TRANSGENIC YEAST AND METHOD FOR PRODUCING ETHANOL USING THE SAME

20200109373 ยท 2020-04-09

Assignee

Inventors

Cpc classification

International classification

Abstract

The present disclosure is intended to reduce the amount of glycerin produced as a byproduct in ethanol fermentation to a significant extent using a transgenic yeast comprising a gene having the pentose assimilating ability and encoding glycerin dehydrogenase having a mitochondrial transport signal introduced thereinto.

Claims

1. A transgenic yeast having pentose assimilating ability, comprising a gene encoding glycerin dehydrogenase having a mitochondrial transport signal introduced thereinto.

2. The transgenic yeast according to claim 1, wherein the glycerin dehydrogenase is NAD-dependent glycerin dehydrogenase having activity of converting NAD into NADPH.

3. The transgenic yeast according to claim 1, wherein the gene encoding glycerin dehydrogenase encodes the protein (a) or (b): (a) a protein comprising the amino acid sequence as shown in SEQ ID NO: 2; or (b) a protein comprising an amino acid sequence having 70% or higher sequence identity to the amino acid sequence as shown in SEQ ID NO: 2, having mitochondrial locality, and having activity of generating dihydroxyacetone using glycerin as a substrate.

4. The transgenic yeast according to claim 1, wherein the gene encoding glycerin dehydrogenase encodes a fusion protein comprising a mitochondrial transport signal and the protein (a) or (b): (a) a protein comprising the amino acid sequence as shown in SEQ ID NO: 4; or (b) a protein comprising an amino acid sequence having 70% or higher sequence identity to the amino acid sequence as shown in SEQ ID NO: 4, and having activity of generating dihydroxyacetone using glycerin as a substrate.

5. The transgenic yeast according to claim 1, wherein the pentose is xylose and/or arabinose.

6. The transgenic yeast according to claim 1, which comprises the xylose isomerase gene introduced thereinto and has xylose assimilating ability.

7. The transgenic yeast according to claim 6, which further comprises a xylulokinase gene introduced thereinto.

8. The transgenic yeast according to claim 1, which comprises a gene encoding an enzyme selected from a group of enzymes constituting a non-oxidative process in the pentose phosphate pathway introduced thereinto.

9. The transgenic yeast according to claim 8, wherein the group of enzymes constituting a non-oxidative process in the pentose phosphate pathway includes ribose-5-phosphate isomerase, ribulose-5-phosphate-3-epimerase, transketolase, and transaldolase.

10. A method for producing ethanol comprising a step of ethanol fermentation by culturing the transgenic yeast according to claim 1 in a medium containing assimilable pentose.

11. The method for producing ethanol according to claim 10, wherein the medium contains cellulose and the ethanol fermentation proceeds simultaneously at least with cellulose saccharification.

Description

DETAILED DESCRIPTION

[0026] Hereafter, the present disclosure is described in greater detail with reference to the embodiments.

[0027] [Transgenic Yeast]

[0028] The transgenic yeast of the present disclosure has pentose assimilating ability and comprises a gene encoding glycerin dehydrogenase having a mitochondrial transport signal introduced thereinto. The term pentose assimilating ability used herein refers to pentose assimilating ability achieved by introducing an enzyme gene involving pentose assimilation into a yeast that does not inherently have pentose assimilating ability (synonymous with metabolizing ability), and the term also refers to an inherent pentose assimilating ability because of the presence of an enzyme gene associated with pentose assimilation. More specifically, the term pentose refers to aldopentose, such as ribose, arabinose, xylose, or lyxose, and ketopentose, such as ribulose or xylulose, although pentose is not particularly limited thereto. In some embodiments, the transgenic yeast of the present disclosure may have xylose and/or arabinose assimilating ability among various types of pentoses. In more specific embodiments, the transgenic yeast may have xylose assimilating ability.

[0029] Examples of yeasts having xylose assimilating ability include a yeast that has acquired xylose assimilating ability by introduction of the xylose isomerase gene into a yeast that does not inherently have xylose assimilating ability and a yeast that has acquired xylose assimilating ability by introduction of another gene involving xylose assimilation. Examples of yeasts having the arabinose-assimilating ability include yeasts that have each acquired the arabinose-assimilating ability by introduction of an L-arabinose isomerase gene, an L-ribulokinase gene, and an L-ribulose-5-phosphate-4-epimerase gene derived from prokaryotes and an L-arabitol-4-dehydrogenase gene and an L-xylose reductase gene derived from eukaryotes into a yeast that does not inherently have the arabinose-assimilating ability.

[0030] [Glycerin Dehydrogenase Gene]

[0031] The transgenic yeast of the present disclosure comprises a gene encoding glycerin dehydrogenase having a mitochondrial transport signal. A glycerin dehydrogenase gene to be introduced into a host yeast may be a gene encoding mitochondria-localized glycerin dehydrogenase or a gene encoding a fusion protein comprising cytoplasm-localized glycerin dehydrogenase and a mitochondrial transport signal fused thereto. Specifically, a gene encoding mitochondria-localized glycerin dehydrogenase inherently has a mitochondrial transport signal.

[0032] In some embodiments, mitochondria-localized glycerin dehydrogenase and cytoplasm-localized glycerin dehydrogenase in the transgenic yeast of the present disclosure may be NAD-dependent glycerin dehydrogenase. The NAD-dependent glycerin dehydrogenase reduces NAD (NAD.fwdarw.NADH) as a coenzyme in a reaction of generating dihydroxyacetone using glycerin as a substrate. A glycerin production pathway oxidizes NADH. Hence, this makes balance between coenzymes in a series of reactions involving glycerin production and. metabolism since.

[0033] Examples of genes encoding mitochondria-localized glycerin dehydrogenase include the gld1 gene of the fission yeast, Schizosaccharomyces pombe (NAD-dependent), and the Gld1 gene of the fission yeast, Schizosaccharomyces octosporus (NAD-dependent) (NCBI Accession Number: XP_013020646). In addition, amino acid sequences of mitochondrial transport signals can be easily inspected with the use of protein subcellular localization prediction tools, such as TargetP (http://www.cbs.dtu.dk/services/TargetP/).

[0034] Specifically, the nucleotide sequence of the coding region in the Schizosaccharomyces pombe gld1 gene is shown in SEQ ID NO: 1, and the amino acid sequence of the gld1 protein (with a mitochondrial transport signal) is shown in SEQ ID NO: 2. The gene encoding glycerin dehydrogenase having a mitochondrial transport signal is not limited to the gld1 gene identified by SEQ ID NO: 1 and SEQ ID NO: 2, and it may be a paralogous gene or a homologous gene of the gld1 gene in the narrow sense having different nucleotide and amino acid sequences.

[0035] The gene encoding glycerin dehydrogenase is not limited to the gene identified by SEQ ID NO: 1 and SEQ ID NO: 2. For example, it may be a gene encoding a protein comprising an amino acid sequence having 70% or higher sequence similarity to or identity with the amino acid sequence as shown in SEQ ID NO: 2 and having activity of generating dihydroxyacetone using glycerin as a substrate by being localized in the mitochondria. In some embodiments, such sequence similarity or identity may be 80% or higher, 90% or higher, or 95% or higher. The degree of sequence similarity or identity can be detei mined using the BLASTN or BLASTX Program equipped with the BLAST algorithm (at default settings). The degree of sequence similarity is determined by subjecting a pair of amino acid sequences to pairwise alignment analysis, identifying completely identical amino acid residues and amino acid residues exhibiting physicochemically similar functions, determining the total number of such amino acid residues, and calculating the percentage of all the amino acid residues subjected to comparison accounted for by the total number of such amino acid residues. The degree of sequence identity is determined by subjecting a pair of amino acid sequences to pairwise alignment analysis, identifying completely identical amino acid residues, and calculating the percentage of all the amino acid residues subjected to comparison accounted for by such amino acid residues.

[0036] Further, the gene encoding glycerin dehydrogenase is not limited to the gene identified by SEQ ID NO: 1 and SEQ ID NO: 2. For example, it may be a gene encoding a protein comprising an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 2 by substitution, deletion, insertion, or addition of one or several amino acids and and having activity of generating dihydroxyacetone using glycerin as a substrate by being localized in the mitochondria. The term several used herein refers to, for example, 2 to 30. In some embodiments, it may refer to 2 to 20, 2 to 10, or 2 to 5.

[0037] Furthermore, the gene encoding glycerin dehydrogenase is not limited to the gene identified by SEQ ID NO: 1 and SEQ ID NO: 2. For example, it may be a gene hybridizing under stringent conditions to the full-length sequence or a partial sequence of a complementary strand of DNA comprising the nucleotide sequence as shown in SEQ ID NO: 1 and encoding a protein having activity of generating dihydroxyacetone using glycerin as a substrate by being localized in the mitochondria. Under stringent conditions, so-called specific hybrids are formed, but non-specific hybrids are not formed. For example, such conditions can be adequately determined with reference to Molecular Cloning: A Laboratory Manual (Third Edition). Specifically, the degree of stringency can be determined in accordance with the temperature and the salt concentration of a solution used for Southern hybridization and the temperature and the salt concentration of a solution used for the step of washing in Southern hybridization. Under stringent conditions, more specifically, the sodium concentration is 25 to 500 mM. In some embodiments, the sodium concentration may be 25 to 300 mM. The temperature is 42 C. to 68 C. In some embodiments, the temperature may be 42 C. to 65 C. Further specifically, the sodium concentration is 5SSC (83 mM NaCl, 83 mM sodium citrate), and the temperature is 42 C.

[0038] Examples of genes encoding cytoplasm-localized glycerin dehydrogenase include the gldA gene derived from Escherichia coli (NAD-dependent) and the gldA gene derived from Klebsiella pneumoniae and Thermoanaerobacterium thermosaccharolyticum. A majority of NAD-dependent glycerin dehydrogenase is derived from prokaryotes and is localized in the cytoplasm.

[0039] Specifically, the nucleotide sequence of the coding region in the gldA gene derived from E. coli is shown in SEQ ID NO: 3, and the amino acid sequence of the gldA protein (without a mitochondrial transport signal) is shown in SEQ ID NO: 4. The gene encoding cytoplasm-localized glycerin dehydrogenase is not limited to the gldA gene identified by SEQ ID NO: 3 and SEQ ID NO: 4, and it may be a paralogous gene or a homologous gene of the gldA gene in the narrow sense having different nucleotide and amino acid sequences.

[0040] The gene encoding glycerin dehydrogenase is not limited to the gene identified by SEQ ID NO: 3 and SEQ ID NO: 4. For example, it may be a gene encoding a protein comprising an amino acid sequence having 70% or higher sequence similarity to or identity with the amino acid sequence as shown in SEQ ID NO: 4 and having activity of generating dihydroxyacetone using glycerin as a substrate. In some embodiments, such sequence similarity or identity may be 80% or higher, 90% or higher, or 95% or higher. The degree of sequence similarity or identity can be determined using the BLASTN or BLASTX Program equipped with the BLAST algorithm (at default settings). The degree of sequence similarity is determined by subjecting a pair of amino acid sequences to pairwise alignment analysis, identifying completely identical amino acid residues and amino acid residues exhibiting physicochemically similar functions, determining the total number of such amino acid residues, and calculating the percentage of all the amino acid residues subjected to comparison accounted for by the total number of such amino acid residues. The degree of sequence identity is detennined by subjecting a pair of amino acid sequences to pairwise alignment analysis, identifying completely identical amino acid residues, and calculating the percentage of all the amino acid residues subjected to comparison accounted for by such amino acid residues.

