METHODS OF INDUCING APOMICTIC OR SEXUAL REPRODUCTION
20200109414 ยท 2020-04-09
Inventors
Cpc classification
C12N15/8218
CHEMISTRY; METALLURGY
C12N15/8213
CHEMISTRY; METALLURGY
International classification
Abstract
This invention is direct to methods of switching from sexual reproduction to apomixis or from apomixis to sexual reproduction in a eukaryote. More particularly this invention provides methods of switching from meiosis to apomeiosis and from syagamy to parthenogenesis in a plant. The invention also provides methods of producing an apomictic eukaryote from a sexual eukaryote and a sexual eukaryote from an apomietic eukaryote.
Claims
1. A method of switching between apomixis and sexual reproduction in a eukaryote, comprising increasing or decreasing glucose signaling, osmotic stress, oxidative stress, perceived oxidative stress, or a combination thereof in a female germline cell and/or a female germline-associated tissue in the eukaryote, wherein apomixis comprises apomeiosis and parthenogenesis and sexual reproduction comprises meiosis and syngamy.
2. The method of claim 1, wherein the eukaryote is a plant selected from the group consisting of: alfalfa, amaranth, asparagus, barley, beans, beets, buckwheat, canary grass, cacao, carob, carrots, castor beans, chickpeas, chilis, clover, coffee, cotton, cowpea, cucumbers, cucurbits, durum, flax (linseed), fonio, Job's tears, kaniwa, lentils, lettuce, lupin beans, maize (corn), melons, mesquite, millet, oat, onions, peanuts, peas, peppers, pitseed goosefoot quinoa, rapeseed, rice, rye, sorghum, soybeans, spelt, squashes, sunflowers, tamarind, teff, tomatoes, triticale, turnips, wheat, wheat, and wild rice.
3. The method of claim 1, wherein the eukaryote is selected from the group consisting of: Brassicaceae, and Fabaceae.
4. The method of claim 1, comprising inducing apomeiosis, parthenogenesis, or both in the eukaryote by increasing glucose signaling, decreasing osmotic stress, decreasing oxidative stress, decreasing perceived oxidative stress, or a combination thereof wherein the eukaryote is a sexual eukaryote.
5. The method of claim 4, wherein at least 50% of the germline cells of the sexual eukaryote switch from meiosis to apomeiosis, syngamy to parthenogenesis, or both; and wherein the apomeiosis is of a diplosporous Antennaria-type, diplosporous Taraxacum-type, aposporous Hieracium-type, or a combination thereof.
6. The method of claim 4, wherein the female germline cell and/or female germline-associated tissue comprises the megaspore mother cell, adjacent cells of the ovule nucellus, or integuments.
7. The method of claim 4, wherein increasing glucose signaling, decreasing osmotic stress, decreasing oxidative stress, decreasing perceived oxidative stress, or a combination thereof comprises increasing sugar level, increasing fatty acid catabolism by beta-oxidation, increasing brassinosteroid (BR) activity, increasing antioxidant activity, decreasing reactive oxygen species (ROS), decreasing abscisic acid (ABA) activity, decreasing sucrose non-fermenting 1 related kinase (SnRK) activity, increasing target of rapamycin complex 1 (TORC1) activity, decreasing meiosis-specific RNA directed DNA methylation (RdDM), or a combination thereof.
8. The method of claim 4, wherein the increase in sugar level, fatty acid catabolism by beta-oxidation, BR activity, antioxidant activity, TORC1 activity, the decrease in ROS, ABA-biosynthesis, SnRK activity, RdDM, or a combination thereof is in an amount and time sufficient to induce apomeiosis, parthenogenesis, or both.
9. The method of claim 4, wherein the time sufficient to induce apomeiosis, parthenogenesis, or both is between 0.05 and 48 hours.
10. The method of claim 4, wherein increasing sugar level comprises applying a monosaccharide, a disaccharide, a short-chain polysaccharide, or a combination thereof; increasing BR activity comprises applying epibrassinolide (epiBL); increasing antioxidant comprises applying superoxide dismutase, glutathione, ABA, peroxidase, (S)-2-aminobutane-1,4-dithiol hydrochloride (DTBA), or a combination thereof; decreasing ABA activity comprises applying fluridone, increasing the activity of CYP707A, protein phosphatase 2C (PP2C), or a combination thereof; decreasing SnRK activity comprises decreasing an activity of SnRK1, SnRK2, or both; decreasing RdDM comprises applying DNA methyltransferase inhibitor 5-azacytidine (5-azaC) decreasing an activity of RING/FYVE/PHI zinc finger superfamily protein, SUVH1, MED17, HEAT INTOLERANT 4 (HIT4), HISTONE 2 (H1.2); ANTHESIS PROMOTING FACTOR 1 (APRF1), SUO, THO1, HISTONE H2A 11 (HTA11), or a combination thereof.
11. The method of claim 10, wherein increasing sugar level comprises applying 30-90 mmol/L glucose to the pistil for 4,480 minutes, 72 to 6 hours before megasporogenesis onset, applying 30-70 mmol/L sucrose to the pistil for 0.1-480 minutes, 72 to 6 hours before megasporogenesis onset, or both; decreasing ABA activity comprises applying 2-20 M fluridone to the pistil for 0.1-480 minutes, 72 to 6 hours before megasporogenesis onset; increasing antioxidant activity comprises applying 0.5-10 M DTBA to the pistil for 0.1-480 minutes, 72 to 6 hours before megasporogenesis onset; wherein decreasing RdDM comprises applying 501,000 M 5-azaC to the pistil for 0.1-480 minutes, 96 to 6 hours before megasporogenesis onset, wherein increasing BR activity comprises applying 0.05-15 M epiBL to the pistil for 0.1-480 minutes, 72 to 6 hours before megasporogenesis onset; wherein increasing sugar level and antioxidant activity comprises applying 30-140 mM glucose and 0.05-10 M DTBA to the pistil for 0.1-480 minutes, 72 to 6 hours before anthesis or fertilization; wherein increasing sugar level and BR activity comprises applying 30-140 mM glucose and 0.0-15 M epiBL to the pistil for 0.1-480 minutes, 72 to 6 hours before anthesis or fertilization; and/or wherein decreasing ABA activity comprises applying 2-20 M fluridone to the pistil for 0.05-480 minutes, 72 to 6 hours before anthesis or fertilization.
12. The method of claim 10, wherein decreasing SnRK activity comprises disrupting an endogenous SnRK gene in a eukaryote cell.
13. The method of claim 12, wherein decreasing SnRK activity comprises introducing into the eukaryote cell a silencing element capable of decreasing or eliminating a polynucleotide or a polypeptide encoded by SnRK1, SnRK2, or both, wherein the silencing element is selected from the group consisting of a double stranded RNA, a siRNA, a miRNA, and a hairpin suppression element, wherein the silencing element is operably linked to a cis-regulatory element active in germline cells, germline associated tissues, or both, and the SnRK1 activity, SnRK2 activity, or both is decreased by 10.90% between 0.5 and 48 hours before megasporogenesis onset to 0.5 to 48 h after embryo formation.
14. The method of claim 12, further comprising disrupting in the eukaryote, the eukaryote cell, or the eukaryote tissue, in addition to the SnRK gene, at least one other gene involved in meiosis wherein the at least one other gene is selected from the group consisting of: RING/FYVE/PHD zinc finger superfamily protein, SUVH1, MED17, HEAT INTOLERANT 4 (HIT4), HISTONE 1.2 (H1.2), ANTHESIS PROMOTING FACTOR 1 (APRF1), SUO, THO1, HISTONE H2A 11 (HTA1), an ortholog thereof, and combinations thereof.
15. The method of claim 1, comprising inducing meiosis in an apomictic eukaryote by decreasing glucose signaling, increasing osmotic stress, increasing oxidative stress, increasing perceived oxidative stress, or a combination thereof, wherein decreasing glucose signaling, increasing oxidative stress, increasing perceived oxidative stress, or a combination thereof comprises decreasing sugar level, decreasing fatty acid catabolism by beta-oxidation, decreasing brassinosteroid (BR) activity, increasing osmotic stress, decreasing antioxidant activity, increasing reactive oxygen species (ROS), increasing abscisic acid (ABA) activity, increasing sucrose non-fermenting 1 related kinase (SnRK) activity, decreasing target of rapamycin complex 1 (TORC1) activity, increasing meiosis-specific RNA directed DNA methylation (RdDM), or a combination thereof.
16. The method of claim 15, wherein the decrease in sugar level, the decrease in fatty acid catabolism by beta-oxidation, the decrease in BR activity, the increase in osmotic stress, the decrease in antioxidant activity, the decrease in TORC1 activity, the increase in ROS, the increase in ABA activity, the increase in SnRK activity, the increase in RdDM, or a combination thereof is in an amount and time sufficient to induce meiosis, the time sufficient to induce meiosis is between 0.05 and 72 hours.
17. The method of claim 15, wherein decreasing sugar level comprises restricting a monosaccharide, a disaccharide, a short-chain polysaccharide, or a combination thereof; decreasing BR activity comprises applying brassinazole; increasing osmotic stress comprises applying PEG 6,000; increasing ROS comprises applying hydrogen peroxide; increasing ABA activity comprises applying ABA, decreasing the activity of CYP707A, protein phosphatase 2C (PP2C) or a combination thereof; increasing SnRK activity comprises increasing an activity of SnRK1, SnRK2, or both; increasing meiosis specific RdDM comprises increasing an activity of RING/FYVE/PHD zinc finger superfamily protein, SUVH1, MED17, HEAT INTOLERANT 4 (HIT4), HISTONE 1.2 (H1.2) ANTHESIS PROMOTING FACTOR 1 (APRF1), SUO, THO1, HISTONE H2A 11 (HTA11), or a combination thereof.
18. The method of claim 17, wherein decreasing sugar level comprises restricting glucose to less than 6 mmol/L for 0.1-10 minutes, from 48 to 0.2 hours before megasporogenesis onset; increasing ROS comprises applying 20-500 mM hydrogen peroxide to the pistil for 5-60 minutes, 72 to 1 hours before megasporogenesis onset; increasing osmotic stress comprises applying 10-40 g/L PEG 6,000 to the pistil for 5-480 minutes, 72 to 1 hours before megasporogenesis onset, decreasing BR activity comprises applying 0.1-10 M brassinazole to the pistil for 0.1-480 minutes, 72 to 1 hours before megasporogenesis onset; and/or increasing ABA activity comprises applying 0.5-10 M abscisic acid to the pistil for 0.1-480 minutes, 72 to 1 hours before megasporogenesis onset.
19. A sexual eukaryote that is induced to reproduce apomictically by inducing apomeiosis, parthenogenesis, or both in the sexual eukaryote by increasing glucose signaling, decreasing osmotic stress, decreasing oxidative stress, decreasing perceived oxidative stress, or a combination thereof.
20. An apomictic eukaryote produced from a sexual eukaryote by decreasing SnRK activity by disrupting an endogenous SnRK gene in the sexual eukaryote.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
DETAILED DESCRIPTION
[0091] The present disclosure covers composition and methods of inducing apomeiosis, parthenogenesis, or both in sexual eukaryotes and inducing sex in apomictic eukaryotes, most particularly in plants. In the following description, numerous specific details are provided for a thorough understanding of specific preferred embodiments. However, those skilled in the art will recognize that embodiments can be practiced without one or more of the specific details, or with other methods, components, materials, etc. In some cases, well-known structures, materials, or operations are not shown or described in detail in order to avoid obscuring aspects of the preferred embodiments. Furthermore, the described features, structures, or characteristics may be combined in any suitable manner in a variety of alternative embodiments. Thus, the following more detailed description of the embodiments of the present invention, as illustrated in some aspects in the drawings, is not intended to limit the scope of the invention, but is merely representative of the various embodiments of the invention.
Definitions
[0092] In this specification and the claims that follow, singular forms such as a, an, and the include plural forms unless the content clearly dictates otherwise. All ranges disclosed herein include, unless specifically indicated, all endpoints and intermediate values. In addition, optional or optionally refer, for example, to instances in which subsequently described circumstance may or may not occur, and include instances in which the circumstance occurs and instances in which the circumstance does not occur. The terms one or more and at least one refer, for example, to instances in which one of the subsequently described circumstances occurs, and to instances in which more than one of the subsequently described circumstances occurs.
[0093] The term ln refers to the number of chromosomes in spores or gametes and generally in most subsequent mitosis produced cells of spores, e.g., in gametophytes of organisms with alternating generations; this number often reflects different ploidy levels (multiples of the chromosome base number, x) plus or minus individual chromosomes (aneuploidy).
[0094] The term 2n refers to the number of chromosomes in the zygote and generally in most subsequent asexual (somatic) cells produced by mitosis; this number often reflects different ploidy levels (multiples of the base number, x) plus or minus individual chromosomes (aneuploidy).
[0095] The term antioxidant refers to a substance that inhibits oxidation in living organisms by reducing or otherwise deactivating potentially damaging oxidizing agents such as reactive oxygen species (ROS).
[0096] The term apomeiosis refers to the formation of parthenogenesis-competent spores, gametes or gamete-like cells wherein the chromosome numbers are the same as those observed in zygotes.
