Method For Determining the Presence of Intestinal Parasites
20230028364 · 2023-01-26
Inventors
- Juha Kirveskari (Espoo, FI)
- Pasi Piiparinen (Espoo, FI)
- Jari Hirvonen (Espoo, FI)
- Juha Saharinen (Espoo, FI)
Cpc classification
C12Q2537/143
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12Q2537/143
CHEMISTRY; METALLURGY
International classification
Abstract
This invention relates to the field of detection of intestinal parasites from patient, food or environmental samples, preferably from a stool sample. Particularly, the present invention provides a polymerase chain reaction (PCR) based assay method for detection of intestinal parasite infection, particularly the infection of parasite species selected from a group consisting of Hymenolepis nana, Hymenolepis diminuta, Fasciolopsis buski, Encephalitozoon spp. (such as E. intestinalis, E. cuniculi and E. hellem), Enterocytozoon bieneusi, Enterobius vermicularis, Diphyllobothrium latum, Diphyllobothrium nihonkaiense, Schistosoma mansoni, Blastocystis hominis, Ancylostoma duodenale and liver worms, such as Clonorchis sinensis, Opisthorchis spp., and Metorchis spp. The present invention further provides materials such as primers, primer pairs and probes for use in the method of the invention. Preferably, the method of the invention is a multiplex real-time PCR assay for rapid determination of clinically important intestinal parasites.
Claims
1. A method for detecting the presence or absence of one or more intestinal parasites in a biological sample comprising the steps of: i) contacting the sample or nucleic acid isolated therefrom with a set of oligonucleotide primers comprising one or more primer pairs that binds to a target sequence selected from SEQ ID NOs: 1-16 and 46-47 and allow amplification of at least part of the target sequence in step ii); ii) performing a nucleic acid amplification reaction to specifically amplify the target sequences of the intestinal parasite(s) in the sample; and iii) detecting the presence of an amplified target sequence, wherein the presence of the target sequence is indicative of the presence of one or more intestinal parasites in the sample, wherein the one or more intestinal parasites is selected from Hymenolepis nana, Hymenolepis diminuta, Fasciolopsis buski, Encephalitozoon spp., Enterocytozoon bieneusi, Enterobius vermicularis, Diphyllobothrium latum, Diphyllobothrium nihonkaiense, Schistosoma mansoni, Blastocystis hominis, Ancylostoma duodenale and liver worms.
2. The method according to claim 1, wherein the set of oligonucleotide primers comprises one or more primer pairs selected from of: a) a primer pair for detecting Hymenolepis nana and Hymenolepis diminuta comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AATTCCTGATGCTTTTGGGTTTTATG (SEQ ID NO:17) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AGAACACTGCCGTCTTTACATCTAA (SEQ ID NO:18); b) a primer pair for detecting Hymenolepis nana and Hymenolepis diminuta comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AATTCCTGATGCTTTTGGGTTTTATG (SEQ ID NO:17) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AAATACAGCCGTCTTAACATCCAA (SEQ ID NO:19); c) a primer pair for detecting Fasciolopsis buski comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CACTGTTCAAGTGGTATTGATTG (SEQ ID NO:20) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CCAGGTTATCAGTCCTACCC (SEQ ID NO:21); d) a primer pair for detecting E. intestinalis, E. cuniculi, and E. hellem comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CTGAGTCCTGAGTGTTAGATAAGA (SEQ ID NO:22) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CTAATGCCAATCAATCCCGTG (SEQ ID NO:23); e) a primer pair for detecting E. intestinalis, E. cuniculi, and E. hellem comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of GTCCTTCGTGTTAGATAAGATATAAGTC (SEQ ID NO:24) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AGATAATGCCAATCAATCCCATG (SEQ ID NO:25); f) a primer pair for detecting E. intestinalis, E. cuniculi, and E. hellem comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of GACGAAGATTGAGAGGTCTGA (SEQ ID NO:26) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CTAATGCCTATCAATCCCGTG (SEQ ID NO:27); g) a primer pair for detecting Enterocytozoon bieneusi comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of GAGTGTAGTATAGACTGGCGAA (SEQ ID NO:28) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of TCGTCCTTGATCCTAAGATACG (SEQ ID NO:29); h) a primer pair for detecting Enterobius vermicularis comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of GCAGAGCTTTTCCAAAATTTATTTCC (SEQ ID NO:30) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CCCAAGTTTGAGGTAATTTCTCG (SEQ ID NO:31); i) a primer pair for detecting Diphyllobothrium latum and Diphyllobothrium nihonkaiense comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CCAGTTATTACTGGTGTAAGATTGAA (SEQ ID NO:32) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of TCAAGCATAACCTGACTCATATAC (SEQ ID NO:33); j) a primer pair for detecting Diphyllobothrium latum and Diphyllobothrium nihonkaiense comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CCAGTTATTACTGGTGTAAGATTGAA (SEQ ID NO:34) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of TCAAGCATAACCTGACTCATATAC (SEQ ID NO:35); k) a primer pair for detecting Diphyllobothrium latum and Diphyllobothrium nihonkaiense comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CCAGTTATTACAGGTGTGAGATTG (SEQ ID NO:36) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CAAGCATAACCCGACTCGTA (SEQ ID NO:37); l) a primer pair for detecting Diphyllobothrium latum and Diphyllobothrium nihonkaiense comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CCAGTTATTACAGGTGTGAGATTG (SEQ ID NO:36) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CAAGCATAACCCGACTCGTA (SEQ ID NO:37); m) a primer pair for detecting Schistosoma mansoni comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AGGTGTTTTCATGACTTTATATGTTGA (SEQ ID NO:38) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AGCAGATGCAGATAAAGCCA (SEQ ID NO:39); n) a primer pair for detecting Blastocystis hominis comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CAGCTTTCGATGGTAGTGTATTG (SEQ ID NO:40) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of GGCTCCCTCTCCGAAATC (SEQ ID NO:41); o) a primer pair for detecting Blastocystis hominis comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of TCAGCTTTCGATGGTAGTATATGG (SEQ ID NO:42) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of GGCTCCCTCTCCGAAATC (SEQ ID NO:43); p) a primer pair for detecting liver worms comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AGCTCGTAGTTGGATCTGG (SEQ ID NO:44) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CCACCAATCATGCTAACACC (SEQ ID NO:45); q) a primer pair for detecting Ancylostoma duodenale comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CAGTGTAGCTTGTGGCAC (SEQ ID NO:48) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CAGCTAACGTACATGTTGCAATA (SEQ ID NO:49); and r) a primer pair for detecting Ancylostoma duodenale comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of ACAGTGCAGCTTGTGGCA (SEQ ID NO:50) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CAGCCAACGTACATGTTGCAATA (SEQ ID NO:51).
3. The method according to claim 2, wherein the set of oligonucleotides comprises primer pairs (a)-(p).
4. The method according to claim 3, wherein the forward and reverse primers of primer pairs (a)-(p) consist of at least 15 contiguous nucleotides of the nucleotide sequences of SEQ ID NOS: 17-45, respectively.
