METHOD FOR DIRECT REPROGRAMMING OF URINE CELLS INTO KERATINOCYTE STEM CELLS AND METHOD FOR PREPARING COMPOSITION FOR PROMOTING SKIN REGENERATION USING REPROGRAMMED KERATINOCYTE STEM CELLS

Abstract

The present invention relates to a method for inducing reprogramming of urine cells into keratinocyte stem cells by introducing reprogramming factors Bmi1 and dNP63a, and a composition for promoting skin regeneration which includes an induced reprogrammed keratinocyte stem cell conditioned medium as an active ingredient.

Claims

1. A composition for direct reprogramming urine cells into keratinocyte stem cells, the composition comprising: (i) a Bmi1 protein, or a coding sequence of Bmi1 protein; and (ii) a dNP63a protein, or a coding sequence of dNP63a protein.

2. The composition of claim 1, wherein the urine cells are somatic cells derived from urine.

3. The composition of claim 1, wherein the composition comprises an expression vector into which coding sequence of Bmi1 protein and dNP63a protein are inserted.

4. The composition of claim 1, wherein the composition comprises a virus into which coding sequence of Bmi1 protein and dNP63a protein are introduced.

5. A method for direct reprogramming urine cells into keratinocyte stem cells, the method comprising: (a) Isolating urine cells from urine and culturing the urine cells; (b) Transducing cording sequence of Bmi1 and dNP63a into the isolated and cultured urine cells; (c) Culturing the transduced urine cells under keratinocyte stem cell culture conditions; and (d) Selecting a reprogrammed keratinocyte stem cell line having characteristics similar to keratinocyte stem cells from the urine cells which have been cultured.

6. The method of claim 5, wherein the transduction of coding sequence of Bmi1 and dNP63a in step (b) by infection of the urine cells with retrovirus expression of Bmi1 and dNP63a.

7. The method of claim 5, wherein the culture conditions in step (c) comprise culturing the urine cells in a high glucose DMEM/F12 3: 1 medium containing fetal bovine serum (FBS), insulin, hydrocortisone, cholera toxin, T3, ascorbic acid, an epidermal growth factor (EGF), L-glutamine, and penicillin-streptomycin.

8. A method for preparing a reprogrammed keratinocyte stem cell conditioned medium or a culture solution thereof from urine cells, the method comprising: (a) Isolating urine cells from urine and culturing the urine cells; (b) Transducing cording sequence of Bmi1 and dNP63a into the isolated and cultured urine cells; (c) Culturing the transduced urine cells under keratinocyte stem cell culture conditions; and (d) Selecting a reprogrammed keratinocyte stem cell line having characteristics similar to keratinocyte stem cells from the urine cells which have been cultured; and (e) Acquiring a conditioned medium or a culture solution thereof by culturing the selected reprogrammed keratinocyte stem cells in a serum-free medium.

9. The method of claim 8, wherein the transduction of coding sequence of Bmi1 and dNP63a in step (b) comprises infecting the urine cells with retrovirus comprising coding sequence of Bmi1 and dNP63.

10. The method of claim 8, wherein the culture conditions in step (c) comprise culturing the urine cells in a high glucose DMEM/F12 3: 1 medium including fetal bovine serum (FBS), insulin, hydrocortisone, cholera toxin, T3, ascorbic acid, an epidermal growth factor (EGF), L-glutamine, and penicillin-streptomycin.

11. The method of claim 8, wherein the conditioned medium comprises VEGF, PDGF-AA, and bFGF produced from reprogrammed keratinocyte stem cells.

12. A cosmetic composition for promoting skin regeneration, the cosmetic composition comprising as an active ingredient the reprogrammed keratinocyte stem cell conditioned medium or culture solution thereof prepared by the method of claim 8.

13. A pharmaceutical composition for treating skin wounds, the pharmaceutical composition comprising as an active ingredient the reprogrammed keratinocyte stem cell conditioned medium or culture solution thereof prepared by the method of claim 8.

14. A cosmetic composition for promoting skin regeneration, the cosmetic composition comprising as an active ingredient the reprogrammed keratinocyte stem cell conditioned medium or culture solution thereof prepared by the method of claim 9.

15. A cosmetic composition for promoting skin regeneration, the cosmetic composition comprising as an active ingredient the reprogrammed keratinocyte stem cell conditioned medium or culture solution thereof prepared by the method of claim 10.