[0097] The term apomixis refers to a process in eukaryotes consisting of two temporally-distinct processes, apomeiosis and parthenogenesis.
[0098] The term autonomous apomixis refers to seed formation in angiosperms wherein both the embryo and endosperm form without fertilization.
[0099] The term cyclical apomixis refers to alternations, generally seasonal, between periods of essentially exclusive sexual reproduction and periods of essentially exclusive apomictic reproduction.
[0100] The term derepression refers to a reversal of repression often by the chemical removal of a transcription repressor gene product from a regulatory DNA sequence.
[0101] The term double fertilization refers to a process unique to angiosperms wherein two 1n (haploid) sperm nuclei of a single male gametophyte are involved in fertilization, one fertilizes the 1n egg, to form the 2n embryo, and the other fertilizes the 2n central cell (fusion product of two 1n polar nuclei) to form the 3n endosperm.
[0102] The term embryo sac refers to the female megagametophyte in angiosperms.
[0103] The term endosperm refers to a triploid tissue in angiospermous seeds that is adjacent to the developing angiospermous embryo and is derived in sexual plants from the fusion product of two haploid female gametophyte cells (polar nuclei) and a haploid sperm cell. Endosperm is consumed by the embryo as it grows and germinates.
[0104] The term enriched gene ontology (GO) category refers to a statistically significant condition wherein genes of the GO category tend to be up or down-regulated in a particular treatment more so than would be expected by chance alone.
[0105] The term epigenome refers to a genome (DNA) plus all of the chemical compounds added to the genome that regulate gene expression. In living cells, epigenome modifications are generally in a state of flux and vary among different tissues and cells. We discovered, and report herein, that the apomixis epigenome differs substantially from the sexual epigenome.
[0106] The term epigenomic state refers to a static state of the genetic material wherein some genes tend to be silenced while others tend to be expressed. The epigenomic state of living organisms is in constant flux. For the purposes of this specification, we use the term epigenetic in a broad sense. Our use of the term includes covalent DNA and RNA modifications that affect gene expression such as chromatin modifications and mRNA splicing variants.
[0107] The term eukaryogenesis refers to an extended period of time, about 1.2 to 0.8 billion years ago, during which eukaryotes evolved from prokaryotes.
[0108] The term eukaryote refers to an organism whose cells contain a nucleus and other organelles enclosed by membranes.
[0109] The term facultative apomixis refers to sexual and apomictic reproduction occurring concurrently within an individual. It is often observed in plants that simultaneously produce seeds sexually and apomictically.
[0110] The term gamete refers to a mature haploid or diploid germ cell that is able to either i) unite with another gamete by syngamy (fertilization) to form a zygote, as in sexual reproduction, or ii) become a zygote-like cell by parthenogenesis, as in apomictic reproduction.
[0111] The term gametophyte refers to the 1n generation that produces gametes in organisms with an alternation-of-generations life cycle. In angiosperms, female megagametophytes (embryo sacs) form in ovules and in most cases consist of seven cells (including the egg, female gamete) and eight nuclei at maturity (central cell contains two polar nuclei). Microgametophytes (pollen grains) in angiosperms consist of three cells, two sperm (male gametes) and a pollen tube nucleus.
[0112] The term genotype refers to the full hereditary information of an organism. Inasmuch as progeny plants of an apomictic plant are clones of each other, they represent a single genotype.
[0113] The term germline refers to a series of cells destined to pass their genetic material to their progeny. In some multicellular organisms, including animals, the germline is continuous from one generation to the next. In other organisms, the germline is discontinuous. In flowering plants, the germline is initiated during flower formation and is terminated with the onset of embryogenesis.
[0114] The term germline-associated tissues refers to those tissues intimately associated with and thereby nutritionally and developmentally supportive of the germline. With regard to flowering plants, the term refers to the nucellus and other nutritive tissues of the ovule.
[0115] The term Hieracium-type apospory refers to a form of apomixis in angiosperms wherein sexual meiosis fails and the parthenogenetically-competent 2n gametophyte forms from a nucellar cell.
[0116] The term meiosis refers to spore or gamete formation wherein chromosome numbers are reduced to half of that observed in zygotes.
[0117] The term nucellus refers to a sporogenous-like nutritive tissue surrounding the meiocyte and later the developing embryo sac in angiospermous ovules.
[0118] The term obligate apomixis refers to reproduction by apomixis with an absence of sexual reproduction.
[0119] The term parthenogenesis refers to life cycle progression without syngamy from products of apomeiosis, e.g., embryo formation from unreduced eggs without fertilization. Parthenogenesis can also occur from products of meiosis. This is referred to as haploid parthenogenesis.
[0120] The term phenism refers to one of two or more phenotypes expressed polyphenically by a single genotype.
[0121] The term phenotype refers to observable characteristics of an individual genotype as a result of environment-genotype interactions.
[0122] The term polyphenism refers to a set of two or more phenotypes (phenisms) that occur in a single individual but at different times. Classic examples include metamorphism in insects, the transition from a tadpole to a frog, or the transition from a vegetative to a reproductive state in plants. Chromatin modifications that differentially silence genes, thus producing different epigenomic states, are responsible for polyphenisms.
[0123] The term polyphyletic trait refers to a trait that occurs in multiple taxa but evolved in each taxon independently of the other taxa
[0124] The term preapomeiotic refers to the stage of apomictic reproduction wherein meiocyte mother cells are not yet mature or are still forming.
[0125] The term premeiotic refers to the stage of sexual reproduction wherein meiocyte mother cells are not yet mature or are still forming.
[0126] The term prokaryote refers to single-celled archaea and bacteria. They do not possess a distinct membrane-bound nucleus, mitochondria or other specialized organelles.
[0127] The term pseudogamous apomixis refers to seed formation in angiosperms wherein the embryo forms apomictically but the central cell must be fertilized for endosperm to form. Without fertilization, seeds of pseudogamous apomicts abort.
[0128] The term reactive oxygen species (ROS) refers to reactive chemicals that contain oxygen, such as peroxides, superoxide, hydroxyl radical and singlet oxygen.
[0129] The term repression refers to suppression of gene expression, which often occurs as a result of a repressor gene product that blocks transcription.
[0130] The term sex refers to a process in eukaryotes consisting of two temporally-distinct processes, meiosis and syngamy (fertilization).
[0131] The term signaling molecule refers to a molecule that interacts with cell surface receptors or otherwise participates as a component of a signal transduction pathway.
[0132] The term simple sugar refers to monosaccharides and disaccharides that provide energy to living cells and may also serve as signaling molecules.
[0133] The term sporophyte refers to the 2n generation in organisms with an alternation-of-generations life cycle. In sexual angiosperms, sporophytes produce 1n spores through meiosis.
[0134] The term steroid refers to a class of organic molecules that contain a characteristic four-ring configuration. Many steroids function as signaling molecules by activating steroid receptors.
[0135] The term syngamy refers to fusion of haploid gametes to produce zygotes.
[0136] The term Taraxacum-type diplospory refers to a form of apomixis in angiosperms wherein the unreduced spore forms as a result of 1st division restitution; 2n gametophyte formation and parthenogenesis then ensue.
[0137] The term x refers to the base number of chromosomes; it constitutes the lowest number of chromosomes that represent one complete set of chromosomes for a species.
[0138] The term zygote refers to a diploid cell resulting from the fusion of two haploid gametes.
[0139] Apomixis occurs infrequently in 20% of flowering plant families. If apomixis could be induced in inbred as well as hybrid crops, then superior-yielding hybrid seeds for all crops maybe cost-effectively produced. It has been assumed that the components of apomixis, apomeiosis and parthenogenesis are derived mutation dependent processes. The inventors have surprisingly found that apomeiosis does not require apomixis-specific mutations but is instead inducible at high frequencies by metabolically modifying wild type gene expression by decreasing SnRK activity, decreasing RdDM activity, increasing TORC1 activity, and/or inducing steroid signaling.
[0140] Inducing Apomixis in Sexual Eukaryotes.
[0141] The methods of inducing Apomixis in sexual eukaryotes disclosed herein enables clonal reproduction of desired genotypes. For example, inducing apomixis in hybrid plants of important world crops will decrease hybrid seed production costs for crops currently grown as hybrids, e.g., maize and sorghum. It will also enable hybrid seed production of crops currently grown as inbred varieties. Such crops, e.g., essentially all wheat and most rice, are currently grown as inbred crops, which are inferior in yield when compared to high-yielding experimental hybrids, the F.sub.1 hybrid seeds of which cannot currently be produced economically in commercial quantities. An object of this invention is to induce apomixis in typically-sexual eukaryotes for the purpose of cloning through the germline (e.g., seeds, etc.) high-yielding (agronomically-important) heterozygous genotypes, e.g., superior-yielding hybrids of world crops.
[0142] Inducing Sex in Apomictic Eukaryotes. In contrast, the methods of inducing sexual reproduction in apomictic eukaryotes disclosed herein enable genetic improvement by conventional breeding, a technique of plant and animal improvement that requires sexual recombination, i.e., it cannot be accomplished in obligately apomictic plants or animals. Another object of this invention is to induce sexual reproduction in typically apomictic eukaryotes for the purpose of genetic improvement by conventional breeding. Thereafter, the methods of the present patent may be used to return the improved hybrid plants to apomixis for the efficient clonal production of hybrid seed.
[0143] Value of the methods of the invention. The present invention provides methods of inducing apomixis in sexual eukaryotes and sexual reporduction in apomictic eukaryotes. One of the many uses of the present invention is to stably clone high-yielding heterozygous hybrids or other superior but unique genotypes of world crops through their own seed. The invention provides a way to enhance global food security by:
[0144] i. simplifying hybrid seed production for crops currently grown as hybrids, e.g., a cost savings is expected of ca. $1 billion annually in the U.S. alone in the production of hybrid corn seed;
[0145] ii. converting inbred (or varietal) crops to hybrids
[0146] a. essentially all world wheat production and more than half of world rice production is obtained from inbred varieties, the yields of which are inferior to experimental hybrids; currently, wheat and rice provide ca. 65% of all calories consumed by humans;
[0147] b. hybrid seeds of wheat, rice and many other inbred crops cannot currently be produced economically in sufficient quantities for commercial plantings;
[0148] c. experimental hybrids of wheat and rice yield 15% and 30% more grain than the best inbred wheat and rice varieties grown today, respectively; the value of the increased yield afforded by apomictically produced hybrids of wheat and rice in the U.S. alone could exceed $34 billion annually (based on 2010-2015 USDA statistics).
[0149] The current disclosure is not limited to agricultural crops. It may also be used, for example, in aquaculture, for the farming of high yielding apomictic hybrids of crustaceans and fish, and for the production of high yielding apomicts of forest and fiber (cotton, hemp) species. This technology, once fully implemented, has the potential of revolutionizing food, feed, fiber and timber production globally and producing economic and humanitarian benefits that dwarf those associated with the green revolution of the 1960s and the development of sexually-produced hybrid crops in the 1930s (28).
[0150] Why Apomixis Technology was not Previously Developed.
[0151] While benefits of an apomixis technology have been recognized for over 80 years, progress toward achieving the necessary breakthroughs has been painfully slow (7, 10, 29-33). Our present discovery reveals that this sluggishness was a consequence of misconceptions concerning how apomixis evolved and how it is regulated. For 118 years, it has been taught and considered obvious that apomixis evolves from sex by mutation in each eukaryote kingdom (1, 9, 34-36). The putative mutations are thought to either cause apomixis directly (mutation-derived modifications of meiosis and syngamy that convert these processes into apomeiosis and parthenogenesis, respectively) (37-39) or to distort the two sexual processes epigenetically so as to bypass specific steps of meiosis and syngamy (7, 10, 33, 35, 36). An estimated $75 M worldwide has been spent during the past 40 years to identify the putative apomixis-causing mutant genes from naturally-occurring apomicts. The goal of these programs has been to identify the apomixis causing mutant genes, and more recently to design mutant genes, and to then transfer the mutations to important world crops by wide hybridization or genetic engineering (7, 35).
[0152] In contrast to the mutation based apomixis gene hypotheses, the present disclosure is based on the discovery based on the results herein, that sexual reproduction and apomixis have been polyphenisms of each other from the beginnings of eukaryote evolution. Polyphenic traits (two or more) are encoded by a single genome. Environmental signaling at the cell metabolism and signaling levels regulates which trait is expressed, and switching from one to another involves metabolism driven modifications of enzyme function and epigenetic modification of gene expression (40-42). Examples include caterpillars changing into butterflies, tadpoles changing into frogs, and vegetative plants changing into flowering plants. Altered metabolic and epigenomic states induce the formation of altered phenotypes, which are better suited for the environmental parameters that induced their onset.
