
[0949] Monoclone cell line: A defined group of cells produced from a single ancestral cell by repeated cellular replication
[0950] Native: a entity that is naturally occuring to the cell
[0951] Non-coding gene: A non protein coding DNA sequence that is transcribed into functional non-coding RNA molecules
[0952] ORF: Open reading frame. Stretch of genetic material that encodes a translation frame for synthesis of a protein (polypeptide) by the ribosome
[0953] Paracrine: Signalling through soluble factors that directly act on neighboring cells.
[0954] PCR: Polymerase chain reaction in which a specific target DNA molecule is exponentially amplified
[0955] Peptide: short string of amino acids between 6 - 30 amino acids in length
[0956] Phenotypic analysis: Analysis of the observable characteristics of a cell.
[0957] Polymorphic: Present in different forms in individuals of the same species through the presence of different alleles of the same gene.
[0958] Polypeptide: Protein consisting of a stretch of peptides, forming a three-dimensional structure.
[0959] Primary Outputs: eAPC cells and eTPC cells from which the terminal outputs can be derived and/or determined from
[0960] Primer: Short DNA sequence that allows specific recognition of a target DNA sequence for example during a PCR.
[0961] Promoter: Regulatory DNA element for the controlled initiation of gene expression
[0962] Selectable marker: A DNA sequence that confers a trait suitable for artificial selection methods
[0963] Shotgun Integration: The process whereby a library of vectors is introduced to a population of cells, whereby only a single copy of any given vector insert may be integrated to the genome of each single cell. Used to refer to pooled vector integration to a given cell population via an integration couple
[0964] Slice acceptor site: A DNA sequence at the 3 end of the intron AM, APX CM or affinity reagent for interaction with cells with TCRsp on the surface, or TCRsp based reagents
[0965] Slice donor site: A DNA sequence at the 5 end of the intron
[0966] Synthetic: an entity that is artificially generated and introduced to a cell
[0967] T-cell: T lymphocyte. White blood cell that expresses a T-cell receptor on its surface. Selected by the immune system to not react with the own body but have the potential to recognize infections and malignancies as well as reject grafts from most members of the same species.
[0968] TCR: T-cell Receptor. Affinity molecule expressed by a subgroup of lymphocytes called T-lymphocytes. In humans the TCR recognizes cargo presented by APX CM or APX AM, including fragments from virus or bacterial infections or cancerous cells. Therefore, the TCR recognition is an integral part of the adaptive immune system. The TCR consists of two chains that are paired on the cell surface. The TCR expressed on the surface of each cells is assembled at random from a large pool of varied genes (the v,d,j and c regions) and thus each individual has a pool of T-cells expressing a very large and diverse repertoire of different TCRs.
[0969] TCRsp: A pair of complementary TCR chains that express as surface proteins in complex with CD3 or a pair of complementary TCR chains expressed as proteins in the form of a soluble reagent, an immobilised reagent or present by NCBP.
[0970] Terminal Outputs: analyte antigen and TCR sequences, in the form of AM, APX, APX:CM, APX:AM, or TCRsp
[0971] TRA: TCR alpha encoding locus. One of the four different locus encoding genes that can form a VDJ recombined TCR chain. Translated TCR alpha chain proteins typically pair with translated TCR beta chain proteins to form alpha/beta TCRsp.
[0972] TRB: TCR beta encoding locus. One of the four different locus encoding genes that can form a VDJ recombined TCR chain. Translated TCR beta chain proteins typically pair with TCR alpha chain proteins to form alpha/beta TCRsp.
[0973] TRD: TCR delta encoding locus. One of the four different locus encoding genes that can form a VDJ recombined TCR chain. Translated TCR delta chain proteins typically pair with translated TCR gamma chain proteins to form gamma/delta TCRsp.
[0974] TRG: TCR gamma encoding locus. One of the four different locus encoding genes that can form a VDJ recombined TCR chain. Translated TCR gamma chain proteins typically pair with translate TCR delta chain proteins to form gamma/delta TCRsp.
[0975] V-region: Variable region. One of the gene segments that is used to assemble the T-cell receptor. Each individual has a large number of different variations of these regions making it possible for each individual to arm T-cells with a very large variety of different TCR.