16. A cosmetic composition for promoting skin regeneration, the cosmetic composition comprising as an active ingredient the reprogrammed keratinocyte stem cell conditioned medium or culture solution thereof prepared by the method of claim 11.

17. A pharmaceutical composition for treating skin wounds, the pharmaceutical composition comprising as an active ingredient the reprogrammed keratinocyte stem cell conditioned medium or culture solution thereof prepared by the method of claim 9.

18. A pharmaceutical composition for treating skin wounds, the pharmaceutical composition comprising as an active ingredient the reprogrammed keratinocyte stem cell conditioned medium or culture solution thereof prepared by the method of claim 10.

19. A pharmaceutical composition for treating skin wounds, the pharmaceutical composition comprising as an active ingredient the reprogrammed keratinocyte stem cell conditioned medium or culture solution thereof prepared by the method of claim 11.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0062] The above and other objects, features and advantages of the present invention will become more apparent to those of ordinary skill in the art by describing in detail exemplary embodiments thereof with reference to the accompanying drawings, in which:

[0063] FIG. 1A illustrates the number of co-positive colonies of KRT15/ITGA6 which is a keratinocyte stem cell marker after inducing direct reprogramming of urine cells into keratinocyte stem cells using a retroviral vector system to introduce a reprogramming factor Bmi1(B)/dNP63a(N)/Klf4(K) into the urine cells at each combination (BNK, BN, BK, NK, B, N, and K);

[0064] FIG. 1B is a result of performing an RT-PCR experiment in order to confirm whether the combination of the reprogramming factors is expressed in urine cells;

[0065] FIG. 1C illustrates a result of inducing reprogrammed keratinocyte stem cells using male or female-derived urine cells;

[0066] FIG. 2A illustrates that reprogrammed keratinocyte stem cell lines BN28-2, BN28-5, and BN28-6 are established using a colony-picking method to select co-positive colonies of KRT15/ITGA6 which is a keratinocyte stem cell marker and subject the colonies to expansion culture;

[0067] FIG. 2B confirmed that the reprogrammed stem cells were keratinocyte stem cells by confirming the expression of keratinocyte stem cell markers ANGPTL2, CD200, ITGA6, KRT15, KRT14, and GJB2 in the established keratinocyte stem cell lines;

[0068] FIGS. 2C and 2D are results of confirming the stability of reprogrammed keratinocyte stem cells induced at each combination (BNK, BN, NK, and N) using Bmi1(B)/dNP63a(N)/Klf4(K);

[0069] FIG. 2E is a result of confirming the stability of reprogrammed keratinocyte stem cells induced at each combination (BNK and BN) using Bmi1(B)/dNP63a(N)/Klf4(K);

[0070] FIG. 3 is a result of confirming the potential to differentiate reprogrammed keratinocyte stem cells into keratinocytes; (A) a result of confirming keratinocyte markers at the mRNA level through qPCR experiments, (B) a result of confirming keratinocyte markers at the protein level through aimmunochemistry experiments;

[0071] FIG. 4 is a result of verifying skin regeneration efficacies according to the concentration of reprogrammed keratinocyte stem cell-derived conditioned medium in vitro; (A) observation of cell growth according to the concentration of the conditioned medium; (B) and (C) comparison of wound healing effects through observation of migration situations of fiber cells in a 50% conditioned medium and a DMEM/F12 3: 1 basal medium;

[0072] FIG. 5 is a result of verifying skin regeneration efficacies according to the composition of reprogrammed keratinocyte stem cell-derived conditioned medium in vivo;

[0073] FIG. 6 confirmed the analysis of components of the conditioned medium derived from reprogrammed stem cells through cytokine array experiments; and

[0074] FIG. 7 is a result of measuring the amounts of skin regeneration promoting growth factors PDGF-AA, bFGF, and VEGF Protein using ELISA.

DETAILED DESCRIPTION OF EXEMPLARY EMBODIMENTS

[0075] Exemplary embodiments of the present invention will be described in detail below with reference to the accompanying drawings. While the present invention is shown and described in connection with exemplary embodiments thereof, it will be apparent to those skilled in the art that various modifications can be made without departing from the spirit and scope of the invention.

[0076] Hereinafter, the present invention will be described in more detail with reference to Examples. However, the following Examples are provided only to more easily understand the present invention, and the present invention is not limited to the following Examples.