[0153] One of the most ancient prokaryotic polyphenisms is the division spore polyphenism. The division phenism involves rapid cell division during metabolically favorable conditions, and the spore phenism involves cell division termination followed by stress resistant spore formation at the onset of metabolic stress (43-49). Based on the results herein sexual reproduction (meiosis/syngamy) and apomixis (apomeiosis/parthenogenesis) evolved during eukaryogenesis (1.2 to 0.8 billion years ago) as extensions of the prokaryotic division spore polyphenism (8, 50). That sex evolved during this period is well supported (43-46), but our result now support that apomixis evolved as a polyphenism of sexual reproduction during this timeframe, first taught and disclosed by the present inventors. Tenets of our apomixis antiquity teachings include:
[0154] i. eukaryotic apomixis evolved during eukaryogenesis as an add on to the division phenism of prokaryotes, the latter had been evolving for ca. 2.7 billion years prior to the evolution of sex (1.2 billion years ago) (51), which makes the defining elements of apomixis more ancient, and perhaps more conserved among extant eukaryotes, than those of sex;
[0155] ii. cellular metabolome and epigenome factors that induce and maintain apomixis occur in response to metabolically favorable conditions;
[0156] iii. sex evolved as an add-on to the spore phenism of prokaryotes (43); and
[0157] iv. cellular metabolome and epigenome factors that induce and maintain sex occur in response to metabolically stressful conditions.
[0158] Four novel implications of the invention and embodiments set forth herein differentiate it from the conventional wisdom and practices which are based upon mutation-based theories:
[0159] i. the last common ancestor of extant eukaryotes, a primitive unicellular eukaryote, was cyclically apomictic, i.e., sex and apomixis in this ancestor were polyphenisms of each other and the expressions of each were environmentally regulated,
[0160] conventional wisdom: apomixis is evolutionarily derived among eukaryotes, i.e., it arises polyphyletically (de novo in each eukaryotic taxon where it occurs) by mutations of the sexual pathway (7, 35, 36, 52);
[0161] ii. extant eukaryotes that exhibit a cyclical apomixis life cycle (9, 53-55) are primitive, i.e., their life cycle (apomixis and sex expressed as polyphenisms of each other in response to seasonal changes) is most similar to that of the last common ancestor of extant eukaryotes,
[0162] conventional wisdom: sex is primitive, and apomixis is derived polyphyletically by mutation;
[0163] iii. extant eukaryotes that exhibit obligate sex or obligate or facultative apomixis are derived, i.e., their apomixis-sex switching mechanisms are ineffective due to genetic mutations, global changes in atmospheric or other environmental parameters that have occurred since eukaryogenesis, or metabolomic or epigenomic modifications caused by hybridization, polyploidization or other genome perturbations,
[0164] conventional wisdom: obligate sex is ancestral in eukaryotes, and apomixis is derived;
[0165] iv. competencies for sex and apomixis are more-or-less imbedded (conserved) in the genomes of all eukaryotes, and in the best-case scenarios we need only tap into and control these competencies to develop an apomixis technology,
[0166] conventional wisdom: competencies for sex are more-or-less imbedded in the genomes of all eukaryotes (56-58), and apomixis is derived.
[0167] Evidence for the latter (iv) is seen in the occasional triggering of apomixis in sexual organisms (from all eukaryote kingdoms) when metabolomes and epigenomes are disturbed, with little or no evidence of mutation, by wide hybridization, polyploidization or other perturbations (8, 10, 50).
[0168] Summary of experiments. We reasoned that if apomixis and sex evolved during eukaryogenesis, as a polyphenic pair, with reproduction occurring by apomixis under favorable conditions and by sex under stressful conditions, then extant obligate or near-obligate apomictic eukaryotes likely possess a genome that detoxifies metabolic stress in germline cells or associated tissues. In contrast, extant sexual eukaryotes likely possess a genome that is less efficient in detoxifying metabolic stress in germline or germline associated tissues during germline development. We conducted six sets of experiments that were designed to i) explore the validity of the unique premise described above, ii) elucidate the molecular biology and biochemistry of the putatively ancient apomixis-sex switch, and iii) develop methods for switching apomictic development to sexual development and sexual development to apomictic development. The six sets of experiments are briefly outlined as follows:
[0169] i. apospory associated QTL (Example 12)
[0170] ii. gene expression profiling in the cereal crop Sorghum bicolor (Poaceae, sorghum) to identify sorghum genes that promote aposporous embryo sac formation (Examples 1 and 13);
[0171] a. compared genes expression profiles from immature ovules of a weakly aposporous genotype to those from a non-aposporous genotype (selected from an F.sub.2 mapping population);
[0172] iii. gene expression profiling comparisons between naturally apomictic and naturally sexual taxa of Boechera (Brassicaceae) (Example 2);
[0173] iv. whole plant environmental stress experiments (Examples 3);
[0174] a. switched apomictic development to sexual development in apomictic Boechera,
[0175] b. compared gene expression profiling between naturally apomictic Boechera versus the same apomictic Boechera that were induced by stress to undergo sexual development;
[0176] v. whole plant and in vitro experiments using Boechera and involving pharmacological applications selected to switch apomixis to sex and to elucidate the molecular and biochemical pathways involved in apomixis-to-sex switching (Examples 4-7);
[0177] vi. whole plant and in vitro experiments using sexual Boechera, sexual Arabidopsis thaliana (Brassicaceae, Arabidopsis), and the sexual legume crop Vigna unguiculata (Fabaceae, cowpea); these experiments involved pharmacological applications selected to switch sex to apomixis and to elucidate the molecular biology and biochemical pathways involved in sex-to-apomixis switching; cowpea is an important world food crop mandated for further improvement by the International Institute of Tropical Agriculture, Ibadan, Nigeria (Examples 9-11 and 14).
SUMMARY OF THE FINDINGS
[0178] Our findings identified signal transduction pathways that regulate apomixis/sex switching. These were verified pharmacologically using signaling molecules that specifically altered biochemical and molecular pathways to induce sexual reproduction in apomictic plants and to induce apomictic reproduction in sexual plants. We found that interrupting peroxide signaling induces apomeiosis. Exposing MMC staged female germline cells and associated tissues to the antioxidant (S)-2-aminobutane-1,4-dithiol hydrochloride (DTBA) increases the frequency of apomeiosis in ovules (diplosporous Taraxacum-type) (Examples 10 and 14). We identified multiple ways of decreasing SnRK activity, and each of these induced apomeiosis. First, we observed that an inhibitor/down regulator of SnRK1 and SnRK2, AIP1, is upregulated in A151 by 3.0-fold (Example 13), and is linked to ovule volume QTL (Example 12). Second, we documented that interrupting peroxide signaling, which normally prevents PP2Cs from silencing SnRK, induces apomeiosis (Examples 10 and 14). Third, we documented that inhibiting the RNA directed DNA methylation (RdDM) specific to meiosis, which constitutes a signaling pathway between SnRK and meiosis, converts Taraxacum type to Antennaria type in apomictic plants and meiosis to Antennaria type in all three sexual species (Examples 10 and 14). We found that decreasing meiosis-specific RdDM activity induces apomeiosis. First, an upstream activator of RdDM, FUS3-COMPLEMENTING GENE 2 (AFC2), is upregulated in A151 by 7.0-fold (Example 13), and is linked to ovule curvature and volume QTL (Example 12). Second, a RdDM inhibitor, the DNA methyltransferase inhibitor 5-azacytidine (5-azaC), reduces the frequency of meiosis (Examples 10 and 14). We also found that increasing BR activity induces apomeiosis. First, a gene that suppresses BR signaling downstream of TORC1, SHAGGY-LIKE PROTEIN KINASE GROUP 2 3 (SK22, ATGSK1), was upregulated in A151 by 8.9-fold (Example 13), and is linked to ovule curvature QTL (Example 12). Second, a gene that suppresses BR signaling downstream of TORC1, BAK1-INTERACTING RECEPTOR-LIKE KINASE 1 (BIR1), is (i) upregulated in A151 by 2.3-fold (Example 13), and is linked to TT QTL (Example 12). Third, exposing immature Arabidopsis pistils to BR induces apomeiosis (Examples 10 and 14).
[0179] Without wishing to be bound by theory, it is believed that growth cessation and decreased metabolic activity occur when TORC1 is inactivated. In plants, this happens in two ways, by glucose starvation or by accumulation of abscisic acid (ABA). Both processes involve multistep molecular pathways (
[0180] Of the five currently recognized eukaryote kingdoms, plants and animals are the most evolutionarily divergent. Our research results compared with finding in the literature provide strong evidence that the same signaling pathways that control apomixis/sex switching in animals also control apomixis/sex switching in plants. The switching processes described here have worked on all five angiospermous species tested to date.
[0181] An object of this invention is to induce apomixis in typically-sexual eukaryotes for the purpose of cloning through the germline (e.g., seeds, etc.) high-yielding (agronomically-important) heterozygous genotypes, e.g., superior-yielding hybrids of world crops. Another object of this invention is to induce sexual reproduction in typically apomictic eukaryotes for the purpose of genetic improvement by conventional breeding. Thereafter, the methods of the present patent may be used to return the improved hybrid plants to apomixis for the efficient clonal production of hybrid seed.
[0182] In accordance with the invention, methods are provided for switching mode of reproduction from sex to apomixis and from apomixis to sex in three genera representing two families of angiospermous plants (kingdom Plantae, Eukaryota). The methods were developed based on results of tests performed to evaluate the initial hypothesis that apomixis and sex in eukaryotes are a polyphenic pair that co-evolved during eukaryogenesis. Further features of the methods of the invention and various other steps, procedures, and examples associated with practicing the invention are described below, including the elucidation of the biochemical and molecular signal transduction pathways of apomixis/sex switching and the development of pharmacological treatments that intentionally modify signal transduction pathway components so as to redirect reproductive development from apomixis to sex or from sex to apomixis.
[0183] in a first aspect of the present invention, there is provided a method of switching between apomixis and sexual reproduction in a eukaryote, comprising increasing or decreasing glucose signaling, osmotic stress, oxidative stress, perceived oxidative stress, or a combination thereof in a female germline cell and/or a female germline-associated tissue in the eukaryote, wherein apomixis comprises apomeiosis and parthenogenesis and sexual reproduction comprises meiosis and syngamy. Said methods are referred to hereinafter as the methods of the invention.
[0184] in one embodiment of the present invention, there is provided a method of inducing apomeiosis, parthenogenesis, or both in a sexual eukaryote, which comprises increasing glucose signaling, decreasing osmotic stress, decreasing oxidative stress, decreasing perceived oxidative stress, or a combination thereof in a female germline cell and/or a female germline-associated tissue in the sexual eukaryote.
[0185] The methods set forth herein may be applied to sexual eukaryotes broadly. As used herein, the term sexual eukaryote refers to a eukaryote capable of sexually reproducing through meiosis and gamete fusion. As used herein, the term sex refers to a process in eukaryotes consisting of two temporally-distinct processes, meiosis and syngamy (fertilization). As used herein, the term eukaryote refers to an organism whose cells contain a nucleus and other organelles enclosed by membranes.
[0186] In particular, commercially important eukaryotic species that play a role in the food industry, plant products industry, and animal products industry may be used. Species reproduced commercially via sexual reproductive methods are desirable candidates for inducing apomictic reproduction therein. Non-limiting exemplary sexual eukaryotes that may be induced from sex to apomixis include economically important eukaryotes, e.g., agronomic crops, forest and fiber (e.g., cotton, hemp) species, or aquacultural crustaceans or fish. Non-limiting exemplary fish include salmon, trout, tilapia, tuna, etc. Non-limiting exemplary crustaceans include crabs, lobsters, crayfish, shrimp, etc.
[0187] In preferred embodiments, the sexual eukaryote is a plant. As used herein, the term plant refers to whole plants, plant organs, plant tissues, seeds, plant cells, seeds and progeny of the same. Plant cells include, without limitation, cells from seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, and microspores. Plant parts include differentiated and undifferentiated tissues including, but not limited to the following: roots, stems, shoots, leaves, pollen, seeds, tumor tissue and various forms of cells and culture (e.g., single cells, protoplasts, embryos, and callus tissue). The plant tissue may be in plant or a plant organ, tissue or cell culture. Non-limiting exemplary plants include grains, legumes, fruit, vegetable, grasses, tubers, and cash crop plant varieties. Non-limiting exemplary grains include rice, wheat, durum wheat, maize (corn), Job's tears, barley, millet, sorghum, oat, rye, triticale, teff, fonio, wild rice, spelt, canary grass, quinoa, amaranth, buckwheat, kaniwa, pitseed goosefoot, etc. Non-limiting exemplary cash crops include oilseeds generally, sunflowers, rapeseed, cotton, peanuts, flax (linseed), castor beans, coffee, cacao, etc. Non-limiting exemplary legumes include soybeans, cowpea, alfalfa, clover, peas, beans, chickpeas, lentils, lupin beans, mesquite, carob, peanuts, tamarind, etc. Non-limiting exemplary vegetables include tuber-included tomatoes, cucurbits, squashes, melons, cucumbers, onions, chilis, peppers, lettuce, beets, potatoes, asparagus, carrots, turnips, etc. In a preferred embodiment, the sexual eukaryote is a sexual Brassicaceae (e.g., Arabidopsis or Drummond's rockcress) or a sexual legume (e.g., cowpea).