5. (canceled)
6. The method according to claim 1, wherein said biological sample is a stool sample or a food sample.
7. (canceled)
8. The method according to claim 2, wherein wherein the method comprises contacting the product of the nucleic acid amplification reaction with one or more probes selected from: a) a probe for detecting Hymenolepis nana and Hymenolepis diminuta comprising or consisting of a sequence that is identical or complementary to at least 10 consecutive nucleotides of 5′-AGTGTGCTTAGGTTGTAGTGTGTGGGCTCATC-3′ (SEQ ID NO:52); b) a probe for detecting Hymenolepis nana and Hymenolepis diminuta comprising or consisting of a sequence that is identical or complementary to at least 10 consecutive nucleotides of 5′-TGTTTGCCATGTTTTCTATTGTTTGTTTAGG-3′ (SEQ ID NO:53); c) a probe for detecting Fasciolopsis buski comprising or consisting of a sequence that is identical or complementary to at least 10 consecutive nucleotides of 5′-TTCGCCCATTCTTTGCCATTGCCC-3′ (SEQ ID NO:54); d) a probe for detecting E. intestinalis, E. cuniculi, and E. hellem comprising or consisting of a sequence that is identical or complementary to at least 10 consecutive nucleotides of 5′-CTGATCCTGCTGCTGGTTCTCCAACAG-3′ (SEQ ID NO:55); e) a probe for detecting E. intestinalis, E. cuniculi, and E. hellem comprising or consisting of a sequence that is identical or complementary to at least 10 consecutive nucleotides of 5′-ATGATCCTGCTAATGGTTCTCCAACAGCA-3′ (SEQ ID NO:56); f) a probe for detecting E. intestinalis, E. cuniculi, and E. hellem comprising or consisting of a sequence that is identical or complementary to at least 10 consecutive nucleotides of 5′-ATGATCCTGCTAATGGTTCTCCAACAGCA-3′ (SEQ ID NO:57); g) a probe for detecting Enterocytozoon bieneusi comprising or consisting of a sequence that is identical or complementary to at least 10 consecutive nucleotides of 5′-AGTGTCGCCTTCGCCTCCGTTAG-3′ (SEQ ID NO:58); h) a probe for detecting Enterobius vermicularis comprising or consisting of a sequence that is identical or complementary to at least 10 consecutive nucleotides of 5′-TCCGGCTCAGACATGAACATCAGTGAGTCT-3′ (SEQ ID NO:59); i) a probe for detecting Diphyllobothrium latum and Diphyllobothrium nihonkaiense comprising or consisting of a sequence that is identical or complementary to at least 10 consecutive nucleotides of 5′-ACACGACGTGGTAAACCGCACACA-3′ (SEQ ID NO:60); j) a probe for detecting Diphyllobothrium latum and Diphyllobothrium nihonkaiense comprising or consisting of a sequence that is identical or complementary to at least 10 consecutive nucleotides of 5′-ACACGACGTGGTAAACCGCACACA-3′ (SEQ ID NO:61); k) a probe for detecting Diphyllobothrium latum and Diphyllobothrium nihonkaiense comprising or consisting of a sequence that is identical or complementary to at least 10 consecutive nucleotides of 5′-ACACGACGTGGTAAACCGCACACA-3′ (SEQ ID NO:62); l) a probe for detecting Diphyllobothrium latum and Diphyllobothrium nihonkaiense comprising or consisting of a sequence that is identical or complementary to at least 10 consecutive nucleotides of 5′-ACACGACGTGGTAAACCGCACACA-3′ (SEQ ID NO:63); m) a probe for detecting Schistosoma mansoni comprising or consisting of a sequence that is identical or complementary to at least 10 consecutive nucleotides of 5′-CCCCTGTGACACCACCAACCGT-3′ (SEQ ID NO:64); n) a probe for detecting Blastocystis hominis comprising or consisting of a sequence that is identical or complementary to at least 10 consecutive nucleotides of 5′-AAATTCTTCGTTACCCGTTACTGCCATGGT-3′ (SEQ ID NO:65); o) a probe for detecting Blastocystis hominis comprising or consisting of a sequence that is identical or complementary to at least 10 consecutive nucleotides of 5′-AAATTCTTCGTTACCCGTTACTGCCATGGT-3′ (SEQ ID NO:66); p) a probe for detecting liver worms comprising or consisting of a sequence that is identical or complementary to at least 10 consecutive nucleotides of 5′-TTGCTCGTATTCCTGGCCTGGTTCA-3′ (SEQ ID NO:67).
9. (canceled)
10. The method according to claim 1, wherein the method comprises detecting the presence or absence of at least Hymenolepis nana, Hymenolepis diminuta and liver worms, and wherein the target sequences comprise at least SEQ ID Nos: 1, 2 and 16.
11. The method according to claim 10, wherein the set of oligonucleotide primers comprises: a) a primer pair for detecting Hymenolepis nana and Hymenolepis diminuta comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AATTCCTGATGCTTTTGGGTTTTATG (SEQ ID NO:17) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AGAACACTGCCGTCTTTACATCTAA (SEQ ID NO:18); a primer pair for detecting Hymenolepis nana and Hymenolepis diminuta comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AATTCCTGATGCTTTTGGGTTTTATG (SEQ ID NO:17) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AAATACAGCCGTCTTAACATCCAA (SEQ ID NO:19); and c) a primer pair for detecting liver worms comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AGCTCGTAGTTGGATCTGG (SEQ ID NO:44) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CCACCAATCATGCTAACACC (SEQ ID NO:45).
12. The method according to claim 1, wherein the method comprises detecting the presence or absence at least Enterocytozoon bieneusi, Enterobius vermicularis, and Schistosoma mansoni, and wherein the target sequences comprise SEQ ID Nos: 7, 8 and 13.
13. The method according to claim 12, wherein the set of oligonucleotide primers comprises: a) a primer pair for detecting Enterocytozoon bieneusi comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of GAGTGTAGTATAGACTGGCGAA (SEQ ID NO:28) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of TCGTCCTTGATCCTAAGATACG (SEQ ID NO:29); b) a primer pair for detecting Enterobius vermicularis comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of GCAGAGCTTTTCCAAAATTTATTTCC (SEQ ID NO:30) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CCCAAGTTTGAGGTAATTTCTCG (SEQ ID NO:31); and c) a primer pair for detecting Schistosoma mansoni comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AGGTGTTTTCATGACTTTATATGTTGA (SEQ ID NO:38) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AGCAGATGCAGATAAAGCCA (SEQ ID NO:39).
14. (canceled)
15. (canceled)
16. (canceled)
17. A composition comprising a set of oligonucleotide primers and probes, wherein the probes each comprise a detectable label, and wherein the set of primers comprises one or more primer pairs selected from: a) a primer pair for detecting Hymenolepis nana and Hymenolepis diminuta comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AATTCCTGATGCTTTTGGGTTTTATG (SEQ ID NO:17) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AGAACACTGCCGTCTTTACATCTAA (SEQ ID NO:18); b) a primer pair for detecting Hymenolepis nana and Hymenolepis diminuta comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AATTCCTGATGCTTTTGGGTTTTATG (SEQ ID NO:17) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AAATACAGCCGTCTTAACATCCAA (SEQ ID NO:19); c) a primer pair for detecting Fasciolopsis buski comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CACTGTTCAAGTGGTATTGATTG (SEQ ID NO:20) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CCAGGTTATCAGTCCTACCC (SEQ ID NO:21); d) a primer pair for detecting E. intestinalis, E. cuniculi, and E. hellem comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CTGAGTCCTGAGTGTTAGATAAGA (SEQ ID NO:22) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CTAATGCCAATCAATCCCGTG (SEQ ID NO:23); e) a primer pair for detecting E. intestinalis, E. cuniculi, and E. hellem comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of GTCCTTCGTGTTAGATAAGATATAAGTC (SEQ ID NO:24) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AGATAATGCCAATCAATCCCATG (SEQ ID NO:25); f) a primer pair for detecting E. intestinalis, E. cuniculi, and E. hellem comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of GACGAAGATTGAGAGGTCTGA (SEQ ID NO:26) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CTAATGCCTATCAATCCCGTG (SEQ ID NO:27); g) a primer pair for detecting Enterocytozoon bieneusi comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of GAGTGTAGTATAGACTGGCGAA (SEQ ID NO:28) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of TCGTCCTTGATCCTAAGATACG (SEQ ID NO:29); h) a primer pair for detecting Enterobius vermicularis comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of GCAGAGCTTTTCCAAAATTTATTTCC (SEQ ID NO:30) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CCCAAGTTTGAGGTAATTTCTCG (SEQ ID NO:31); i) a primer pair for detecting Diphyllobothrium latum and Diphyllobothrium nihonkaiense comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CCAGTTATTACTGGTGTAAGATTGAA (SEQ ID NO:32) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of TCAAGCATAACCTGACTCATATAC (SEQ ID NO:33); j) a primer pair for detecting Diphyllobothrium latum and Diphyllobothrium nihonkaiense comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CCAGTTATTACTGGTGTAAGATTGAA (SEQ ID NO:34) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of TCAAGCATAACCTGACTCATATAC (SEQ ID NO:35); k) a primer pair for detecting Diphyllobothrium latum and Diphyllobothrium nihonkaiense comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CCAGTTATTACAGGTGTGAGATTG (SEQ ID NO:36) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CAAGCATAACCCGACTCGTA (SEQ ID NO:37); l) a primer pair for detecting Diphyllobothrium latum and Diphyllobothrium nihonkaiense comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CCAGTTATTACAGGTGTGAGATTG (SEQ ID NO:36) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CAAGCATAACCCGACTCGTA (SEQ ID NO:37); m) a primer pair for detecting Schistosoma mansoni comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AGGTGTTTTCATGACTTTATATGTTGA (SEQ ID NO:38) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AGCAGATGCAGATAAAGCCA (SEQ ID NO:39); n) a primer pair for detecting Blastocystis hominis comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CAGCTTTCGATGGTAGTGTATTG (SEQ ID NO:40) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of GGCTCCCTCTCCGAAATC (SEQ ID NO:41); o) a primer pair for detecting Blastocystis hominis comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of TCAGCTTTCGATGGTAGTATATGG (SEQ ID NO:42) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of GGCTCCCTCTCCGAAATC (SEQ ID NO:43); p) a primer pair for detecting liver worms comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AGCTCGTAGTTGGATCTGG (SEQ ID NO:44) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CCACCAATCATGCTAACACC (SEQ ID NO:45); q) a primer pair for detecting Ancylostoma duodenale comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CAGTGTAGCTTGTGGCAC (SEQ ID NO:48) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CAGCTAACGTACATGTTGCAATA (SEQ ID NO:49); and r) a primer pair for detecting Ancylostoma duodenale comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of ACAGTGCAGCTTGTGGCA (SEQ ID NO:50) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CAGCCAACGTACATGTTGCAATA (SEQ ID NO:51).