Example 1: Isolation of Urine Cells from Urine

[0077] After urine cells were centrifuged at 2,000 rpm for 10 minutes by collecting 200 ml of urine in a container, the supernatant thereof was removed. After the pellet was washed with PBS including an antibiotic and then centrifuged at 2,000 rpm for 10 minutes, the supernatant thereof was removed. The cell pellets were seeded onto a 12-well plate coated with gelatin by resuspending the cell pellets with a DMEM/F12 1: 1 medium including an antibiotic+10% FBS.

[0078] After 1 ml of the DMEM/F12 1: 1 medium including an antibiotic+10% FBS was added daily for 5 days, the medium was replaced with a medium of 5% FBS, bFGF 2.5 ng/ml, EGF 2.5 ng/ml, 44% high glucose DMEM including 0.5% L-glutamine and 0.5% penicillin-streptomycin, and a 50% renal epithelial cell growth medium (REGM). When confluence reached 95% or more, urine cells were cultured (passaging) through subculture. At Passage 3, urine cells were used to induce reprogrammed keratinocyte stem cells.

Example 2: Selection of Combination of Reprogramming Factors for Inducing of Urine-Derived Reprogrammed Keratinocyte Stem Cell Lines

[0079] In order to obtain reprogrammed keratinocyte stem cell lines, urine cells were induced into reprogrammed keratinocyte stem cells using a retroviral vector system to introduce reprogramming factors Bmi1 (B, NCBI ID:648, RefSeq: NM_005180.8), dNP63a(N, NCBI ID:8626, RefSeq: NM_001114980.1), and Klf4(K, NCBI ID: 9314, RefSeq: NM_001314052.1) into urine cells at each combination (BNK, BN, BK, NK, B, N, and K). The specific method is as follows:

[0080] In the urine cells isolated and cultured in Example 1, vectors (pMXs-Bmi1, pMXs-dNP63a, and pMXs-Klf4) constructed by inserting nucleotide sequences encoding Bmi1, dNP63a and Klf4 proteins into a pMXs vector were infected with a virus into which the reprogramming factor combination prepared using a human 293-derived retroviral packaging cell line (293GPG) was introduced, thereby introducing the reprogramming factors into urine cells.

[0081] The urine cells into which the reprogramming factors were introduced were cultured in a high glucose DMEM/F12 3: 1 medium including 1% L-glutamine, 1% penicillin-streptomycin, 5 ug/ml insulin, 0.5 ug/ml hydrocortisone, 8.3 ng/ml cholera toxin, 1.37 ng/ml T3, 52.8 ug/ml ascorbic acid, 20 ng/ml EGF, and 2% FBS.

[0082] The cultured urine cells were each fixed with 4% paraformaldehyde for 20 minutes, and then washed three times with PBS+0.1% BSA. Thereafter, after bloking and permeabilization (with a nuclear and cytoplasmic marker for 40 minutes, and with a surface marker for 10 minutes) were performed using 0.3% Triton X100 (PBS+1% BSA+10% donkey serum), the cells were washed three times with PBS+0.1% BSA. And then, after the cells were reacted with a primary antibody (PBS+1% BSA+10% donkey serum) at room temperature for 1 hour, and then washed three times with PBS+0.1% BSA, the cells were reacted with a secondary antibody (PBS+0.1% BSA) at room temperature for 1 hour, and then washed three times with PBS+0.1% BSA. And then, after the cells were reacted with DAPI (PBS+0.1% BSA) at room temperature for 5 minutes, the cells were washed three times with PBS+0.1% BSA, and then observed under a microscope. For the primary antibody and the secondary antibody, keratinocyte stem cell markers KRT15 and ITGA6 were used.

[0083] Further, a RT-PCR experiment was performed as follows in order to confirm whether the reprogramming factors were properly overexpressed by viral infection:

[0084] An mRNA encoding Bmi1, dNP63a, Klf4 or a combination thereof for confirming the expression was isolated from cell using TRIzol. After the mRNA was prepared into a cDNA by a T3000 Thermocycler (Biometra) device using oligDT and Reverse Transcriptase II, specific sequence fragments were confirmed using primers (pBMN5: GCTTGGATACACGCCGC (SEQ ID No. 1); Bmi-Reverse: TTGCTGGTCTCCAGGTAACG (SEQ ID NO. 2); dNP63a-Reverse: ATGATGAACAGCCCAACCTC (SEQ ID No. 3); Klf4-Reverse: TGTACACCGGGTCCAATT (SEQ ID No. 4)) specific for Bmi1, dNP63a or Klf4 genes to perform PCR in the T3000 Thermocycler device. GAPDH was used as a house-keeping gene.

