A GENETIC STRAIN FOR PRODUCING 3-AMINOISOBUTYRIC ACID

20230028933 · 2023-01-26

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention discloses a S-adenosyl-L-methionine δ24-sterol-C-methyltransferase mutant C24MTgm-M11. Strain MG1655 (ΔptsG ΔfumAC ΔfumB, panD, aspA, C24MTgm) is constructed based on the polynucleotide encoding the enzyme mutant. Strain MG1655 (Δpts GΔfumAC ΔfumB, panD, aspA, C24MTgm-M11) can produce 480 mg/L 3-aminoisobutyric acid under shake flask fermention. Compared to the wild type strain C24MTgm, the strain containing mutant C24MTgm-M11 has a significantly improved ability to produce 5.8 times' 3-aminobutyric acid.

    Claims

    1. A methyltransferase enzyme mutant C24MTgm-M11, which is derived from a wild type enzyme C24MTgm of SEQ ID NO: 1, wherein proline 135 is replaced by alanine, leucine 136 is replaced by alanine and phenylalanine 213 is replaced by serine.

    2. The methyltransferase enzyme mutant C24MTgm-M11 according to claim 1, comprising the amino acid sequence of SEQ ID NO: 3.

    3. The methyltransferase enzyme mutant C24MTgm-M11 according to claim 1, wherein the methyltransferase enzyme mutant C24MTgm-M11 is encoded by a polynucleotide comprising nucleic acid sequence of SEQ ID NO: 4.

    4. The methyltransferase enzyme mutant C24MTgm-M11 according to claim 3, wherein the polynucleotide is located on an expression vector.

    5. The expression vector according to claim 4, wherein the expression vector is pSU-laclqTrc-C24MTgm-M11 plasmid.

    6. A host cell comprising the expression vector of claim 4.

    7. The host cell according to claim 6, wherein the host cell is E coli MG1655 (ΔptsG ΔfumAC ΔfumB, panD, aspA, C24MTgm-M11).

    8. (canceled)

    9. (canceled)

    10. (canceled)

    11. (canceled)

    12. A use of the host cell of claim 6.

    13. The use of claim 12, wherein the host cell is E coli MG1655 (ΔptsG ΔfumAC ΔfumB, panD, aspA, C24MTgm-M11).

    14. The use of claim 13, wherein the use is for producing 3-aminoisobutyric acid.

    15. The use of claim 14, wherein the production of 3-aminoisobutyric acid is through fermentation.

    16. The use of claim 14, wherein the use comprises following steps: inoculating the host cell of claim 13 into a culture medium, and then adding glucose as a substrate, wherein glucose is converted to form 3-aminoisobutyric acid by the host cell.

    17. The use of claim 15, wherein the culture medium consists of following: (NH4)2S4 15 g/L, KH2PO4 5.0 g/L, Na2HPO4.Math.12H2O 15 g/L, MgSO4.Math.7H2O 1.0 g/L, yeast extract 1.0 g/L, glucose 20 g/L, pH 7.0.

    Description

    FIGURES

    [0026] FIG. 1: The structure of expression plasmid pSU-lacIqTrc-C24MTgm-M11 constructed by the present invention for the C24MTgm-M11 gene.

    DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

    [0027] While the present disclosure is capable of being embodied in various forms, the description below of several embodiments is made with the understanding that the present disclosure is to be considered as an exemplification of the claimed subject matter, and is not intended to limit the appended claims to the specific embodiments illustrated and/or described, and should not be construed to limit the scope or breadth of the present disclosure. The headings used throughout this disclosure are provided for convenience only and are not to be construed to limit the claims in any way. Embodiments illustrated under any heading may be combined with embodiments illustrated under any other heading.

    Definitions

    [0028] The present invention relates to the addition amount, content and concentration of various substances, wherein the percentages are referred to as mass percentages unless otherwise specified.

    [0029] In the present invention, the term “E.coli MG1655”, “original strain MG1655” have the same meaning and refer to the original strain which has not been genetically engineered.

    [0030] In the present invention, the term “gene knockout strain MG1655” and “MG1655(ΔptsG ΔfumAC ΔfumB)” have the same meaning and refer to the strain in which the ptsG, fumAC, fumB genes have been knocked out in the E. coli MG1655 genome.