[0188] As used herein, the term germline refers to a series of cells destined to pass their genetic material to their progeny. In flowering plants, the germline is initiated during flower formation and is terminated with the onset of embryogenesis. As used herein, the term germline cell refers to a biological cell that gives rise to the gametes of an organism that reproduces sexually. As used herein, germline cell of a flowering plant refers to a meiotic spore mother cell (megasporocyte or MMC). As used herein, germline-associated tissues refers to those tissues intimately associated with and thereby nutritionally and developmentally supportive of the germline. With regard to flowering plants, the term refers to the nucellus and other nutritive tissues of the ovule. As used herein, the term nucellus refers to a sporogenous-like nutritive tissue surrounding the meiocyte and later the developing embryo sac in angiospermous ovules.
[0189] As used herein, inducing apomeiosis refers to producing viable non-reduced, or viable non-reduced and non-recombined, gametes. The apomeiosis maybe of a diplosporous Antennaria-type, a diplosporous Taraxacum-type, an aposporous Hieracium-type, or a combination thereof. As used herein, the term aposporous apomict refers to a form of apomixis wherein the reduced megaspore degenerates and is replaced by a somatic cell. As used herein, the term Hieracium-type apospory refers to a form of apomixis in angiosperms wherein sexual meiosis fails and the parthenogenetically-competent 2n gametophyte forms from a nucellar cell. As used herein, the term diplosporous apomict refers to a form of apomixis wherein the reductional meiosis is replaced by a restitutional meiosis or by mitosis. As used herein, the term Antennaria-type diplospory refers to a form of apomixis wherein the unreduced embryo sac forms directly from a megaspore mother cell that does not initiate meiosis. As used herein, the term Taraxacum-type diplospory refers to a form of apomixis in angiosperms wherein the unreduced spore forms as a result of 1st division restitution; 2n gametophyte formation and parthenogenesis then ensue. As used herein, the term parthenogenesis refers to life cycle progression without syngamy from products of apomeiosis, e.g., embryo formation from unreduced eggs without fertilization. Parthenogenesis can also occur from products of meiosis. This is referred to as haploid parthenogenesis.
[0190] In one implementation, the frequency or probability of switching from meiosis to apomeiosis, syngamy to parthenogenesis, or both, is between 1% and 100%, or any percent range in between, e.g., 1-75%, 1-50%, 1-25%, 5-100%, 5-95%, 5-90%, 5-85%, 5-80%, 5-75%, 5-70%, 5-65%, 5-60%, 5-55%, 5-50%, 5-45%, 5-40%, 5-35%, 5-30%, 5-25%, 5-20%, 5-15%, 5-10%, 10-100%, 10-90%, 10-80%, 10-70%, 10-60%, 10-50%, 10-40%, 10-30%, 10-20%, 20-80%, 25-100%, 25-75%, 25-50%, 30-100%, 30-95%, 30-90%, 30-85%, 30-80%, 30-75%, 30-70%, 30-65%, 30-60%, 30-55%, 30-50%, 40-100%, 40-90%, 40-80%, 40-70%, 40-60%, 40-50%, 50-100%, 50-95%, 50-90%, 50-80%, 50-75%, 50-70%, or 75-100%, etc. in the sexual eukaryote. In other embodiments, the frequency or probability of switching from meiosis to apomeiosis, syngamy to parthenogenesis, or both is at least 10%, for example, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%, etc. in the sexual eukaryote.
[0191] Glucose is an ancient and conserved eukaryotic signaling molecule. As used herein, the term glucose signaling refers to gene expression and enzyme function including cell-cycle progression, general metabolism and various aspects of development regulated by glucose. As used herein, the term oxidative stress refers to a cellular disturbance in the prooxidant-antioxidant balance in favor of prooxidants.
[0192] In some implementations, increasing glucose signaling, decreasing osmotic stress, decreasing oxidative stress, decreasing perceived oxidative stress, or a combination thereof comprises increasing sugar level, increasing fatty acid catabolism by beta-oxidation, increasing brassinosteroid (BR) activity, increasing antioxidant activity, decreasing reactive oxygen species (ROS), decreasing abscisic acid (ABA) activity, decreasing sucrose non-fermenting 1 related kinase (SnRK) activity, increasing target of rapamycin complex 1 (TORC1) activity, decreasing meiosis-specific RNA directed DNA methylation (RdDM), or a combination thereof. In some implementations, the increase in sugar level, fatty acid catabolism by beta-oxidation, BR activity, antioxidant activity, TORC1 activity, the decrease in ROS, ABA activity, SnRK activity, RdDM, or a combination thereof is in an amount and time sufficient to induce apomeiosis, parthenogenesis, or both. In some implementation, the time sufficient to induce apomeiosis, parthenogenesis, or both is between 0.05 and 48 hours.
[0193] In some implementations, increasing sugar level comprises applying a monosaccharide, a disaccharide, a short-chain polysaccharide, or a combination thereof; increasing BR activity comprises applying epibrassinolide (epiBL); increasing antioxidant comprises applying superoxide dismutase, glutathione, ABA, peroxidase, (S)-2-aminobutane-1,4-dithiol hydrochloride (DTBA), or a combination thereof; decreasing ABA activity comprises applying fluridone, increasing the activity of CYP707A, protein phosphatase 2C (PP2C), or a combination thereof; decreasing SnRK activity comprises decreasing an activity of SnRK1, SnRK2, or both; decreasing RdDM comprises applying DNA methyltransferase inhibitor 5-azacytidine (5-azaC), decreasing an activity of RING/FYVE/PHD zinc finger superfamily protein, SUVH1, MED17, HEAT INTOLERANT 4 (HIT4), HISTONE 1.2 (H1.2), ANTHESIS PROMOTING FACTOR 1 (APRF1), SUO, THO1, HISTONE H2A 11 (HTA11), or a combination thereof.
[0194] The term reactive oxygen species (ROS) refers to reactive chemicals that contain oxygen, such as peroxides, superoxide, hydroxyl radical and singlet oxygen. In one implementation, the reactive oxygen species comprises hydrogen peroxide. Non-limiting examples of the sugar include monosaccharide (e.g., glucose or fructose), disaccharide (e.g., sucrose), or short-chain polysaccharide. Non-limiting examples of a naturally occurring antioxidant include superoxide dismutase, glutathione, ABA, or peroxidase. A non-limiting example of synthetic antioxidant is (S)-2-aminobutane-1,4-dithiol hydrochloride (DTBA). In one implementation, the steroid comprises epibrassinolide. A non-limiting example of meiosis-specific DNA methylation is meiosis-specific RNA directed DNA methylation (RdDM). In some implementations, increasing BR activity comprises applying epibrassinolide (epiBL); increasing ABA activity comprises applying fluridone, increasing the activity of CYP707A, protein phosphatase 2C (PP2C), or a combination thereof decreasing SnRK activity comprises decreasing an activity of SnRK1, SnRK2, or both; decreasing RdDM comprises applying DNA methyltransferase inhibitor 5-azacytidine (5-azaC), decreasing an activity of RING/FYVE/PHD zinc finger superfamily protein, SUVH1, MED17, HEAT INTOLERANT 4 (HIT4), HISTONE 1.2 (H1.2), ANTHESIS PROMOTING FACTOR 1 (APRF1), SUO, THO1, HISTONE H2A 11 (HTA11), or a combination thereof.
[0195] Chemical Application
[0196] Chemical treatments for inducing apomixis in sexual eukaryotes include applying steroids (e.g., BR), antioxidants, sugars, and combinations thereof that are formulated and administered in an effective dose to repress the epigenome and/or metabalome responsible for sex and/or derepress the epigenome and/or metabalome responsible for apomixis. Exemplary steroids include epibrassinolide. Exemplary sugars include monosaccharides, disaccharides, and short-chain polysaccharides such as glucose, sucrose, and fructose. Exemplary antioxidants include naturally occurring antioxidants, superoxide dismutase, glutathione, ABA, peroxidases, synthetic antioxidants, (S)-2-aminobutane-1,4-dithiol hydrochloride (DTBA).
[0197] The chemical treatment may be administered exogenously or endogenously.
[0198] Exogenous administration must be administered in an effective amount. The specific concentration and duration of administration and target tissue/cells is affected by the specific chemical treatment to be administered. For example, in administering hydrogen peroxide to induce sex in apomictic plants, a 2-500 mM concentration of hydrogen peroxide may be administered to premeiotic inflorescences. In another example, to induce apomixis in sexual plants, 0.1-5 M of epibrassinolide may be administered to premeiotic inflorescences. In another example, to induce apomixis in sexual plants, 10-60 mM of glucose may be administered to premeiotic inflorescences. In other examples, glucose and a steroid, such as epibrassinolide, may be together administered in the above concentrations to induce apomixis in sexual plants. In some embodiments, the eukaryote is transgenically modified to produce the chemical treatment endogenously. In either case, the chemical treatment is administered to the premeiotic germline or germline-associated tissues. In some embodiments, multiple treatments of the chemical treatments may be administered to the subject organism beginning at the premeiotic stage and continuing through the preembryonic stage. In certain plant applications, this period of administering could last from about 3 to about 10 days.
[0199] It will be appreciated that various of the above-disclosed and other features and functions, or alternatives thereof, may be desirably combined into many other different systems or applications. Also, various presently unforeseen or unanticipated alternatives, modifications, variations or improvements therein may be subsequently made by those skilled in the art, and are also intended to be encompassed by the following claims.
[0200] In one non-limiting implementation, increasing sugar level comprises applying glucose to the female germline cell and/or the female germline-associated tissue in the sexual eukaryote (e.g., a pistil). In a non-limiting implementation, glucose is applied to the female germline cell and/or the female germline-associated tissue in an amount and time sufficient to induce apomeiosis, parthenogenesis, or both in the sexual eukaryote. In a non-limiting implementation, glucose is applied in an amount between 20 and 120 mmol/liter (mM), or any number range in between, e.g., 20-110 mM, 25-110 mM, 25-100 mM, 30-100 mM, 30-90 mM, 35-90 mM, 45-90 mM, 45-85 mM, 50-85 mM, 50-80 mM, or 65-75 mM, etc. In another non-limiting implementation, the duration of glucose application (e.g., pre-treatment emersion) is between 2 and 600 minutes, or any number range in between, e.g., 2-480 minutes, 2-420 minutes, 2.5-420 minutes, 2-18 minutes, 2.5-360 minutes, 3-360 minutes, 3-17 minutes, 3.5-240 minutes, 3.5-120 minutes, 4-480 minutes, 4-120 minutes, 4-100 minutes, 4-16 minutes, 5-100 minutes, 5-80 minutes, 5-15 minutes, 6-80 minutes, 6-60 minutes, 6-14 minutes, 7-60 minutes, 7-40 minutes, 7-13 minutes, 8-40 minutes, 8-20 minutes, 8-12 minutes, 9-20 minutes, 9-11 minutes, 40-600 minutes, 60-600 minutes, 60-580 minutes, 80-580 minutes, 80-560 minutes, 100-560 minutes, 100-540 minutes, 120-540 minutes, 120-520 minutes, 140-520 minutes, 140-500 minutes, 160-500 minutes, 160-480 minutes, 180-480 minutes, 210-480 minutes, 210-460 minutes, 240-460 minutes, 240-440 minutes, 270-440 minutes, 270-420 minutes, 300-420 minutes, 300-400 minutes, 320-400 minutes, 320-380 minutes, or 340-380 minutes, etc. In a further non-limiting implementation, to induce apomeiosis, the time to begin glucose application is between 1 and 96 hours before megasporogenesis onset, or any length of time in between, e.g. 1-84 hours, 2-84 hours, 2-72 hours, 3-72 hours, 3-60 hours, 3-48 hours, 4-48 hours, 4-36 hours, 5-36 hours, 5-24 hours, 6-72 hours, 6-24 hours, 6-22 hours, 7-22 hours, 7-20 hours, 8-20 hours, 8-18 hours, 9-18 hours, 9-16 hours, 10-16 hours, 10-14 hours, 11-14 hours, or 11-13 hours, etc. before megasporogenesis onset.