[0085] As a result, a gene combination of Bmi1/dNP63a(BN), which exhibited the highest efficiency through the number of co-positive colonies of KRT15 and ITGA6 which is a keratinocyte stem cell-specific marker, was selected as an optimal combination (FIG. 1A). In order to confirm whether reprogramming factors were properly overexpressed in cells, an RT-PCR experiment was performed, and it could be confirmed that exogenous Bmi1/dNP63a/Klf4 genes of each combination were expressed at the mRNA level (FIG. 1B). Regardless of gender, the gene combination Bmi1/dNP63a (BN) could successfully induce urine cells into de-diffrentiated keratinocyte stem cells (FIG. 1C).

Example 3: Establishment of Urine-Derived Reprogrammed Keratinocyte Stem Cell Lines into which Bmi1 and dNP63a are Introduced

[0086] After colonies co-positive for KRT15/ITGA6 which is a keratinocyte stem cell-specific marker were selected from colonies similar to keratinocyte stem cells among cells induced in Example 2 using a colony-picking method, reprogrammed keratinocyte stem cells BN28-2, BN28-5, and BN28-6 were established by expansion culturing the colonies in a high glucose DMEM/F12 3: 1 medium including 1% L-glutamine, 1% penicillin-streptomycin, 5 ug/ml insulin, 0.5 ug/ml hydrocortisone, 8.3 ng/ml cholera toxin, 1.37 ng/ml T3, 52.8 ug/ml ascorbic acid, 20 ng/ml EGF, and 10% FBS (FIG. 2A).

[0087] With respect to the established cell lines, the expression of the keratinocyte stem cell markers ANGPTL2, CD200, ITGA6, KRT15, KRT14, and GJB2 at the mRNA level was confirmed using primers (ANGPTL2-Forward: TACATGGCACAACGGCAAGCA (SEQ ID No. 5); ANGPTL2-Reverse: TTGGAGTGGGCACAGGCGTTAT (SEQ ID No. 6); CD200-Forward: AATGGGACCACGTCTGTTAC (SEQ ID No. 7); CD200-Reverse: GCGGAACTGAAAACCAATAGC (SEQ ID No. 8); ITGA6-Forward: TGCACGCGGATCGAGTTTGA (SEQ ID No. 9); ITGA6-Reverse: AACACCGCCCAAAGATGTCTCG (SEQ ID No. 10); KRT15-Forward: TGCAGTCCCAGCTCAGCATG (SEQ ID No. 11); KRT15-Reverse: ATGCCAATGCCAGCCATCTT (SEQ ID No. 12); KRT14-Forward: TGTGGAAGCCGACATCAATG(SEQ ID No. 13); KRT14-Reverse: CTCTCAGGGCATTCATCTCC (SEQ ID No. 14); GJB2-Forward: AGGAGATCAAAACCCAGAAGG (SEQ ID No. 15); and GJB2-Reverse: AAGACGTACATGAAGGCGG (SEQ ID No. 16)) specific for the markers to perform an RT-PCR experiment.

[0088] Further, a long-term culture capacity was confirmed by calculating the doubling-time of each cell line at each subculture (passage), and after each cell line was seeded on a 3T3J2 feeder at 2500 cell/well (6 well plate), and then cultured for 7 days, the formation of colonies was confirmed by performing crystal violet staining as follows:

[0089] after the colonies were fixed with 10% formaldehyde or 4% paraformaldehyde for 20 minutes, and then washed twice with distilled water, the colonies were reacted for 20 minutes using a 0.05% crystal violet solution, washed approximately ten times with water, and dried overnight, and then the colonies were observed under a microscope or with the naked eye.