18. The composition according to claim 17, wherein the set of primer pairs comprises: a) a primer pair for detecting Hymenolepis nana and Hymenolepis diminuta comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AATTCCTGATGCTTTTGGGTTTTATG (SEQ ID NO:17) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AGAACACTGCCGTCTTTACATCTAA (SEQ ID NO:18); b) a primer pair for detecting Hymenolepis nana and Hymenolepis diminuta comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AATTCCTGATGCTTTTGGGTTTTATG (SEQ ID NO:17) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AAATACAGCCGTCTTAACATCCAA (SEQ ID NO:19); and c) a primer pair for detecting liver worms comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AGCTCGTAGTTGGATCTGG (SEQ ID NO:44) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CCACCAATCATGCTAACACC (SEQ ID NO:45).
19. The composition according to claim 17, wherein the set of primer pairs comprises: a) a primer pair for detecting Enterocytozoon bieneusi comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of GAGTGTAGTATAGACTGGCGAA (SEQ ID NO:28) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of TCGTCCTTGATCCTAAGATACG (SEQ ID NO:29); b) a primer pair for detecting Enterobius vermicularis comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of GCAGAGCTTTTCCAAAATTTATTTCC (SEQ ID NO:30) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CCCAAGTTTGAGGTAATTTCTCG (SEQ ID NO:31); and c) a primer pair for detecting Schistosoma mansoni comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AGGTGTTTTCATGACTTTATATGTTGA (SEQ ID NO:38) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AGCAGATGCAGATAAAGCCA (SEQ ID NO:39).
20. The composition according to claim 17, wherein the probes comprise or consist of a sequence that is identical or complementary to at least 10 consecutive nucleotides of any of the probe sequences as set forth in SEQ ID NOS:52-67.
21. (canceled)
22. A kit for detecting the presence or absence of intestinal parasites in a sample, wherein said kit comprises a set of oligonucleotide primers and probes, wherein the probes each comprise a detectable label, and wherein the set of primers comprises one or more primer pairs selected from: a) a primer pair for detecting Hymenolepis nana and Hymenolepis diminuta comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AATTCCTGATGCTTTTGGGTTTTATG (SEQ ID NO:17) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AGAACACTGCCGTCTTTACATCTAA (SEQ ID NO:18); a primer pair for detecting Hymenolepis nana and Hymenolepis diminuta comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AATTCCTGATGCTTTTGGGTTTTATG (SEQ ID NO:17) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AAATACAGCCGTCTTAACATCCAA (SEQ ID NO:19); c) a primer pair for detecting Fasciolopsis buski comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CACTGTTCAAGTGGTATTGATTG (SEQ ID NO:20) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CCAGGTTATCAGTCCTACCC (SEQ ID NO:21); d) a primer pair for detecting E. intestinalis, E. cuniculi, and E. hellem comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CTGAGTCCTGAGTGTTAGATAAGA (SEQ ID NO:22) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CTAATGCCAATCAATCCCGTG (SEQ ID NO:23); e) a primer pair for detecting E. intestinalis, E. cuniculi, and E. hellem comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of GTCCTTCGTGTTAGATAAGATATAAGTC (SEQ ID NO:24) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AGATAATGCCAATCAATCCCATG (SEQ ID NO:25); f) a primer pair for detecting E. intestinalis, E. cuniculi, and E. hellem comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of GACGAAGATTGAGAGGTCTGA (SEQ ID NO:26) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CTAATGCCTATCAATCCCGTG (SEQ ID NO:27); g) a primer pair for detecting Enterocytozoon bieneusi comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of GAGTGTAGTATAGACTGGCGAA (SEQ ID NO:28) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of TCGTCCTTGATCCTAAGATACG (SEQ ID NO:29); h) a primer pair for detecting Enterobius vermicularis comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of GCAGAGCTTTTCCAAAATTTATTTCC (SEQ ID NO:30) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CCCAAGTTTGAGGTAATTTCTCG (SEQ ID NO:31); i) a primer pair for detecting Diphyllobothrium latum and Diphyllobothrium nihonkaiense comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CCAGTTATTACTGGTGTAAGATTGAA (SEQ ID NO:32) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of TCAAGCATAACCTGACTCATATAC (SEQ ID NO:33); j) a primer pair for detecting Diphyllobothrium latum and Diphyllobothrium nihonkaiense comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CCAGTTATTACTGGTGTAAGATTGAA (SEQ ID NO:34) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of TCAAGCATAACCTGACTCATATAC (SEQ ID NO:35); k) a primer pair for detecting Diphyllobothrium latum and Diphyllobothrium nihonkaiense comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CCAGTTATTACAGGTGTGAGATTG (SEQ ID NO:36) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CAAGCATAACCCGACTCGTA (SEQ ID NO:37); l) a primer pair for detecting Diphyllobothrium latum and Diphyllobothrium nihonkaiense comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CCAGTTATTACAGGTGTGAGATTG (SEQ ID NO:36) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CAAGCATAACCCGACTCGTA (SEQ ID NO:37); m) a primer pair for detecting Schistosoma mansoni comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AGGTGTTTTCATGACTTTATATGTTGA (SEQ ID NO:38) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of AGCAGATGCAGATAAAGCCA (SEQ ID NO:39); n) a primer pair for detecting Blastocystis hominis comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CAGCTTTCGATGGTAGTGTATTG (SEQ ID NO:40) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of GGCTCCCTCTCCGAAATC (SEQ ID NO:41); o) a primer pair for detecting Blastocystis hominis comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of TCAGCTTTCGATGGTAGTATATGG (SEQ ID NO:42) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of GGCTCCCTCTCCGAAATC (SEQ ID NO:43); p) a primer pair for detecting liver worms comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of AGCTCGTAGTTGGATCTGG (SEQ ID NO:44) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CCACCAATCATGCTAACACC (SEQ ID NO:45); q) a primer pair for detecting Ancylostoma duodenale comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of CAGTGTAGCTTGTGGCAC (SEQ ID NO:48) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CAGCTAACGTACATGTTGCAATA (SEQ ID NO:49); and r) a primer pair for detecting Ancylostoma duodenale comprising a forward primer comprising or consisting of at least 15 consecutive nucleotides of ACAGTGCAGCTTGTGGCA (SEQ ID NO:50) and a reverse primer comprising or consisting of at least 15 consecutive nucleotides of CAGCCAACGTACATGTTGCAATA (SEQ ID NO:51).
23. The kit according to claim 22, comprising other PCR reagent components selected from the group consisting of: a polymerase, nucleotides, buffer, salts, detergents and/or other additives.