[0201] In one non-limiting implementation, increasing sugar level comprises applying sucrose to the female germline cell and/or the female germline-associated tissue in the sexual eukaryote (e.g., a pistil). In a non-limiting implementation, sucrose is applied to the female germline cell and/or the female germline-associated tissue in an amount and time sufficient to induce apomeiosis, parthenogenesis, or both in the sexual eukaryote. In a non-limiting implementation, sucrose is applied in an amount between 20 and 100 mmol/liter (mM), or any number range in between, e.g., 20-90 mM, 25-90 mM, 25-80 mM, 30-80 mM, 30-70 mM, 35-70 mM, 45-70 mM, 45-65 mM, 50-65 mM, 50-60 mM, or 45-55 mM, etc. In another non-limiting implementation, the duration of sucrose application (e.g., pre-treatment emersion) is less than 480 minutes, e.g., less than 360 minutes, less than 240 minutes, less than 120 minutes, less than 80 minutes, less than 60 minutes, less than 55 minutes, less than 50 minutes, less than 45 minutes, less than 40 minutes, less than 35 minutes, less than 30 minutes, less than 25 minutes, less than 20 minutes, less than 15 minutes, or about 10 minutes, etc. In yet another non-limiting implementation, the duration of sucrose application (e.g., pre-treatment emersion) is between 0.05 and 480 minutes, or any length of time in between, e.g., 0.1-480 minutes, 0.1-450 minutes, 0.5-450 minutes, 0.5-400 minutes, 1-400 minutes, 1-350 minutes, 1-300 minutes, 2-300 minutes, 2-250 minutes, 3-250 minutes, 3-200 minutes, 4-200 minutes, 4-150 minutes, 5-150 minutes, 5-100 minutes, 2-50 minutes, 2-45 minutes, 3-45 minutes, 3-40 minutes, 4-40 minutes, 4-35 minutes, 5-35 minutes, 5-30 minutes, 6-30 minutes, 6-25 minutes, 7-25 minutes, 7-20 minutes, 7-13 minutes, 8-12 minutes, or 9-11 minutes, etc. In a further non-limiting implementation, to induce apomeiosis, the time to begin sucrose application is between 1 and 96 hours before megasporogenesis onset, or any length of time in between, e.g. 1-84 hours, 2-84 hours, 2-72 hours, 3-72 hours, 3-60 hours, 3-48 hours, 4-48 hours, 4-36 hours, 5-36 hours, 5-24 hours, 6-72 hours, 6-24 hours, 6-22 hours, 7-22 hours, 7-20 hours, 8-20 hours, 8-18 hours, 9-18 hours, 9-16 hours, 10-16 hours, 10-14 hours, 11-14 hours, or 11-13 hours, etc. before megasporogenesis onset.
[0202] In one non-limiting implementation, increasing ABA activity comprises applying fluridone is applied to the female germline cell and/or the female germline-associated tissue (e.g., a pistil). In a non-limiting implementation, fluridone is applied in an amount and time sufficient to induce apomeiosis, parthenogenesis, or both in the sexual eukaryote. In a non-limiting implementation, fluridone is applied in an amount between 1 and 30 micromol/liter (M), or any number range in between, e.g., 1-25 M, 2-25 M, 2-20 M, 3-20 M, 3-18 M, 4-18 M, 4-16 M, 5-16 M, 5-15 M, 7-13 M, 8-12 M, or 9-11 M etc. In another non-limiting implementation, the duration of fluridone application (e.g., pre-treatment emersion) is less than 480 minutes, e.g., less than 360 minutes, less than 240 minutes, less than 120 minutes, less than 80 minutes, less than 60 minutes, less than 55 minutes, less than 50 minutes, less than 45 minutes, less than 40 minutes, less than 35 minutes, less than 30 minutes, less than 25 minutes, less than 20 minutes, less than 15 minutes, or about 10 minutes, etc. In yet another non-limiting implementation, the duration of fluridone application (e.g., pre-treatment emersion) is between 0.05 and 480 minutes, or any length of time in between, e.g., 0.1-480 minutes, 0.1-450 minutes, 0.5-450 minutes, 0.5-400 minutes, 1-400 minutes, 1-350 minutes, 1-300 minutes, 2-300 minutes, 2-250 minutes, 3-250 minutes, 3-200 minutes, 4-200 minutes, 4-150 minutes, 5-150 minutes, 5-100 minutes, 2-50 minutes, 2-45 minutes, 3-45 minutes, 3-40 minutes, 4-40 minutes, 4-35 minutes, 5-35 minutes, 5-30 minutes, 6-30 minutes, 6-25 minutes, 7-25 minutes, 7-20 minutes, 7-13 minutes, 8-12 minutes, or 9-11 minutes, etc. In a further non-limiting implementation, to induce apomeiosis, the time to begin fluridone application is between 1 and 96 hours before megasporogenesis onset, or any length of time in between, e.g. 1-84 hours, 2-84 hours, 2-72 hours, 3-72 hours, 3-60 hours, 3-48 hours, 4-48 hours, 4-36 hours, 5-36 hours, 5-24 hours, 6-72 hours, 6-24 hours, 6-22 hours, 7-22 hours, 7-20 hours, 8-20 hours, 8-18 hours, 9-18 hours, 9-16 hours, 10-16 hours, 10-14 hours, 11-14 hours, or 11-13 hours, etc. before megasporogenesis onset. In a yet further non-limiting implementation, to induce parthenogenesis, the time to begin fluridone application is between 1 and 96 hours before anthesis or fertilization, or any length of time in between, e.g. 1-84 hours, 2-84 hours, 2-72 hours, 3-72 hours, 3-60 hours, 3-48 hours, 4-48 hours, 4-36 hours, 5-36 hours, 5-24 hours, 6-72 hours, 6-24 hours, 6-22 hours, 7-22 hours, 7-20 hours, 8-20 hours, 8-18 hours, 9-18 hours, 9-16 hours, 10-16 hours, 10-14 hours, 11-14 hours, or 11-13 hours, etc.
[0203] In one non-limiting implementation, increasing antioxidant activity comprises applying DTBA to the female germline cell and/or the female germline-associated tissue (e.g., a pistil). In a non-limiting implementation, DTBA is applied in an amount and time sufficient to induce apomeiosis, parthenogenesis, or both in the sexual eukaryote. In a non-limiting implementation, DTBA is applied in an amount between 0.05 and 10.0 micromol/liter (04), or any number range in between, e.g., 0.1-10 M, 0.1-9 M, 0.1-8 M, 0.1-7 M, 0.1-6 M, 0.1-5 M, 0.1-4.5 M, 0.2-4.5 M, 0.3-4.5 M, 0.3-4.0 M, 0.4-4.0 M, 0.4-3.0 M, 0.5-10.0 M, 0.5-3.0 M, 0.5-2.0 M, 0.5-1.5 M, 0.7-1.3 M, 0.8-1.2 M, or 0.9-1.1 M, etc. In another non-limiting implementation, the duration of DTBA application (e.g., pre-treatment emersion) is less than 480 minutes, e.g., less than 360 minutes, less than 240 minutes, less than 120 minutes, less than 80 minutes, less than 60 minutes, less than 55 minutes, less than 50 minutes, less than 45 minutes, less than 40 minutes, less than 35 minutes, less than 30 minutes, less than 25 minutes, less than 20 minutes, less than 15 minutes, or about 10 minutes, etc. In yet another non-limiting implementation, the duration of DTBA application (e.g., pre-treatment emersion) is between 0.05 and 480 minutes, or any length of time in between, e.g., 0.1-480 minutes, 0.1-450 minutes, 0.5-450 minutes, 0.5-400 minutes, 1-400 minutes, 1-350 minutes, 1-300 minutes, 2-300 minutes, 2-250 minutes, 3-250 minutes, 3-200 minutes, 4-200 minutes, 4-150 minutes, 5-150 minutes, 5-100 minutes, 2-50 minutes, 2-45 minutes, 3-45 minutes, 3-40 minutes, 4-40 minutes, 4-35 minutes, 5-35 minutes, 5-30 minutes, 6-30 minutes, 6-25 minutes, 7-25 minutes, 7-20 minutes, 7-13 minutes, 8-12 minutes, or 9-11 minutes, etc. In a further non-limiting implementation, to induce apomeiosis, the time to begin DTBA application is between 1 and 96 hours before megasporogenesis onset, or any length of time in between, e.g. 1-84 hours, 2-84 hours, 2-72 hours, 3-72 hours, 3-60 hours, 3-48 hours, 4-48 hours, 4-36 hours, 5-36 hours, 5-24 hours, 6-72 hours, 6-24 hours, 6-22 hours, 7-22 hours, 7-20 hours, 8-20 hours, 8-18 hours, 9-18 hours, 9-16 hours, 10-16 hours, 10-14 hours, 11-14 hours, or 11-13 hours, etc.
[0204] In one embodiment, increasing sugar level and antioxidant activity comprises applying glucose and DTBA to the female germline cell and/or the female germline-associated tissue (e.g., a pistil). In a non-limiting implementation, glucose and DTBA are applied in an amount and time sufficient to induce apomeiosis, parthenogenesis, or both in the sexual eukaryote. In a non-limiting implementation, DTBA is applied in an amount between 0.01 and 10.0 micromol/liter (04), or any number range in between, e.g., 0.01-4 M, 0.02-4 M, 0.02-3 M, 0.03-3 M, 0.03-2 M, 0.04-2 M, 0.04-1 M, 0.05-1 M, 0.05-0.5 M, 0.06-0.5 M, 0.06-0.4 M, 0.07-0.4 M, 0.07-0.3 M, 0.08-0.3 M, 0.08-0.2 M, 0.08-0.12 M, 0.09-0.2 M, or 0.09-0.11 M, 0.05-10 M, 0.1-10 M, 0.1-9 M, 0.1-8 M, 0.1-7 M, 0.1-6 M, 0.1-5 M, 0.1-4.5 M, 0.2-4.5 M, 0.3-4.5 M, 0.3-4.0 M, 0.4-4.0 M, 0.4-3.0 M, 0.5-10.0 M, 0.5-3.0 M, 0.5-2.0 M, 0.5-1.5 M, 0.7-1.3 M, 0.8-1.2 M, or 0.9-1.1 M, etc. In another non-limiting implementation, glucose is applied in an amount between 10 and 200 mmol/liter (mM), or any number range in between, e.g., 10-180 mM, 20-180 mM, 20-160 mM, 30-160 mM, 30-150 mM, 30-140 mM, 40-150 mM, 40-140 mM, 50-140 mM, 50-135 mM, 60-135 mM, 60-130 mM, 70-130 mM, 70-125 mM, 80-140 mM, 80-125 mM, 80-120 mM, 90-130 mM, 90-120 mM, or 90-115 mM, etc. In another non-limiting implementation, the duration of DTBA and glucose application (e.g., pre-treatment emersion) is less than 480 minutes, e.g., less than 360 minutes, less than 240 minutes, less than 120 minutes, less than 80 minutes, less than 60 minutes, less than 55 minutes, less than 50 minutes, less than 45 minutes, less than 40 minutes, less than 35 minutes, less than 30 minutes, less than 25 minutes, less than 20 minutes, less than 15 minutes, or about 10 minutes, etc. In yet another non-limiting implementation, the duration of DTBA and glucose application (e.g., pre-treatment emersion) is between 0.05 and 480 minutes, or any length of time in between, e.g., 0.1-480 minutes, 0.1-450 minutes, 0.5-450 minutes, 0.5-400 minutes, 1-400 minutes, 1-350 minutes, 1-300 minutes, 2-300 minutes, 2-250 minutes, 3-250 minutes, 3-200 minutes, 4-200 minutes, 4-150 minutes, 5-150 minutes, 5-100 minutes, 2-50 minutes, 2-45 minutes, 3-45 minutes, 3-40 minutes, 4-40 minutes, 4-35 minutes, 5-35 minutes, 5-30 minutes, 6-30 minutes, 6-25 minutes, 7-25 minutes, 7-20 minutes, 7-13 minutes, 8-12 minutes, or 9-11 minutes, etc. In yet another non-limiting implementation, to induce parthenogenesis, the time to begin DTBA and glucose application is between 1 and 96 hours before anthesis or fertilization, or any length of time in between, e.g. 1-84 hours, 2-84 hours, 2-72 hours, 3-72 hours, 3-60 hours, 3-48 hours, 4-48 hours, 4-36 hours, 5-36 hours, 5-24 hours, 6-72 hours, 6-24 hours, 6-22 hours, 7-22 hours, 7-20 hours, 8-20 hours, 8-18 hours, 9-18 hours, 9-16 hours, 10-16 hours, 10-14 hours, 11-14 hours, or 11-13 hours, 12-72 hours, 12-66 hours, 15-66 hours, 15-60 hours, 18-60 hours, 18-54 hours, 21-54 hours, 21-48 hours, 24-48 hours, 24-45 hours, 27-45 hours, 27-42 hours, 30-42 hours, 30-39 hours, or 33-39 hours, etc. before anthesis or fertilization.