    [0031] C24MTgm-M11 mutant in the present invention is S-adenosyl-L-methionine δ24-sterol-C-methyltransferase mutant constructed from wild-type S-adenosyl-L-methionine δ24- sterol-C-methyltransferase (C24MTgm). It is a new protein with several individual amino acids replaced in the SEQ ID NO: 1. Therefore, the term “C-methyltransferase” herein may also be referred to as “S-adenosyl-L-methionine δ24-sterol-methyltransferase mutant”, which means the same meaning and can be used interchangeably.

    [0032] The C24MTgm-M11 mutant from soybean was obtained by a rationally designed directed evolution method. C24MTgm-M11 mutant, which is derived form a wild type C24MTgm, wherein proline is replaced by alanine at position 135, leucine is replaced by alanine at position 136 and phenylalanine is replaced by serine at position 213. After the above steps, and a mutant having the amino acid sequence of SEQ ID NO: 3 in the present invention was obtained.

    [0033] In the present invention, the nucleic acid sequence SEQ ID NO: 4 is obtained by a site-directed mutagenesis using the nucleic acid sequence SEQ ID NO: 2 of the wild type C24MTgm gene as a template.

    [0034] The present invention constructs the nucleic acid sequence of C24MTgm-M11 into the expression vector of pSU-lacIqTrc-C24MTgm-M11 containing the trc promoter, and transforms the expression plasmid into MG1655 (ΔptsG ΔfumAC ΔfumB, panD, aspA) to obtain transformant MG1655 (ΔptsG ΔfumAC ΔfumB, panD, aspA, C24MTgm-M11).

    [0035] It was found that the ability of transformant MG1655 (AptsG AfumAC AfumB, panD, aspA, C24MTgm-M11) to produce 3-aminoisobutyric acid was significantly improved compared to the MG1655 (AptsG AfumAC AfumB, panD, aspA, C24MTgm) constructed by wild-type gene C24MTgm.

    PREPARATION AND EXAMPLES

    General Method

    Materials and Method

    [0036] In the present invention, the whole gene synthesis, primer synthesis and sequencing was done by Suzhou GENEWIZ, Inc. Molecular biology experiments include plasmid construction, restriction enzyme digestion, ligation, competent cell preparation, transformation, medium preparation, etc., mainly refer to “Molecular Cloning: A Laboratory Manual ” (Third Edition), J.F. Sambrook, D.W. Russell edited, translated by Huang Peitang et al., Science Press, Beijing, 2002).

    [0037] For example, the methods of transformation of competent cell and the preparation of competent cell are all referred to Chapter 1, page 96 of the “Molecular Cloning: A Laboratory Manual” (Third Edition). Specific experimental conditions can be determined by simple tests if necessary.

    [0038] Enzyme KOD FX for PCR involved in the examples was purchased from Toyobo Co., Ltd., and the restriction endonuclease was purchased from Thermofisher, Gibson assembly kit was purchased from NEB, and the Axygen DNA purification and plasmid extraction kit was purchased from Corning Incorporated Company. The experimental operation was carried out according to the product instruction manual.

    Culture Medium and Buffer

    [0039] LB medium: 10 g/L tryptone, 10 g/L sodium chloride, 5.0 g/L yeast extract (solid medium added 20 g/L agar powder, pH=7.0)

    [0040] The fermentation medium: (NH.sub.4).sub.2SO.sub.4 15 g/L, KH.sub.2PO.sub.4 5.0 g/L, Na.sub.2HPO.sub.4.Math.12H.sub.2O 15 g/L, MgSO.sub.4.Math.7H.sub.2O 1.0 g/L, 1.0 g/L yeast extract, 20 g/L glucose, pH=7.0

    [0041] In the following examples, when an antibiotic-containing medium was used, the final concentration of the antibiotic was ampicillin 100 μg/ml, and chloramphenicol 40 μg/ml. The corresponding antibiotic was added according to the characteristics of the transformed plasmid.

    [0042] 20X electro transfer stock solution: 80 g/L glycine, 2% Tween 80.

    Culture Condition

    [0043] The solid medium was statically cultured at 37° C. The liquid medium was cultured at 37° C and shaken at 230 rpm.

    Analytical Method for 3-aminoisobutyric Acid

    [0044] Pre-column derivatization of the sample with o-phthalaldehyde as a derivatizing agent, the column is Agilent SB-C18, and the mobile phase is sodium acetate (concentration is 2.871 g/L) in 30% of methanol aqueous solution, temperature of column is 30° C, detection wavelength is 334 nm, detection time is 10 min, retention time is 5.1 min.