[0041] Further, the gene encoding glycerin dehydrogenase is not limited to the gene identified by. SEQ ID NO: 3 and SEQ ID NO: 4. For example, it may be a gene encoding a protein comprising an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 4 by substitution, deletion, insertion, or addition of one or several amino acids and having activity of generating dihydroxyacetone using glycerin as a substrate. The term several used herein refers to, for example, 2 to 30. In some embodiments, it may refer to 2 to 20, 2 to 10, or 2 to 5.

[0042] Furthermore, the gene encoding glycerin dehydrogenase is not limited to the gene identified by SEQ ID NO: 3 and SEQ ID NO: 4. For example, it may be a gene hybridizing under stringent conditions to the full-length sequence or a partial sequence of a complementary strand of DNA comprising the nucleotide sequence as shown in SEQ ID NO: 3 and encoding a protein having activity of generating dihydroxyacetone using glycerin as a substrate. Under stringent conditions, so-called specific hybrids are formed, but non-specific hybrids are not formed. For example, such conditions can be adequately determined with reference to Molecular Cloning: A Laboratory Manual (Third Edition). Specifically, the degree of stringency can be determined in accordance with the temperature and the salt concentration of a solution used for Southern hybridization and the temperature and the salt concentration of a solution used for the step of washing in Southern hybridization. Under stringent conditions, more specifically, the sodium concentration is 25 to 500 mM. In some embodiments, the sodium concentration may be 25 to 300 mM. The temperature is 42 C. to 68 C. In some embodiments, the temperature may be 42 C. to 65 C. Further specifically, the sodium concentration is 5SSC (83 mM NaCl, 83 mM sodium citrate), and the temperature is 42 C.

[0043] A mitochondrial transport signal fused to the cytoplasm-localized glycerin dehydrogenase is not particularly limited. An example thereof is a given N-terminal region (i.e., a mitochondrial transport signal) in the mitochondria-localized glycerin dehydrogenase described above. For example, an N-terminal region may comprise 15 to 70 amino acid residues from the N terminus. In some embodiments, such region may comprise 20 to 50 amino acids or 25 to 45 amino acid residues from the N terminus. An example of a mitochondrial transport signal is a region comprising 30 amino acid residues from the N terminus of glycerin dehydrogenase (SEQ ID NO: 2) encoded by the Schizosaccharomyces pombe gld1 gene.

[0044] As mitochondrial transport signals, various known sequences can be used without particular limitation. Concerning a mitochondrial transport signal, a reference may be made to, for example, the EMBO Journal, vol. 5, no. 6, pp. 1335-1342, 1986. Also, protein subcellular localization prediction tools, such as TargetP (http://www.cbs.dtu.dk/services/TargetP/), may be used. This enables prediction of mitochondrial transport signals based on mitochondria-localized proteins.

[0045] As described above, whether or not a gene comprising a nucleotide sequence that differs from the nucleotide sequence as shown in SEQ ID NO: 1 or 3 or a gene encoding an amino acid sequence that differs from the amino acid sequence as shown in SEQ ID NO: 2 or 4 would function as a glycerin dehydrogenase gene may be determined by, for example, preparing an expression vector comprising the gene of interest incorporated into an adequate site between a promoter and a terminator, transforming an E. coli host using such expression vector, and assaying the glycerin dehydrogenase activity of the protein expressed. The term glycerin dehydrogenase activity refers to activity of generating dihydroxyacetone using glycerin as a substrate. Accordingly, glycerin dehydrogenase activity can be evaluated by preparing a solution containing glycerin as a substrate, allowing the target protein to react at an adequate temperature, and measuring the amount of glycerin that has decreased and/or the amount of dihydroxyacetone that has been generated.

[0046] [Xylose Metabolism-Associated Gene]

[0047] The transgenic yeast of the present disclosure may have ability of assimilating, for example, xylose among various types of pentoses (i.e., the xylose assimilating ability). Specifically, it can assimilate xylose contained in a medium to generate ethanol. Xylose contained in a medium may be obtained by saccharification of xylan or hemicellulose comprising xylose as a constituent saccharide. Alternatively, it may be supplied to a medium as a result of saccharification of xylan or hemicellulose contained in a medium by a saccharifying enzyme. The latter case refers to the so-called simultaneous saccharification and fermentation process.

[0048] Examples of yeasts having xylose-metabolizing ability include a yeast that has acquired xylose-metabolizing ability as a result of introduction of a xylose isomerase gene into a yeast that does not inherently have xylose-metabolizing ability and a yeast that has acquired xylose-assimilating ability as a result of introduction of another xylose assimilation-associated gene.

[0049] The xylose isomerase gene (the XI gene) is not particularly limited, and a gene originating from any organism species may be used. For example, a plurality of the xylose isomerase genes derived from the intestinal protozoa of termites disclosed in JP 2011-147445 A can be used without particular limitation. Examples of the xylose isomerase genes that can be used include a gene derived from the anaerobic fungus Piromyces sp. strain E2 (JP 2005-514951 A), a gene derived from the anaerobic fungus Cyllamyces aberensis, a gene derived Clostridium phytofermentans, and a gene derived from the Streptomyces murinus cluster.

[0050] Specifically, a xylose isomerase gene derived from the intestinal protozoa of Reticulitermes speratus may be used. The nucleotide sequence of the coding region of the xylose isomerase gene derived from the intestinal protozoa of Reticuliterhes speratus and the amino acid sequence of a protein encoded by such gene are shown in SEQ ID NO: 5 and SEQ ID NO: 6, respectively.

[0051] The xylose isomerase gene is not limited to the gene identified by SEQ ID NO: 5 and SEQ ID NO: 6. It may be a paralogous gene or a homologous gene in the narrow sense having different nucleotide and amino acid sequences.

[0052] The xylose isomerase gene is not limited to the gene identified by SEQ ID NO: 5 and SEQ ID NO: 6. For example, it may be a gene encoding a protein comprising an amino acid sequence having 70% or higher sequence similarity to or identity with the amino acid sequence as shown in SEQ ID NO: 6 and having xylose isomerase activity. In some embodiments, such sequence similarity or identity may be 80% or higher, 90% or higher, or 95% or higher. The degree of sequence similarity or identity can be determined using the BLASTN or BLASTX Program equipped with the BLAST algorithm (at default settings). The degree of sequence similarity is determined by subjecting a pair of amino acid sequences to pairwise alignment analysis, identifying completely identical amino acid residues and amino acid residues exhibiting physicochemically similar functions, determining the total number of such amino acid residues, and calculating the percentage of all the amino acid residues subjected to comparison accounted for by the total number of such amino acid residues. The degree of sequence identity is determined by subjecting a pair of amino acid sequences to pairwise alignment analysis, identifying completely identical amino acid residues, and calculating the percentage of all the amino acid residues subjected to comparison accounted for by such amino acid residues.

[0053] Further, the xylose isomerase gene is not limited to the gene identified by SEQ ID NO: 5 and SEQ ID NO: 6. For example, it may be a gene encoding a protein comprising an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 6 by substitution, deletion, insertion, or addition of one or several amino acids and having xylose isomerase activity. The term several used herein refers to, for example, 2 to 30. In some embodiments, it may refer to 2 to 20, 2 to 10, or 2 to 5.

[0054] Furthermore, the xylose isomerase gene is not limited to the gene identified by SEQ ID NO: 5 and SEQ ID NO: 6. For example, it may be a gene hybridizing under stringent conditions to the full-length sequence or a partial sequence of a complementary strand of DNA comprising the nucleotide sequence as shown in SEQ ID NO: 6 and encoding a protein having xylose isomerase activity. Under stringent conditions, so-called specific hybrids are foiined, but non-specific hybrids are not formed. For example, such conditions can be adequately determined with reference to Molecular Cloning: A Laboratory Manual (Third Edition). Specifically, the degree of stringency can be determined in accordance with the temperature and the salt concentration of a solution used for Southern hybridization and the temperature and the salt concentration of a solution used for the step of washing in Southern hybridization. Under stringent conditions, more specifically, the sodium concentration is 25 to 500 mM. In some embodiments, the sodium concentration may be 25 to 300 mM. The temperature is 42 C. to 68 C. In some embodiments, the temperature may be 42 C. to 65 C. Further specifically, the sodium concentration is 5SSC (83 mM NaCl, 83 mM sodium citrate), and the temperature is 42 C.

[0055] As described above, whether or not a gene comprising a nucleotide sequence that differs from the sequence as shown in SEQ ID NO: 5 or a gene encoding an amino acid sequence that differs from the sequence as shown in SEQ ID NO: 6 would function as a xylose isomerase gene may be determined by, for example, preparing an expression vector comprising the gene of interest incorporated into an adequate site between a promoter and a terminator, transforming an E. coli host using such expression vector, and assaying the xylose isomerase activity of the protein expressed. The term xylose isomerase activity refers to activity of isomerizing xylose into xylulose. Accordingly, xylose isomerase activity can be evaluated by preparing a solution containing xylose as a substrate, allowing the target protein to react at an adequate temperature, and measuring the amount of xylose that has decreased and/or the amount of xylulose that has been generated.

[0056] In some embodiments, a gene encoding mutant xylose isomerase comprising an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 6 by introduction of a particular mutation into a particular amino acid residue and having improved xylose isomerase activity may be used as a xylose isomerase gene. A specific example of a gene encoding mutant xylose isomerase is a gene encoding an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 6 by substitution of asparagine with cysteine at position 337. Xylose isomerase comprising an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 6 by substitution of asparagine with cysteine at position 337 has xylose isomerase activity superior to that of wild-type xylose isomerase. In addition, mutant xylose isomerase is not limited to the xylose isomerase resulting from substitution of asparagine with cysteine at position 337. Such mutant xylose isomerase may be prepared by substitution of, for example, asparagine at position 337 with an amino acid residue other than cysteine, asparagine at position 337 and another amino acid residue with other amino acids, or an amino acid residue other than cysteine at position 337 with another amino acid.

[0057] Meanwhile, examples of xylose metabolism-associated genes other than the xylose isomerase gene include a xylose reductase gene encoding xylose reductase that converts xylose into xylitol, a xylitol dehydrogenase gene encoding xylitol dehydrogenase that converts xylitol into xylulose, and a xylulokinase gene encoding xylulokinase that phosphorylates xylulose to produce xylulose 5-phosphate. Xylulose 5-phosphate produced by a xylulokinase enters the pentose phosphate pathway, and it is then metabolized therein.

[0058] Examples of xylose metabolism-associated genes include, but are not particularly limited to, a xylose reductase gene and a xylitol dehydrogenase gene derived from Pichia stipitis and a xylulokinase gene derived from Saccharomyces cerevisiae (see Eliasson A. et al., Appl. Environ. Microbiol., 66: 3381-3386; and Toivari M. N. et al., Metab. Eng., 3: 236-249). In addition, xylose reductase gene derived from Candida tropicalis or Candida prapsilosis, xylitol dehydrogenase gene derived from Candida tropicalis or Candida prapsilosis, and a xylulokinase gene derived from Pichia stipitis can be used.

[0059] Examples of yeasts that inherently have xylose-metabolizing ability include, but are not particularly limited to, Pichia stipitis, Candida tropicalis, and Candida prapsilosis.