[0090] As a result, the expression of keratinocyte stem cell specific markers ANGPTL2, CD200, ITGA6, KRT15, KRT14, and GJB2 could be confirmed, and thus, it was confirmed that the colonies were reprogrammed into keratinocyte stem cells (FIG. 2B). In addition, during the continuous subculture, the reprogrammed keratinocyte stem cells established through the BN combination could maintain the growth rate and cell state for a longer period of time than the other combinations (BNK, NK, or N) (FIGS. 2C and 2D). In order to confirm stem cell properties of the established reprogrammed keratinocyte stem cell lines, a colony-forming experiment was performed, and it was confirmed that the reprogrammed keratinocyte stem cell lines established by the BN combination could maintain stem cell properties for a longer period of time than the BNK combination (FIG. 2E).

Example 4: Confirmation of Differentiation Potential of Reprogrammed Keratinocyte Stem Cells

[0091] After the reprogrammed keratinocyte stem cell lines established in Example 3 were cultured in the medium to which 1.2 mM Ca.sup.2+ was added in Example 3 for 7 days, a differentiation experiment of the reprogrammed keratinocyte stem cells was performed. In order to confirm the differentiation into keratinocytes, by using a qPCR experiment, the expression of the markers was confirmed using primers (KRT18-Forward: AGACCATGCAAAGCCTGAAC (SEQ ID No. 17); KRT18-Reverse: GCAGTCGTGTGATATTGGTGTC (SEQ ID No. 18); KRT8-Forward: CTCAGAGATCAACCGGAACA (SEQ ID No. 19); KRT8-Reverse: TTCATCAGCTCCTGGTACTCAC (SEQ ID No. 20); KRT1-Forward: TCTGGCTCTGCTGGGATCATCA (SEQ ID No. 21); KRT1-Reverse: TCCGACTTCCAAATCCACCACC (SEQ ID No. 22); Involucrin-Forward: CTCCTCCAGTCAATACCCATCAG (SEQ ID No. 23); Involucrin-Reverse: ACATTCTTGCTCAGGCAGTCC (SEQ ID No. 24); Filaggrin-Forward: TTCGGCAAATCCTGAAGAATC (SEQ ID No. 25); and Filaggrin-Reverse: CTTGAGCCAACTTGAATACCATC (SEQ ID No. 26)) specific for the keratinocyte markers (ITGA6, KRT14, KRT18, KRT8, KRT1, Involucrin, and Filaggrin) at the mRNA level.

[0092] Further, the keratinocyte specific marker at the protein level was confirmed using an immunochemistry experiment. In the immunochemistry experiment, the same method as in Example 2 was performed, and for the primary antibody and the secondary antibody, the keratinocyte specific markers ITGA6, KRT14, KRT18, KRT8, KRT1, Involucrin, and Filaggrin were used.

[0093] As a result, it could be confirmed that the expression of the keratinocyte specific markers KRT1, Involucrin, and Filaggrin was improved more than that of reprogrammed keratinocyte stem cells, whereas the expression of the reprogrammed keratinocyte stem cell specific marker KRT15 was reduced (FIG. 3A). In addition, through the immunochemistry experiment, the expression of the keratinocyte specific markers ITGA6, KRT14, KRT10, and Involucrin could be confirmed at the protein level (FIG. 3B).

Example 5: Verification of Production and In Vivo Skin Regeneration Efficacy of Reprogrammed Keratinocyte Stem Cell-Derived Conditioned Medium

[0094] When confluence reached 95% or more in a 100 mm dish using the reprogrammed keratinocyte stem cell lines established in Example 3, a conditioned medium was prepared by culturing the stem cell lines in a serum-free DMEM/F12 3: 1 medium for 3 days. After preparing the conditioned medium at various percentage concentrations, the fiber cells were treated with the conditioned medium to confirm the cell growth for 5 days by a cck-8 method of treating the reprogrammed keratinocyte stem cell lines treated with the medium with a cck-8 solution for 1 hour, and then measuring absorbance at 450 nm. As a result, when the cell lines were treated with the conditioned media at a concentration of 50% and 75%, the highest growth without any difference rate was exhibited, and the 50% reprogrammed keratinocyte stem cell-derived conditioned medium was used for the verification of skin regeneration efficacy (FIG. 4A).

[0095] In order to confirm the skin regeneration efficacy of the reprogrammed keratinocyte stem cell-derived conditioned medium in vitro, an in vitro scratch assay experiment was performed as follows: 710.sup.6 of confluenced fiber cells were seeded onto a 6 well-plate cells, and 6 hours later, scratches were formed using a 200-L pipette tip, and then treated with the conditioned medium to observe the migration situation of fiber cells for 12 hours by a microscope. As a result, when the fiber cells were treated with the 50% reprogrammed keratinocyte stem cell-derived conditioned medium, a much better wound closure effect was confirmed than when the fiber cells were treated with a basal medium of 3: 1 mixture of DMEM/F12 (FIGS. 4B and 4C).

