NITRILASE MUTANTS AND APPLICATION THEREOF

20200115695 ยท 2020-04-16

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention discloses a nitrilase mutant and application thereof. The mutant is obtained by mutating the amino acid at position 201 or replacing one or more amino acids at region 324-381 of the amino acid sequence shown in SEQ ID No. 2. In the present invention, by the protein molecular modification, thermostability of the purified nitrilase LNIT5 is increased by up to 4.5 folds; and by utilizing recombinant E. coli containing the nitrilase mutant to hydrolyze 1-cyanocyclohexylacetonitrile at a high temperature (45 C.), product tolerance is increased, activity of NIT5-L201F is increased by 20%, and the mutant NIT.sub.LNIT5-AcN can completely hydrolyze 750 mM 1-cyanocyclohexylacetonitrile within 8 hours and achieve an doubled conversion rate. Therefore, the mutants obtained by the present invention have a good application prospect in efficiently catalyzing 1-cyanocyclohexylacetonitrile to synthesize gabapentin intermediate, 1-cyanocyclohexyl acetic acid. In the present invention, by protein molecular modification, thermal stability of pure nitrilase LNIT5 at 45 C. is increased up to 4.5 times, and while 1-cyanocyclohexylacetonitrile is hydrolyzed using recombinant Escherichia coli containing nitrilase mutant at high temperature(45 C.), the product yield is increased. Therefore, the mutants obtained in the present invention have a good application prospect in highly efficiently catalyzing 1-cyanocyclohexylacetonitrile to 1-cyanocyclohexyl acetic acid, the gabapentin intermediate.

    Claims

    1. A nitrilase mutant, wherein the mutant is obtained by mutating the amino acid at position 201 or replacing amino acids at region 324-381 of the amino acid sequence shown in SEQ ID No. 2.

    2. The nitrilase mutant as claimed in claim 1, wherein the mutant is obtained by: (1) mutating leucine at position 201 of the amino acid sequence shown in SEQ ID No. 2 into phenylalanine; or (2) replacing amino acids at region 324-381 of the amino acid sequence as shown in SEQ ID No. 2 with amino acids at region 324-371 of the nitrilase derived from Acidovorax facilis CCTCC NO: M 209044, and the amino acid sequence of the amino acids at region 324-371 is shown in SEQ ID No.8.

    3. The nitrilase mutant as claimed in claim 1, wherein the amino acid sequence of the mutant is shown in SEQ ID No.4 or SEQ ID No.6.

    4. An encoding gene of the nitrilase mutant as claimed in claim 1.

    5. A recombinant vector constructed from the encoding gene as claimed in claim 4.

    6. A recombinant genetic engineered strain transformed by the recombinant vector as claimed in claim 5.

    7. An application of the nitrilase mutant as claimed in claim 1 in catalyzing 1-cyanocyclohexylacetonitrile to prepare 1-cyanocyclohexyl acetic acid.

    8. The application as claimed in claim 7, wherein the application is carried out in the following reaction system: use wet cells, wet cell-immobilized cells or purified nitrilase as a catalyst, 1-cyanocyclohexylacetonitrile as a substrate, and pH=7.0, 200 M disodium hydrogen phosphate-sodium dihydrogen phosphate buffer as a reaction medium, carry out the reaction in 45 C. constant temperature water bath, after the reaction is completed, subject the reaction solution to separation and purification to obtain 1-cyanocyclohexyl acetic acid; in which, the wet wells are obtained by the fermentation culture of the genetically engineered strain containing the encoding gene of the nitrilase mutant, and the purified nitrilase is obtained by subjecting the wet cells to ultrasonic breaking and then extraction.

    9. The application as claimed in claim 8, wherein in the reaction system, the final concentration of the substrate calculated by the volume of the buffer is 1001300 mM, and the amount of the catalyst calculated by the weight of the wet cells is 10100 g/L buffer.

