Edible vaccines expressed in yeast for preventing and treating infectious diseases in animals and humans

10617751 ยท 2020-04-14

Assignee

Inventors

Cpc classification

International classification

Abstract

In the invention described here, the approach is to formulate an edible vaccine based on N-terminal yeast surface display expression systems including S. cerevisiae EBY100/pYD5-VP28, S. cerevisiae EBY100/pYD5-VP28-VP24 and S. cerevisiae EBY100/pYD5-VP24 for preventing shrimps such as L. vannamei, P. monodon and M. rosenbergii species from white spot syndrome virus (WSSV) infection, suggesting that yeast surface display expression system expressing WSSV antigen has potential as a prophylactic treatment for WSSV in shrimps via oral vaccination. The technology developed in this patent application can also be used to produce edible (oral) vaccines for preventing and treating other infectious diseases in animals and human.

Claims

1. A composition comprising a yeast expression plasmid, pYD5, for N-terminal display surface of vp28 and vp24 envelope genes from white spot syndrome virus (WSSV) in host S. cerevisiae EBY 100 for preventing shrimps from WSSV infection.

2. The composition as in claim 1, wherein recombinant yeast display system that includes S. cerevisiae EBY 100/pYD5-VP28, S. cerevisiae EBY 100/pYD5-VP28-VP24 and S. cerevisiae EBY100/pYD5-VP24.

3. The composition as in claim 1 or 2, wherein the said recombinant yeast is heated at 60 C. for 1 hour.

4. The composition as in claim 3, wherein the said recombinant yeast is mixed with a feeding pellet.

5. The composition as in claim 4, wherein the said recombinant yeast is administered to shrimps.

6. The composition as in claim 5, wherein the said shrimps are L. vannamei, P. monodon and M. rosenbergii species.

7. The composition as in claim 5 or 6, wherein the said shrimps are orally vaccinated with recombinant yeast.

8. The composition as in claim 7, wherein the said shrimps are challenged with WSSV.

Description

DETAILED DESCRIPTION OF INVENTION

(1) Construction of WSSV Antigen Surface-Displayed Yeast Vaccines

(2) The VP28 gene (Gene accession No. KR057961.1) will be PCR-amplified using specific primers and subcloned into pYD5 in-frame with the endogenous Aga2p signal peptide sequence. The resultant shuttle plasmid pYD5-VP28 will be transformed into E. coli DH5. The plasmid pYD5-VP28 will then be extracted from E. coli, purified and electroporated into competent S. cerevisiae EBY100 after being linearized. Recombinant yeast transformants will be plated on selective minimal dextrose plates containing amino acids (0.67% yeast nitrogen base without amino acids (YNB), 2% glucose, 0.01% leucine, 2% agar, and 1M sorbitol). Trp.sup.+ transformants will be selected after 3 days of growth on the selective minimal dextrose plates.

(3) The positive colonies are confirmed by genomic PCR. Recombinant S. cerevisiae EBY100/pYD5-VP28 is cultured in YNB-CAA-Glu (0.67% YNB, 0.5 casamino acids, 2% Glucose) and induced in YNB-CAA-Gal (0.67% YNB, 0.5 casamino acids, 2% Galactose, 13.61 g/L Na.sub.2HPO.sub.4, 7.48 g/L NaH.sub.2PO.sub.4 and 5 g/L casamino acids) at 20 C. with shaking (250 rpm) for inducing VP28 surface display. S. cerevisiae EBY100 carrying pYD5 plasmid served as a negative control for all the tests.

(4) Two additional types of vaccines will be constructed in this section:

(5) S. cerevisiae EBY100/pYD5-VP24VP24 surface displayed yeast vaccine.

(6) S. cerevisiae EBY100/pYD5-VP28-VP24VP28 and VP24 cosurface-displayed yeast vaccine.

(7) Determining the Functional Display of WSSV Antigen on Yeast Surface

(8) This experiment is designed to validate the functional display of the WSSV antigen on yeast surface.

(9) Western Blotting

(10) 1 OD.sub.600(1 OD.sub.60010.sup.7 cells) equivalent recombinant yeast will be collected at different time point post inducement with 2% galactose. The samples are washed three times with 500 l of PBS, re-suspended in 50 l of 6SDS loading buffer (Bio-Rad, Hercules, Calif.), and boiled for 10 min. The surface presented VP28 will be extracted by heating 1 OD.sub.600 of S. cerevisiae EBY100/pYD5-VP28 pellets at 95 C. in a Bromophenol blue sample buffer supplemented with 5%-ME for 5 min. The samples were then resolved on a 4-15% SDS-PAGE gel (Bio-Rad), and transferred to 0.45 m nitrocellulose membranes (Bio-Rad). After blocking with 5% non-fat milk at room temperature for 2 h, the membrane will be incubated with polyclonal rabbit anti-VP28 antibody (Thermo) as primary antibody (1:500 diluted). After incubated overnight at 4 C. and washed three times using PBS buffer, the membranes will be reacted to the secondary antibodies, horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (1:5,000 diluted) (Sigma-Aldrich Co., St. Louis, Mo.) for 1 hour at room temperature. The signal will be generated using West Pico chemiluminescent substrates (Thermo Fisher Scientific Inc., Rockford, Ill.) and detected using a ChemiDoc XRS System (Bio-Rad).