[0060] [Arabinose Metabolism-Associated Gene]

[0061] The transgenic yeast of the present disclosure may have ability to assimilate, for example, arabinose among various pentose sugars (i.e., arabinose assimilating ability). Specifically, the transgenic yeast of the present disclosure may be capable of assimilating arabinose contained in a medium to produce ethanol. The arabinose assimilating ability can be imparted to a yeast that does not have the arabinose assimilating ability by introduction of the arabinose metabolism-associated gene, such as the L-arabinose isomerase gene, the L-ribulokinase gene, or the L-ribulose-5-phosphate-4-epimerase gene derived from prokaryotes or the L-arabitol-4-dehydrogenase gene or the L-xylose reductase gene derived from eukaryotes, into such yeast.

[0062] An example of the L-arabinose isomerase gene is the araA gene derived from Lactobacillus plantarum. The nucleotide sequence of the coding region of the araA gene derived from Lactobacillus plantarum and the amino acid sequence of the protein encoded by such gene are shown in SEQ ID NO: 7 and SEQ ID NO: 8, respectively.

[0063] The L-arabinose isomerase gene is not limited to the gene identified by SEQ ID NO: 7 and SEQ ID NO: 8, and it may be a paralogous gene or a homologous gene in the narrow sense having different nucleotide and amino acid sequences.

[0064] The L-arabinose isomerase gene is not limited to the gene identified by SEQ ID NO: 7 and SEQ ID NO: 8. For example, it may be a gene encoding a protein comprising an amino acid sequence having 70% or higher sequence similarity to or identity with the amino acid sequence as shown in SEQ ID NO: 8 and having L-arabinose isomerase activity. In some embodiments, such sequence similarity or identity may be 80% or higher, 90% or higher, or 95% or higher. The degree of sequence similarity or identity can be determined using the BLASTN or BLASTX Program equipped with the BLAST algorithm (at default settings). The degree of sequence similarity is determined by subjecting a pair of amino acid sequences to pairwise alignment analysis, identifying completely identical amino acid residues and amino acid residues exhibiting physicochemically similar functions, determining the total number of such amino acid residues, and calculating the percentage of all the amino acid residues subjected to comparison accounted for by the total number of such amino acid residues. The degree of sequence identity is determined by subjecting a pair of amino acid sequences to pairwise alignment analysis, identifying completely identical amino acid residues, and calculating the percentage of all the amino acid residues subjected to comparison accounted for by such amino acid residues.

[0065] The L-arabinose isomerase gene is not limited to the gene identified by SEQ ID NO: 7 and SEQ ID NO: 8. For example, it may be a gene encoding a protein comprising an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 8 by substitution, deletion, insertion, or addition of one or several amino acids and having L-arabinose isomerase activity. The term several used herein refers to, for example, 2 to 30. In some embodiments, it may refer to 2 to 20, 2 to 10, or 2 to 5.

[0066] The L-arabinose isomerase gene is not limited to the gene identified by SEQ ID NO: 7 and SEQ ID NO: 8. For example, it may be a gene hybridizing under stringent conditions to the full-length sequence or a partial sequence of a complementary strand of DNA comprising the nucleotide sequence as shown in SEQ ID NO: 7 and encoding a protein having L-arabinose isomerase activity. Under stringent conditions, so-called specific hybrids are formed, but non-specific hybrids are not formed. For example, such conditions can be adequately determined with reference to Molecular Cloning: A Laboratory Manual (Third Edition). Specifically, the degree of stringency can be determined in accordance with the temperature and the salt concentration of a solution used for Southern hybridization and the temperature and the salt concentration of a solution used for the step of washing in Southern hybridization.

[0067] Under stringent conditions, more specifically, the sodium concentration is 25 to 500 mM. In some embodiments, the sodium concentration may be 25 to 300 mM. The temperature is 42 C. to 68 C. In some embodiments, the temperature may be 42 C. to 65 C. Further specifically, the sodium concentration is 5SSC (83 mM NaCl, 83 mM sodium citrate), and the temperature is 42 C.

[0068] As described above, whether or not a gene comprising a nucleotide sequence that differs from the sequence as shown in SEQ ID NO: 7 or a gene encoding an amino acid sequence that differs from the sequence as shown in SEQ ID NO: 8 would function as a L-arabinose isomerase gene may be determined by, for example, preparing an expression vector comprising the gene of interest incorporated into an adequate site between a promoter and a terminator, transforming an E. coli host using such expression vector, and assaying the L-arabinose isomerase activity of the protein expressed. The term L-arabinose isomerase activity refers to activity of isomerizing L-arabinose into L-ribulose. Accordingly, L-arabinose isomerase activity can be evaluated by preparing a solution containing L-arabinose as a substrate, allowing the target protein to react at an adequate temperature, and measuring the amount of L-arabinose that has decreased and/or the amount of L-ribulose that has been generated.

[0069] An example of the L-ribulokinase gene is the araB gene derived from Lactobacillus plantarum. The nucleotide sequence of the coding region of the araB gene derived from Lactobacillus plantarum and the amino acid sequence of a protein encoded by such gene are shown in SEQ ID NO: 9 and SEQ ID NO: 10, respectively.

[0070] The L-ribulokinase gene is not limited to the gene identified by SEQ ID NO: 9 and SEQ ID NO: 10. It may be a paralogous gene or a homologous gene in the narrow sense having different nucleotide and amino acid sequences.

[0071] Further, the L-ribulokinase gene is not limited to the gene identified by SEQ ID NO: 9 and SEQ ID NO: 10. For example, it may be a gene encoding a protein comprising an amino acid sequence having 70% or higher sequence similarity to or identity with the amino acid sequence as shown in SEQ ID NO: 10 and having L-ribulokinase activity. In some embodiments, such sequence similarity or identity may be 80% or higher, 90% or higher, or 95% or higher. The degree of sequence similarity or identity can be determined using the BLASTN or BLASTX Program equipped with the BLAST algorithm (at default settings). The degree of sequence similarity is determined by subjecting a pair of amino acid sequences to pairwise alignment analysis, identifying completely identical amino acid residues and amino acid residues exhibiting physicochemically similar functions, determining the total number of such amino acid residues, and calculating the percentage of all the amino acid residues subjected to comparison accounted for by the total number of such amino acid residues. The degree of sequence identity is determined by subjecting a pair of amino acid sequences to pairwise alignment analysis, identifying completely identical amino acid residues, and calculating the percentage of all the amino acid residues subjected to comparison accounted for by such amino acid residues.

[0072] Further, the L-ribulokinase gene is not limited to the gene identified by SEQ ID NO: 9 and SEQ ID NO: 10. For example, it may be a gene encoding a protein comprising an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 10 by substitution, deletion, insertion, or addition of one or several amino acids and having L-ribulokinase activity. The term several used herein refers to, for example, 2 to 30. In some embodiments, it may refer to 2 to 20, 2 to 10, or 2 to 5.

[0073] Furthermore, the L-ribulokinase gene is not limited to the gene identified by SEQ ID NO: 9 and SEQ ID NO: 10. For example, it may be a gene hybridizing under stringent conditions to the full-length sequence or a partial sequence of a complementary strand of DNA comprising the nucleotide sequence as shown in SEQ ID NO: 9 and encoding a protein having L-ribulokinase activity. Under stringent conditions, so-called specific hybrids are formed, but non-specific hybrids are not formed. For example, such conditions can be adequately determined with reference to Molecular Cloning: A Laboratory Manual (Third Edition). Specifically, the degree of stringency can be determined in accordance with the temperature and the salt concentration of a solution used for Southern hybridization and the temperature and the salt concentration of a solution used for the step of washing in Southern hybridization. Under stringent conditions, more specifically, the sodium concentration is 25 to 500 MM. In some embodiments, the sodium concentration may be 25 to 300 mM. The temperature is 42 C. to 68 C. In some embodiments, the temperature may be 42 C. to 65 C. Further specifically, the sodium concentration is 5SSC (83 mM NaCl, 83 mM sodium citrate), and the temperature is 42 C.

[0074] As described above, whether or not a gene comprising a nucleotide sequence that differs from the sequence as shown in SEQ ID NO: 9 or a gene encoding an amino acid sequence that differs from the sequence as shown in SEQ ID NO: 10 would function as an L-ribulokinase gene may be determined by, for example, preparing an expression vector comprising the gene of interest incorporated into an adequate site between a promoter and a terminator, transforming an E. coli host using such expression vector, and assaying the L-ribulokinase activity of the protein expressed. The term L-ribulokinase refers to activity of catalyzing a reaction comprising phosphorylating L-ribulose to generate L-ribulose-5-phosphate. Accordingly, L-ribulokinase activity can be evaluated by preparing a solution containing L-ribulose as a substrate, allowing the target protein to react at an adequate temperature, and measuring the amount of L-ribulose that has decreased and/or the amount of L-ribulose-5-phosphate that has been generated.

[0075] An example of the L-ribulose-5-phosphate 4-epimerase gene is the araD gene derived from Lactobacillus plantarum. The nucleotide sequence of the coding region of the araD gene derived from Lactobacillus plantarum and the amino acid sequence of the protein encoded by such gene are shown in SEQ ID NO: 11 and SEQ ID NO: 12, respectively.

[0076] The L-ribulose-5-phosphate 4-epimerase gene is not limited to the gene identified by SEQ ID NO: 11 and SEQ ID NO: 12. It may be a paralogous gene or a homologous gene in the narrow sense having different nucleotide and amino acid sequences.

[0077] The L-ribulose-5-phosphate 4-epimerase gene is not limited to the gene identified by SEQ ID NO: 11 and SEQ ID NO: 12. For example, it may be a gene encoding a protein comprising an amino acid sequence having 70% or higher sequence similarity to or identity with the amino acid sequence as shown in SEQ ID NO: 12 and having L-ribulose-5-phosphate 4-epimerase activity. In some embodiments, such sequence similarity or identity may be 80% or higher, 90% or higher, or 95% or higher. The degree of sequence similarity or identity can be detei mined using the BLASTN or BLASTX Program equipped with the BLAST algorithm (at default settings). The degree of sequence similarity is determined by subjecting a pair of amino acid sequences to pairwise alignment analysis, identifying completely identical amino acid residues and amino acid residues exhibiting physicochemically similar functions, determining the total number of such amino acid residues, and calculating the percentage of all the amino acid residues subjected to comparison accounted for by the total number of such amino acid residues. The degree of sequence identity is determined by subjecting a pair of amino acid sequences to pairwise alignment analysis, identifying completely identical amino acid residues, and calculating the percentage of all the amino acid residues subjected to comparison accounted for by such amino acid residues.

[0078] Further, the L-ribulose-5-phosphate 4-epimerase gene is not limited to the gene identified by SEQ ID NO: 11 and SEQ ID NO: 12. For example, it may be a gene comprising an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 12 by substitution, deletion, insertion, or addition of one or several amino acids and encoding a protein having L-ribulose-5-phosphate 4-epimerase activity. The term several used herein refers to, for example, 2 to 30. In some embodiments, it may refer to 2 to 20, 2 to 10, or 2 to 5.

[0079] Furthermore, the L-ribulose-5-phosphate 4-epimerase gene is not limited to the gene identified by SEQ ID NO: 11 and SEQ ID NO: 12. For example, it may be a gene hybridizing under stringent conditions to the full-length sequence or a partial sequence of a complementary strand of DNA comprising the nucleotide sequence as shown in SEQ ID NO: 11 and encoding a protein having L-ribulose-5-phosphate 4-epimerase activity. Under stringent conditions, so-called specific hybrids are formed, but non-specific hybrids are not formed. For example, such conditions can be adequately determined with reference to Molecular Cloning: A Laboratory Manual (Third Edition). Specifically, the degree of stringency can be determined in accordance with the temperature and the salt concentration of a solution used for Southern hybridization and the temperature and the salt concentration of a solution used for the step of washing in Southern hybridization. Under stringent conditions, more specifically, the sodium concentration is 25 to 500 m. In some embodiments, the sodium concentration may be 25 to 300 mM. The temperature is 42 C. to 68 C. In some embodiments, the temperature may be 42 C. to 65 C. Further specifically, the sodium concentration is 5SSC (83 mM NaCl, 83 mM sodium citrate), and the temperature is 42 C.