24. The kit according to claim 22, further comprising one or more control primers, additional probes or nucleotide sequences.
25. The kit according to claim 22, wherein the one or more probes comprise or consist of a sequence that is identical or complementary to at least 10 consecutive nucleotides of any of the probe sequences as set forth in SEQ ID NOS:52-67.
26. The method according to claim 1, wherein the method comprises detecting the presence or absence of one or more intestinal parasites and optionally one or more controls in a multiplex real-time PCR assay.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
DETAILED DESCRIPTION OF THE EMBODIMENTS
[0027] The present invention provides a nucleic acid amplification based assay method for detection of intestinal parasites, particularly one or more intestinal parasites selected from the group consisting of Hymenolepis nana, Hymenolepis diminuta, Fasciolopsis buski, Encephalitozoon spp. (such as E. intestinalis, E. cuniculi and E. hellem), Enterocytozoon bieneusi, Enterobius vermicularis, Diphyllobothrium latum, Diphyllobothrium nihonkaiense, Schistosoma mansoni, Blastocystis hominis, Ancylostoma duodenale and liver worms, such as Clonorchis sinensis, Opisthorchis spp., and Metorchis spp. The present invention further provides materials such as primers, primer pairs (i.e. a pair of a forward primer and a reverse primer) and probes for use in the method of the invention. Particularly, the present invention provides a method for determining the presence of intestinal parasites in a biological sample comprising the steps of i) contacting the sample or nucleic acid isolated therefrom with oligonucleotide primers in an amplification assay to provide a reaction mix for nucleic acid amplification;
[0028] ii) performing a nucleic acid amplification reaction with the reaction mix obtained from step i) comprising DNA from the biological sample as a template, so that the target sequences of the intestinal parasite(s) is/are specifically amplified, whenever said sequences are present in the sample; and
[0029] iii) detecting the presence of an amplified target sequence in the reaction mix, wherein the presence of the target sequence is indicative of the presence of intestinal parasites in the sample;
[0030] wherein said target sequence(s) is/are selected from the group consisting of the sequences as defined by SEQ ID Nos: 1-16 and 46-47, wherein said oligonucleotide primers comprise a primer pair which binds to one of the target sequences as defined by SEQ ID Nos: 1-16 and 46-47 and allow amplification of at least part of the target sequence in step ii).
[0031] Said biological sample can be a stool sample, a food sample, such as a meat sample, or any environmental sample. The sample may be enriched before step i).
[0032] Preferably, said nucleic acid amplification reaction is a polymerase chain reaction (PCR). As well-known in the art, PCR is a method whereby a limited segment of a nucleic acid molecule, i.e. a target sequence, is amplified repetitively to produce a large amount of DNA molecules consisting of only that segment. The procedure depends on repetition of a large number of priming and transcription cycles. In each cycle, two oligonucleotide primers, i.e. a forward primer and a reverse primer, bind to the segment, and define the limits of the segment. A primer-dependent DNA polymerase then transcribes, or replicates, the strands to which the primers have bound. The resulting PCR products are called amplicons. In a particular example, the methods disclosed herein include the step of PCR amplifying a portion of the genome of an intestinal parasite.
[0033] “Target sequence” as defined herein is a nucleic acid segment present in the genome of a intestinal parasite whose detection, quantitation, qualitative detection, or a combination thereof, is intended. For example, the target sequence is a specific nucleic acid in intestinal parasite genome, the amplification of which is intended. Purification or isolation of a template molecule, if needed, for initiation of the amplification reaction can be conducted by methods known to those in the art. For example, isolation of the template can be achieved by using a commercially available purification kit or the like.
[0034] Preferred target sequences (or amplicons) amplified in target organisms are listed in Table 1. However, a person skilled in the art knows that these target sequences naturally vary in related strains. This minor variation can be taken into account while designing primers suitable to amplify said amplicons in the method of the present invention. Preferably, at least 20, 25, 30, 35, 40, 50, 60, 70, 80, 90 100, or 125 nucleotides long sequence of each of the target sequences selected from the group consisting of SEQ ID NOS:1-16 and 46-47 are amplified in the method.
TABLE-US-00001 TABLE 1 Target sequences (5′.fwdarw.3′) amplified in target organisms. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. Hymenolepis cox1 AATTCCTGATGCTTTTGGGTTTTATGGTTTATTATTTGCTATGTTTTCTATAGTGTGCTTA GGTTGTAGTGTGTGGGCTCATCATATGTTTACTGTTGGTTTGGATGTTAAGACGGCTGTAT TTT (SEQ ID NO: 1) Hymenolepis cox1, v2 AATTCCTGATGCTTTTGGGTTTTATGGGCTCTTGTTTGCCATGTTTTCTATTGTTTGTTTA GGTAGAAGTGTTTGAGGGCATCATATGTTTACTGTTGGTTTAGATGTAAAGACGGCAGTGT TOT (SEQ ID NO: 2) Fasciolopsis buski ITS1 CACTGTTCAAGTGGTATTGATTGGGTTCGCCCATTCTTTGCCATTGCCCTCGCATGCACCT GGTCCTTGTGGCCGGACTGCACGTACGTCGCCCGGCGGTGCCTATCCCGGGTAGGACTGAT AACCTGG (SEQ ID NO: 3) Encephalitozoon sp 18S GACGAAGATCGGAAGGTCTGAGTCCTGAGTGTTAGATAAGATATAAGTCGTAACATGGCTG CTGTTGGAGAACCAGCAGCAGGATCAGTATGTTGTTGTGTTTTGATGGATGTTTGTTTGTT TGTTTGTGGTTTCTCTGTTCACGGGATTGATTGGCATTAGCG (SEQ ID NO: 4) Encephalitozoon sp 18S v2 GACGAAGATTGGAAGGTCTGAGTCCTTCGTGTTAGATAAGATATAAGTCGTAACGCGGCTG CTGTTGGAGAACCAGCAGCAGGATCAGTATTTGAGAGATTGGGGGGAATTTTTTTGATTTG AGGATCCACGGGATTGATAGGCATTAGCA (SEQ ID NO: 5) Encephalitozoon sp 18S v3 GACGAAGATTGAGAGGTCTGAGTCTTTCGTGTTAGATAAGATATAAGTCGTAACATGGCTG CTGTTGGAGAACCAGCAGCAGGATCAGTATGTTGATTTGATTGATTTGTGGGGATTTTTAG TTTTTTAGTTTTTCTTTCTCTATCCATGGGATTGATTGGCATTATCT (SEQ ID NO: 6) Enterocytozoon bieneusi 18S GAGTGTAGTATAGACTGGCGAAGAATGAAATCTCAAGACCCAGTTTGGACTAACGGAGGCG AAGGCGACACTCTTAGACGTATCTTAGGATCAAGGACGA (SEQ ID NO: 7) Enterobius vermicularis ITS GCAGAGCTTTTCCAAAATTTATTTCCAAGCCACAGACTCACTGATGTTCATGTCTGAGCCGGAACG AGAAATTACCTCAAACTTGGG (SEQ ID NO: 8) Diphyllobothrium latum/nihonkaiense