Recombinant Pseudomonas Plecoglossicida for Producing L-xylose and Application thereof
20200109424 ยท 2020-04-09
Inventors
Cpc classification
C12Y101/99004
CHEMISTRY; METALLURGY
International classification
Abstract
The disclosure discloses recombinant Pseudomonas plecoglossicida for producing L-xylose and application thereof, and belongs to the technical field of bioengineering. According to the disclosure, a synthesized 2-ketogluconate reductase gene and a 2,5-diketogluconate reductase gene derived from Corynebaterium ATCC 31090 and a pyruvate decarboxylase gene derived from Saccharomyces cerevisiae are successfully expressed in a host P. plecoglossicida by a double plasmid system, and an obtained genetically engineered strain is fermented for 56 h in a shake flask, where the yield of L-xylose reaches 16.2 g/L, and the transformation rate reaches 20.3%; the obtained genetically engineered strain is fermented for 48 h and 44 h in 3 L and 15 L fermentors, respectively, where the yields of L-xylose reach 37.6 g/L and 45.8 g/L, respectively, and the glucose transformation rates are 47.0% and 57.3%, respectively. The method has the advantages of low raw material cost, no pollution to the environment, simple operation, and important economic and social benefits.
Claims
1. A recombinant strain for producing L-xylose, comprises nucleic acid sequences for expressing a 2-ketogluconate dehydrogenase gene, a 2,5-diketogluconate reductase gene and a pyruvate decarboxylase gene and wherein the recombinant strain uses Pseudomonas plecoglossicida as a host strain.
2. The recombinant strain according to claim 1, comprising a double plasmid expression system to express the 2-ketogluconate dehydrogenase gene, the 2,5-diketogluconate reductase gene and the pyruvate decarboxylase gene, and the double plasmid expression system comprises a plasmid pME6032 and a plasmid pBBR1MCS-2.
3. The recombinant strain according to claim 2, wherein the plasmid pME6032 is used for expressing the 2-ketogluconate dehydrogenase gene, and the plasmid pBBR1MCS-2 is used for expressing the 2,5-diketogluconate reductase gene and the pyruvate decarboxylase gene.
4. The recombinant strain according to claims 1, wherein the 2-ketogluconate dehydrogenase (2GADH) gene comprises nucleic acid sequences for three subunits, which are set forth in SEQ ID NO. 1, SEQ ID NO. 2, and SEQ ID NO. 3, respectively; the 2,5-diketogluconate reductase gene (2,5DKG) is obtainable from Corynebaterium ATCC 31090; and the pyruvate decarboxylase gene (PDC) is obtainable from Saccharomyces cerevisiae.
5. The recombinant strain according to claims 3, wherein the 2-ketogluconate dehydrogenase gene consists of three subunits, which are set forth in SEQ ID NO. 1, SEQ ID NO. 2, and SEQ ID NO. 3, respectively; the 2,5-diketogluconate reductase gene is available from Corynebaterium ATCC 31090; and the pyruvate decarboxylase gene is available from Saccharomyces cerevisiae.
6. The recombinant strain according to claims 1, wherein the host strain of Pseudomonas plecoglossicida is any one selected from a group consisting of Pseudomonas plecoglossicida CGMCC 7150, Pseudomonas plecoglossicida CGMCC 1.16111, Pseudomonas plecoglossicida CGMCC 1.12685, and Pseudomonas plecoglossicida CGMCC 1.761.
7. The recombinant strain according to claims 5, wherein the host strain of Pseudomonas plecoglossicida is any one selected from a group consisting of Pseudomonas plecoglossicida CGMCC 7150, Pseudomonas plecoglossicida CGMCC 1.16111, Pseudomonas plecoglossicida CGMCC 1.12685, and Pseudomonas plecoglossicida CGMCC 1.761.
8. A method for constructing the recombinant strain according to claim 7, comprising the following steps: (1) simultaneously ligating nucleic acid sequences of gene subunits set forth in SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3 to a vector plasmid pME6032 to form a recombinant plasmid pME6032-2gadh; (2) transforming the recombinant plasmid pME6032-2gadh obtained in step (1) into Pseudomonas plecoglossicida to obtain single plasmid-containing recombinant Pseudomonas plecoglossicida; (3) separately amplifying a 2,5-diketogluconate reductase gene and a pyruvate decarboxylase gene, and simultaneously ligating amplified nucleic acid sequences of the 2,5-diketogluconate reductase gene and the pyruvate decarboxylase gene to a vector pBBR1MCS-2 to form a recombinant plasmid pBBR1MCS-2-25dkg-pdc; and (4) transforming the recombinant plasmid pBBR1MCS-2-25dkg-pdc obtained in step (3) into the Pseudomonas plecoglossicida containing the recombinant plasmid pME6032-2gadh obtained in step (2) to obtain double plasmid-containing recombinant Pseudomonas plecoglossicida.