[0080] As described above, whether or not a gene comprising a nucleotide sequence that differs from the sequence as shown in SEQ ID NO: 11 or a gene encoding an amino acid sequence that differs from the sequence as shown in SEQ ID NO: 12 would function as a L-ribulose-5-phosphate 4-epimerase gene may be determined by, for example, preparing an expression vector comprising the gene of interest incorporated into an adequate site between a promoter and a terminator, transforming an E. coli host using such expression vector, and assaying the L-ribulose-5-phosphate 4-epimerase activity of the protein expressed. The term L-ribulose-5-phosphate 4-epimerase activity refers to activity of catalyzing epimerization of L-ribulose-5-phosphate and D-xylulose-5-phosphate. Accordingly, L-ribulose-5-phosphate 4-epimerase activity can be evaluated by preparing a solution containing L-ribulose-5-phosphate as a substrate, allowing the target protein to react at an adequate temperature, and measuring the amount of L-ribulose-5-phosphate that has decreased and/or the amount of D-xylulose-5-phosphate that has been generated.

[0081] [Other Genes]

[0082] The transgenic yeast of the present disclosure may further comprise another gene (or other genes) introduced thereinto, and such another gene (or other genes) is (or are) not particularly limited. For example, the transgenic yeast may comprise a gene involving the saccharide metabolism of glucose introduced thereinto. For example, a transgenic yeast can have -glucosidase activity resulting from introduction of the -glucosidase gene.

[0083] The term -glucosidase activity used herein refers to the activity of catalyzing a hydrolysis reaction of a -glycosidic bond of a saccharide. Specifically, -glucosidase is capable of degrading a cellooligosaccharide, such as cellobiose, into glucose. The -glucosidase gene can be introduced in the form of a cell-surface display gene. The term cell-surface display gene used herein refers to a gene that is modified to display a protein to be encoded by the gene on a cell surface. For example, a cell-surface display -glucosidase gene results from fusion of a -glucosidase gene with a cell-surface localized protein gene. A cell-surface localized protein is fixed and present on a yeast cell surface layer. Examples include agglutinative proteins, such as - or a-agglutinin and FLO proteins. In general, a cell-surface localized protein comprises an N-terminal secretory signal sequence and a C-terminal GPI anchor attachment recognition signal sequence. While a cell-surface localized protein shares properties with a secretory protein in terms of the presence of a secretory signal, its secretory signal differs in that the cell-surface localized protein is transported while fixed to a cell membrane through a GPI anchor. When a cell-surface localized protein passes through a cell membrane, a GPI anchor attachment recognition signal sequence is selectively cut, it binds to a GPI anchor at a newly protruded C-terminal region, and it is then fixed to the cell membrane. Thereafter, the root of the GPI anchor is cut by phosphatidylinositol-dependent phospholipase C (PI-PLC). Subsequently, a protein separated from the cell membrane is integrated into a cell wall, fixed onto a cell surface layer, and then localized on a cell surface layer (see, for example, JP 2006-174767 A).

[0084] The -glucosidase gene is not particularly limited, and an example is a -glucosidase gene derived from Aspergillus aculeatus (Murai et al., Appl. Environ. Microbiol., 64: 4857-4861). In addition, a -glucosidase gene derived from Aspergillus oryzae, a -glucosidase gene derived from Clostridium cellulovorans, or a 3-glucosidase gene derived from Saccharomycopsis fibligera may be used.

[0085] In addition to or other than the -glucosidase gene, a gene encoding another cellulase-constituting enzyme may have been introduced into the transgenic yeast of the present disclosure. Examples of cellulase-constituting enzymes other than -glucosidase include exo-cellobiohydrolases that liberate cellobiose from the terminus of crystalline cellulose (CBM and CBH2) and endo-glucanase (EG) that cannot degrade crystalline cellulose but cleaves a non-crystalline cellulose (amorphous cellulose) chain at random.

[0086] In particular, an example of another gene to be introduced into a transgenic yeast is a gene capable of promoting the use of xylose in a medium. A specific example thereof is a gene encoding xylulokinase having activity of generating xylulose-5-phosphate using xylulose as a substrate. The metabolic flux of the pentose phosphate pathway can be improved through the introduction of the xylulokinase gene.

[0087] Further, a gene encoding an enzyme selected from the group of enzymes constituting a non-oxidative process in the pentose phosphate pathway can be introduced into the transgenic yeast of the present disclosure. Examples of enzymes constituting a non-oxidative process in the pentose phosphate pathway include ribose-5-phosphate isomerase, ribulose-5-phosphate-3-epimerase, transketolase, and transaldolase. In some embodiments, one or more genes encoding such enzymes may be introduced, two or more such genes may be introduced in combination, three or more genes may be introduced in combination, or all of the genes above may be introduced.

[0088] More specifically, the xylulokinase (XK) gene of any origin can be used without particular limitation. A wide variety of microorganisms, such as bacterial and yeasts, which assimilate xylulose, possess the XK gene. Information concerning XK genes can be obtained by searching the website of NCBI or other institutions, according to need. In some embodiments, such XK genes may be derived from yeasts, lactic acid bacteria, E. coli bacteria, or plants. An example of an XK gene is XKS1, which is an XK gene derived from the S. cerevisiae S288C strain (GenBank: 272979) (the nucleotide sequence and the amino acid sequence in the CDS coding region).

[0089] More specifically, a transaldolase (TAL) gene, a transketolase (TKL) gene, a ribulose-5-phosphate epimerase (RPE) gene, and a ribose-5-phosphate ketoisomerase (RKI) gene of any origin can be used without particular limitation. A wide variety of organisms comprising the pentose phosphate pathway possess such genes. For example, a common yeast such as S. cerevisiae possesses such genes. Information concerning such genes can be obtained from the website of NCBI or other institutions, according to need. Genes belonging to the same genus as the host eukaryotic cells, such as eukaryotic or yeast cells, may be used, and genes originating from the same species as the host eukaryotic cells may be used. A TAL1 gene, a TKL1 gene and a TKL2 gene, an RPE1 gene, and an RK11 gene may be used as the TAL gene, the TKL genes, the RPE gene, and the RKI gene, respectively. Examples of such genes include a TAL1 gene derived from the S. cerevisiae 5288 strain (GenBank: U19102), a TKL1 gene derived from the S. cerevisiae S288 strain (GenBank: X73224), an RPEI gene derived from the S. cerevisiae 5288 strain (GenBank: X83571), and an RKI1 gene derived from the S. cerevisiae 5288 strain (GenBank: Z75003).

[0090] <Production of Transgenic Yeast>

[0091] The transgenic yeast of the present disclosure can be produced by, for example, introducing the gene encoding glycerin dehydrogenase having a mitochondrial transport signal into a yeast having ability of metabolizing pentose, such as xylose or arabinose. Alternatively, the transgenic yeast of the present disclosure can be produced by introducing the xylose metabolism-associated enzyme gene or the arabinose metabolism-associated gene into a yeast having no pentose assimilating ability. It should be noted that another gene described above may be introduced when producing the transgenic yeast of the present disclosure.

[0092] When the glycerin dehydrogenase gene, the xylose metabolism-associated gene, the arabinose metabolism-associated gene, and other genes are to be introduced into a yeast, such genes may be simultaneously introduced thereinto, or such genes may be successively introduced with the use of different expression vectors.

[0093] Examples of host yeasts that can be used include, but are not particularly limited to, Candida Shehatae, Pichia stipitis, Pachysolen tannophilus, Saccharomyces cerevisiae, and Schizosaccaromyces pombe. In some embodiments, Saccharomyces cerevisiae may be used. Experimental yeasts may also be used from the viewpoint of experimental convenience, or industrial (practical) strains may also be used from the viewpoint of practical usefulness. Examples of industrial strains include yeasts used for the production of wine, sake, and shochu.

[0094] A host yeast may have homothallic properties. According to the technique disclosed in JP 2009-34036 A, multiple copies of genes can be easily introduced into a genome with the use of a yeast having homothallic properties. The term yeast having homothallic properties has the same meaning as the term homothallic yeast. Yeasts having homothallic properties are not particularly limited, and any yeasts can be used. An example of a yeast having homothallic properties is, but is not limited to, the Saccharomyces cerevisiae OC-2 train (NBRC2260). Examples of other yeasts having homothallic properties include an alcohol-producing yeast (Taiken No. 396, NBRCO216) (reference: Alcohol kobo no shottokuser (Various properties of alcohol-producing yeast), Shuken Kaiho, No. 37, pp. 18-22, 1998.8), an ethanol-producing yeast isolated in Brazil and in Japan (reference: Brazil to Okinawa de bunri shita Saccharomyces cerevisiae yaseikabu no idengakuteki seishitsu (Genetic properties of wild-type Saccharomyces cerevisiae isolated in Brazil and in Okinawa), the Journal of the Japan Society for Bioscience, Biotechnology, and Agrochemistry, Vol. 65, No. 4, pp. 759-762, 1991.4), and 180 (reference: Alcohol Hakkoryoku no tsuyoi kobo no screening (Screening of yeast having potent alcohol-fermenting ability), the Journal of the Brewing Society of Japan, Vol. 82, No. 6, pp. 439-443, 1987.6). In addition, the HO gene may be introduced into a yeast exhibiting heterothallic phenotypes in an expressible manner, and the resulting strain can be used as a yeast having homothallic properties. That is, the term yeast having homothallic properties used herein also refers to a yeast into which the HO gene has been introduced in an expressible manner.

[0095] Promoters of genes to be introduced are not particularly limited. For example, promoters of the glyceraldehyde-3-phosphate dehydrogenase gene (TDH3), the 3-phosphoglycerate kinase gene (PGK1), and the high-osmotic pressure response 7 gene (HOR7) can be used. In some embodiments, the promoter of the pyruvate decarboxylase gene (PDC1) may be used because of its high capacity for expressing target genes in a downstream region at high levels.

[0096] Specifically, such gene may be introduced into the yeast genome together with an expression-regulated promoter or another expression-regulated region. Such gene may be introduced into a host yeast genome in such a manner that expression thereof is regulated by a promoter or another expression-regulated region of a gene that is inherently present therein.

[0097] The gene can be introduced into the genome by any conventional technique known as a yeast transformation technique. Specific examples include, but are not limited to, electroporation (Meth. Enzym., 194, p. 182, 1990), the spheroplast technique (Proc. Natl. Acad. Sci., U.S.A., 75, p. 1929, 1978), and the lithium acetate method (J. Bacteriology, 153, p. 163, 1983; Proc. Natl. Acad. Sci., U.S.A., 75, p. 1929, 1978; Methods in yeast genetics, 2000 Edition: A Cold Spring Harbor Laboratory Course Manual).

[0098] <Production of Ethanol>

[0099] When producing ethanol with the use of the transgenic yeast described above, ethanol fermentation is carried out by culture in a medium containing at least pentose, such as xylose or arabinose. Specifically, a medium in which ethanol fermentation is carried out contains, as a carbon source, at least metabolizable pentose. The medium may be supplemented with another carbon source, such as glucose, in advance.