    10. The application as claimed in claim 8, wherein the catalyst is prepared according to one of the following methods: (1) the genetic engineered strain containing the encoding gene of the nitrilase mutant is inoculated into LB medium and cultured at 37 C. for 10-12 hours, then the resulting inoculum is inoculated with 2% incubating volume to LB medium containing kanamycin with the final concentration of 50 mg/L, amplified and cultured at 37 C.; when OD600 of the culture medium reaches 0.6-0.8, isopropyl--D-thiogalactopyranoside is added with the final concentration of 0.1 mM, and the bacteria solution is subjected to induced expression at 28 C. for 10 hours; the wet cells are harvested by centrifugation and washed with normal saline twice; (2) the wet cells obtained in step (1) are resuspended with 50 mM NaH2PO4 buffer (pH 8.0) containing NaCl with the final concentration of 300 mM, ultrasonic broken, and followed by centrifugation to remove cell debris, the resulting supernatant is a crude enzyme solution; the crude enzyme solution is applied onto the Ni-NTA column which has been washed with equilibrium buffer at a flow rate of 1 mL/min, then the weakly adsorbed protein impurities are eluted with elution buffer at a flow rate of 2 mL/min; then the target protein is eluted with protein elution buffer at a flow rate of 2 mL/min and collected; finally, the obtained target protein is dialyzed with a sodium chloride aqueous solution with the mass concentration of 0.9% as the dialysate, and the retention is purified nitrilase; in which the equilibrium buffer is 50 mM NaH2PO4 buffer (pH 8.0) containing NaCl with the final concentration of 300 mM, the elution buffer is 50 mM NaH2PO4 buffer (pH 8.0) containing NaCl and imidazole with the final concentrations of 300 mM and 50 mM, and the protein elution buffer is 50 mM NaH2PO4 buffer (pH 8.0) containing NaCl and imidazole with the final concentrations of 300 mM and 250 mM; (3)the wet cells of the step(1) are suspended in 200 mM sodium dihydrogen phosphate-disodium hydrogen phosphate buffer system (pH 7.0), diatomite is added into the suspension with the final concentration of 0.006 g/mL, and the mixture is stirred at room temperature for 1 h; subsequently, polyethyleneimine is added into the mixture with the final volume concentration of 3%, and the mixture is stirred at room temperature for 1 hour; finally, glutaraldehyde is added with the final volume concentration of 1% and the mixture is stirred for 1 hour, and the immobilized cells are obtained by vacuum filtration; in which, the polyethyleneimine is added in the form of a aqueous solution with the mass concentration of 5%, and the glutaraldehyde is added in the form of a aqueous solution with the mass concentration of 25%.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0020] FIG. 1: comparison of activities of the purified nitrilase mutants.

    [0021] FIG. 2: thermal stability of the nitrilase mutants at 45 C.

    [0022] FIG. 3: comparison of activity of E. coli resting cells containing the nitrilase mutants.

    [0023] FIG. 4: comparison of hydrolysis of 400 mM 1-cyanocycloalkaneacetonitrile by recombinant E. coli resting cells containing the nitrilase mutants.

    [0024] FIG. 5: comparison of hydrolysis of 750 mM 1-cyanocycloalkaneacetonitrile by recombinant E. coli resting cells containing the nitrilase mutants.

    [0025] FIG. 6: hydrolysis of 1.0 M 1-cyanocycloalkaneacetonitrile by recombinant E. coli resting cells containing the nitrilase mutant NIT.sub.LNIT5-AcN.

    [0026] FIG. 7: high performance liquid chromatogram of 1-cyanocyclohexyl acetic acid.

    SPECIFIC EMBODIMENT

    [0027] The present invention is further illustrated below with specific examples, but protection scope of the present invention is not limited to these examples:

    EXAMPLE 1

    Acquisition of Nitrilase LNIT5

    [0028] According to protein NCBI database, BLAST was run by using a nitrilase derived from A. facilis CCTCC NO: M 209044 as a template, and a nitrilase gene (GenBank Accession no: AAR97494.1) was screened from the results. The screened nitrilase is derived from an uncultured microorganism, and 76% similar to the nitrilase derived from A. facilis CTCCC NO: M 209044. According to the amino acid sequence of the screened nitrilase and codons which Escherichia coli prefers, codon optimization was carried out, the amino acid sequence of the nitrilase LNIT5 is shown in SEQ ID No. 2, and the nucleotide sequence encoding the enzyme is shown in SEQ ID No. 1.