9. A method of using the recombinant strain according to claim 1, comprising: culturing the recombinant strain in a fermentation medium until OD.sub.650 is 0.6 to 0.8; adding IPTG to induce expression of a 2-ketogluconate dehydrogenase gene, a 2,5-diketogluconate reductase gene and a pyruvate decarboxylase gene; and synthesizing L-xylose by using glucose as a substrate.
10. The method according to claim 9, wherein the fermentation medium comprises 75.0 to 85.0 g/L of glucose, 3.0 to 4.0 g/L of corn steep liquor, 1.5 to 2.5 g/L of urea, 1.5 to 2.5 g/L of KH.sub.2PO.sub.4, 0.4 to 0.6 g/L of MgSO.sub.4.7H.sub.2O, and 9.0 to 11.0 g/L of CaCO.sub.3, and has a pH value of 6.8.
11. The method according to claim 9, comprising culturing the recombinant strain on a seed medium before fermentation, and the seed medium comprises 14.0 to 15.0 g/L of glucose, 3.5 to 4.0 g/L of corn steep liquor, 1.5 to 2.5 g/L of urea, 1.5 to 2.5 g/L of KH.sub.2PO.sub.4, 0.4 to 0.6 g/L of MgSO4.7H.sub.2O, and 0.8 to 1.2 g/L of CaCO.sub.3, and has a pH value of 7.0.
12. A method of using the recombinant strain according to claim 1, comprising: culturing the recombinant strain to produce L-xylose by synthesis using glucose as a substrate; and utilizing saccharomycetes to transform the L-xylose into xylitol.
Description
BRIEF DESCRIPTION OF FIGURES
[0027]
[0028]
[0029]
DETAILED DESCRIPTION
[0030] For the purpose of making objects, characteristics and advantages of the disclosure more clear and understandable, the detailed descriptions will be made to the specific implementations of the disclosure in conjunction with specific embodiments.
[0031] The concentration of L-xylose is determined by high performance liquid chromatography. The high performance liquid chromatography conditions are as follows: chromatographic column : HPX-87H (Bio-Rad Hercules), column temperature: 35 C.; detector: refractive index detector; mobile phase: 5 mM H.sub.2SO.sub.4, and flow rate: 0.6 mL/min. A fermentation supernatant was filtered by 0.22 m micropores to remove impurities and then directly used for the detection of L-xylose.
[0032] The concentration of glucose is determined by a domestic SBA-40C biosensor analyzer.
[0033] A calculation method of glucose transformation rate: glucose transformation rate =total amount of glucosamine/total sugar consumption*100%.
[0034] A sequence of a subunit 1 of a 2-ketogluconate dehydrogenase gene 2GADH is shown in SEQ ID NO. 1.
[0035] A sequence of a subunit 2 of the 2-ketogluconate dehydrogenase gene 2GADH is shown in SEQ ID NO. 2.
[0036] A sequence of a subunit 3 of the 2-ketogluconate dehydrogenase gene 2GADH is shown in SEQ ID NO. 3.
[0037] Primers are shown in Table 1.
TABLE-US-00001 TABLE1 Associatedprimers Sequence Name F/R Primersequence(5-3) number 2GADH-1 F CGC GATGAACCTGAAA SEQID ATCGAACCGGA NO.4 R CCC
TTACAGGTTTTCA SEQID ATCAGAGACGG NO.5 2GADH-2 F CGC
GATGAAAAAACCG SEQID GTTTTCACCGCG NO.6 R CCC
TCATGCATCACCT SEQID TTCATACGCAGGC NO.7 2GADH-3 F CGC
GATGAAACAGCTG SEQID CTGATGGCAA NO.8 R CTG
TTAACCGTTATCA SEQID CGCGCGA NO.9 2,5DKG F CGC
GATGAATCTAAAA SEQID ATCGAACCCGACGTAATTTTTT NO.10 R ACGC
TCATCCATTGTC SEQID TCGGGCTATCC NO.11 PDC F CATG
ATTCAATTACTT SEQID TGGGTAAATATTTGTTCG NO.12 R CCG
TTGCTTAGCGTTG SEQID GTAGCAGCAGTC NO.13
[0038]
Embodiment 1
[0039] (1) Construction and identification of recombinant plasmid pME6032-2gadh
[0040] Sequences shown in SEQ ID NO. 1, SEQ ID NO. 2, and SEQ ID NO. 3 were obtained by chemical synthesis, and primers (2GADH-1,2GADH-2, and 2GADH-3, see Table 1) were designed. A gene of three subunits of a ketogluconate dehydrogenase gene (2GADH) was sequentially ligated on a plasmid pME6032 at a temperature of 16 C. overnight at restriction enzyme cutting sites EcoRI, SacI, KpnI, and NcoI, and a ligation product pME6032-gadh was transformed by a chemical method into Escherichia coli JM109 competent cells. The obtained transformation liquid was applied onto a 50 mg/L tetracycline-containing LB plate, and the recombinant plasmid pME6032-2gadh constructed was verified by extracting and sequencing the plasmid.