[0100] Pentose, such as xylose or arabinose, that is contained in a medium to be used for ethanol fermentation can be derived from a biomass. In other words, a medium to be used for ethanol fermentation may comprise a cellulosic biomass and hemicellulase that generates pentose, such as xylose or arabinose, through saccharification of hemicellulose contained in a cellulosic biomass. The cellulosic biomass may have been subjected to a conventional pretreatment technique. Examples of pretreatment techniques include, but are not particularly limited to, degradation of a lignin with a microorganism and grinding of a cellulosic biomass. For example, a ground cellulosic biomass may be subjected to pretreatment, such as soaking thereof in a dilute sulfuric acid solution, alkaline solution, or ionic solution, hydrothermal treatment, or fine grinding. Thus, the efficiency of biomass saccharification can be improved.

[0101] When producing ethanol with the use of the transgenic yeast described above, the medium may further comprise cellulose and cellulase. In such a case, the medium contains glucose generated by the action of cellulase imposed upon cellulose. When a medium used for ethanol fermentation contains cellulose, such cellulose can be derived from a biomass. In other words, a medium used for ethanol fermentation may comprise cellulase that is capable of saccharifying cellulose contained in a cellulosic biomass.

[0102] A saccharified solution resulting from saccharification of a cellulosic biomass may be added to the medium used for ethanol fermentation. In such a case, the saccharified solution contains remaining cellulose or cellulase and pentose, such as xylose or arabinose, derived from hemicellulose contained in a cellulosic biomass.

[0103] As described above, the method for producing ethanol of the present disclosure comprises a step of ethanol fermentation involving the use of at least pentose, such as xylose or arabinose, as a saccharide source. According to the method for producing ethanol of the present disclosure, ethanol can be produced through ethanol fermentation using pentose, such as xylose or arabinose, as a saccharide source. According to the method for producing ethanol with the use of the transgenic yeast of the present disclosure, ethanol fermentation is followed by recovery of ethanol from the medium. Ethanol may be recovered by any conventional means without particular limitation. After the completion of the process of ethanol fermentation mentioned above, for example, a liquid layer containing ethanol is separated from a solid layer containing the transgenic yeast or solid matter by solid-solution separation. Thereafter, ethanol contained in a liquid layer is separated and purified by distillation, so that highly purified ethanol can be recovered. The degree of ethanol purification can be adequately determined in accordance with the purpose of the use of ethanol.

[0104] In general, glycerin is known as a representative by-product of ethanol production by fermentation using a yeast. In order to improve an ethanol yield in ethanol production by fermentation, it is critical to reduce the amount of glycerin produced. When genes associated with the glycerin production pathway from glyceraldehyde-3-phosphate (i.e., GPD1, GPD2, GPP1, and GPP2 genes) are disrupted or expression levels thereof are lowered to reduce the amount of glycerin produced, however, drawbacks, such as a lowered ethanol production speed, have been pointed out (Appl. Environ. Microbiol., 2011, 77, 5857-5867; Appl. Environ. Microbiol., 2013, 79, 3273-3281).

[0105] As described in the examples below, the transgenic yeast of the present disclosure is characterized by a very low glycerin production level. It is generally known that glycerin is biosynthesized and accumulated in the cytoplasm. In order to accelerate glycerin metabolism and suppress the amount thereof produced, accordingly, it may be considered to enhance the glycerin dehydrogenase activity in the cytoplasm. While the transgenic yeast of the present disclosure comprises the glycerin dehydrogenase gene having a mitochondrial transport signal introduced thereinto to enhance the glycerin dehydrogenase activity in the mitochondria, such activity is not enhanced in the cytoplasm.

[0106] In the transgenic yeast of the present disclosure, in other words, metabolism of glycerin biosynthesized in the cytoplasm is accelerated in spite of high glycerin dehydrogenase activity levels in the mitochondria, and the amount of glycerin produced would be lowered to a significant extent. Compared with the transgenic yeast comprising the cytoplasm-localized glycerin dehydrogenase gene introduced thereinto, the amount of glycerin produced by the transgenic yeast of the present disclosure would be lowered to a greater extent.

[0107] The method for producing ethanol of the present disclosure may employ the so-called simultaneous saccharification and fermentation process in which the step of saccharification of cellulose contained in a medium with a cellulase proceeds simultaneously with the step of ethanol fermentation involving the use of saccharide sources (i.e., pentose, such as xylose or arabinose, and glucose generated by saccharification). The simultaneous saccharification and fermentation process refers to a processcarrying out saccharification of a cellulosic biomass and ethanol fermentation without distinction of step.

[0108] Methods of saccharification are not particularly limited. For example, an enzymatic method involving the use of a cellulase preparation, such as cellulase or hemicellulase, may be employed. A cellulase preparation contains a plurality of enzymes involved in degradation of a cellulose chain and a hemicellulose chain, and it exhibits a plurality of types of activity, such as endoglucanase activity, endoxylanase activity, cellobiohydrolase activity, glucosidase activity, and xylosidase activity. Cellulase preparations are not particularly limited, and examples include cellulases produced by Trichoderma reesei and Acremonium cellulolyticus. Commercially available cellulase preparations may also be used.

[0109] In the simultaneous saccharification and fermentation process, a cellulase preparation and the transgenic yeast are added to a medium containing a cellulosic biomass (a biomass after pretreatment may be used), and the transgenic yeast is cultured at given temperature. Culture may be carried out at any temperature without particular limitation, and the temperature may be 25 C. to 45 C. from the viewpoint of ethanol fermentation efficiency. In some embodiment, the temperature may be 30 C. to 40 C. The pH level of the culture solution may be 4 to 6. Agitation or shake culture may be employed. Alternatively, the simultaneous saccharification and fermentation process may be carried out irregularly in such a manner that saccharification is first carried out at an optimal temperature for an enzyme (40 C. to 70 C.), temperature is lowered to a given level (30 C. to 40 C.), and the transgenic yeast is then added thereto.

EXAMPLES

[0110] Hereafter, the present disclosure is described in greater detail with reference to the examples, although the technical scope of the present disclosure is not limited to these examples.

Example 1

[0111] In this example, effects of glycerin reduction attained by introducing the glycerin dehydrogenase gene having a mitochondrial transport signal into a transgenic yeast capable of metabolizing pentose such as xylose were inspected.

[0112] 1. Method

[0113] 1.1. Test Strains

[0114] Strains subjected to the fermentation test concerning the effects of glycerin reduction are as follows: a strain resulting from introduction of the NAD-dependent glycerin dehydrogenase gene (the gld1 gene) derived from a fission yeast, Schizosaccharomyces pombe, into a parent strain capable of metabolizing xylose and arabinose; a strain resulting from introduction of a gene derived from the gld1 gene by removal of a mitochondrial transport signal; a strain resulting from introduction of the glycerin dehydrogenase gene (gldA gene) derived from Escherichia coli (E. coli); and a strain resulting from introduction of the mitochondria-localized gldA gene comprising the gldA gene and a region encoding a sequence corresponding to the mitochondrial transport signal of the gld1 gene fused thereto. The parent strain described above was prepared by introducing a xylose metabolizing gene, the xylose isomerase (XI) gene derived from the intestinal protozoa of Reticulitermes speratus, and the arabinose metabolizing genes derived from lactic bacteria, Lactobacillus plantarum, such as the arabinose isomerase (araA) gene, the ribulokinase (araB) gene, and the ribulose 5 phosphate epimerase (araD) gene into the wine yeast, S. cerevisiae OC-2, reinforcing the the pentose phosphate pathway genes (TKLI, TAIL RPE1, and RKI1), the xylulokinase gene (XKS1), and the xylose and arabinose transporter gene (GAL2), and disrupting the GRE3 gene converting xylose into a by-product, xylitol.

[0115] Table 1 shows genotypes of strains used in the example.

TABLE-US-00001 TABLE 1 Strain Genotype Uz2937 GAD1/GAD1::GAL2 araA araB araD GRE3/gre3:: XI TKL1 TAL1 RPE1 RKI1 XKS1 Uz3102 PFK1/PFK1::gld1 (wild-type, mitochondria-localized) GAD1/GAD1::GAL2 araA araB araD GRE3/gre3:: XI TKL1 TAL1 RPE1 RKI1 XKS1 Uz3084 PFK1/PFK1::gld1 (mitochondrial transport signal sequence being removed) GAD1/GAD1::GAL2 araA araB araD GRE3/gre3:: XI TKL1 TAL1 RPE1 RKI1 XKS1 Uz3040 PFK1/PFK1::gldA (wild-type, cytoplasm-localized) GAD1/GAD1::GAL2 araA araB araD GRE3/gre3:: XI TKL1 TAL1 RPE1 RKI1 XKS1 Uz3083 PFK1/PFK1::gldA (mitochondrial transport signal sequence being fused, mitochondria-localized) GAD1/GAD1::GAL2 araA araB araD GRE3/gre3:: XI TKL1 TAL1 RPE1 RKI1 XKS1

[0116] 1.2. Plasmid for XI, TKL1, TAL1, RPE1, RKI1, and XKS1 Gene Expression and GRE3 Gene Disruption

[0117] A plasmid comprising a sequence necessary for introducing a mutant XI gene derived from the intestinal protozoa of Reticulitermes speratus, which is prepared by the total synthesis on the basis of the sequence designed by substituting asparagine with cysteine at amino acid 337 and changing codons over the entire region in accordance with the frequency of codon usage of the yeast (Katahira, S. et al., Biotechnology for Biofuels 10, 2017: 203) and TKLI, TALL RPE1, RKI1, and XXS1 genes derived from S. cerevisiae into the GRE3 gene locus of a yeast while disrupting the GRE3 gene; that is, pUC-5U_GRE3-P_HOR7-TKL1-TAL1-P_FBA1-P_ADH1-RPE1-RKI1-TEF1_P-P_TDH1-XIN337C-T_DIT1-P_TDH3-XKS1-LoxP-G418-LoxP-3U_GRE3, was prepared. The nucleotide sequence of the wild-type XI gene derived from the intestinal protozoa of Reticulitermes speratus and the amino acid sequence of the protein encoded by the gene are shown in SEQ ID NO: 5 and SEQ ID NO: 6, respectively.

[0118] This plasmid was constructed to comprise: the ADH1 gene comprising an HOR7 promoter added thereto; the TAL1 gene comprising an FBA1 promoter added thereto; the TAL1 gene comprising an ADH1 promoter added thereto; the RKI1 gene comprising a TEF1 promoter added thereto; the XKS1 gene comprising a TDH3 promoter and an HISS terminator added thereto; the mutant XI gene comprising a TDH1 promoter and a DIT1 terminator added thereto; a gene sequence of an upstream region of approximately 700 bp from the 5 terminus of the GRE3 gene (5U_GRE3) and a DNA sequence of a downstream region of approximately 1000 bp from the 3 terminus of the GRE3 gene (3U_GRE3) as the homologous recombination regions on the yeast genome; and the gene sequence comprising a G418 resistant gene as a marker (G418 marker). The marker gene is flanked by two LoxP sequences, and the marker gene can be removed upon Cre gene expression.

[0119] Each DNA sequence can be amplified by PCR using the primers listed in Table 2. In order to ligate DNA fragments, each primer comprises a DNA sequence added thereto in a manner such that the DNA sequence would overlap its adjacent DNA sequence by approximately 15 bp. The primers were used to amplify desired DNA fragments using, as a template, the S. cerevisiae OC-2 genome or DNA of the XI-synthesizing gene, and the DNA fragments were sequentially ligated using an In-Fusion HD Cloning Kit, followed by cloning into the pUC19 plasmid. Thus, the plasmid as a final product was obtained.