    Example 1: Acquisition of C24MTgm-M11 Gene

    [0045] Plasmid pSU-lacIqTrc-C24MTgm disclosed in patent CN108998401A was used as template. KOD-FX PCR amplification was carried out with C24MTgm-F/135A136A-R, 135A136A-F/213 S-R, 213 S-F/C24MTgm-R as primers, respectively. The fragment C24MTgm-P1/C24MTgm-P2/C24MTgm-P3 was obtained.

    [0046] And then three fragments of C24MTgm-P1/C24MTgm-P2/C24MTgm-P3 were used as templates, C24MTgm-F/C24MTgm-R was used as primer for overlapping PCR, and finally obtain C24MTgm- Mll gene. The primer sequences used above are as follows:

    TABLE-US-00001 C24MTgm-F: 5′-CCATGGATCCAGGAGGTAAAAAAACATGCAGAAGAAAAAGAAAAAT CGCAACGAG-3′, C24MTgm-R: 5′-CTAGAAAGCTTTTAATTACGATCCAGATCCGGTTTACGG-3′.sub.o 135A136A-F: 5′-GATGTGGGTTGTGGCATTGGTGGCGCAGCACGTGAAATCAGCCGCT TTAGCAG-3′ 135A136A-R: CTGCTAAAGCGGCTGATTTCACGTGCTGCGCCACCAATGCCACAACCCA CATC-3′ 213S-F: 5′-CTGCTACAAAGAGATCAGCCGCGTGCTGAAACCGGGCCAG-3′ 213S-R: 5′-CTGGCCCGGTTTCAGCACGCGGCTGATCTCTTTGTAGCAG-3′

    Example 2: Construction of C24MTgm-M11 Expression Vector

    [0047] The pSU-lacIqTrc-C24MTgm plasmid was digested with BamHI/HindIII to recover a 4351 bp fragment. The C24MTgm-M11 gene fragment constructed in Example 1 was digested with BamHI/HindIII and cloned into the recombinant plasmid fragment to obtain C24MTgm-M11 expression vector. The pSU-lacIqTrc-C24MTgm-M11 expression plasmid has a structure as shown in FIG. 1.

    Example 3: Construction of 3-aminoisobutyric Acid Producing Strain

    [0048] The pSU-lacIqTrc-C24MTgm-M11 expression plasmid constructed in Example 2 was transformed into the E. coli strain MG1655 (AptsGAfumACAfumB, panD, aspA) by electroporation (the strain was from the patent CN108998401A), and then the strain MG1655 (ΔptsG ΔfumAC ΔfumB, panD, aspA, C24MTgm-M11) was obtained.

    Example 4: Fermentation of strain

    [0049] The fermentation can use glucose as a carbon source.

    [0050] For example, the fermentation medium consisted of the following: (NH.sub.4).sub.2SO.sub.4 15 g/L, KH.sub.2PO.sub.4 5.0 g/L, Na.sub.2HPO.sub.4.Math.12H.sub.2O 15 g/L, MgSO.sub.4.Math.7H.sub.2O 1.0 g/L, yeast extract 1.0 g/L, glucose 20 g/L, pH 7.0.

    [0051] The original strains MG1655, MG1655 (ΔptsGΔfumACΔfumB, panD, aspA, C24MTgm), and MG1655 (ΔptsGΔfumACΔfumB, panD, aspA, C24MTgm-M11) were cultured and fermented respectively. The fermentation medium was loaded with 30/250 ml, 37 ° C, 230 rpm. Fermentation was carried out for 24-32 h, and the content of 3-aminoisobutyric acid was measured.

    [0052] Analytical method for 3-aminoisobutyric acid: pre-column derivatization of the sample with o-phthalaldehyde as a derivatizing agent, the column is Agilent SB-C18, and the mobile phase is sodium acetate (concentration is 2.871 g/L) in 30% of methanol aqueous solution, temperature of column is 30 ° C, detection wavelength is 334 nm, detection time is 10 min, retention time is 5.1 min.

    [0053] The results showed that strain MG1655 cannot produce 3-aminoisobutyric acid; strain MG1655 (ΔptsGΔfumACΔfumB, panD, aspA, C24MTgm) could produce 82 mg/L of 3-aminoisobutyric acid; strain MG1655 (ΔptsGΔfumACΔfumB, panD, aspA, C24MTgm-M11) can produce 480 mg/L 3-aminoisobutyric acid. Compared to the wild type strain C24MTgm, the strain containing mutant C24MTgm-M11 has a significantly improved ability to produce 5.8-fold of 3-aminobutyric acid.