[0205] In one non-limiting implementation, increasing ABA activity comprises applying 5-azacytidine (5-azaC) to the female germline cell and/or the female germline-associated tissue (e.g., a pistil). In a non-limiting implementation, 5-azaC is applied in an amount and time sufficient to induce apomeiosis, parthenogenesis, or both in the sexual eukaryote. In a non-limiting implementation, 5-azaC is applied in an amount between 5 and 5,000 micromol/liter (M), or any number range in between, e.g., 5-4,000 M, 15-4,000 M, 15-3,000 M, 25-3,000 M, 25-2,000 M, 35-2,000 M, 35-1,500 M, 45-1,500 M, 45-1,000 M, 50-1,000 M, 50-900 M, 150-900 M, 150-800 M, 250-800 M, 250-700 M, 350-700 M, 350-600 M, 450-600 M, or 450-550 M, etc. In another non-limiting implementation, the duration of 5-azaC application (e.g., pre-treatment emersion) is less than 480 minutes, e.g., less than 360 minutes, less than 240 minutes, less than 120 minutes, less than 80 minutes, less than 60 minutes, less than 55 minutes, less than 50 minutes, less than 45 minutes, less than 40 minutes, less than 35 minutes, less than 30 minutes, less than 25 minutes, less than 20 minutes, less than 15 minutes, or about 10 minutes, etc. In yet another non-limiting implementation, the duration of 5-azaC application (e.g., pre-treatment emersion) is between 0.05 and 480 minutes, or any length of time in between, e.g., 0.1-480 minutes, 0.1-450 minutes, 0.5-450 minutes, 0.5-400 minutes, 1-400 minutes, 1-350 minutes, 1-300 minutes, 2-300 minutes, 2-250 minutes, 3-250 minutes, 3-200 minutes, 4-200 minutes, 4-150 minutes, 5-150 minutes, 5-100 minutes, 2-50 minutes, 2-45 minutes, 3-45 minutes, 3-40 minutes, 4-40 minutes, 4-35 minutes, 5-35 minutes, 5-30 minutes, 6-30 minutes, 6-25 minutes, 7-25 minutes, 7-20 minutes, 7-13 minutes, 8-12 minutes, or 9-11 minutes, etc. In a further non-limiting implementation, to induce apomeiosis, the time to begin 5-azaC application is between 1 and 96 hours before megasporogenesis onset, or any length of time in between, e.g. 1-84 hours, 2-84 hours, 2-72 hours, 3-72 hours, 3-60 hours, 3-48 hours, 4-48 hours, 4-36 hours, 5-36 hours, 5-24 hours, 6-96 hours, 6-72 hours, 6-24 hours, 6-22 hours, 7-22 hours, 7-20 hours, 8-20 hours, 8-18 hours, 9-18 hours, 9-16 hours, 10-16 hours, 10-14 hours, 11-14 hours, or 11-13 hours, etc.
[0206] In one non-limiting implementation, increasing BR activity comprises applying epibrassinolide (epiBL) to the female germline cell and/or the female germline-associated tissue (e.g., a pistil). In a non-limiting implementation, epiBL is applied in an amount and time sufficient to induce apomeiosis, parthenogenesis, or both in the sexual eukaryote. In a non-limiting implementation, epiBL is applied in an amount between 0.02 and 20 micromol/liter (M), or any number range in between, e.g., 0.02-19 M, 0.03-19 M, 0.03-18 M, 0.04-18 M, 0.04-17 M, 0.05-17 M, 0.05-18 M, 0.05-15 M, 0.06-15 M, 0.06-14 M, 0.07-14 M, 0.07-13 M, 0.08-13 M, 0.08-12 M, 0.09-12 M, 0.10-11 M, or 0.10-10 M, etc. In another non-limiting implementation, the duration of epiBL application (e.g., pre-treatment emersion) is less than 480 minutes, e.g., less than 360 minutes, less than 240 minutes, less than 120 minutes, less than 80 minutes, less than 60 minutes, less than 55 minutes, less than 50 minutes, less than 45 minutes, less than 40 minutes, less than 35 minutes, less than 30 minutes, less than 25 minutes, less than 20 minutes, less than 15 minutes, or about 10 minutes, etc. In yet another non-limiting implementation, the duration of epiBL application (e.g., pre-treatment emersion) is between 0.05 and 480 minutes, or any length of time in between, e.g., 0.1-480 minutes, 0.1-450 minutes, 0.5-450 minutes, 0.5-400 minutes, 1-400 minutes, 1-350 minutes, 1-300 minutes, 2-300 minutes, 2-250 minutes, 3-250 minutes, 3-200 minutes, 4-200 minutes, 4-150 minutes, 5-150 minutes, 5-100 minutes, 2-50 minutes, 2-45 minutes, 3-45 minutes, 3-40 minutes, 4-40 minutes, 4-35 minutes, 5-35 minutes, 5-30 minutes, 6-30 minutes, 6-25 minutes, 7-25 minutes, 7-20 minutes, 7-13 minutes, 8-12 minutes, or 9-11 minutes, etc. In a further non-limiting implementation, to induce apomeiosis, the time to begin epiBL application is between 1 and 96 hours before megasporogenesis onset, or any length of time in between, e.g. 1-84 hours, 2-84 hours, 2-72 hours, 3-72 hours, 3-60 hours, 3-48 hours, 4-48 hours, 4-36 hours, 5-36 hours, 5-24 hours, 6-72 hours, 6-24 hours, 6-22 hours, 7-22 hours, 7-20 hours, 8-20 hours, 8-18 hours, 9-18 hours, 9-16 hours, 10-16 hours, 10-14 hours, 11-14 hours, or 11-13 hours, etc. before megasporogenesis onset.
[0207] In one non-limiting implementation, increasing sugar level and BR activity comprises applying glucose and epibrassinolide (epiBL) to the female germline cell and/or the female germline-associated tissue (e.g., a pistil). In a non-limiting implementation, glucose and epiBL are applied in an amount and time sufficient to induce apomeiosis, parthenogenesis, or both in the sexual eukaryote. In a non-limiting implementation, epiBL is applied in an amount between 0.05 and 15 micromol/liter (M), or any number range in between, e.g., 0.05-10 M, 0.1-15 M, 0.1-10 M, 0.1-8.5 M, 0.2-8.5 M, 0.2-7.0 M, 0.3-7.0 M, 0.3-5.5 M, 0.4-5.5 M, 0.4-5.0 M, 0.5-5.0 M, 0.5-4.5 M, 0.5-4 M, 1.0-4 M, 1.0-3.5 M, 1.5-3.5 M, 1.5-3.0 M, or 1.5-2.0 M, etc. In another non-limiting implementation, glucose is applied in an amount between 3 and 200 mmol/liter (mM), or any number range in between, e.g., 3-180 mM, 3-140 mM, 10-180 mM, 20-180 mM, 20-160 mM, 30-160 mM, 30-150 mM, 40-150 mM, 40-140 mM, 50-140 mM, 50-135 mM, 60-135 mM, 60-130 mM, 70-130 mM, 70-125 mM, 80-140 mM, 80-125 mM, 80-120 mM, 90-130 mM, 90-120 mM, or 90-115 mM, etc. In yet another non-limiting implementation, the duration of epiBL and glucose application (e.g., pre-treatment emersion) is between 0.01 and 600 minutes, or any number range in between, e.g., 0.05 and 480 minutes, or any length of time in between, e.g., 0.1-480 minutes, 0.1-450 minutes, 0.5-450 minutes, 0.5-400 minutes, 1-400 minutes, 1-350 minutes, 1-300 minutes, 2-300 minutes, 2-250 minutes, 3-250 minutes, 3-200 minutes, 4-200 minutes, 4-150 minutes, 5-150 minutes, 5-100 minutes, 2-50 minutes, 2-45 minutes, 3-45 minutes, 3-40 minutes, 4-40 minutes, 4-35 minutes, 5-35 minutes, 5-30 minutes, 6-30 minutes, 6-25 minutes, 7-25 minutes, 7-20 minutes, 7-13 minutes, 8-12 minutes, 9-11 minutes, 40-600 minutes, 60-600 minutes, 60-580 minutes, 80-580 minutes, 80-560 minutes, 100-560 minutes, 100-540 minutes, 120-540 minutes, 120-520 minutes, 140-520 minutes, 140-500 minutes, 160-500 minutes, 160-480 minutes, 180-480 minutes, 210-480 minutes, 210-460 minutes, 240-460 minutes, 240-440 minutes, 270-440 minutes, 270-420 minutes, 300-420 minutes, 300-400 minutes, 320-400 minutes, 320-380 minutes, or 340-380 minutes etc. In a further non-limiting implementation, to induce parthenogenesis, the time to begin epiBL and glucose application is between 6 and 72 hours before anthesis or fertilization, or any length of time in between, e.g., 12-66 hours, 15-66 hours, 15-60 hours, 18-60 hours, 18-54 hours, 21-54 hours, 21-48 hours, 24-48 hours, 24-45 hours, 27-45 hours, 27-42 hours, 30-42 hours, 30-39 hours, or 33-39 hours, etc. before anthesis or fertilization.
Transgenic Upregulation or Downregulation
[0208] In some embodiments, increasing glucose signaling, decreasing osmotic stress, decreasing oxidative stress, decreasing perceived oxidative stress, or a combination thereof comprises decreasing sucrose non-fermenting 1 related kinase (SnRK) activity, decreasing meiosis-specific RNA directed DNA methylation (RdDM), increasing target of rapamycin complex 1 (TORC1) activity, increasing brassinosteroids (BR) activity, increasing ABA activity (e.g., increasing PP2C, CYP707A, or both), or a combination thereof in a female germline cell, a female germline-associated tissue, or both of the sexual eukaryote.
[0209] As used herein, target gene refers to any gene that one desires to increase or decrease the activity in a eukaryote, the eukaryote cell, or the eukaryote tissue (e.g., the female germline cell, the female germline-associated tissue, or both) of the sexual eukaryote. In some embodiments, decreasing the activity of the target gene in the female germline cell, the female germline-associated tissue, or both decreases reduction and/or recombination in meiosis. In some embodiments, decreasing the activity of the target gene in the female germline cell, the female germline-associated tissue, or both prevents reduction and/or recombination in meiosis. In some implementations, the target gene encodes SnRK1. In other implementations, the target gene encodes SnRK2. In further implementations, the target gene encodes RING/FYVE/PHD zinc finger superfamily protein, SUVH1, MED17, HEAT INTOLERANT 4 (HIT4), HISTONE 1.2 (H1.2), ANTHESIS PROMOTING FACTOR 1 (APRF1), SUO, THO1, or HISTONE H2A 11 (HTA11).
[0210] As used herein, decreasing activity of a target gene refers to causing, directly or indirectly, reduction in the transcription of the target gene, reduction in the amount, stability or translatability of transcription products (e.g., RNA) of said target gene, reduction in translation of the polypeptide(s) encoded by the target gene and/or reduction in the amount, stability, or alteration of biochemical function of the polypeptides encoded by the target gene, so as to reduce the amount or function of the target gene products. As used herein, increasing activity of a target gene refers to causing, directly or indirectly, increase in the transcription of the target gene, increase in the amount, stability or translatability of transcription products (e.g., RNA) of said target gene, reduction in translation of the polypeptide(s) encoded by the target gene and/or increase in the amount, stability, or alteration of biochemical function of the polypeptides encoded by the target gene, so as to increase the amount or function of the target gene products.
[0211] A decrease or increase in the target gene activity can be monitored, e.g., by direct detection of gene transcripts (e.g., by PCR), by detection of polypeptide(s) encoded by the gene (e.g., by Western blot or immunoprecipitation), by detection of biological activity of polypeptides encode by the gene (e.g., catalytic activity, ligand binding, etc), or by monitoring changes in a cell or organism resulting from reduction in expression of the gene.
[0212] In one implementation, the target gene activity is decreased (e.g., SnRK and/or RdDM) or increased (e.g., TORC1, BR, PP2C, and/or CYP707A) by 1%-100%, or any percent number in between, e.g., 1-75%, 1-50%, 1-25%, 5-100%, 5-95%, 5-90%, 5-85%, 5-80%, 5-75%, 5-70%, 5-65%, 5-60%, 5-55%, 5-50%, 5-45%, 5-40%, 5-35%, 5-30%, 5-25%, 5-20%, 5-15%, 5-10%, 10-100%, 10-90%, 10-80%, 10-70%, 10-60%, 10-50%, 10-40%, 10-30%, 10-20%, 25-100%, 25-75%, 25-50%, 30-100%, 30-95%, 30-90%, 30-85%, 30-80%, 30-75%, 30-70%, 30-65%, 30-60%, 30-55%, 30-50%, 40-100%, 40-90%, 40-80%, 40-70%, 40-60%, 40-50%, 50-100%, 50-95%, 50-90%, 50-80%, 50-75%, 50-70%, or 75-100% in one or more plant cells as compared to the target gene of that would exist in the same plant tissue(s) without the decrease or increase. In another implementations, the target gene activity is decreased (e.g., SnRK or RdDM) or increased (e.g., TORC1, BR, PP2C, and/or CYP707A) by at least 10%, for example, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in one or more plant cells as compared to the target gene of that would exist in the same plant tissue(s) without the decrease.
[0213] In one implementation, the decrease or increase of the target gene activity is detectable pre-meiosis, e.g., is detectable at least one-, two-, four-, eight-, twelve-, or eighteen-hours pre-meiosis, or is detectable at least one-, two-, three-, or four-days pre-meiosis. As used herein, the term pre-meiosis or premeiotic refers to the stage of sexual reproduction prior to when meiosis typically occurs, wherein meiocyte mother cells are not yet mature or are still forming.
[0214] In one implementation, the decrease or increase of the target gene activity is permanent, i.e., resulting in reduction or increase of gene expression for the lifetime of the organism and/or its future generations. In an alternative implementation, the decrease or increase of the target gene activity is transient, e.g., for the duration of the presence of a silencing element or downregulating agent. In a specific implementation, the decrease or increase of the target gene activity lasts at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, at least 120 hours, at least 144 hours, at least 168 hours, at least 192 hours, at least 216 hours, or at least 240 hours. In another implementation, the decrease of the target gene activity lasts for about 24-240 hours, about 24-144 hours, about 24-96 hours, about 24-48 hours, about 48-240 hours, about 48-192 hours, about 48-144 hours, about 48-72 hours, about 72-249 hours, about 72-192 hours, about 72-144 hours, about 96-144 hours, or about 120-240 hours. In some embodiments, the decrease of the target gene activity begins pre-meiosis, at least one-hour before megasporogenesis onset, e.g., at least two-hours, at least four-hours, at least eight-hours, at least 12-hours, at least 18-hours, at least 24-hours pre-meiosis, at least 48-hours, or at least 72-hours pre-meiosis, etc. before megasporogenesis onset. In some implementations, the SnRK1 activity, SnRK2 activity, or both is decreased by 10-90% between 0.5 and 48 hours before megasporogenesis onset to 0.5 to 48 h after embryo formation.