    EXAMPLE 2

    Construction of Recombinant Expression Vector pET-28b(+)-LNIT5 and the Recombinant Strain

    [0029] The recombinant expression vector pET-28b(+)-LNIT5 containing the nitrilase LNIT5 gene was synthesized by the total-synthetic method and via conventional operation of genetic engineering. The constructed expression vector pET-28b(+)-LNIT5 was transferred into a receptor strain, E. coli BL21 (DE3), which was then plated on a LB agar plate containing kanamycin (at the final concentration of 50 g/mL) and cultured overnight at 37 C. The colonies grown on the plate were randomly selected, and the plasmid was extracted and identified by agarose gel electrophoresis to obtain the recombinant strain E. coli BL21 (DE3)/pET-28b(+)-LNIT5.

    TABLE-US-00001 TABLE1 primerdesigntable Primername Primersequence(5to3) L201F-f CCGGACGTTCCGCAGTTTGGCGCAGGTGCGAATG L201F-r CATTCGCACCTGCGCCAAACTGCGGAACGTCCGG I-f ACCTGGACGAAGAAGGTCGTCTGGATGTTAACAC GCGTTCC I-r TTGTTAGCAGCCGGATCTCAGTGGTGGTGGTGGT GGTGC P-f TGAGATCCGGCTGCTAACAAA P-r ACGACCTTCTTCGTCCAGGTAA

    EXAMPLE 3

    Construction of Nitrilase LNIT5 Mutant

    [0030] The expression plasmid pET-28b(+)-LNIT5 was used as a template, and the site-directed mutagenesis was carried out by amplification of the whole plasmid. The PCR system (50 L) was as follows: 0.5-20 ng of the template, 10-15 pmol of each primer (L201F-f and L201F-r, whose sequences is seen in in table 1), 5 PrimeSTAR Buffer (Mg.sup.2 plus), 0.2 mM dNTP, and 1.25 U PrimeSTAR HS DNA Polymerase. The PCR program was as follows: (1) pre-denaturation at 98 C. for 3 min; (2) denaturation at 98 C. for 10 s; (3) anneal at 60 C. for 5 s; (4) extension at 72 C. for 6.5 min, wherein steps (2)(4) were cycled 30 times; and (5) finally, extension at 72 C. for 5 min, preservation at 4 C. The PCR product was identified by agarose gel electrophoresis, digested with DpnI, and then introduced into the host strain E. coli BL21 (DE3), which was then plated on a LB plate containing 50 g/mL kanamycin to obtain monoclones. The selected monoclonal plasmid was extracted, and sequenced and verified by Beijing TSINGKE Biological Technology CO., LTD. to obtain the mutant LNIT5-L201F, whose amino acid sequence was shown in SEQ ID No. 4, and nucleotide sequence was shown in SEQ ID. No.3.

    [0031] Using the recombinant expression plasmid pET-28b(+)-AcN containing the nitrilase AcN gene derived from A. facilis CTCCC NO: M 209044 as a template, the nucleotide sequence containing homologous arms and the nucleotide sequence corresponding to the amino acids at the C-terminal region 324-381 of the nitrilase AcN (the amino acid sequence of the amino acids at region 324-381 is shown in SEQ ID No. 8, and the nucleotide sequence is shown in SEQ ID No. 7) was obtained by PCR amplification. The PCR system (50 L) was as follows: 0.5-20 ng of the template, 10-15 pmol of each of primers I-f and I-r, 5PrimeSTAR Buffer (Mg.sup.2+ plus), 0.2 mM dNTP, and 1.25 U PrimeSTAR HS DNA Polymerase. The PCR program was as follows: (1) pre-denaturation at 98 C. for 3 min; (2) denaturation at 98 C. for 10 s; (3) anneal at 60 C. for 5 s; (4) extension at 72 C. for 10 s, wherein steps (2)(4) were cycled 30 times; and (5) finally, extension at 72 C. for 5 min, preservation at 4 C. The obtained PCR product was separated by agarose gel electrophoresis, and about 150 bp DNA fragments were recovered for use.