[0120] 1.3. Plasmid for GAL2, araA, araB, and araD Gene Expression

[0121] A plasmid comprising a sequence necessary for introducing the araA gene, the araB gene, and the araD gene derived from L. plantarum (see WO 2008/041840) and the GAL2 gene derived from S. cerevisiae into the GAD1 gene locus of a yeast; that is, pUC-5U500_GAD1-P_SED1-GAL2-T_RPL15A-P_TDH3-LParaB-T_DIT_1-P_HOR7-LParaA-T_RPL41B-T_RPL3-LParaD-P_FBA1-LoxP71-T_CYC1-Crei-P_GAL1-T_LEU2-Bla-P_TEF1-LoxP66-5U_GAD1, was prepared. The nucleotide sequence of the araA gene and the amino acid sequence of the protein encoded by the gene are shown in SEQ ID NO: 7 and SEQ ID NO: 8, respectively, the nucleotide sequence of the araB gene and the amino acid sequence of the protein encoded by the gene are shown in SEQ ID NO: 9 and SEQ ID NO: 10, respectively, and the nucleotide sequence of the araD gene and the amino acid sequence of the protein encoded by the gene are shown in SEQ ID NO: 11 and SEQ ID NO: 12, respectively. The araA gene, the araB gene, and the araD gene used in this example were prepared by the total synthesis on the basis of the nucleotide sequence designed by changing codons in accordance with the frequency of codon usage of the yeast.

[0122] This plasmid was constructed to comprise: the araB gene comprising a TDH3 promoter and a DIT1 terminator added thereto; the araA gene comprising a HOR7 promoter and a RPL41B terminator added thereto; the araD gene comprising a FBA1 promoter and a RPL3 terminator added thereto; the GAL2 gene comprising a SED1 promoter and a RPL15A terminator added thereto; a gene sequence of an upstream region of approximately 500 to 1250 bp from the 5 terminus of the GAD1 gene (5U500_GAD1) and a DNA sequence of a downstream region of approximately 500 bp from a site approximately 500 bp upstream from the 5 terminus of the GAD1 gene (3U_GAD1) as the homologous recombination regions on the yeast genome; the gene sequence comprising a blasticidin resistant gene as a marker (bla marker); and a DNA recombinase Cre gene that undergoes ioxP-sequence-specific recombination. The Cre gene (NCBI Accession Number: 27774771; prepared by the total synthesis by changing codons over the entire region in accordance with the frequency of codon usage of the yeast) used herein comprises a GUI promoter added thereto, it can be induced to express in a galactose-containing medium, and it comprises an intron sequence included in the COXSB gene of S. cerevisiae BY4742 fused thereto so as to suppress expression thereof in E. coli (Cre-inducible expression cassette).

[0123] The marker gene and the Cre gene are flanked by two LoxP sequences, and the marker gene and the Cre gene can be simultaneously removed upon Cre gene expression.

[0124] Each DNA sequence can be amplified by PCR using the primers shown in Table 2. In order to ligate DNA fragments, each primer comprises a DNA sequence added thereto in a manner such that the DNA sequence would overlap its adjacent DNA sequence by approximately 15 bp. With the use thereof, DNA fragments of interest were amplified using, as templates, the S. cerevisiae BY4742 and OC-2 genomes or DNA of the araA, araB, or araD-synthesizing gene and the pYES6/CT plasmid (bla marker, Thermo Fisher Scientific), and the DNA fragments were sequentially ligated using an In-Fusion HD Cloning Kit, followed by cloning into the pUC19 plasmid. Thus, the plasmid as a final product was obtained.

[0125] 1.4. Plasmid for gld1 Gene Expression

[0126] While retaining the PFKI gene in the PFKI gene locus, a plasmid comprising a sequence necessary for introducing the gld1 gene derived from S. pombe (the gene comprising a mitochondrial transport signal) into a yeast; that is, pUC-3U_PFK1-P_TDH3-gld1-T_RPL41B-LoxP66-P_TEF 1-SAT-T_LEU2-P_GAL1-Crei-T_CYC1-LoxP71-3U300_PFK1, was prepared. The nucleotide sequence of the gld1 gene derived from S. pombe and the amino acid sequence of the protein encoded by the gene are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

[0127] This plasmid was constructed to comprise: the gld1 gene comprising a TDH3 promoter and an RPL41B terminator added thereto; a DNA sequence of an upstream region of approximately 4000 bp from a site approximately 300 bp downstream from the 3 terminus of the PFK1 gene (3U_PFK1) and a DNA sequence of a downstream region of approximately 500 bp from a site approximately 300 bp downstream from the 3 terminus of the PFK1 gene (3U300_PFK1) as the homologous recombination regions on the yeast genome; the gene sequence comprising a nourseothricin resistant gene as a marker (nat marker); and the Cre-inducible expression cassette. The marker gene and the Cre gene are flanked by two LoxP sequences, and the marker gene and the Cre gene can be simultaneously removed upon Cre gene expression.

[0128] Each DNA sequence can be amplified by PCR using the primers shown in Table 2. In order to ligate DNA fragments, each primer comprises a DNA sequence added thereto in a manner such that the DNA sequence would overlap its adjacent DNA sequence by approximately 15 bp. With the use thereof, DNA fragments of interest were amplified using, as templates, genomic DNA of S. cerevisiae OC-2, genomic DNA of E. coli K-12, genomic DNA of S. pombe, and pUC_-5_U500GAD1-P_SED1-GAL2-T_RPL15A-P_TDH3-LParaB_-T_DIT1-P_HOR7-LParaA-T_RPL41B-T_RPL3-LParaD-P_FBA1-LoxP71-T_CYC1-Crei-P_GAL1-T_LEU2-Bla-P_TEF1-LoxP66-5U_GAD1, and the DNA fragments were sequentially ligated using an In-Fusion HD Cloning Kit, followed by cloning into the pUC19 plasmid. Thus, the plasmid as a final product was obtained.

[0129] 1.5. Plasmid for Cytoplasm-Localized gld1 Gene Expression

[0130] While retaining the PFKI gene in the PFK1. gene locus, a plasmid comprising a sequence necessary for introducing the gld1 gene from which the mitochondrial transport signal has been removed into a yeast; that is, pUC-3U_PFK1-P_TDH3-gld1cy-T_RPL41B-LoxP66-P_TEF1-SAT-T_LEU2-P_GAL1-Crei-T_CYC1-LoxP71-3U300_PFK1, was prepared.

[0131] This plasmid was constructed to comprise: the cytoplasm-localized gld1 gene comprising a TDH3 promoter and an RPL41B terminator added thereto (from which a DNA sequence corresponding to 30 amino acids from the 5 terminus, which is equivalent to the mitochondrial transport signal, has been removed); 3U_PFK1 and 3U300_PKF1 as homologous recombination regions on a yeast genome; the nat marker; and a Cre-inducible expression cassette. The marker gene and the Cre gene are flanked by two LoxP sequences, and the marker gene and the Cre gene can be simultaneously removed upon Cre gene expression.

[0132] Each DNA sequence can be amplified by PCR using the primers shown in Table 2. In order to ligate DNA fragments, each primer comprises a DNA sequence added thereto in a manner such that the DNA sequence would overlap its adjacent DNA sequence by approximately 15 bp. With the use thereof, DNA fragments of interest were amplified using, as a template, pUC-3U_PFK1-P_RPL41B-LoxP66-P_TEF1-SAT-T_LEU2-P_GAL1-Crei-T_CYC1-LoxP71-3U300_PFK, and the DNA fragments were sequentially ligated using an In-Fusion HID Cloning Kit, followed by cloning into the pUC19 plasmid. Thus, the plasmid as a final product was obtained.

[0133] 1.6. Plasmid for gldA Gene Expression

[0134] While retaining the PFK1 gene in the PFK1 gene locus, a plasmid comprising a sequence necessary for introducing the gldA gene derived from E. coli into a yeast; that is, UC-3U_PFK1-P_TDH3-gldA-T_RPL41B-LoxP66-P_TEF1-SAT-T_LEU2-P_GAL1-Crei-T_CYC1-LoxP71-3U300 PFK1, was prepared. The nucleotide sequence of the gldA gene derived from E. coli and the amino acid sequence of the protein encoded by the gene are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

[0135] This plasmid was constructed to comprise: the gldA gene comprising a TDH3 promoter and an RPL41B terminator added thereto; a DNA sequence of an upstream region of approximately 4000 bp from a site approximately 300 bp downstream from the 3 terminus of the PFK1 gene (3U_PFK1) and a DNA sequence of a downstream region of approximately 500 bp from a site approximately 300 by downstream from the 3 terminus of the PFK1 gene (3U300_PFK1) as the homologous recombination regions on the yeast genome; the gene sequence comprising a nourseothricin resistant gene as a marker (nat marker); and the Cre-inducible expression cassette. The marker gene and the Cre gene are flanked by two LoxP sequences, and the marker gene and the Cre gene can be simultaneously removed upon Cre gene expression.

[0136] Each DNA sequence can be amplified by PCR using the primers shown in Table 2. In order to ligate DNA fragments, each primer comprises a DNA sequence added thereto in a manner such that the DNA sequence would overlap its adjacent DNA sequence by approximately 15 bp. With the use thereof, DNA fragments of interest were amplified using, as templates, the gldA synthesizing gene and pUC-3U_PFK1-P_TDH3-gld1-T_RPL41B-LoxP66-P_TEF1-SAT-T_LEU2-P_GAL1-Crei-T_CYC1-LoxP71-3U300_PFK, and the DNA fragments were sequentially ligated using an In-Fusion HD Cloning Kit, followed by cloning into the pUC19 plasmid. Thus, the plasmid as a final product was obtained.

[0137] 1.7. Plasmid for Mitochondria-Localized gldA Gene Expression

[0138] While retaining the PFK1 gene in the PFK1 gene locus, a plasmid comprising a sequence necessary for introducing a fusion gene comprising the gidA gene derived from E. coli and a region encoding the mitochondrial transport signal (a sequence of 30 amino acid residues from the N terminus of the amino acid sequence as shown in SEQ ID NO: 2) fused thereto into a yeast; that is, pUC-3U_PFK1-PTDH3-gldAmt-T_RPL41B-LoxP66-P_TEF1-SAT-T_CYC1-LoxP71-3U300_PFK1, was prepared.

[0139] This plasmid was constructed to comprise: the gidA gene comprising a TDH3 promoter, an RPL41B teiminator, and a mitochondrial transport signal of the gid1 gene derived from S. pombe added thereto; a DNA sequence of an upstream region of approximately 4000 bp from a site approximately 300 bp downstream from the 3 terminus of the PFK1 gene (3U_PFK1) and a DNA sequence of a downstream region of approximately 500 bp from a site approximately 300 bp downstream from the 3 terminus of the PFK1 gene (3U300_PFK1) as the homologous recombination regions on the yeast genome; the gene sequence comprising a nourseothricin resistant gene as a marker (nat marker); and the Cre-inducible expression cassette. The marker gene and the Cre gene are flanked by two LoxP sequences, and the marker gene and the Cre gene can be simultaneously removed upon Cre gene expression.

[0140] Each DNA sequence can be amplified by PCR using the primers shown in Table 2. In order to ligate DNA fragments, each primer comprises a DNA sequence added thereto in a manner such that the DNA sequence would overlap its adjacent DNA sequence by approximately 15 bp. With the use thereof, DNA fragments of interest were amplified using, as templates, genomic DNA of S. pombe and pUC-3U_PFK1-P_TDH3-gldA-T_RPL41B-LoxP66-P_TEF1-SAT-T_GAL1-Crei-T_CYC1-LoxP71-3U300_PFK1, and the DNA fragments were sequentially ligated using an In-Fusion HD Cloning Kit, followed by cloning into the pUC19 plasmid. Thus, the plasmid as a final product was obtained.