Gene Disruption
[0215] In some embodiments of the present disclosure, the activity of the target gene is decreased or eliminated by disrupting the gene encoding the polypeptide. In one embodiment, SnRK activity is decreased by disrupting an endogenous SnRK gene in the female germline cell, the female germline-associated tissue, or both. In a particular implementation, the endogenous SnRK gene is selected from the group consisting of: SnRK1, SnRK2, an ortholog thereof, and combinations thereof.
[0216] In another embodiment, RdDM activity is decreased by disrupting an endogenous RdDM gene in the female germline cell, the female germline-associated tissue, or both. In a particular implementation, the endogenous RdDM gene is selected from the group consisting of: RING/FYVE/PHD zinc finger superfamily protein, SUVH1, MED17, HEAT INTOLERANT 4 (HIT4), HISTONE 1.2 (H1.2), ANTHESIS PROMOTING FACTOR 1 (APRF1), SUO, THO1, HISTONE H2A 11 (HTA11), an ortholog thereof, and combinations thereof.
[0217] In a further embodiment, in addition to disrupting the SnRK gene, at least one other endogenous gene involved in meiosis is disrupted. In one implementation, the at least one other endogenous gene is selected from the group consisting of: RING/FYVE/PHD zinc finger superfamily protein, SUVH1, MED17, HEAT INTOLERANT 4 (HIT4), HISTONE 1.2 (H1.2), ANTHESIS PROMOTING FACTOR 1 (APRF1), SUO, THO1, HISTONE H2A 11 (HTA11), an ortholog thereof, and combinations thereof.
[0218] The gene encoding the polypeptide may be disrupted by any method known in the art, for example, by genome editing, transposon tagging or mutagenizing plants using random or targeted mutagenesis and selecting for plants that have decreased activity. A plant cell other than the female germline cell and/or female germline-associated tissue may be used for the gene disruption technology.
A. Genome Editing and Induced Mutagenesis
[0219] In some embodiments, the target gene (e.g., SnRK1 and/or SnRK2) is modified using gene editing technology, including without limitation double-strand-break-inducing agent, such as but not limited to a CRISPR-Cas guideRNA or other polynucleotide-guided double strand break reagent, a Zinc Finger endonuclease, a meganuclease, or a TALEN endonuclease.
[0220] CRISPR loci (Clustered Regularly Interspaced Short Palindromic Repeats) (also known as SPIDRs-SPacer Interspersed Direct Repeats) constitute a family of recently described DNA loci. CRISPR loci consist of short and highly conserved DNA repeats (typically 24 to 40 bp, repeated from 1 to 140 times, also referred to as CRISPR-repeats) which are partially palindromic. The repeated sequences (usually specific to a species) are interspaced by variable sequences of constant length (typically 20 to 58 bp depending on the CRISPR locus (WO2007/025097 published Mar. 1, 2007).
[0221] CRISPR loci were first recognized in Escherichia coli (Ishino et al., (1987) J. Bacteriol. 169:5429-33; Nakata et al., (1989) J. Bacteriol. 171:3553-56). Similar interspersed short sequence repeats have been identified in Haloferax mediterranei, Streptococcus pyogenes, Anabaena, and Mycobacterium tuberculosis (Groenen et al., (1993) Mol. Microbiol. 10:1057-65; Hoe et al., (1999) Emerg. Infect. Dis. 5:254-263; Masepohl et al., (1996) Biochim. Biophys. Acta 1307:26-30; Mojica et al., (1995) Mol. Microbiol. 17:85-93). The CRISPR loci differ from other simple sequence repeats (SSRs) by the structure of the repeats, which have been termed short regularly spaced repeats (SRSRs) (Janssen et al., (2002) J. Integ. Biol. 6:23-33; Mojica et al., (2000) Mol. Microbiol. 36:244-46). The repeats are short elements that occur in clusters, which are always regularly spaced by variable sequences of constant length (Mojica et al., (2000) Mol. Microbiol. 36:244-46).
[0222] Cas gene relates to a gene that is generally coupled, associated or close to, or in the vicinity of flanking CRISPR loci. The terms Cas gene, CRISPR-associated (Cas) gene are used interchangeably herein. A comprehensive review of the Cas protein family is presented in Haft et al., (2005) PLoS Comput Biol 1: e60. As described therein, 41 CRISPR-associated (Cas) gene families are described, in addition to the four previously known gene families. It shows that CRISPR systems belong to different classes, with different repeat patterns, sets of genes, and species ranges. The number of Cas genes at a given CRISPR locus can vary between species.
[0223] Cas endonuclease relates to a Cas protein encoded by a Cas gene, wherein said Cas protein is capable of introducing a double strand break into a DNA target sequence. The Cas endonuclease is guided by a guide polynucleotide to recognize and optionally introduce a double strand break at a specific target site into the genome of a cell (U.S. application Ser. No. 15/571,510, filed May 6, 2016). The guide polynucleotide/Cas endonuclease system includes a complex of a Cas endonuclease and a guide polynucleotide that is capable of introducing a double strand break into a DNA target sequence. The Cas endonuclease unwinds the DNA duplex in close proximity of the genomic target site and cleaves both DNA strands upon recognition of a target sequence by a guide RNA if a correct protospacer-adjacent motif (PAM) is approximately oriented at the 3 end of the target sequence.
[0224] The Cas endonuclease gene can encode Cas9 endonuclease, or a functional fragment thereof, such as but not limited to the Cas9 genes listed in WO2007/025097, published Mar. 1, 2007. The Cas endonuclease gene can be a plant, maize or soybean optimized Cas9 endonuclease, such as but not limited to a plant codon optimized Streptococcus pyogenes Cas9 gene. The Cas endonuclease can be introduced directly into a cell by any method known in the art, for example, but not limited to, transient introduction methods, transfection, and/or topical application.
[0225] As used herein, the term guide RNA relates to a synthetic fusion of two RNA molecules, a crRNA (CRISPR RNA) comprising a variable targeting domain, and a tracrRNA. In one embodiment, the guide RNA comprises a variable targeting domain of 12 to 30 nucleotide sequences and a RNA fragment that can interact with a Cas endonuclease.
[0226] As used herein, the term guide polynucleotide relates to a polynucleotide sequence that can form a complex with a Cas endonuclease and enables the Cas endonuclease to recognize and optionally cleave a DNA target site (U.S. application Ser. No. 15/571,510, filed May 6, 2016). The guide polynucleotide can be a single molecule or a double molecule. The guide polynucleotide sequence can be an RNA sequence, a DNA sequence, or a combination thereof (an RNA-DNA combination sequence). Optionally, the guide polynucleotide can comprise at least one nucleotide, phosphodiester bond or linkage modification such as, but not limited to, Locked Nucleic Acid (LNA), 5-methyl dC, 2,6-Diaminopurine, 2-Fluoro A, 2-Fluoro U, 2-O-Methyl RNA, phosphorothioate bond, linkage to a cholesterol molecule, linkage to a polyethylene glycol molecule, linkage to a spacer 18 (hexaethylene glycol chain) molecule, or 5 to 3 covalent linkage resulting in circularization. A guide polynucleotide that solely comprises ribonucleic acids is also referred to as a guide RNA.
[0227] The guide polynucleotide can be a double molecule (also referred to as duplex guide polynucleotide), comprising a first nucleotide sequence domain (referred to as Variable Targeting domain or VT domain) that is complementary to a nucleotide sequence in a target DNA and a second nucleotide sequence domain (referred to as Cas endonuclease recognition domain or CER domain) that interacts with a Cas endonuclease polypeptide. The CER domain of the double molecule guide polynucleotide comprises two separate molecules that are hybridized along a region of complementarity. The two separate molecules can be RNA, DNA, and/or RNA-DNA-combination sequences. In some embodiments, the first molecule of the duplex guide polynucleotide comprising a VT domain linked to a CER domain is referred to as crDNA (when composed of a contiguous stretch of DNA nucleotides) or crRNA (when composed of a contiguous stretch of RNA nucleotides), or crDNA-RNA (when composed of a combination of DNA and RNA nucleotides). The crNucleotide can comprise a fragment of the cRNA naturally occurring in Bacteria and Archaea. In one embodiment, the size of the fragment of the cRNA naturally occurring in Bacteria and Archaea that is present in a crNucleotide disclosed herein can range from, but is not limited to, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleotides. In some embodiments, the second molecule of the duplex guide polynucleotide comprising a CER domain is referred to as tracrRNA (when composed of a contiguous stretch of RNA nucleotides) or tracrDNA (when composed of a contiguous stretch of DNA nucleotides) or tracrDNA-RNA (when composed of a combination of DNA and RNA nucleotides. In one embodiment, the RNA that guides the RNA/Cas9 endonuclease complex is a duplexed RNA comprising a duplex crRNA-tracrRNA.
[0228] The guide polynucleotide can also be a single molecule comprising a first nucleotide sequence domain (referred to as Variable Targeting domain or VT domain) that is complementary to a nucleotide sequence in a target DNA and a second nucleotide domain (referred to as Cas endonuclease recognition domain or CER domain) that interacts with a Cas endonuclease polypeptide. By domain it is meant a contiguous stretch of nucleotides that can be RNA, DNA, and/or RNA-DNA-combination sequence. The VT domain and/or the CER domain of a single guide polynucleotide can comprise a RNA sequence, a DNA sequence, or a RNA-DNA-combination sequence. In some embodiments, the single guide polynucleotide comprises a crNucleotide (comprising a VT domain linked to a CER domain) linked to a tracrNucleotide (comprising a CER domain), wherein the linkage is a nucleotide sequence comprising a RNA sequence, a DNA sequence, or a RNA-DNA combination sequence. The single guide polynucleotide being comprised of sequences from the crNucleotide and tracrNucleotide may be referred to as single guide RNA (when composed of a contiguous stretch of RNA nucleotides) or single guide DNA (when composed of a contiguous stretch of DNA nucleotides) or single guide RNA-DNA (when composed of a combination of RNA and DNA nucleotides). In one embodiment of the disclosure, the single guide RNA comprises a cRNA or cRNA fragment and a tracrRNA or tracrRNA fragment of the type II CRISPR/Cas system that can form a complex with a type II Cas endonuclease, wherein said guide RNA/Cas endonuclease complex can direct the Cas endonuclease to a plant genomic target site, enabling the Cas endonuclease to introduce a double strand break into the genomic target site. One aspect of using a single guide polynucleotide versus a duplex guide polynucleotide is that only one expression cassette needs to be made to express the single guide polynucleotide.
[0229] The term variable targeting domain or VT domain is used interchangeably herein and includes a nucleotide sequence that is complementary to one strand (nucleotide sequence) of a double strand DNA target site. The % complementation between the first nucleotide sequence domain (VT domain) and the target sequence can be at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 63%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%. The variable target domain can be at least 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length. In some embodiments, the variable targeting domain comprises a contiguous stretch of 12 to 30 nucleotides. The variable targeting domain can be composed of a DNA sequence, an RNA sequence, a modified DNA sequence, a modified RNA sequence, or any combination thereof.
[0230] The term Cas endonuclease recognition domain or CER domain of a guide polynucleotide is used interchangeably herein and includes a nucleotide sequence (such as a second nucleotide sequence domain of a guide polynucleotide) that interacts with a Cas endonuclease polypeptide. The CER domain can be composed of a DNA sequence, a RNA sequence, a modified DNA sequence, a modified RNA sequence (see for example modifications described herein), or any combination thereof.
[0231] The nucleotide sequence linking the crNucleotide and the tracrNucleotide of a single guide polynucleotide can comprise a RNA sequence, a DNA sequence, or a RNA-DNA combination sequence. In one embodiment, the nucleotide sequence linking the crNucleotide and the tracrNucleotide of a single guide polynucleotide can be at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 nucleotides in length. In another embodiment, the nucleotide sequence linking the crNucleotide and the tracrNucleotide of a single guide polynucleotide can comprise a tetraloop sequence.
[0232] Nucleotide sequence modification of the guide polynucleotide, VT domain and/or CER domain can be selected from, but not limited to, the group consisting of a 5 cap, a 3 polyadenylated tail, a riboswitch sequence, a stability control sequence, a sequence that forms a dsRNA duplex, a modification or sequence that targets the guide polynucleotide to a subcellular location, a modification or sequence that provides for tracking, a modification or sequence that provides a binding site for proteins, a Locked Nucleic Acid (LNA), a 5-methyl dC nucleotide, a 2,6-Diaminopurine nucleotide, a 2-Fluoro A nucleotide, a 2-Fluoro U nucleotide, a 2-O-Methyl RNA nucleotide, a phosphorothioate bond, linkage to a cholesterol molecule, linkage to a polyethylene glycol molecule, linkage to a spacer 18 molecule, a 5 to 3 covalent linkage, or any combination thereof. These modifications can result in at least one additional beneficial feature, wherein the additional beneficial feature is selected from the group of a modified or regulated stability, a subcellular targeting, tracking, a fluorescent label, a binding site for a protein or protein complex, modified binding affinity to complementary target sequence, modified resistance to cellular degradation, and increased cellular permeability.