[0976] Items [0977] 1. A two-part device, wherein a first part is an engineered antigen-presenting cell system (eAPCS), and a second part is an engineered TCR-presenting cell system (eTPCS). [0978] 2. A two-part device according to item 1 wherein eAPCS provides the one or more of analyte eAPC selected from [0979] a. eAPC-p and/or [0980] b. eAPC-a, and/or [0981] c. eAPC-pa, and/or [0982] d. one or more libraries of a and/or b and/or c. [0983] 3. A two-part device according to item 2, wherein an eAPC-p, eAPC-a or eAPC-pa expresses an analyte antigen selected from [0984] a. an aAPX or [0985] b. an aAM or [0986] c. an aAPX:aAM or [0987] d. an aAPX:CM or [0988] e. a combination thereof. [0989] 4. A two-part device according to item 1 or 2 wherein eTPCS provides the one or more analyte eTPC selected from [0990] a. eTPC-t and/or [0991] b. one or more libraries thereof. [0992] 5. A two-part device according to item 4, wherein an analyte pair of TCR chains are expressed as TCR surface proteins in complex with CD3 (TCRsp) by an analyte eTPC. [0993] 6. A two-part device according to any of the preceding items wherein the one or more analyte eAPC, is combined with the one or more analyte eTPC. [0994] 7. A two-part device according to item 6, wherein the combination results in a contact between an analyte TCRsp and an analyte antigen as defined in item 3. [0995] 8. A two-part device according to item 7 wherein the contact can result in the formation of a complex between the analyte TCRsp and the analyte antigen. [0996] 9. A two-part device according to item 8 wherein a formation of a complex, if any, can induce a signal response in the analyte eTPC and/or the analyte eAPC. [0997] 10. A two-part device according to item 9, wherein the response is used to select an analyte eTPC or a pool of analyte eTPC with or without a signal response and/or analyte eAPC or a pool of analyte eAPC with or without a signal response. [0998] 11. An analyte eTPC obtained from the two-part device according to any of the preceding items for use in characterisation of a signal response of the analyte eTPC, expressing analyte TCRsp, to an analyte antigen. [0999] 12. A method for selecting one or more analyte eTPC from an input analyte eTPC or a library of analyte eTPC, to obtain one or more analyte eTPC wherein the expressed TCRsp binds to one or more analyte antigen as defined in item 3, wherein the method comprises [1000] a. Combining one or more analyte eTPC with one or more analyte eAPC resulting in a contact between an analyte TCRsp with an analyte antigen and at least one of [1001] b. Measuring a formation, if any, of a complex between one or more analyte TCRsp with one or more analyte antigen and/or [1002] c. Measuring a signal response by the analyte eTPC, if any, induced by the formation of a complex between one or more analyte TCRsp with one or more analyte antigen and/or [1003] d. Measuring a signal response by the analyte eAPC, if any, induced by the formation of a complex between one or more analyte TCRsp with one or more analyte antigen and [1004] e. Selecting one or more analyte eTPC based on step b, c and/or d wherein the selection is made by a positive and/or negative measurement. [1005] 13. A method according item 12 wherein the selection step e is performed by single cell sorting and/or cell sorting to a pool. [1006] 14. A method according to item 13 wherein the sorting is followed by expansion of the sorted single cell. [1007] 15. A method according to item 13 wherein the sorting is followed by expansion of the sorted pool of cells. [1008] 16. A method according to any of items 13 to 15 further comprising a step of sequencing component 2B and/or component 2D of the sorted and/or expanded cell(s). [1009] 17. A method according to item 16 wherein the sequencing step is preceded by the following [1010] a. Extracting of genomic DNA and/or [1011] b. Extracting of component 2B and/or component 2D RNA transcript and/or
[1012] 2c. Amplifying by a PCR and/or a RT-PCR of the DNA and/or RNA transcript of component 2B and/or component 2D. [1013] 18. A method according to item 16 or 17 wherein the sequencing step is destructive to the cell and wherein the sequencing information obtained is used for preparing the analyte eTPC selected in step e of item 12. [1014] 19. A method according to any of items 12, 13, 14, 15, 18 wherein the selected analyte eTPC is subjected to characterisation of the signal response wherein the method further comprises [1015] a. Determining a native signalling response and/or [1016] b. Determining a synthetic signalling response, if the eTPC contains component 2F. [1017] 20. A method according to item 19 wherein the induced signal response is determined by detecting an increase or decrease in one or more of the following [1018] a. a secreted biomolecule [1019] b. a secreted chemical [1020] c. an intracellular biomolecule [1021] d. an intracellular chemical [1022] e. a surface expressed biomolecule [1023] f. a cytotoxic action of the analyte eTPC upon the analyte eAPC [1024] g. a paracrine action of the analyte eTPC upon the analyte eAPC such that a signal response is induced in the analyte eAPC and is determined by detecting an increase or decrease any of a to e [1025] h. a proliferation of the analyte eTPC [1026] i. an immunological synapse between the analyte eTPC and the analyte eAPC [1027] compared to the non-induced signal response state. [1028] 21. An analyte eAPC, obtained from the two-part device as defined in items 1 to 10 to identify the analyte antigen that induces