    [0032] Using the expression plasmid pET-28b(+)-LNIT5 as a template, a pET-28b(+) linear vector plasmid containing homologous arms and the nucleotide sequence corresponding to amino acids at the N-terminal region 1-323 of the nitrilase LNIT5 was obtained by PCR amplification. The PCR system (50 L) was as follows: 0.5-20 ng of the template, 10-15 pmol of each of primers P-f and P-r, 5PrimeSTAR Buffer (Mg.sup.2+ plus), 0.2 mM dNTP, and 1.25 U PrimeSTAR HS DNA Polymerase. The PCR program was as follows: (1) pre-denaturation at 98 C. for 3 min; (2) denaturation at 98 C. for 10 s; (3) anneal at 60 C. for 5 s; (4) extension at 72 C. for 6.5 min, wherein steps (2)(4) were cycled 30 times; and (5) finally, extension at 72 C. for 5 min, preservation at 4 C. The PCR product was verified by agarose gel electrophoresis, digested with restriction endonuclease DpnI, and the target fragments were obtained by PCR purification kit.

    [0033] Finally, homologous recombination was achieved using the ClonExpress II One Step Cloning Kit (Vazyme Biotech Co., Ltd., Nanjing). The expression plasmid containing the fusion protein was introduced into the host strain E. coli BL21 (DE3), which was then plated onto a LB plate containing 50 g/mL kanamycin to obtain monoclones. The selected monoclonal plasmid was extracted, and sequenced and verified by Beijing TSINGKE Biological Technology CO., LTD. to obtain fusion protein NIT.sub.LNIT5-AcN, whose amino acid sequence was shown in SEQ ID No. 6, and nucleotide sequence was shown in SEQ ID No. 5.

    EXAMPLE 4

    Expression of the Wild-Type or the Mutant-Type Nitrilase

    [0034] The transformants E. coli BL21 (DE3)/pET-28b(+)-LNIT5, E. coli BL21 (DE3)/pET-28b(+)-LNIT5-L201F and E. coli BL21 (DE3)/pET-28b(+)-NIT.sub.LNIT5-AcN obtained in example 2 and example 3 were respectively inoculated into LB medium, cultured at 37 C. for 10-12 hours, the resulting inocula were respectively inoculated to LB medium containing kanamycin (with the final concentration of 50 mg/L) with 2% incubating volume, amplified and cultured at 37 C. When OD.sub.600 of the culture medium reached 0.6-0.8, isopropyl--D-thiogalactopyranoside (IPTG) was added with the final concentration of 0.1 mM, and the bacteria solution was subjected to induced expression at 28 C. for 10 hours. The wet cells were harvested by centrifugation and washed with normal saline twice.

    EXAMPLE 5

    Purification of the Wild-Type or the Mutant-Type Nitrilase

    [0035] (1) 50 mM NaH2PO4 buffer (pH 8.0) containing 300 mM NaCl was added to the wet cells obtained in example 4, the cells were resuspended, ultrasonic broken (400 W, 15 min, 1 s breaking, 1 s pause) and followed by centrifugation at 12,000g for 20 min to remove cell debris. The supernatant was a crude enzyme solution for separation and purification.

    [0036] (2)After pre-filling the 20 mL Ni-NTA affinity column, equilibration was performed using equilibrium buffer (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, pH 8.0) at a flow rate of 2 mL/min.