(11) Glycosylation Analysis of Yeast Surface Displayed VP28

(12) PNGase F is obtained from New England Labs (Beverly, Mass.). Recombinant S. cerevisiae EBY100/pYD5-VP28 will be cultured at 30 C. in YNB-CAA-Glu overnight and then induced at 20 C. in YNB-CAA-Gal for 72 hours. 1 OD.sub.600 equivalent cells will be collected, centrifuged, and washed once in a PBS buffer. Cell pellets were denatured at 100 C. for 10 min in a denaturing buffer included in the PNGase F reagent. A portion of 1 L of PNGase F (5,000 U) will be added to the denatured protein solution, followed by incubation at 37 C. for 1 hour according to the manufacturer's instruction. The treated samples will then be subjected to Western blotting analysis.

(13) Immunofluorescence Microscopy

(14) To detect VP28 display on yeast surface, recombinant S. cerevisiae EBY100/pYD5-VP28 will be collected in a 24-hour interval over a 72-hour time period after inducement with galactose (2%). 1 OD.sub.600 equivalent recombinant yeast will be collected and blocked with 5% non-fat milk in PBS for 1 hour, and incubated with polyclonal rabbit anti-VP28 antibodies (1:500 diluted) at 4 C. for 1 hour. After washing with PBS, the samples will be incubated with goat anti-rabbit IgG FITC conjugates (Sigma) (1:5,000 diluted) at room temperature for 1 h. The samples will be kept in dark until use. The FITC labeled yeast will be examined under an inverted phase contrast fluorescence microscope.

(15) Flow Cytometric Assay

(16) After inducement with galactose (2%), 1 OD.sub.600 equivalent recombinant yeasts will be collected over a 72-hour time period, with a 24-hour interval, as described above. The cell samples will be washed three times with sterile PBS containing 1% bovine serum albumin (BSA) and incubated with polyclonal rabbit anti-VP28 antibodies from BEI Resources (NR-2729) (1:500 diluted) at 4 C. for 1 hour, followed by reacting with FITC-conjugated goat anti-rabbit IgG (1:5,000) at 4 C. for 30 min. The cell samples will be re-suspended in 500 L of sterile PBS and will be subject to flow cytometric analysis using a BD FACS Aira III (BD Bioscience, San Jose, Calif.). S. cerevisiae EBY100/pYD5 served as a negative control for the assay. These data will be used to ascertain which time point will be the best for collecting yeast vaccines that present the highest level of VP28 on their surface.

(17) Note: The similar methods are used to determine the functional display for the following yeast vaccines (S. cerevisiae EBY100/pYD5-VP28-VP24 and S. cerevisiae EBY100/pYD5-VP24).

(18) Optimization of Oral Immunization

(19) Commercial shrimp pellet feed weighing 2 g were coated with 3 ml of 110.sup.8 pfu/ml of recombinant yeast. The feed was mixed and incubated on ice for 30 min followed by room temperature (RT) incubation for 30 min to allow absorption. The pellets were coated with fish oil to prevent dispersion.

(20) A batch of shrimp was divided into five groups and 20 shrimps per group were selected. The shrimp in group first, second and third were administrated orally with recombinant yeast-VP28, yeast-VP24 and yeast-VP28-VP24 coated feed continuously for 7 days, whereas group fourth and fifth were administrated orally with PBS and yeast containing empty plasmid coated feed, respectively.

(21) Virus Challenge

(22) Third day after final vaccination, the shrimp in group one to three were immersed in a sea water containing a dilution of 1:150 WSSV stock solution for 2 hrs, then the shrimp was changed in to fresh seawater without WSSV. Another batch of shrimp (5 groups, 20 shrimp each group), the vaccine experiment was repeated and shrimp were challenged with WSSV on 15 days post vaccination (dpv). The oral vaccination experiments were repeated three times.

(23) Based on these results, we can evaluate and determine the strength and degree of immune protection that can be provided by the yeast vaccines. Further, we can determine which vaccine provides the complete immune protection of shrimps from virus challenge.