cox1 CCAGTTATTACAGGTGTGAGATTGAATAAGTATTTATTACAATGTCATTGTATAGTTTCTA ATGTTGGTTTCAATTTATGTTTTTTCCCTATGCATTACTTTGGTGTGTGCGGTTTACCACG TCGTGTGTGTGTGTACGAGTCGGGTTATGCTTGA (SEQ ID NO: 9) Diphyllobothrium latum/nihonkaiense cox1 v2 CCAGTTATTACTGGTGTAAGATTGAATAAGTATTTACTACAATGTCATTGTATAGTTTCTA ATGTTGGTTTCAATTTATGTTTTTTTCCCATGCATTATTTTGGTGTGTGCGGTTTACCACG TCGTGTGTGCGTATATGAGTCAGGTTATGCTTGA (SEQ ID NO: 10) Diphyllobothrium latum/nihonkaiense cox1 v3 CCAGTTATTACTGGTGTAAGATTGAATAAGTATTTACTACAATGTCATTGTATAGTTTCTA ATGTTGGTTTCAATTTATGTTTTTTTCCTATGCATTATTTTGGTGTGTGCGGTTTACCACG TCGTGTGTGTGTATATGAGTCAGGTTATGCTTGA (SEQ ID NO: 11) Diphyllobothrium latum/nihonkaiense cox1 v4 CCAGTTATTACTGGTGTGAGATTGAATAAGTATTTACTACAATGTCATTGTATAGTTTCTA ATGTTGGTTTCAATTTATGTTTTTTTCCTATGCATTATTTTGGTGTGTGCGGTTTACCACG TCGTGTGTGCGTATATGAGTCAGGTTATGCTTGA (SEQ ID NO: 12) Schistosoma mansoni cox1 AGGTGTTTTCATGACTTTATATGTTGAATAGTTGCGGTATGCGGGTTTTAGATCCCATAGT ATGGTGATTAGTCGGTTTTATATTTTTATTTACGGTTGGTGGTGTCACAGGGGTGGCTTTA TCTGCATCTGCT (SEQ ID NO: 13) Blastocystis hominis 18S TCAGCTTTCGATGGTAGTGTATTGGACTACCATGGCAGTAACGGGTAACGAAGAATTTGGG TTCGATTTCGGAGAGGGAGCC (SEQ ID NO: 14) Blastocystis hominis 18S v2 TCAGCTTTCGATGGTAGTATATGGGCCTACCATGGCAGTAACGGGTAACGAAGAATTTGGG TTCGATTTCGGAGAGGGAGCC (SEQ ID NO: 15) C.sinensis/Opisthorchis sp./Metorchis sp. 18S AGCTCGTAGTTGGATCTGGGTCGCATGGCTACATGCCGTTGCTCGTATTCCTGGCCTGGTT CACACCGGGACGGGTTTGTGAGTCGGTGTCGTGG (SEQ ID NO: 16) Ancylostoma duodenale ITS gB 1 CCCATGAGACATACAAAAAGGTAATGCCGCCGTCTGGTTCAGGGTTGTTTATATCTACTAC AGTGTAGCTTGTGGCACTGTTTGTCGAACGGCACTTGCTTTTAGCGATTCCCGTTCTAGAT CAGAATATATTGCAACATGTACGTTAGCTGGCTAGTTTGCTAACGTGCGCTGAATGACAGC AAACTCGTTGTTGCTGCTGAATCGTTCACCGACTTTAGAACGTTTCGGGTCTCGACTATAC GCCCGTTTTCGGATC (SEQ ID NO: 46) Ancylostoma duodenale ITS gB 2 CCCATGAGACATACAAAAAGGTAATGCCGCCTATATCTACTACAGTGCAGCTTGTGGCACT GTTTGTCGAACGGCACTTGCTTTTAGCGATTCCCGTTCTAGATCAGAATATATTGCAACAT GTACGTTGGCTGGCTAGTTTGCTAACGTGCGCTGAATGACAGCAAACTCGTTGTTGCTGCT GAATCGTTTACCGACTTTAGAACGTTTCGGGTCTCGACTATACGCCCGTTTTCGGATC (SEQ ID NO: 47)
[0035] Primer pairs, which are preferably used in the present method to amplify the target sequences are listed in Table 2.
TABLE-US-00002 TABLE 2 Examples of primer sequences (5′.fwdarw.3′) for amplification of the target sequences listed in Table 1. Primer pair A), Hymenolepis cox1 forward primer: AATTCCTGATGCTTTTGGGTTTTATG (SEQ ID NO: 17) reverse primer: AGAACACTGCCGTCTTTACATCTAA (SEQ ID NO: 18) Primer pair B), Hymenolepis cox1, v2 forward primer: AATTCCTGATGCTTTTGGGTTTTATG (SEQ ID NO: 17) reverse primer: AAATACAGCCGTCTTAACATCCAA (SEQ ID NO: 19) Primer pair C), Fasciolopsis buski ITS1 forward primer: CACTGTTCAAGTGGTATTGATTG (SEQ ID NO: 20) reverse primer: CCAGGTTATCAGTCCTACCC (SEQ ID NO: 21) Primer pair D), Encephalitozoon sp 18S forward primer: CTGAGTCCTGAGTGTTAGATAAGA (SEQ ID NO: 22) reverse primer: CTAATGCCAATCAATCCCGTG (SEQ ID NO: 23) Primer pair E), Encephalitozoon sp 18S v2 forward primer: GTCCTTCGTGTTAGATAAGATATAAGTC (SEQ ID NO: 24) reverse primer: AGATAATGCCAATCAATCCCATG (SEQ ID NO: 25) Primer pair F), Encephalitozoon sp 18S v3 forward primer: GACGAAGATTGAGAGGTCTGA (SEQ ID NO: 26) reverse primer: CTAATGCCTATCAATCCCGTG (SEQ ID NO: 27) Primer pair G), Enterocytozoon bieneusi 18S forward primer: GAGTGTAGTATAGACTGGCGAA (SEQ ID NO: 28) reverse primer: TCGTCCTTGATCCTAAGATACG (SEQ ID NO: 29) Primer pair H), Enterobius vermicularis ITS forward primer: GCAGAGCTTTTCCAAAATTTATTTCC (SEQ ID NO: 30) reverse primer: CCCAAGTTTGAGGTAATTTCTCG (SEQ ID NO: 31) Primer pair I), Diphyllobothrium latum/nihonkaiense cox1 forward primer: CCAGTTATTACTGGTGTAAGATTGAA (SEQ ID NO: 32 reverse primer: TCAAGCATAACCTGACTCATATAC(SEQ ID NO: 33) Primer pair J), Diphyllobothrium latum/nihonkaiense cox1 v2 forward primer: CCAGTTATTACTGGTGTAAGATTGAA (SEQ ID NO: 34 reverse primer: TCAAGCATAACCTGACTCATATAC(SEQ ID NO: 35) Primer pair K), Diphyllobothrium latum/nihonkaiense cox1 v3 forward primer: CCAGTTATTACAGGTGTGAGATTG (SEQ ID NO: 36) reverse primer: CAAGCATAACCCGACTCGTA (SEQ ID NO: 37) Primer pair L), Diphyllobothrium latum/nihonkaiense cox1 v4 forward primer: CCAGTTATTACAGGTGTGAGATTG (SEQ ID NO: 36) reverse primer: CAAGCATAACCCGACTCGTA (SEQ ID NO: 37) Primer pair M), Schistosoma mansoni coxl forward primer: AGGTGTTTTCATGACTTTATATGTTGA (SEQ ID NO: 38 reverse primer: AGCAGATGCAGATAAAGCCA (SEQ ID NO: 39) Primer pair N), Blastocystis hominis 18S forward primer: CAGCTTTCGATGGTAGTGTATTG (SEQ ID NO: 40) reverse primer: GGCTCCCTCTCCGAAATC (SEQ ID NO: 41) Primer pair O), Blastocystis hominis 18S v2 forward primer: TCAGCTTTCGATGGTAGTATATGG (SEQ ID NO: 42) reverse primer: GGCTCCCTCTCCGAAATC (SEQ ID NO: 43) Primer pair P), C.sinensis/Opisthorchis sp./Metorchis sp. 18S forward primer: AGCTCGTAGTTGGATCTGG (SEQ ID NO: 44) reverse primer: CCACCAATCATGCTAACACC (SEQ ID NO: 45) Primer pair Q), Ancylostoma duodenale ITS.3.1 forward primer: CAGTGTAGCTTGTGGCAC (SEQ ID NO: 48) reverse primer: CAGCTAACGTACATGTTGCAATA (SEQ ID NO: 49) Primer pair R), Ancylostoma duodenale ITS.3.2 forward primer: ACAGTGCAGCTTGTGGCA (SEQ ID NO: 50) reverse primer: CAGCCAACGTACATGTTGCAATA (SEQ ID NO: 51)
[0036] The method of the invention is characterized in that the presence of the amplified target sequence, i.e. the product, of each of primer pairs in the PCR reaction in step iv) indicates the presence of intestinal parasites in the sample in the following way: [0037] the product of primer pair A) or B) indicates the presence of Hymenolepis nana or Hymenolepis diminuta; [0038] the product of primer pair C) indicates the presence of Fasciolopsis buski; [0039] the product of primer pair D), E) or F) indicates the presence of E. intestinalis, E. cuniculi or E. hellem; [0040] the product of primer pair G) indicates the presence of Enterocytozoon bieneusi; [0041] the product of primer pair H) indicates the presence of Enterobius vermicularis; [0042] the product of primer pair I), J), K), or L) indicates the presence of Diphyllobothrium latum, or Diphyllobothrium nihonkaiense; [0043] the product of primer pair M) indicates the presence of Schistosoma mansoni; [0044] the product of primer pair N) or O) indicates the presence of Blastocystis hominis; [0045] the product of primer pair P) indicates the presence of liver worms, such as Clonorchis sinensis, Opisthorchis spp., and Metorchis spp.; and [0046] the product of primer pair Q) or R) indicates the presence of Ancylostoma duodenale.