TABLE-US-00002 TABLE2 SEQID AmplifiedDNAfragment Primersequence(5-3) No: pUC-5U_GRE3-P_HOR7-TKL1-TAL1-P_FBA1-P_ADH1-RPE1-RKI1-TEF1_P-P_TDH1-XIN337C-T_DIT1- P_TDH3-XKS1-LoxP-G418-LoxP-3U_GRE3 5U_GRE3 TGGGAATATTACCGCTCGAAG 13 CTTTAAAAAATTTCCAATTTTCCTTTACG 14 HOR7promoter GGAAATTTTTTAAAGTCGCAGCCACGGGTCAAC 15 GTGAATTGAGTCATTTTTTATTATTAGTCTTTTTTT 16 TTTTTGACAATATC TKL1 ATGACTCAATTCACTGACATTGATAAGCTAG 17 (tenninatorregionincluded) CCTTAAATCAACGTCATATTCTTTATTGGCTTTAT 18 AC TA1 GACGTTGATTTAAGGTGGTTCCGG 19 (terminatorregionincluded) ATGTCTGAACCAGCTCAAAAGAAAC 20 FBA1promoter AGCTGGTTCAGACATTTTGAATATGTATTACTTGG 21 TTATGGTTATATATGAC CACCCAAATGAATTGAAAGCGACTGGTAGAGAGC 22 GACTTTG ADH1promoter GCTTTCAATTCATTTGGGTGTG 23 TGTATATGAGATAGTTGATTGTATGCTTGG 24 RPE1 ACTATCTCATATACAATGGTCAAACCAATTATAG 25 (terminatorregionincluded) CTCCC AAATGGATATTGATCTAGATGGCGG 26 RKI1 GATCAATATCCATTTCTTGGTGTGTCATCGGTAGT 27 (terminatorregionincluded) AACGCC AGTTTTAATTACAAAATGGCTGCCGGTGTCCCAA 28 A TEF1promoter TTGTAATTAAAACTTAGATTAGATTGCTATGCTTT 29 C AGGAACAGCCGTCAAGGG 30 TDH1promoter TTGACGGCTGTTCCTCTTCCCTTTTACAGTGCTTC 31 AAAAATTTGAGACATTTTGTTTTGTGTGTAAATTT 32 AGTGAAG XI ATGTCTCAAATTTTTAAGGATATCCCAG 33 AGCGCTCTTACTTTAGCGATCGCACTAGTTTATTG 34 AAACAAAATTTGGTT DIT1terminator TAAAGTAAGAGCGCTACATTGGTCTACC 35 TAACATTCAACGCTATTACTCCGCAACGCTTTTCT 36 G TDH3promoter TAGCGTTGAATGTTAGCGTCAACAAC 37 TACTGAACACAACATTTTGTTTGTTTATGTGTGTT 38 TATTCG XKS1 ATGTTGTGTTCAGTAATTCAGAGACAG 39 (terminatorregionincluded) AAATAATCGGTGTCATTAGATGAGAGTCTTTTCCA 40 GTTC HIS3terminator TGACACCGATTATTTAAAGCTGCAG 41 (apartofLoxPsequence ATAATGTATGCTATACGAAGTTATAGGGAAAGAT 42 included) ATGAGCTATACAGCGGAATTAGAGCGCGCCTCGT TC CYC1promoter TATAGCATACATTATACGAAGTTATACGACATCG 43 (apartofLoxPsequence TCGAATATG included) TTGAATATGGCTCATTATTAATTTAGTGTGTGTAT 44 TTGTGTTTGTGTG G418resistantgene ATGAGCCATATTCAACGGGAAAC 45 TTTAGTAGACATGCATTACAACCAATTAACCAATT 46 CTG URA3terminator TGCATGTCTACTAAACTCACAAATTAGAGCTTCA 47 (apartofLoxPsequence ATT included) ATAATGTATGCTATACGAAGTTATGGGTAATAAC 48 TGATATAATTAAATTGAAGC 3U_GRE3 TATAGCATACATTATACGAAGTTATTGACACCGA 49 (apartofLoxPsequence TTATTTAAAGCTGCAGCATACTCCAGCCAGTAAA included) ATCCATACTCAAC GTCTTTTTGCCAGCCAGTCC 50 pUC19 GGCTGGCAAAAAGACGGCCCTGCATTAATGAATC 51 G GCGGTAATATTCCCAACTAGTGGATCATCCCCAC 52 G pUC-5U500_GAD1-P_SED1-GAL2-T_RPL15A-P_TDH3-LParaB-T_DIT1-P_HOR7-LParaA-T_RPL41B- T_RPL3-LParaD-P_FBA1-LoxP71-T_CYC1-Crei-P_GAL1-T_LEU2-Bla-P_TEF1-LoxP66-5U_GAD1 5U500_GAD1 ACGGCCAGTGAATTCGGCTGATGTAATGGTATTG 53 TTATTCAACC GCAGATGCATGGATCGTTTTTACCAGCATCAGCG 54 CCTAGGAAC SED1promoter AACGATCCATGCATCTGCC 55 CTTAATAGAGCGAACGTATTTTATTTTGCTTGTCT 56 TTGTAGTTACG GAL2 TACGTTCGCTCTATTAAGATGGCAGTTGAGGAGA 57 ACAATATG TATTTTCCATCAACCAGCTTATTCTAGCATGGCCT 58 TGTACC RPL15Aterminator GCTGGTTGATGGAAAATATAATTTTATTGG 59 GGAAAAACGGGAAGAAAAGGAAAG 60 TDH3promoter TTTTCTTCCCGTTTTTCCTAGCGTTGAATGTTAGCG 61 TC CATTTTGTTTGTTTATGTGTGTTTATTCG 62 araB ACATAAACAAACAAAATGAATTTGGTCGAAACCG 63 C AGCGCTCTTACTTTATTAGTATTTAATAGCTTGAC 64 CAGCGGC DIT1terminator TAAAGTAAGAGCGCTACATTGGTCTACC 65 TTACTCCGCAACGCTTTTCTGAAC 66 HOR7promoter AGCGTTGCGGAGTAATCGCAGCCACGGGTCAAC 67 TTTTTATTATTAGTCTTTTTTTTTTTTGACAATATC 68 TGTATGATTTG araA AGACTAATAATAAAAATGTTGTCCGTTCCAGATT 69 ATGAATTTTG TTGCTCTCAATCCGCTTATTTTAAGAAAGCCTTTG 70 TCATACCAAC RPL41Bterminator GCGGATTGAGAGCAAATCGTTAAGT 71 AGAGGCATAGCGGCAAACTAAG 72 RPL3terminator TGCCGCTATGCCTCTAAACAAGCTCCCAAGGGC 73 GAAGTTTTGTTAGAAAATAAATCATTTTTTAATTG 74 AGCATTC araD ATTTTCTAACAAAACTTCTTACTTTCTAACAGCGT 75 GATCTTTTG AAGTAATACATATTCAAAATGTTGGAAGCATTGA 76 AGCAAGAAG FBA1promoter CATTTTGAATATGTATTACTTGGTTATGGTTATAT 77 (apartofLoxPsequence ATGACAAAA included) ATAGCATACATTATACGAACGGTATGACACCGAT 78 TATTTAAAGCTGCAGCATACACTGGTAGAGAGCG ACTTTGTATGC CYC1terminator TATAATGTATGCTATACGAAGTTATAGCTTGCAA 79 (apartofLoxPsequence ATTAAAGCCTTCGAGCGTCCCAAAACCTTC included) TTAGTTATGTCACGCTTACATTCACG 80 Cre3-terminalside GCTTTCGAAAGAACTGATTTCGATC 81 GCGTGACATAACTAATCAATCACCATCTTCCAAC 82 AATC COX5B-derivedintron GCTAAGCAGGCTTTGGCATGTATAACAAACACTG 83 ATTTTTGTTTTGAGTTTTAAAAGATATCCATTT AGTTCTTTCGAAAGCCTGCAAAACTTGTGCTTGTA 84 CACCTCGAATGTTAGTAAATGGATATCTTTT Cre5-terminalside CAAGGAGAAAAAACCATGTCTAACTTGTTGACTG 85 TTC CAAAGCCTGCTTAGCTCTTTCAC 86 GAL1promoter TGCATGTCTACTAAACTCACAAATTAGAGCTTCA 87 ATTTAATTATATCAGTTATTACCCACGGATTAGAA GCCGCCG GGTTTTTTCTCCTTGACGTTAAAGTATAG 88 blamarker TTTAGTAGACATGCATTAGCCCTCCCACACATAAC 89 (apartofLoxPsequence ATAGCATACATTATACGAAGTTATCCCACACACC 90 included) ATAGCTTCAAAATG 5U_GAD1 ATAGCATACATTATACGAAGTTATCCCACACACC 91 (apartofLoxPsequence ATAGCTTCAAAATG included) TCCCCGGGTACCGAGTATTCCTTGTTTTGTTCAGC 92 CTGG pUC-3U_PFK1-P_TDH3-gld1-T_RPL41B-LoxP66-P_TEF1-SAT-T_LEU2-P_GAL1-Crei-T_CYC1- LoxP71-3U300_PFK1 3U_PFK1 ATTTAGCATCGTGCATGGG 93 TAACATTCAACGCTAATTCCATAGCTTAGTTTAAT 94 CAAGGC TDH3promoter TAGCGTTGAATGTTAGCGTCAACAAC 95 CATTTTGTTTGTTTATGTGTGTTTATTCG 96 gld1 ACATAAACAAACAAAATGATTGGTCCTCGTCTTT 97 G TTGCTCTCAATCCGCCTATGGATGAATGTCGGTCA 98 AG RPL41Bterminator GCGGATTGAGAGCAAATCGTTAAGT 99 (apartofLoxPsequence ATAATGTATGCTATACGAACGGTAAGGGAAAGAT 100 included) ATGAGCTATACAGCGGAATTAGAGGCATAGCGGC AAACTAAG TEF1promoter ATAGCATACATTATACGAAGTTATCCCACACACC 101 (apartofLoxPsequence ATAGCTTCAAAATG included) CACCGAAATCTTCATCCCTTAGATTAGATTGCTAT 102 GC nourseothricinresistantgene ATGAAGATTTCGGTGAT 103 TTAGGCGTCATCCTGTGCTC 104 LEU2terminator CAGGATGACGCCTAAAAAGATTCTCTTTTTTTATG 105 ATATTTGTAC AGGAATCATAGTTTCATGATTTTCTGTTAC 106 Creinducibleexpression GAAACTATGATTCCTACGGATTAGAAGCCGCCG 107 cassette(apartofLoxP TATAATGTATGCTATACGAAGTTATAGCTTGCAA 108 sequenceincluded) ATTAAAGCCTTCGAGCGTCCCAAAACCTTC 3U300_PFK1 ATAGCATACATTATACGAACGGTATGACACCGATTA 109 (apartofLoxPsequence TTTAAAGCTGCAGCATACTTGCATTATTCAAGTTTT included) AGGGTG CATTCTGTATGCGATGCCC 110 pUC19 ATCGCATACAGAATGGATCCCCGGGTACCGAGC 111 TGCACGATGCTAAATGATCCTCTAGAGTCGACCT 112 GC pUC-3U_PFK1-P_TDH3-gld1cy-T_RPL41B-LoxP66-P_TEF1-SAT-T_LEU2-P_GAL1-Crei-T_CYC1- LoxP71-3U300_PFK1 Sequenceotherthangld1 GCGGATTGAGAGCAAATCGTTAAGT 113 TTTGTTTGTTTATGTGTGTTTATTCGAAACTAAGTT 114 CTTGGTGTTTTAAAACTAA gld1withthemitochondrial CACACATAAACAAACAAAATGGCCGTTGCACAAC 115 transportsignalbeingremoved GTTGGGGC TTGCTCTCAATCCGCCTATGGATGAATGTCGGTCA 116 AG pUC-3U_PFK1-P_TDH3-gldA-T_RPL41B-LoxP66-P_TEF1-SAT-T_LEU2-P_GAL1-Crei-T_CYC1- LoxP71-3U300_PFK1 SequenceotherthangldA GCGGATTGAGAGCAAATCGTTAAGT 117 TTTGTTTGTTTATGTGTGTTTATTCGAAACTAAGTT 118 CTTGGTGTTTTAAAACTAA gldA CACACATAAACAAACAAAATGGACCGCATTATTC 119 AATCACCGG TTGCTCTCAATCCGCTTATTCCCACTCTTGCAGGA 120 AAC pUC-3U_PFK1-P_TDH3-gldAmt-T_RPL41B-LoxP66-P_TEF1-SAT-T_LEU2-P_GAL1-Crei-T_CYC1- LoxP71-3U300_PFK1 Sequenceotherthangldl GCGGATTGAGAGCAAATCGTTAAGT 121 mitochondrialtransportsignal TTTGTTTGTTTATGTGTGTTTATTCGAAACTAAGTT 122 fusedtogldA CTTGGTGTTTTAAAACTAA gld1mitochondrialtransport ACATAAACAAACAAAATGATTGGTCCTCGTCTTT 123 signal G TTGAATAATGCGGTCCATAGAGGCGAGCGCAAAT 124 ACTTTAG