(24) TABLE-US-00001 VP28genesequence(615bp): ATGGATCTTTCTTTCACTCTTTCGGTCGTGTCGGCCATCCTCGCCATCAC TGCTGTGATTGCTGTATTTATTGTGATTTTTAGGTATCACAACACTGTGA CCAAGACCATCGAAACCCACACAGACAATATCGAGACAAACATGGATGAA AACCTCCGCATTCCTGTGACTGCTGAGGTTGGATCAGGCTACTTCAAGAT GACTGATGTGTCCTTTGACAGCGACACCTTGGGCAAAATCAAGATCCGCA ATGGAAAGTCTGATGCACAGATGAAGGAAGAAGATGCGGATCTTGTCATC ACTCCCGTGGAGGGCCGAGCACTCGAAGTGACTGTGGGGCAGAATCTCAC CTTTGAGGGAACATTCAAGGTGTGGAACAACACATCAAGAAAGATCAACA TCACTGGTATGCAGATGGTGCCAAAGATTAACCCATCAAAGGCCTTTGTC GGTAGCTCCAACACCTCCTCCTTCACCCCCGTCTCTATTGATGAGGATGA AGTTGGCACCTTTGTGTGTGGTACCACCTTTGGCGCACCAATTGCAGCTA CCGCCGGTGGAAATCTTTTCGACATGTACGTGCACGTCACCTACTCTGGC ACTGAGACCGAGTAA VP24genesequence(627bp): ATGCACATGTGGGGGGTTTACGCCGCTATACTGGCGGGTTTGACATTGAT ACTCGTGGTTATATCTATAGTTGTAACCAACATAGAACTTAACAAGAAAT TGGACAAGAAGGATAAAGACGCCTACCCTGTTGAATCTGAAATAATAAAC TTGACCATTAACGGTGTTGCTAGAGGAAACCACTTTAACTTTGTAAACGG CACATTACAAACCAGGAACTATGGAAAGGTATATGTAGCTGGCCAAGGAA CGTCCGATTCTGAACTGGTAAAAAAGAAAGGAGACATAATCCTCACATCT TTACTTGGAGACGGAGACCACACACTAAATGTAAACAAAGCCGAATCTAA AGAATTAGAATTGTATGCAAGAGTATACAATAATACAAAGAGGGATATAA CAGTGGACTCTGTTTCACTGTCTCCAGGTCTAAATGCTACAGGAAGGGAA TTTTCAGCTAACAAATTTGTATTATATTTCAAACCAACAGTTTTGAAGAA AAATAGGATCAACACACTTGTGTTTGGAGCAACGTTTGACGAAGACATCG ATGATACAAATAGGCATTATCTGTTAAGTATGCGATTTTCTCCTGGCAAT GATCTGTTTAAGGTTGGGGAAAAATAA VP28-VP24genesequence(1302bp) GCTAGCGTTTTAGCAGCTGGTGATCTTTCTTTCACTCTTTCGGTCGTGTC GGCCATCCTCGCCATCACTGCTGTGATTGCTGTATTTATTGTGATTTTTA GGTATCACAACACTGTGACCAAGACCATCGAAACCCACACAGACAATATC GAGACAAACATGGATGAAAACCTCCGCATTCCTGTGACTGCTGAGGTTGG ATCAGGCTACTTCAAGATGACTGATGTGTCCTTTGACAGCGACACCTTGG GCAAAATCAAGATCCGCAATGGAAAGTCTGATGCACAGATGAAGGAAGAA GATGCGGATCTTGTCATCACTCCCGTGGAGGGCCGAGCACTCGAAGTGAC TGTGGGGCAGAATCTCACCTTTGAGGGAACATTCAAGGTGTGGAACAACA CATCAAGAAAGATCAACATCACTGGTATGCAGATGGTGCCAAAGATTAAC CCATCAAAGGCCTTTGTCGGTAGCTCCAACACCTCCTCCTTCACCCCCGT CTCTATTGATGAGGATGAAGTTGGCACCTTTGTGTGTGGTACCACCTTTG GCGCACCAATTGCAGCTACCGCCGGTGGAAATCTTTTCGACATGTACGTG CACGTCACCTACTCTGGCACTGAGACCGAGGGTGGTGGTGGTTCTGGTGG TGGTGGTTCTGGTGGTGGTGGTTCTCACATGTGGGGGGTTTACGCCGCTA TACTGGCGGGTTTGACATTGATACTCGTGGTTATATCTATAGTTGTAACC AACATAGAACTTAACAAGAAATTGGACAAGAAGGATAAAGACGCCTACCC TGTTGAATCTGAAATAATAAACTTGACCATTAACGGTGTTGCTAGAGGAA ACCACTTTAACTTTGTAAACGGCACATTACAAACCAGGAACTATGGAAAG GTATATGTAGCTGGCCAAGGAACGTCCGATTCTGAACTGGTAAAAAAGAA AGGAGACATAATCCTCACATCTTTACTTGGAGACGGAGACCACACACTAA ATGTAAACAAAGCCGAATCTAAAGAATTAGAATTGTATGCAAGAGTATAC AATAATACAAAGAGGGATATAACAGTGGACTCTGTTTCACTGTCTCCAGG TCTAAATGCTACAGGAAGGGAATTTTCAGCTAACAAATTTGTATTATATT TCAAACCAACAGTTTTGAAGAAAAATAGGATCAACACACTTGTGTTTGGA GCAACGTTTGACGAAGACATCGATGATACAAATAGGCATTATCTGTTAAG TATGCGATTTTCTCCTGGCAATGATCTGTTTAAGGTTGGGGAAAAAGAAT TC