[0047] Preferably, each primer of said primer pairs is less than 25, 30, 35, 40, 45, 50 or 55 nucleotides long, and more preferably, less than 50 nucleotides long. Each of the present primers can also be defined as comprising or consisting of at least 10, 15, 16, 17 or 18 contiguous nucleotides present in at least one primer sequence selected from the group consisting of SEQ ID NOS:17-45 and 48-51. Each of the present primers can further be defined as having at least 80%, 85%, or 90% sequence identity to at least one primer sequence selected from the group consisting of SEQ ID NOS:17-45 and 48-51.
[0048] One specific embodiment of the invention is to perform said method as a real-time polymerase chain reaction and in that case nucleic acid probes comprising or consisting of the following sequences are specifically used with each of primer pairs A) to T) in the following manner:
TABLE-US-00003 -the probe for primer pair A): (SEQ ID NO: 52) 5′-AGTGTGCTTAGGTTGTAGTGTGTGGGCTCATC-3′ -the probe for primer pair B): (SEQ ID NO: 53) 5′-TGTTTGCCATGTTTTCTATTGTTTGTTTAGG-3′ -the probe for primer pair C): (SEQ ID NO: 54) 5′-TTCGCCCATTCTTTGCCATTGCCC-3′ -the probe for primer pair D): (SEQ ID NO: 55) 5′-CTGATCCTGCTGCTGGTTCTCCAACAG-3′ -the probe for primer pair E): (SEQ ID NO: 56) 5′-ATGATCCTGCTAATGGTTCTCCAACAGCA-3′ -the probe for primer pair F): (SEQ ID NO: 57) 5′-ATGATCCTGCTAATGGTTCTCCAACAGCA-3′ -the probe for primer pair G): (SEQ ID NO: 58) 5′-AGTGTCGCCTTCGCCTCCGTTAG-3′ -the probe for primer pair H): (SEQ ID NO: 59) 5′-TCCGGCTCAGACATGAACATCAGTGAGTCT-3′ -the probe for primer pair I): (SEQ ID NO: 60) 5′-ACACGACGTGGTAAACCGCACACA-3′ -the probe for primer pair J): (SEQ ID NO: 61) 5′-ACACGACGTGGTAAACCGCACACA-3′ -the probe for primer pair K): (SEQ ID NO: 62) 5′-ACACGACGTGGTAAACCGCACACA-3′ -the probe for primer pair L): (SEQ ID NO: 63) 5′-ACACGACGTGGTAAACCGCACACA-3′ -the probe for primer pair M): (SEQ ID NO: 64) 5′-CCCCTGTGACACCACCAACCGT-3′ -the probe for primer pair N): (SEQ ID NO: 65) 5′-AAATTCTTCGTTACCCGTTACTGCCATGGT-3′ -the probe for primer pair O): (SEQ ID NO: 66) 5′-AAATTCTTCGTTACCCGTTACTGCCATGGT-3′ -the probe for primer pair P): (SEQ ID NO: 67) 5′-TTGCTCGTATTCCTGGCCTGGTTCA-3′
[0049] The melting temperature, Tm, of some of the probes (such as probes for primer pairs G), H), K) and L)) is preferably increased at least 5 degrees ° C. by addition of modified nucleotides. The amount of modified nucleotides in one probe is 1, 2, 3 or preferably 4. The underlined nucleotides in the above list are modified nucleotides each increasing the Tm of the probe. The modified nucleotide can be a LNA nucleotide (Exiqon A/S), minor groove binder (MGB™), SuperBase, or Peptide Nucleic Acid (PNA) or any other modification increasing the Tm of the probe.
[0050] Preferably, the above probes comprise the sequences as defined and are less than 25, 30, 35, 40, 45, 50 or 55 nucleotides long, and more preferably, less than 50 nucleotides long. Each of the present probes can also be defined as comprising or consisting of at least 10 or 15, 16, 17 or 18 contiguous nucleotides present in one probe sequence selected from the group consisting of SEQ ID NOS:52-67 or complements thereof.
[0051] A probe preferably includes a detectable label, such as a fluorophore. Examples of the fluorophores are fluorescein and derivatives thereof such as 6-carboxyfluorescein (FAM) and fluorescein isothiocyanate (FITC). The detectable label may produce a signal in the presence of a target amplicon, or result in a decreased signal in the presence of a target amplicon, depending on the particular construction of the probe.
[0052] The method of the invention is based on multiplex PCR technique simultaneously analyzing nucleic acids of many templates from a sample, i.e. a multiplex PCR reaction comprises a set of primer pairs capable of simultaneous amplification of various target sequences.
[0053] In a further embodiment, the invention provides nucleotide probes comprising or consisting of any of the probe sequences as defined above.
[0054] The present invention is preferably directed to a method for determining the presence of intestinal parasites in a sample, wherein the presence of at least one of the pathogens Hymenolepis nana, Hymenolepis diminuta, Fasciolopsis buski, Encephalitozoon spp. (such as E. intestinalis, E. cuniculi and E. hellem), Enterocytozoon bieneusi, Enterobius vermicularis, Diphyllobothrium latum, Diphyllobothrium nihonkaiense, Schistosoma mansoni, Blastocystis hominis, Ancylostoma duodenale and liver worms, such as Clonorchis sinensis, Opisthorchis spp., and Metorchis spp., is detected. In preferred embodiments, the presence of any combination of the above listed intestinal parasites is detected. Accordingly, each combination of 2, 3, 4, 5, 6, 7, 8 or more of said intestinal parasites is a preferred embodiment for the present invention.
[0055] In a preferred embodiment, at least the presence of Hymenolepis nana and Hymenolepis diminuta are detected in the method, wherein the target sequences are at least as defined by SEQ ID NOS: 1 and 2. More preferably, a primer pair set allowing amplification of at least part of said target sequences comprise or consist of at least 15 consecutive nucleotides of the sequences as defined in SEQ ID NOS: 17, 18, and 19.
[0056] In a preferred embodiment, at least the presence of Fasciolopsis buski is detected in the method, wherein the target sequence is at least as defined by SEQ ID NO: 3. More preferably, a primer pair set allowing amplification of at least part of said target sequences comprise or consist of at least 15 consecutive nucleotides of the sequences as defined in SEQ ID NOS: 20 and 21.
[0057] In a preferred embodiment, at least the presence of Encephalitozoon spp. (such as E. intestinalis, E. cuniculi and E. hellem) are detected in the method, wherein the target sequences are at least as defined by SEQ ID NOS:4-6. More preferably, a primer pair set allowing amplification of at least part of said target sequences comprise or consist of at least 15 consecutive nucleotides of the sequences as defined in SEQ ID NOS:22-27.
[0058] In a preferred embodiment, at least the presence of Enterocytozoon bieneusi is detected in the method, wherein the target sequence is at least as defined by SEQ ID NO:7. More preferably, a primer pair set allowing amplification of at least part of said target sequences comprise or consist of at least 15 consecutive nucleotides of the sequences as defined in SEQ ID NOS: 28 and 29.
[0059] In a preferred embodiment, at least the presence of Enterobius vermicularis is detected in the method, wherein the target sequence is at least as defined by SEQ ID NO:8. More preferably, a primer pair set allowing amplification of at least part of said target sequences comprise or consist of at least 15 consecutive nucleotides of the sequences as defined in SEQ ID NOS: 30 and 31.