    [0037] (3)After the Ni-NTA column was washed with 8-10 column volume, the obtained crude enzyme solution was applied onto the Ni-NTA column at a flow rate of 1 mL/min, and the target protein bound to the column. After loading, a large amount of unbound protein impurities which did not bind to the resin would be directly removed.

    [0038] (4)The weakly adsorbed protein impurities were eluted with elution buffer(50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 50 mM imidazole, pH 8.0) at a flow rate of 2 mL/min.

    [0039] (5)The target protein was eluted with protein elution buffer(50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 250 mM imidazole, pH 8.0) at a flow rate of 2 mL/min and collected.

    [0040] (6) The collected enzyme solution was dialyzed using a dialysis bag(Economical Biotech Membrane, 14KD, 34 mm Width, purchased from Sangon Biotech (Shanghai) Co., Ltd.) with a sodium chloride aqueous solution with the mass concentration of 0.9% as the dialysate, and the retention was purified nitrilase.

    [0041] (7) The purified proteins were analyzed by SDS-PAGE.

    EXAMPLE 6

    Determination of Activity of the Purified Nitrilases

    [0042] The activity of the purified nitrilases from example 5 was determined. A reaction system (10 mL) for nitrilase activity assay was as follows: sodium dihydrogen phosphate-disodium hydrogen phosphate buffer (100 mM, pH 7.0), 200 mM 1-cyanocyclohexylacetonitrile, and 75 mg of the purified nitrilase. The reaction solution was preheated at 45 C. for 10 min and then reacted at 150 rpm for 10 min. 500 L of the supernatant was sampled, and 500 L of 2 M HCl was added to terminate the reaction, and the conversion rate of 1-cyanocyclohexyl acetic acid was determined by liquid chromatography (Shimadzu LC-16) external standard method. The column is XBridge BEH C.sub.18 Column (130 , 5 m, 4.6 mm250 mm, 1/pkg, Waters), and the mobile phase was a buffer (0.58 g/L diammonium phosphate, 1.83 g/L sodium perchlorate, pH was adjusted to 1.8 by perchloric acid) and acetonitrile in a ratio of 76:24 (v/v), the flow rate was 1 mL/min, the ultraviolet detection wavelength was 215 nm, and the column temperature was 40 C. Enzyme activity definition (U): the amount of enzyme required to catalyze the formation of 1 mol of 1-cyanocyclohexyl acetic acid per minute at 45 C., in pH 7.0, 100 mM sodium dihydrogen phosphate-disodium hydrogen phosphate buffer was defined as 1 U. The results were shown in FIG. 1.

    EXAMPLE 7

    Determination of Thermostability of the Wild-Type or the Mutant-Type Nitrilase at 45 C.

    [0043] The thermostability of the purified nitrilases from example 5 was measured. A certain amount of the purified nitrilase was taken into a 50 mL sterile polypropylene centrifuge tube and stored in a 45 C. constant temperature water bath. The protein was sampled for measurement of activity of the protein at different time intervals according to the method as described in example 6. With the activity of the protein before stored in a 45 C. constant temperature water bath as a control, residual activities of the protein at every time interval were calculated.

    [0044] As shown in FIG. 2, the half-life of the original nitrilase LNIT5 was determined to be 6 h, the half-life of the mutant LNIT5-L201F was 16 h, and the half-life of the fusion protein NIT.sub.LNIT5-AcN was 27 h.

    EXAMPLE 8

    Determination of Activity of Recombinant E. Coli Containing the Wild-Type or the Mutant-Type Nitrilase

    [0045] The nitrilase activities of recombinant E. coli containing the wild-type or the mutant-type nitrilase E. coli BL21 (DE3)/pET-28b(+)-LNIT5, E. coli BL21 (DE3)/pET-28b(+)-LNIT5-L201F and E. coli BL21(DE3)/pET-28b(+)-NIT.sub.LNIT5-AcN obtained in example 4 were measured. A reaction system (10 mL) for nitrilase activity assay was as follows: sodium dihydrogen phosphate-disodium hydrogen phosphate buffer (200 mM, pH 7.0), 1-cyanocyclohexylacetonitrile with the final concentration of 100 mM, 10 g/L of the E. coli wet cells. The reaction solution was preheated at 45 C. for 10 min and then reacted at 150 rpm for 10 min. 500 L of the supernatant was sampled, and conversion rate of 1-cyanocyclohexyl acetic acid was measured by liquid chromatography (Shimadzu LC-16) external standard method. The conditions of liquid chromatography were described in example 6, and the results were shown in FIG. 3.