[0041] (2) Construction of recombinant strain P. plecoglossicida-2gadh
[0042] The plasmid pME6032-2gadh constructed in step (1) was transformed into an original strain Pseudomonas. plecoglossicida CGMCC 7150 by an electrotransformation method, and a positive strain P. plecoglossicida-2gadh was obtained by screening with tetracycline.
[0043] (3) Construction and identification of recombinant plasmid pBBR1MCS-2-25dkg-pdc
[0044] Primers (2,5DKG and PDC, see Table 1) were designed using Corynebaterium ATCC 31090 and Saccharomyces cerevisiae genomes as templates, respectively, a 2,5-diketogluconate reductase gene (2,5DKG) and a pyruvate decarboxylase gene (PDC) were amplified, the 2,5-diketogluconate reductase gene and the pyruvate decarboxylase gene were sequentially ligated on a plasmid pBBR1MCS-2 at a temperature of 16 C. overnight at restriction enzyme cutting sites KpnI, EcoRI, and BamHI, and a ligation product pBBR1MCS-2-25dkg-pdc was transformed into the E. coli JM109 competent cells by a chemical method. The obtained transformation liquid was applied onto a 50 mg/L kanamycin-containing LB plate and the recombinant plasmid pBBR1MCS-2-25dkg-pdc was verified by extracting and sequencing the plasmid.
[0045] (4) Construction of recombinant strain P. plecoglossicida-2gadh-25dkg-pdc
[0046] The plasmid pBBR1MCS-2-25dkg-pdc constructed in step (3) was transformed into the strain P. plecoglossicida-2gadh obtained in step (2) by an electrotransformation method, and a positive strain P. plecoglossicida-2gadh-25dkg-pdc was obtained by screening with ampicillin.
Embodiment 2
[0047] An original strain was Pseudomonas plecoglossicida CGMCC 1.12685, the remaining steps were the same as in Embodiment 1, and a positive recombinant strain P. plecoglossicidal-2gadh-25dkg-pdc was obtained by screening.
Embodiment 3 Culture of recombinant strain P. plecoglossicida-2gadh-25dkg-pdc and L-xylose fermentation
[0048] Seed medium: glucose: 15.0 g/L, corn steep liquor: 4.0 g/L, urea: 2.0 g/L, KH.sub.2PO.sub.4: 2.0 g/L, 0.5 g/L, CaCO.sub.3: 1.0 g/L, and pH value : 7.0.
[0049] Fermentation medium: glucose 80.0 g/L, corn steep liquor: 4.0 g/L, urea 2.0 g/L, KH.sub.2PO.sub.4: 2.0 g/L, MgSO.sub.4.7H.sub.2O: 0.5 g/L, CaCO.sub.3: 10.0 g/L, and pH value: 6.8.
[0050] Shake flask culture: a suitable amount of suspension of strain (the recombinant strain obtained in Embodiment 1) was inoculated into a 500 mL shake flask containing 50 mL of seed medium, cultured at a temperature of 30 C. and a rate of 220 r/min for 16 to 20 h, and transferred to a 500 mL shake flask containing 50 mL of fermentation medium at an inoculation amount of 10%; when the strain was cultured at the temperature of 30 C. and the rate of 220 r/min until OD.sub.650 was 0.6, IPTG was used for induction, where the final concentration of IPTG was 0.5 mM, and the induction temperature was 25 C., fermentation was carried out for 64 h, and samples were taken periodically.
[0051] The yield of L-xylose was determined. The results are shown in
Embodiment 4 Fermentation of recombinant strain P. plecoglossicida-2gadh-25dkg-pdc in 3L fermentor
[0052] A fermentation medium and conditions of a 3L fermentor are as follows:
[0053] Fermentation medium: glucose: 80.0 g/L, corn steep liquor: 4.0 g/L, urea: 2.0 g/L, KH.sub.2PO.sub.4: 2.0 g/L, MgSO.sub.4.7H.sub.2O: 0.5 g/L, CaCO.sub.3: 10.0 g/L, and pH value: 6.8.