[0060] In a preferred embodiment, at least the presence of Diphyllobothrium latum and Diphyllobothrium nihonkaiense are detected in the method, wherein the target sequences are at least as defined by SEQ ID NOS:9-12. More preferably, a primer pair set allowing amplification of at least part of said target sequences comprise or consist of at least 15 consecutive nucleotides of the sequences as defined in SEQ ID NOS:32-37.
[0061] In a preferred embodiment, at least the presence of Schistosoma mansoni is detected in the method, wherein the target sequence is at least as defined by SEQ ID NO:13. More preferably, a primer pair set allowing amplification of at least part of said target sequences comprise or consist of at least 15 consecutive nucleotides of the sequences as defined in SEQ ID NOS:38 and 39.
[0062] In a preferred embodiment, at least the presence of Blastocystis hominis is detected in the method, wherein the target sequences are at least as defined by SEQ ID NOS:14 and 15. More preferably, a primer pair set allowing amplification of at least part of said target sequences comprise or consist of at least 15 consecutive nucleotides of the sequences as defined in SEQ ID NOS: 40-43.
[0063] In a preferred embodiment, at least the presence of liver worms, such as Clonorchis sinensis, Opisthorchis spp., and Metorchis spp. are detected in the method, wherein the target sequence is at least as defined by SEQ ID NO:16. More preferably, a primer pair set allowing amplification of at least part of said target sequences comprise or consist of at least 15 consecutive nucleotides of the sequences as defined in SEQ ID NOS: 44 and 45.
[0064] In a preferred embodiment, the presence of at least Hymenolepis nana, Hymenolepis diminuta and liver worms Clonorchis sinensis, Opisthorchis spp., and Metorchis spp are detected in the method, wherein the target sequences are at least as defined by SEQ ID NOS:1, 2 and 16. More preferably, a primer pair set allowing amplification of at least part of said target sequences comprise or consist of at least 15 consecutive nucleotides of the sequences as defined in SEQ ID NOS:17, 18, 19, 44 and 45.
[0065] In another preferred embodiment, the presence of at least Enterocytozoon bieneusi, Enterobius vermicularis, and Schistosoma mansoni are detected in the method, wherein the target sequences are at least as defined by SEQ ID NOS:7, 8 and 13. More preferably, a primer pair set allowing amplification of at least part of said target sequences comprise or consist of at least 15 consecutive nucleotides of the sequences as defined in SEQ ID NOS:28, 29, 30, 31, 38 and 39.
[0066] In a preferred embodiment, at least the presence of Ancylostoma duodenalis is detected in the method, wherein the target sequences are at least as defined by SEQ ID NOS:46 and 47. More preferably, a primer pair set allowing amplification of at least part of said target sequences comprise or consist of at least 15 consecutive nucleotides of the sequences as defined in SEQ ID NOS: 48-51.
[0067] The present invention is further directed to the use of nucleotide primers, primer pairs or probes as defined above for determining the presence of intestinal parasites in a sample.
[0068] The present invention also provides kits for the detection of the presence of intestinal parasites in a sample. Such a kit comprises primer pairs selected from the group consisting of primer pairs as defined above. The kit may further comprise a probe selected from the probes as defined above. The use of the primer pairs and probes are described above and in the Example below. Preferably, said kit comprises means for a real-time polymerase chain reaction, such as labelled probes, polymerase enzymes, buffers and nucleotides.
[0069] Unless explained otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. The materials, methods, and examples are illustrative only and not intended to be limiting.
Example 1
[0070] This example describes results from a proof-of-concept study of the detection of Hymenolepis nana, Hymenolepis diminuta, Fasciolopsis buski, Encephalitozoon spp. (such as E. intestinalis, E. cuniculi and E. hellem), Enterocytozoon bieneusi, Enterobius vermicularis, Diphyllobothrium latum, Diphyllobothrium nihonkaiense, Schistosoma mansoni, Blastocystis hominis and liver worms, such as Clonorchis sinensis, Opisthorchis spp., and Metorchis spp. in a proprietary multiplex qPCR assay. Sample material for this designed assay is a spiked stool sample.
[0071] Materials and Methods
[0072] qPCR Reagents:
[0073] Mobidiag's qPCR Mastermix (MM)
[0074] Assay mixture consisting of parasite target specific primers as defined in Table 2 and probes as defined above.
[0075] Devices:
[0076] BIO-RAD CFX96
[0077] PCR Setup
[0078] In reaction:
##STR00001##
[0079] PCR Protocol:
TABLE-US-00004 95° C. 10 min 45x 95° C. 15 s 63° C. 1 min
[0080] Two-step qPCR with detection by labelled probes.
[0081] Samples:
[0082] Spiked samples, representing the pathogens listed above, in a stool background. Samples have been collected from commercially available biobanks (such as ATCC) or from Mobidiag sample storage facilities and the analyses are performed in a series of ten-fold sample dilutions.
[0083] Results
[0084] All targets were detected in all sample concentrations in a high multiplexing condition (
Example 2
[0085] This example describes results from a study of potential false positive results in the intestinal parasites qPCR assay due to a cross-reaction. Sample material for this designed assay is preferably stool sample. Therefore, pathogens other than parasites (bacteria and viruses) associated with gastrointestinal infections, and which are not covered by assay panel, can cause potential cross-reaction. Also, other eukaryotic microbes may cross-react.
[0086] Materials and Methods
[0087] qPCR Reagents:
[0088] Mobidiag's qPCR Mastermix (MM)
[0089] Assay mixture consisting of parasite target specific primers as defined in Table 2 and probes as defined above.
[0090] Devices:
[0091] BIO-RAD CFX96
[0092] PCR Setup
[0093] In reaction:
10 μl2×MM
5 μl 4×Primer mix
2 μl sample/H2O
20 μl
[0094] PCR Protocol
[0095] A two-step qPCR with detection by labelled probes:
TABLE-US-00005 95° C. 10 min 45x 95° C. 15 s 63° C. 1 min
[0096] Samples:
[0097] In total, 61 living or attenuated microbes or extracted DNA samples from different micro-organisms (Table 3). Strains have been mainly collected from commercially available biobanks (ATCC, DSMZ, Microbiologics Qnostics and Vircell). All samples are analysed at high (>10.sup.8 CFU/mL) concentrations.
TABLE-US-00006 TABLE 3 Cross-reaction results. Target Result Acanthamoeba castellanii Negative Neospora caninum Negative Perkinsus marinus Negative Prototheca wickerhamii Negative Tetrahymena thermophila Negative Aspergillus fumigatus Negative Debaryomyces hansenii Negative Eremothecium gossypii Negative Malassezia globosa Negative Malassezia pachydermatis Negative Penicillium rubens Negative Saprolegnia diclina Negative Trichoderma reesei Negative Trichophyton interdigitale Negative Geotrichum candidum Negative Iodamoeba butschlii Negative Endolimax nana Negative Entamoeba coli Negative Entamoeba dispar Negative Plasmodium falciparum Negative Plasmodium malariae Negative Aspergillus fumigatus Negative Candida albicans Negative Candida glabrata Negative Candida krusei Negative Fusarium solani Negative Saccharomyces cervisiae Negative Aeromonas hydrophila Negative Escherichia coli, non toxigenic Negative Escherichia coli, EAEC Negative Escherichia coli, EIEC Negative Escherichia coli, EPEC Negative Escherichia coli, ETEC Negative Bacillus cereus Negative Bacteroides fragilis Negative Campylobacter coli Negative Campylobacter jejuni Negative Clostridium difficile Negative Clostridium perfringens Negative Clostridium sordellii Negative Enterobacter cloacae Negative Enterococcus faecalis Negative Enterococcus faecium Negative Helicobacter pylori Negative Klebsiella pneumoniae Negative Lactobacillus acidophilus Negative Proteus vulgaris Negative Pseudomonas aeruginosa Negative Salmonella enterica subsp. enterica, Typhimurium Negative Shigella sonnei Negative Serratia marcescens Negative Staphylococcus aureus Negative Staphylococcus epidermidis Negative Streptococcus bovis Negative Vibrio parhaemolyticus Negative Yersinia enterocolitica subsp. enterocolitica Negative Yersinia pseudotuberculosis Negative Cytomegalovirus Negative Human herpesvirus 1 Negative Human herpesvirus 2 Negative Human adenovirus 41 Negative
[0098] Results
[0099] The cross-reactivity test showed no false positives (see Table 3 above).