a signal response of one or more analyte eTPC expressing an analyte TCRsp to the expressed analyte antigen. [1029] 22. A method for selecting one or more analyte eAPC from an input analyte eAPC or a library of analyte eAPC, to obtain one or more analyte eAPC that induces a signal response of one or more analyte eTPC expressing an analyte TCRsp to the expressed analyte antigen as defined in item 3, wherein the method comprises [1030] a. Combining one or more analyte eAPC with one or more analyte eTPC, resulting in a contact between an analyte antigen presented by the analyte eAPC with analyte TCRsp of one or more analyte eTPC and [1031] b. Measuring a formation, if any, of a complex between one or more analyte antigen with one or more analyte TCRsp and/or [1032] c. Measuring a signal response in the one or more analyte eTPC, if any, induced by the formation of a complex between the analyte TCRsp with the analyte antigen and/or [1033] d. Measuring a signal response, if any, by the analyte eAPC induced by the formation of a complex between one or more analyte TCRsp with one or more analyte antigen and [1034] e. Selecting one or more analyte eAPC from step b, c and/or d wherein the selection is made by a positive and/or negative measurement. [1035] 23. A method according item 22 wherein the selection step e is performed by single cell sorting and/or cell sorting to a pool. [1036] 24. A method according to item 23 wherein the sorting is followed by expansion of the sorted single cell. [1037] 25. A method according to item 24 wherein the sorting is followed by expansion of the sorted pool of cells. [1038] 26. A method according to any of items 23 to 25 further comprising a step of sequencing component 1B and/or component 1D of the sorted and/or expanded cell(s). [1039] 27. A method according to item 26 wherein the sequencing step is preceded by the following [1040] a. Extracting of genomic DNA and/or [1041] b. Extracting of component 1B and/or component 1D RNA transcript and/or [1042] c. Amplifying by a PCR and/or a RT-PCR of the DNA and/or RNA transcript of component 1B and/or component 1D. [1043] 28. A method according to item 26 or 27 wherein the sequencing step is destructive to the cell and wherein the sequencing information obtained is used for preparing the analyte eAPC selected in step e of item 22. [1044] 29. A method according to any of items 22, 23, 24, 25, 28 wherein the selected analyte eAPC is select based on the signal response of an analyte eTPC wherein the method further comprises [1045] a. Determining a native signalling response and/or [1046] b. Determining a synthetic signalling response. [1047] 30. A method according to item 29 wherein the induced signal response is determined by detecting an increase or decrease in one or more of the following [1048] a. a secreted biomolecule [1049] b. a secreted chemical [1050] c. an intracellular biomolecule [1051] d. an intracellular chemical [1052] e. a surface expressed biomolecule [1053] f. a cytotoxic action of the analyte eTPC upon the analyte eAPC [1054] g. a paracrine action of the analyte eTPC upon the analyte eAPC such that a signal response is induced in the analyte eAPC and is determined by detecting an increase or decrease any of a to e [1055] h. a proliferation of the analyte eTPC [1056] i. an immunological synapse between the analyte eTPC and the analyte eAPC [1057] compared to the non-induced signal response state. [1058] 31. A method to select and identify an aAM cargo or a CM cargo, wherein the cargo is a metabolite and/or a peptide, that is loaded in an aAPX of an analyte eAPC selected and obtained by methods defined in items 22 to 30 wherein the method comprises [1059] a. isolating an aAPX:aAM or an aAPX:CM or the cargo aM or the cargo CM and [1060] b. identifying the loaded cargo. [1061] 32. A method according to item 31 wherein step b comprises subjecting the isolated aAPX:aAM or an aAPX:CM to one or more [1062] a. Mass-spectroscopy analysis [1063] b. Peptide sequencing analysis. [1064] 33. A pair of TCR chain sequences or library of pairs of TCR chain sequences selected by the method as defined in items 12 to 20 for use in at least one of the following [1065] a. diagnostics [1066] b. medicine [1067] c. cosmetics [1068] d. research and development. [1069] 34. An antigenic molecule and/or ORF encoding said antigenic molecule, or libraries thereof selected by the method as defined in items 22 to 32 for use in at least one of the following [1070] a. diagnostics [1071] b. medicine [1072] c. cosmetics [1073] d. research and development. [1074] 35. A antigen-presenting complex loaded with an antigenic molecule as cargo and/or ORF(s) encoding said complex, or libraries thereof selected by the method as defined in items 22 to 32 for use in at least one of the following [1075] a. diagnostics [1076] b. medicine [1077] c. cosmetics [1078] d. research and development. [1079] 36. An eAPC, or library of eAPC selected by the method as defined in items 22 to 30 for use in at least one of the following [1080] a. diagnostics [1081] b. medicine [1082] c. cosmetics [1083] d. research and development. [1084] 37. An eTPC, or library of eTPC selected by the method as defined in items 12 to 20 for use in at least one of the following [1085] a. diagnostics [1086] b. medicine [1087] c. cosmetics [1088] d. research and development. [1089] 38. A device according to any of items 1-10 for use in at least one of the following [1090] a. diagnostics [1091] b. medicine [1092] c. cosmetics [1093] d. research and development.