    EXAMPLE 9

    Determination of Thermostability of Recombinant E. Coli Containing the Wild-Type or the Mutant-Type Nitrilase at 45 C.

    [0046] The resting cells of the recombinant E. coli containing the wild-type or the mutant-type nitrilase, E. coli BL21 (DE3)/pET-28b(+)-LNIT5, E. coli BL21 (DE3)/pET-28b(+)-LNIT5-L201F and E. coli BL21(DE3)/pET-28b(+)-NIT.sub.LNIT5-AcN, obtained in example 4, were respectively suspended in sodium dihydrogen phosphate-disodium hydrogen phosphate buffer (200 mM, pH 7.0) to obtain a 20 g/L bacterial suspension, and stored in a 45 C. constant temperature water bath. The bacterial suspension was sampled for measurement of activity of the resting cells at different time intervals according to the method as described in example 8. With the activity of the resting cells before stored in a 45 C. constant temperature water bath as a control, residual activities of the resting cells at each time interval were calculated, and the results were shown in table 2.

    TABLE-US-00002 TABLE 2 Thermostability of E. coli resting cells containing the nitrilase mutants at 45 C. Residual activity Residual activity Mutants after 14 hours after 24 hours E. coli BL21 (DE3)/pET- 71.5% 40% 28b(+)-LNIT5 E. coli BL21 (DE3)/pET- 96.8% 78% 28b(+)-LNIT5-L201F E. coli BL21 (DE3)/pET- 98.5% 89% 28b(+)-NIT.sub.LNIT5-AcN E. coli BL21 (DE3) 0 0 E. coli BL21 (DE3)/pET- 0 0 28b(+)

    EXAMPLE 10

    Hydrolysis of 400 mM 1-cyanocycloalkaneacetonitrile by Recombinant E. Coli Containing the Wild-Type or the Mutant-Type Nitrilase

    [0047] 0.5 g of wet cells of E. coli BL21 (DE3)/pET-28b(+)-LNIT5, E. coli BL21 (DE3)/pET-28b(+)-LNIT5-L201F and E. coli BL21(DE3)/pET-28b(+)-NIT.sub.LNIT5-AcN, obtained by the method as described in example 4, were suspended in 10 mL of sodium dihydrogen phosphate-disodium hydrogen phosphate buffer (200 mM, pH 7.0) respectively, 0.592 g of 1-cyanocyclohexylacetonitrile was added with the final concentration of 400 mM, and the reaction was carried out in a 45 C. constant temperature water bath. Samples were taken at different times, centrifuged at 12000rpm, and the precipitates were discarded. The treated reaction solutions were analyzed for profiling the product concentration by high performance liquid chromatography. The HPLC conditions were as described in example 6.

    [0048] As shown in FIG. 4, E. coli BL21 (DE3)/pET-28b(+)-LNIT5, E. coli BL21 (DE3)/pET-28b(+)-LNIT5-L201F and E. coli BL21 (DE3)/pET-28b(+)-NIT.sub.LNIT5-AcN could completely hydrolyze the substrate within 6 h, wherein the reaction catalyzed by E. coli BL21 (DE3)/pET-28b(+)-NIT.sub.LNIT5-AcN was faster than that catalyzed by E. coli BL21 (DE3)/pET-28b(+)-LNIT5.