Example 3
[0100] For the experiment, two set of samples were used: a set of (n=8) known Encephalitozoon spp. positive samples from clinical origin (one per patient) and a set of (n=104) stool samples negative for Encephalitozoon spp. (see Table 4). Positive samples were prepared by spiking the known strains into negative stool background in clinically relevant concentrations. In total, 120 Novodiag cartridges (Mobidiag, Finland) were run.
[0101] Sample Quantitation
[0102] The known Encephalitozoon samples from commercially available biobank (ATCC) were quantified in CFX96 qPCR instrument against known standard DNA sample of the same target diluted in a 10-fold fashion. The standard series ranged from 200 to 200 000 c/μL. The final “clinical” samples were prepared by spiking the primary Encephalitozoon spp. samples into eSwab-stool-suspension in clinically relevant concentration (ranging from 100 to 80 000 cells/mL).
[0103] Sample Analysis
[0104] Each sample (positive and negative) were pre-treated and run in the Novodiag instrument.
TABLE-US-00007 TABLE 4 Samples ATTC Number Comment E. intestinalis {sample 1) ATCC 50651 From clinical origin E. intestinalis (sample 2) ATCC 50507 From clinical origin E. intestinalis (sample 3) ATCC 50506 From clinical origin E. cuniculi (sample 4) ATCC 50503 From clinical origin E. cuniculi (sample 5) ATCC 50789 From clinical origin E. cuniculi (sample 6) ATCC 50612 From clinical origin E. hellem (sample 7) ATCC 50504 From clinical origin E. hellem (sample 8) ATCC 80451 From clinical origin Samples (n = 104) negative N/A Clinical pseudonymised for Encephalitozoon spp. left-over samples and MDE biobank samples
[0105] Oligonucleotides
[0106] Encephalitozoon Assay mix comprised the following oligonucleotides:
[0107] Encephalitozoon_sp_18S_F3.1 (SEQ ID NO:22)
[0108] Encephalitozoon_sp_18S_F3.2 (SEQ ID NO:24)
[0109] Encephalitozoon_sp_18S_F3.3 (SEQ ID NO:26)
[0110] Encephalitozoon_sp_18S_P2.1 as
[0111] Encephalitozoon_sp_18S_P2.2 as
[0112] Encephalitozoon_sp_18S_R2.1 (SEQ ID NO:23)
[0113] Encephalitozoon_sp_18S_R2.2 (SEQ ID NO:25)
[0114] Encephalitozoon_sp_18S_R2.3 (SEQ ID NO:27)
[0115] Results
[0116] The results of positive samples with cell count approximation are presented in Table 5 below:
TABLE-US-00008 Copies/mL converted Clinically relevant Detected into cells/ml concentrations (conc. yielding (conversion commonly Encephalitozoon samples: positive call) factor 11).sup.1 found in stools.sup.2, 3 E. intestinalis ATCC 50651 32000 c/mL ~3000 cells/mL 230-78000 cells/mL E. intestinalis ATCC 50507 6400 c/mL ~600 cells/mL 231-78000 cells/mL E. cuniculi ATCC 50503 1800 c/mL ~200 cells/mL 100-1000 cells/mL E. hellem ATCC 50504 1900 c/mL ~200 cells/mL 180-3600 cells/mL E. hellem ATCC 50451 32000 c/mL ~3000 cells/mL 180-3600 cells/mL E. intestinalis ATCC 50506 3500 c/mL ~300 cells/mL 231-78000 cells/mL E. cuniculi ATCC 50789 3500 c/mL ~300 cells/mL 100-1000 cells/mL E. cuniculi ATCC 50612 1800 c/mL ~200 cells/mL 100-1000 cells/mL .sup.1Conversion factor 11 comes from the number of copies of 18S genes found in Encephalitozoon spp. nuclei. Biderre C, Peyretaillade E, Duffieux F, Peyret P, Méténier G, Vivarès C. The rDNA Unit of Encephalitozoon cuniculi (Microsporidia): Complete 23S Sequence and Copy Number. J Eukaryot Microbiol. Nov-Dec 1997; 44(6): 76S. .sup.2 Graczyk TK, Johansson MA, Tamang L, Visvesvara GS, Moura LS, DaSilva AJ, Girouard AS, Matos O. Retrospective Species Identification of Microsporidian Spores in Diarrheic Fecal Samples from Human Immunodeficiency Virus/AIDS Patients by Multiplexed Fluorescence In Situ Hybridization. J Clin Microbiol. 2007 Apr; 45(4): 1255-60. .sup.3 Kahler AM, Thurston-Enriquez JA. Human pathogenic microsporidia detection in agricultural samples: method development and assessment. Parasitol Res. 2007 Feb; 100(3): 529-38.
[0117] The final results are summarized below in Table 6:
TABLE-US-00009 Novodiag NVD Stool Parasites results Sens Spec PPV NPV Accuracy Targets TP FP FN TN (95% CI) (95% CI) (95% CI) (95% CI) (95% CI) Encephalitozoon spp. 8 0 0 104 100% 100% 100% 100% 100% (63.1-100%) (96.5-100%) (63.1-100%) (96.5-100%) (96.8-100%) E. cuniculi 3 0 0 104 100% 100% 100% 100% 100% (29.2-100%) (96.5-100%) (29.2-100%) (96.5-100%) (96.6-100%) E. hellem 2 0 0 104 100% 100% 100% 100% 100% (15.8-100%) (96.5-100%) (15.8-100%) (96.5-100%) (96.6-100%) E. intestinalis 3 0 0 104 100% 100% 100% 100% 100% (29.2-100%) (96.5-100%) (29.2-100%) (96.5-100%) (96.6-100%)
[0118] Overall sensitivity and specificity of the assay for detection of Encephalitozoon spp. with spiked and Encephalitozoon spp. negative stool samples was 100% (95% CI 63.1-100%) and 100% (95% CI 96.5-100%), respectively.
[0119] Overall positive predictive value (PPV) and negative predictive value (NPV) was 100% (95% CI 63.1-100%) and 100% (95% CI 96.5-100%), respectively.
Example 4
[0120] This experiment was conducted with Ancylostoma duodenale primers as described in SEQ ID NOS:48-51 and the results were compared to the reference O&P microscopic method.
[0121] The final results are:
TABLE-US-00010 Novodiag NVD Stool Parasites results vs. O&P microscopy Sens Spec PPV NPV Accuracy Target TP FP FN TN (95% CI) (95% CI) (95% CI) (95% CI) (95% CI) PLR NLR Ancylostoma 3 0 0 93 100% 100% 100% 100% 100% N/A 0 duodenale (29.2-100%) (96.1-100%) (29.2-100%) (96.1-100%) (96.2-100%) PLR = Positive Likelihood Ratio. Since no clinical data were obtained for this study, the likelihood ratio and correctness are estimations only. NLR = Negative Likelihood Ratio. Since no clinical data were obtained for this study, the likelihood ratio and correctness are estimations only. N/A = cannot be calculated since sens. and spec. are 100%.
[0122] Overall sensitivity and specificity of the NVD SP assay for detection of Ancylostoma duodenale from unpreserved stool samples was 100% (95% CI 29.2-100%) and 100% (95% CT 96.1-100%), respectively.
[0123] Overall PPV and NPV was 100% (95% CI 29.2-100%) and 100% (95% CI 96.1-100%), respectively.
[0124] One invalid run was observed from the sample set (1/96) yielding 1% invalidity rate.
REFERENCES
[0125] Garcia, Lynne S., Michael Arrowood, Evelyne Kokoskin, Graeme P. Paltridge, Dylan R. Pillai, Gary W. Procop, Norbert Ryan, Robyn Y. Shimizu, and Govinda Visvesvarab, Laboratory Diagnosis of Parasites from the Gastrointestinal Tract, Clinical Microbiology Reviews, January 2018, Volume 31, Issue 1, e00025-17.