Example 6: Verification of In Vivo Skin Regeneration Efficacies of Reprogrammed Keratinocyte Stem Cell-Derived Conditioned Medium

[0096] In order to verify the in vivo skin regeneration efficacies of the reprogrammed keratinocyte stem cell-derived conditioned medium, ICR mice were used. After hairs were removed from the backs of the ICR mice, an 8-mm wound was physically created on the skin. The skin regeneration situation was observed by treating each wound with an amniotic fluid-derived mesenchymal stem cell-derived conditioned medium, a 50% reprogrammed keratinocyte stem cell-derived conditioned medium, and a basal medium of 3: 1 mixture of DMEM/F12 daily for 7 days. According to the result, it could be confirmed that when the wound was treated with a 50% reprogrammed keratinocyte stem cell-derived conditioned medium, the wound recovery situation exhibited much better effects than when wound was treated with the basal medium of 3: 1 mixture of DMEM/F12, and it was confirmed that the wound recovery effect exhibited a result similar to that of the amniotic fluid-derived mesenchymal stem cell-derived conditioned medium already known to exhibit a good effect of skin regeneration (FIGS. 5A and 5B). By histologically confirming the wounds with H&E staining, it could be confirmed that when the wounds were treated with a 50% reprogrammed keratinocyte stem cell-derived conditioned medium, cicatricial tissues were formed similarly to when the wounds were treated with the amniotic fluid-derived mesenchymal stem cell-derived conditioned medium (FIG. 5C).

Example 7: Analysis of Ingredients of Reprogrammed Keratinocyte Stem Cell-Derived Conditioned Medium

[0097] In order to analyze the ingredients of the reprogrammed keratinocyte stem cell-derived conditioned medium, a cytokine array was performed using an R&D ARY007 cytokine array kit. In the reprogrammed keratinocyte stem cell-derived conditioned medium, various growth factors and cytokines such as activin A, angiogenin (ANG), coagulation factor , CXCL16, DPPIV, endostatin/collagen , a basic Fibroblast Growth Factor (bFGF), a granulocyte macrophage colony-stimulating factor (GM-CSF), an insulin-like growth factor-binding protein 1 (IGFBP-1), IGFBP-2, IL-1, IL-8, CCL2/MCP-1, CCL3/MIP1, pentraxin3 (PTX3), a platelet-derived growth factor (PDGF-AA), a placental growth factor (PIGF), Serpin B5/Maspin, Serpin E1/PAI-1, a tissue inhibitor of metalloproteinase 1 (TIMP-1), thrombospondin-1 (TSP-1), a urokinase-type plasminogen activator (uPA), and a vascular endothelial growth factor (VEGF) were confirmed as components thereof (FIG. 6).

[0098] In particular, the amounts of skin regeneration promoting growth factors PDGF-AA, bFGF, and VEGF were determined by measuring the concentrations of PDGF-AA, bFGF, and VEGF using a RayBio Human VEGF-A, PDGF-AA, bFGF ELISA kit (FIG. 7). According to the measurement, PDGF-AA, bFGF, and VEGF were present in an amount of about 5.2 pg/mL, about 9.6 pg/mL, and about 3.7 pg/mL, respectively. It could be confirmed that a skin regeneration-related protein was also included in the reprogrammed keratinocyte stem cell-derived conditioned medium.

[0099] The present invention can mass-produce personally-customized reprogrammed keratinocyte stem cells using urine cells known as somatic cells which can be easily and repeatedly obtained at any time without any inconvenience and pain. Furthermore, a conditioned medium including various human growth factors prepared using the reprogrammed keratinocyte stem cells can be prepared and can also be applied to the intractable disease field which can be expanded into the skin wound healing and skin generation fields and to a technique for producing cell therapeutic agents.

[0100] It will be apparent to those skilled in the art that various modifications can be made to the above-described exemplary embodiments of the present invention without departing from the spirit or scope of the invention. Thus, it is intended that the present invention covers all such modifications provided they come within the scope of the appended claims and their equivalents.