    EXAMPLE 11

    Hydrolysis of 750 mM 1-cyanocycloalkaneacetonitrile by Recombinant E. Coli Containing the Nitrilase Mutant NIT.SUB.LNIT5-AcN

    [0049] 0.5 g of the E. coli BL21 (DE3)/pET-28b(+)-NIT.sub.LNIT5-AcN wet cells obtained by the method as described in example 4, were suspended in 10 mL of sodium dihydrogen phosphate-disodium hydrogen phosphate buffer (200 mM, pH 7.0), 1.11 g of 1-cyanocyclohexylacetonitrile was added with the final concentration of 0.75 M, and the reaction was carried out in 45 C. constant temperature water bath. Samples were taken at different times, centrifuged at 12000rpm for 3 min, and the precipitates were discarded. The treated reaction solution was analyzed for profiling the product concentration by high performance liquid chromatography. The HPLC conditions were as described in example 6.

    [0050] As shown in FIG. 5, the mutant, E. coli BL21 (DE3)/pET-28b(+)-NIT.sub.LNIT5-AcN, could completely hydrolyze the substrate within 8 h, much faster than E. coli BL21 (DE3)/pET-28b(+)-LNIT5.

    EXAMPLE 12

    Hydrolysis of 1.0 M 1-cyanocycloalkaneacetonitrile by Recombinant E. Coli Containing the Nitrilase Mutant NIT.SUB.LNIT5-AcN

    [0051] 0.5 g of the E. coli BL21 (DE3)/pET-28b(+)-NIT.sub.LNIT5-AcN wet cells obtained by the method as described in example 4, were suspended in 10 mL of sodium dihydrogen phosphate-disodium hydrogen phosphate buffer (200 mM, pH 7.0), 1.48 g of 1-cyanocyclohexylacetonitrile(at a final concentration of 1.0M) was added, and the reaction was carried out in 45 C. constant temperature water bath. Samples were taken at different times, centrifuged at 12000 rpm for 3 min, and the precipitates were discarded. The treated reaction solution was analyzed for profiling the product concentration by high performance liquid chromatography. The analysis conditions of HPLC were as described in example 6.

    [0052] As shown in FIG. 6, the mutant, E. coli BL21 (DE3)/pET-28b(+)-NIT.sub.LNIT5-AcN, could completely hydrolyze the substrate within 11 h.

    EXAMPLE 13

    Hydrolysis of 750 mM 1-cyanocycloalkaneacetonitrile by the Immobilized Cells

    [0053] 2 g of the E. coli BL21 (DE3)/pET-28b(+)-NIT.sub.LNIT5-AcN wet cells obtained by the method as described in example 4, were suspended in 20 mL of sodium dihydrogen phosphate-disodium hydrogen phosphate buffer (200 mM, pH 7.0), diatomite was added into the suspension with the final concentration of 0.006 g/mL, and the mixture was stirred at room temperature for 1 h. Subsequently, polyethyleneimine (added in the form of a 5% (w/w) aqueous solution) was added into the mixture with the final concentration of 3% (v/v), and stirred at room temperature for 1 hour. Finally, glutaraldehyde (added in the form of a 25% (w/w) aqueous solution) was added with the final concentration of 1% (v/v) and the mixture was stirred for 1 hour, and the immobilized cells were obtained by vacuum filtration.

    [0054] All the immobilized cells obtained above (the amount of the immobilized cells was 100 g/L calculated by resting cells) were suspended in 20 mL of disodium hydrogen phosphate-sodium dihydrogen phosphate buffer system (200 mM, pH=7.0), 2.22 g of 1-cyanocyclohexylacetonitrile were added with the final concentration of 750 mM, and the reaction was carried out in 45 C. constant temperature water bath for 8 hours per batch. After the completion of each batch of the reaction, vacuum filtration was carried out for the solid-liquid separation, and the resulting reaction solution was analyzed by high performance liquid chromatography for profiling the concentration of the product according to the method described in example 6, and the recovered immobilized cells were applied into the next batch of reaction. As a result, the prepared immobilized cells were reused for 6 batches, and the conversion rate of each batch was more than 99%.