[0141] 1.8. Preparation of a Strain in which XI, TKL1, TAL1, RPE1, RKI1, and XKS1, GAL2, araA, araB, and araD Genes are Expressed and GRE3 Gene is Heterozygously Disrupted

[0142] The yeast was transformed using the diploid yeast, S. cerevisiae OC-2 (NBRC2260), as a host strain and the Frozen-EZ Yeast Transformation II (ZYMO RESEARCH) in accordance with the protocols included thereinto.

[0143] A fragment obtained by amplification of the homologous recombination site of the plasmid, pUC-5U_GRE3-P_HOR7-TKL1-TAL1-P_FBA1-PADH1-RPE1-RKI1-TEF1_P-P_TDH1-XIN337C-T_DIT1-P_TDH3-XKS1-LoxP-G418-LoxP-3U_GRE3, by PCR was used to transform the OC2 strain, the resultant was applied to a G418-containing YPD agar medium, and the grown colonies were then purified. In addition, a fragment obtained by amplification of the homologous recombination site of the plasmid, pUC-5U500_GAD1-P_SED1-GAL2-T_RPL15A-P_TDH3-LParaB-T_DIT1-P_HOR7-LParaA-T_RPL41B-T_RPL3-LParaD-P_FBA 1-LoxP71-T_CYC1-Crei-P_GAL1-T_LEU2-Bla-P_TEF1-LoxP66-5U_GAD1, by PCR was used to transform the strain mentioned above, the resultant was applied to a blasticidin-containing YPE agar medium, and the grown colonies were then purified. The resultant was designated as the Uz2937 strain. Heterozygous recombination (1 copy) of the gene introduced into the elite strain was observed, and the GRE3 gene was found to have been heterozygously disrupted.

[0144] 1.9. Preparation of a Strain Into Which the Glycerin Dehydrogenase Gene has Been Introduced

[0145] A fragment obtained by amplification of a region between homologous recombination sites of the plasmid prepared in 1.4. (pUC-3U_PFK1-P_TDH3-gld1-T_RPL41B-LoxP66-P_TEF1-SAT-T_LEU2-P_GAL1-Crei-T_CYC1-LoxP71-3U300_PFK1) by PCR was used to transform the Uz2937 strain. Thereafter, the resultant was applied to a nourseothricin-containing YPD agar medium, and the grown colonies were then purified. The purified strain was designated to be Uz3102.

[0146] A fragment obtained by amplification of a region between homologous recombination sites of the plasmid prepared in 1.5 (pUC-3U_PFK1-P_TDH3-gld1cy-T_RPL41B-LoxP66-P_TEF1-SAT-T_LEU2-P_GAL1-Crei-T_CYC1-LoxP71-3U300_PFK1) by PCR was used to transform the Uz2937 strain. Thereafter, the resultant was applied to a nourseothricin-containing YPD agar medium, and the grown colonies were then purified. The purified strain was designated to be Uz3084.

[0147] Also, a fragment obtained by amplification of a region between homologous recombination sites of the plasmid prepared in 1.6 (pUC-3U_PFK1-P_TDH3-gldA-T_RPL41B-LoxP66-P_TEF1-SAT-T_LEU2-P_GAL1-Crei-T_CYC1-LoxP71-3U300_PFK1) by PCR was used to transform the Uz2937 strain. Thereafter, the resultant was applied to a nourseothricin-containing YPD agar medium, and the grown colonies were then purified. The purified strain was designated to be Uz3040.

[0148] Also, a fragment obtained by amplification of a region between homologous recombination sites of the plasmid prepared in 1.7 (pUC-3U_PFK1-P_TDH3-gldAmt-T_RPL41B-LoxP66-P_TEF1-SAT-T_LEU2-P_GAL1-Crei-T_CYCI-LoxP71-3U300_PFK1) by PCR was used to transform the Uz2937 strain. Thereafter, the resultant was applied to a nourseothricin-containing YPD agar medium, and the grown colonies were then purified. The purified strain was designated to be Uz3083.

[0149] Heterozygous recombination (1 copy) was observed in all of Uz3102, Uz3084, Uz3040, and Uz3083 strains prepared above.

[0150] 1.10. Fermentation Test in Flask

[0151] The test strains (Uz3102, Uz3084, Uz3040, or Uz3083) were inoculated into 100-ml baffled flasks each comprising 20 ml of YPD liquid medium (yeast extract concentration: 10 g/l; peptone concentration: 20 g/l; and glucose concentration: 20 g/l), and culture was conducted at 30 C. and 120 rpm for 24 hours. The strains were harvested and inoculated into a 24-deep-well plate comprising 4.9 ml of a medium for ethanol production per well (concentration: 0.3 g dry cells/l), and the fermentation test was carried out by agitation culture at 230 rpm with an amplitude of 25 mm at 31 C. Each well of the 24-deep-well plate was covered by a silicon cap with a check valve to allow the generated carbon dioxide gas to be discharged outside while preventing oxygen from entering into the wells. Thus, the condition in per well was maintained anaerobic.

[0152] In this example, a medium containing glucose as a saccharide source (glucose: 227 g/l, yeast extract: 10 g/l, and acetic acid 2.3 g/l) and a medium containing molasses as a saccharide source (a medium containing 260 g/l of sucrose, glucose, and fructose in total) were used as media for ethanol production.

[0153] Glycerin and ethanol in the fermentation liquor were assayed by HPLC (Prominence; Shimadzu Corporation) under the conditions described below.

[0154] Column: Aminex HPX-87H

[0155] Mobile phase: 0.01 N H.sub.2SO.sub.4

[0156] Flow rate: 0.6 ml/min

[0157] Temperature: 50 C.

[0158] Detection apparatus: Differential refractometer (RID-10A)

[0159] Sucrose, fructose, and glucose in the fermentation liquor containing molasses were assayed by HPLC (Prominence; Shimadzu Corporation) under the conditions described below.

[0160] Column: SHIMADZU Shim-pack SPR-Na

[0161] Mobile phase: 0.01 N H.sub.2SO.sub.4.

[0162] Flow rate: 0.6 ml/min

[0163] Temperature: 60 C.

[0164] Detection apparatus: Differential refractometer (RID-10A)

[0165] Table 3 shows the results of the fermentation test concerning Uz3102 into which the mitochondria-localized gld1 gene had been introduced and Uz3084 into which the cytoplasm-localized gld1 gene had been introduced, which was carried out with the use of a medium containing glucose as a saccharide source. A glycerin yield indicates a ratio of glycerin produced (g) relative to saccharide consumed (g).

TABLE-US-00003 TABLE 3 Uz3102 Uz3084 gld1 gld1 Uz2937 mitochondria- cytoplasm- control localied localized Glycerin concentration (g/l) 4.7 4.1 4.8 Glycerin yield (g/g) 0.021 0.018 0.021 Standard deviation of 0.14 0.04 0.13 glycerin concentration Ethanol concentration (g/l) 99.9 104.5 103.9 Standard deviation of ethanol 2.9 0.02 0.28 Glucose concentration (g/l) 6.9 0 0.4

[0166] Table 4 shows the results of the fermentation test concerning Uz3102 and Uz3084, which was carried out with the use of a medium containing molasses as a saccharide source.

TABLE-US-00004 TABLE 4 Uz3102 Uz3084 gld1 gld1 Uz2937 mitochondria- cytoplasm- control localied localized Glycerin concentration (g/l) 14.0 13.2 12.2 Glycerin yield (g/g) 0.074 0.072 0.074 Standard deviation of glycerin 0.78 0.17 0.10 concentration Ethanol concentration (g/l) 69.4 71.7 64.7 Standard deviation of ethanol 2.25 0.31 1.08 Glucose concentration (g/l) 70.4 77.1 95.6

[0167] Further, Table 5 shows the results of the fermentation test concerning Uz3083 into which the mitochondria-localized gldA gene had been introduced and Uz3040 into which the cytoplasm-localized gldA gene had been introduced, which was carried out with the use of a medium containing molasses as a saccharide source.

TABLE-US-00005 TABLE 5 Uz3083 Uz3040 gldA gldA Uz2937 mitochondria- cytoplasm- control localied localized Glycerin concentration (g/l) 13.3 11.6 11.0 Glycerin yield (g/g) 0.68 0.61 0.58 Standard deviation of glycerin 0.11 0.19 0.19 concentration Ethanol concentration (g/l) 70.0 75.4 73.7 Standard deviation of ethanol 0.75 0.78 1.12 Glucose concentration (g/l) 4.82 6.43 7.49

[0168] As demonstrated in Tables 3 to 5, in comparison with the control strain (Uz2937) and the strains into which the cytoplasm-localized gene of glycerin dehydrogenase had been introduced (Uz3084 and Uz3040), the strains into which the mitochondria-localized gene of glycerin dehydrogenase had been introduced (Uz3102 and Uz3083) exhibited an equivalent glycerin yield, a higher saccharide consumption speed, and a higher amount of ethanol production in a medium selectively comprising molasses or glucose as a saccharide source.

[0169] In general, glycerin as a by-product of ethanol fermentation is biosynthesized and accumulated in the cytoplasm. Dihydroxyacetone kinase equivalent to an enzyme existing downstream of glycerin dehydrogenase in the glycerin metabolizing pathway of a yeast is a cytoplasm-localized enzyme. Thus, a strain into which a cytoplasm-localized glycerin dehydrogenase gene has been introduced is presumed to have lower glycerin concentration and higher ethanol concentration. In contrast to such presumption, introduction of the mitochondria-localized glycerin dehydrogenase gene did not show a significant difference in the glycerin metabolism, and ethanol yield would be improved to a significant extent, as demonstrated in the examples.