[0054] Fermentation conditions: the initial liquid volume was 2.0 L, and the seed inoculation amount was 10%. Initial fermentation conditions: the culture temperature was 30 C., pH was 6.8, the stirring rate was 400 rpm, the ventilation volume was 1.5 vvm, when the OD650 of a thallus was 0.6, IPTG was used for induction, where the final concentration of IPTG was 0.5 mM, and the induction temperature was 25 C., the fermentation was carried out for 64 h, and samples were taken periodically.
[0055] The yield of L-xylose was determined. The results are shown in
Embodiment 5 Fermentation of recombinant strain P. plecoglossicida-2gadh-25dkg-pdc in 15L fermentor
[0056] A fermentation medium and conditions of a 15L fermentor were as follows:
[0057] Fermentation medium: glucose: 80.0 g/L, corn steep liquor: 4.0 g/L, urea: 2.0 g/L, KH.sub.2PO.sub.4: 2.0 g/L, MgSO.sub.4.7H.sub.2O: 0.5 g/L, CaCO.sub.3: 10.0 g/L, and pH value: 6.8.
[0058] Fermentation conditions: the initial liquid volume was 10.0 L, and the seed inoculation amount was 10%. Initial fermentation conditions: the culture temperature was 30 C., pH was 6.8, the stirring rate was 400 rpm, the ventilation volume was 0.8 vvm, the fermentor pressure was 0.5 bar, when the OD.sub.650 of a thallus was 0.6, IPTG was used for induction, where the final concentration of IPTG was 0.5 mM, and the induction temperature was 25 C., the fermentation was carried out for 64 h, and samples were taken periodically.
[0059] The yield of L-xylose was determined. The results are shown in
Comparative Example 1 Construction of recombinant strain using single plasmid pME6032 expression
[0060] Using the strategy of Embodiment 1, a gene of three subunits of a 2-ketogluconate dehydrogenase gene (2GADH), a 2,5-diketogluconate reductase gene and a pyruvate decarboxylase gene were sequentially ligated to a plasmid pME6032 at restriction enzyme cutting sites EcoRI, SacI, KpnI, NcoI, BgiII, and XhoI, a constructed plasmid pME6032-2gadh-25dkg-pdc was expressed in P. plecoglossicida CGMCC 7150, and the result shows that the expression is not successful.
Comparative Example 2 Construction of recombinant strain using single plasmid pBBR1MCS expression
[0061] Using the strategy of Embodiment 1, a gene of three subunits of a 2-ketogluconate dehydrogenase gene (2GADH), a 2,5-diketogluconate reductase gene and a pyruvate decarboxylase gene were sequentially ligated to a plasmid pBBR1MCS at restriction enzyme cutting sites KpnI, XhoI, HindIII, EcoRI, BamHI, and SacI, a constructed plasmid pBBR1MCS-2gadh-25dkg-pdc was expressed in P. plecoglossicida CGMCC 7150, and the result shows that the expression is not successful.
Comparative Example 3: Using of 2-ketogluconate dehydrogenase gene (2GADH) derived from Erwinia
[0062] An original strain was P. plecoglossicida CGMCC 7150, a 2-ketogluconate dehydrogenase gene (2GADH) was derived from Erwinia, the remaining steps were the same as in Embodiment 1, and it is found that the 2-ketogluconate dehydrogenase gene (2GADH) derived from Erwinia cannot be successfully expressed in a host strain.
Comparative Example 4: Adjustment of fermentation medium of recombinant strain P. plecoglossicida-2gadh-25dkg-pdc
[0063] The Comparative Example 4 is the same as Embodiment 3, the difference is that the concentrations of glucose, corn steep liquor and urea in a fermentation medium are respectively shown in Table 1 below, and the results show that when the concentrations of glucose, corn steep liquor and urea were 80.0 g/, L4.0 g/L, and 2.0 g/L, respectively, the yield and transformation rate of L-xylose were relatively high, 16.2 g/L and 20.3%, respectively.
TABLE-US-00002 TABLE 1 Composition adjustment of fermentation medium and corresponding yield and transformation rate Glucose Corn steep Urea L-xylose Transformation No. (g/L) liquor (g/L) (g/L) (g/L) rate (100%) 1 70.0 4.0 2.0 12.0 17.1 2 80.0 4.0 2.0 16.2 20.3 3 90.0 4.0 2.0 16.4 18.2 4 80.0 2.0 2.0 13.5 15.9 5 80.0 5.0 2.0 14.0 17.5 6 80.0 4.0 1.0 13.4 16.8 7 80.0 4.0 3.0 13.0 16.3