B. Transposon Tagging
[0233] In one embodiment, transposon tagging is used to decrease or eliminate the activity of one or more polypeptides. Transposon tagging comprises inserting a transposon within an endogenous gene in the pathway to decrease or eliminate expression of the polypeptide.
[0234] In this embodiment, the expression of one or more polypeptides is decreased or eliminated by inserting a transposon within a regulatory region or coding region of the gene encoding the polypeptide. A transposon that is within an exon, intron, 5 or 3 untranslated sequence, a promoter or any other regulatory sequence of a gene may be used to decrease or eliminate the expression and/or activity of the encoded polypeptide.
[0235] Methods for the transposon tagging of specific genes in plants are well known in the art. See, e.g., Maes et al., (1999) Trends Plant Sci. 4:90-96; Dharmapuri & Sonti, (1999) FEMS Microbiol. Lett. 179:53-59; Meissner et al., (2000) Plant J. 22:265-74; Phogat et al., (2000) J. Biosci. 25:57-63; Walbot, (2000) Curr. Opin. Plant Biol. 2:103-07; Gai et al., (2000) Nucleic Acids Res. 28:94-96; Fitzmaurice et al., (1999) Genetics 153:1919-28. In addition, the TUSC process for selecting Mu insertions in selected genes has been described in Bensen et al., (1995) Plant Cell 7:75-84; Mena et al., (1996) Science 274:1537-40; and U.S. Pat. No. 5,962,764, each of which is herein incorporated by reference.
C. Mutant Plants with Decreased Activity
[0236] Additional methods for decreasing or eliminating the expression of endogenous genes in plants are also known in the art and may be similarly applied to the instant disclosure. These methods include other forms of mutagenesis, such as ethyl methanesulfonate-induced mutagenesis, deletion mutagenesis, and fast neutron deletion mutagenesis used in a reverse genetics sense (with PCR) to identify plant lines, in which the endogenous gene has been mutated or deleted. For examples of these methods see Ohshima et al., (1998) Virology 243:472-81; Okubara et al., (1994) Genetics 137:867-74; and Quesada et al., (2000) Genetics 154:421-36, each of which is herein incorporated by reference. In addition, a fast and automatable method for screening for chemically induced mutations, TILLING (Targeting Induced Local Lesions In Genomes), using denaturing HPLC or selective endonuclease digestion of selected PCR products is also applicable to the instant disclosure. See McCallum et al., (2000) Nat. Biotechnol. 18:455-57, herein incorporated by reference.
[0237] Mutations may impact gene expression or interfere with the activity of an encoded target gene (e.g., SnRK1 and/or SnRK2) protein. Insertional mutations in gene exons usually result in null-mutants. Mutations in conserved residues are particularly effective in inhibiting the activity of the encoded protein. Conserved residues of plant polypeptides suitable for mutagenesis with the goal to eliminate activity have been described. Such mutants may be isolated according to well-known procedures and mutations in different target gene (e.g., SnRK1 and/or SnRK2) loci may be stacked by genetic crossing. See, e.g., Gruis et al., (2002) Plant Cell 14:2863-82.
[0238] In another embodiment, dominant mutants is used to trigger RNA silencing due to gene inversion and recombination of a duplicated gene locus. See, e.g., Kusaba et al., (2003) Plant Cell 15:1455-67.
[0239] The disclosure encompasses additional methods for decreasing or eliminating the activity of one or more target polypeptides. Examples of other methods for altering or mutating a genomic nucleotide sequence in a plant are known in the art and include, but are not limited to, the use of RNA:DNA vectors, RNA:DNA mutational vectors, RNA:DNA repair vectors, mixed-duplex oligonucleotides, self-complementary RNA:DNA oligonucleotides, and recombinogenic oligonucleobases. Such vectors and methods of use are known in the art. See, for example, U.S. Pat. Nos. 5,565,350; 5,731,181; 5,756,325; 5,760,012; 5,795,972; and 5,871,984, each of which are herein incorporated by reference. See also WO 1998/49350, WO 1999/07865, WO 1999/25821, and Beetham et al., (1999) Proc. Natl. Acad. Sci. USA 96:8774-78, each of which is herein incorporated by reference.
Silencing Elements
[0240] As used herein, silencing element refers to a polynucleotide that is capable of reducing or eliminating the level or expression of a target polynucleotide or the polypeptide encoded thereby. The silencing element employed can decrease or eliminate the expression level of the target sequence by influencing the level of the target RNA transcript or, alternatively, by influencing translation and thereby affecting the level of the encoded polypeptide. A single polynucleotide employed in the methods can comprise one or more silencing elements to the same or different target polynucleotides. The silencing element can be produced in vivo (i.e., in a host cell such as a plant) or in vitro.
[0241] In some embodiments, decreasing the target gene (e.g., SnRK1 and/or SnRK2) activity comprises introducing into the female germline cell and/or the female germline-associated tissue a silencing element thereby reducing or eliminating the level or expression of a polynucleotide or a polypeptide encoded by the target gene. In a specific implementation, decreasing SnRK activity comprises introducing into the female germline cell and/or the female germline-associated tissue a silencing element capable of decreasing or eliminating a polynucleotide or a polypeptide encoded by SnRK1, SnRK2, or both. In another specific implementation, decreasing RdDM activity comprises introducing into the female germline cell and/or the female germline-associated tissue a silencing element capable of decreasing or eliminating a polynucleotide or a polypeptide encoded by RING/FYVE/PHD zinc finger superfamily protein, SUVH1, MED17, HEAT INTOLERANT 4 (HIT4), HISTONE 1.2 (H1.2), ANTHESIS PROMOTING FACTOR 1 (APRF1), SUO, THO1, and/or HISTONE H2A 11 (HTA11).
[0242] In specific embodiments, the target sequence is endogenous to the plant. In other embodiments, while the silencing element regulates non-reduction and non-recombination of meiosis, preferably the silencing element has no effect on the parts of the plant that do not constitute the female germline, the female germline-associated tissue, or both.
[0243] Non-limiting examples of silencing elements include, a sense suppression element, an antisense suppression element, a double stranded RNA, a siRNA, an amiRNA, a miRNA, or a hairpin suppression element. Non-limiting examples of silencing elements that can be employed to decrease expression of these target sequences or additionally sequences targeting genes involved in recombination comprise fragments and variants of the sense or antisense sequence or consists of the sense or antisense sequence of wild type polynucleotide or polypeptide sequences, variant polynucleotides, variant polypeptides, cognate promoter sequences, ortholog sequences, variants or fragments thereof. The silencing element can further comprise additional sequences that advantageously effect transcription and/or the stability of a resulting transcript. For example, the silencing elements can comprise at least one thymine residue at the 3 end. This can aid in stabilization. Thus, the silencing elements can have at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more thymine residues at the 3 end. Enhancer suppressor elements can also be employed in conjunction with the silencing elements.
[0244] In some implementations, introducing the silencing element decreases the polynucleotide level and/or the polypeptide level of the target sequence to less than 95%, less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, or less than 5% of the polynucleotide level, or the level of the polypeptide encoded thereby, of the same target sequence in an appropriate control.
A. Sense Suppression/Cosuppression
[0245] In some embodiments, decreasing expression of the target gene (e.g., SnRK1 and/or SnRK2) is obtained by sense suppression or cosuppression. For cosuppression, an expression cassette is designed to express an RNA molecule corresponding to all or part of a messenger RNA encoding a polypeptide in the sense orientation. Over expression of the RNA molecule may result in decreased expression of the native gene. Accordingly, multiple plant lines transformed with the cosuppression expression cassette are screened to identify those that show the desired degree of inhibition of polypeptide expression.
[0246] Typically, a sense suppression element has substantial sequence identity to the target polynucleotide, typically greater than about 65% sequence identity, greater than about 85% sequence identity, about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity. See, U.S. Pat. Nos. 5,283,184 and 5,034,323; herein incorporated by reference. The sense suppression element can be any length so long as it allows for the suppression of the targeted sequence. In other implementations, the sense suppression element is, for example, 15, 16, 17, 18 19, 20, 22, 25, 30, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 900, 1000, 1100, 1200, 1300 nucleotides or longer of the target polynucleotides. In other implementations, the sense suppression element is, for example, about 15-25, 25-100, 100-150, 150-200, 200-250, 250-300, 300-350, 350-400, 450-500, 500-550, 550-600, 600-650, 650-700, 700-750, 750-800, 800-850, 850-900, 900-950, 950-1000, 1000-1050, 1050-1100, 1100-1200, 1200-1300, 1300-1400, 1400-1500, 1500-1600, 1600-1700, 1700-1800 nucleotides or longer of the target polynucleotides.
[0247] The polynucleotide used for cosuppression may correspond to all or part of the sequence encoding the polypeptide, all or part of the 5 and/or 3 untranslated region of a polypeptide transcript or all or part of both the coding sequence and the untranslated regions of a transcript encoding a polypeptide. In some embodiments where the polynucleotide comprises all or part of the coding region for the polypeptide, the expression cassette is designed to eliminate the start codon of the polynucleotide so that no protein product will be translated.
[0248] Cosuppression has been used to inhibit the expression of plant genes to produce plants having undetectable protein levels for the proteins encoded by these genes (see, e.g., Broin et al., (2002) Plant Cell 14:1417-32), and to inhibit the expression of multiple proteins in the same plant (see, e.g., U.S. Pat. No. 5,942,657). Methods for using cosuppression to inhibit the expression of endogenous genes in plants are described in Flavell et al., (1994) Proc. Natl. Acad. Sci. USA 91:3490-96; Jorgensen et al., (1996) Plant Mol. Biol. 31:957-73; Johansen & Carrington, (2001)Plant Physiol. 126:930-38; Broin et al., (2002) Plant Cell 14:1417-32; Stoutj esdij k et al., (2002) Plant Physiol. 129:1723-31; Yu et al., (2003) Phytochemistry 63: 753-63; and U.S. Pat. Nos. 5,034,323, 5,283,184, and 5,942,657, each of which is herein incorporated by reference. The efficiency of cosuppression may be increased by including a poly-dT region in the expression cassette at a position 3 to the sense sequence and 5 of the polyadenylation signal. See, US Patent Application Publication No. 2002/0048814, herein incorporated by reference. Typically, such a nucleotide sequence has substantial sequence identity to the sequence of the transcript of the endogenous gene, optimally greater than about 65% sequence identity, more optimally greater than about 85% sequence identity, most optimally greater than about 95% sequence identity. See U.S. Pat. Nos. 5,283,184 and 5,034,323, herein incorporated by reference.
B. Antisense Suppression
[0249] In some implementations, decreasing expression of the target gene (e.g., SnRK1 and/or SnRK2) is obtained by antisense suppression. For antisense suppression, the expression cassette is designed to express an RNA molecule complementary to all or part of a messenger RNA encoding the polypeptide. Over expression of the antisense RNA molecule may result in decreased expression of the target gene. Accordingly, multiple plant lines transformed with the antisense suppression expression cassette are screened to identify those that show the desired degree of inhibition of polypeptide expression.
[0250] The polynucleotide for use in antisense suppression may correspond to all or part of the complement of the sequence encoding the polypeptide, all or part of the complement of the 5 and/or 3 untranslated region of the target transcript or all or part of the complement of both the coding sequence and the untranslated regions of a transcript encoding the polypeptide. In addition, the antisense polynucleotide may be fully complementary (i.e., 100% identical to the complement of the target sequence) or partially complementary (i.e., less than 100% identical to the complement of the target sequence) to the target sequence. In addition, the antisense suppression element may be fully complementary (i.e., 100% identical to the complement of the target sequence) or partially complementary (i.e., less than 100% identical to the complement of the target sequence) to the target polynucleotide. In specific embodiments, the antisense suppression element comprises at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence complementarity to the target polynucleotide. Antisense suppression may be used to inhibit the expression of multiple proteins in the same plant. See, for example, U.S. Pat. No. 5,942,657. Furthermore, the antisense suppression element can be complementary to a portion of the target polynucleotide. Generally, sequences of at least 15, 20, 22, 25, 50, 100, 200, 300, 400, 450 nucleotides or greater of the target gene sequence may be used. Methods for using antisense suppression to inhibit the expression of endogenous genes in plants are described, e.g., in Liu et al. (2002) Plant Physiol. 129:1732-43 and U.S. Pat. Nos. 5,759,829 and 5,942,657, each of which is herein incorporated by reference. Efficiency of antisense suppression may be increased by including a poly-dT region in the expression cassette at a position 3 to the antisense sequence and 5 of the polyadenylation signal. See, US Patent Application Publication No. 2002/0048814, herein incorporated by reference.
C. Double-Stranded RNA Interference
[0251] In some embodiments, decreasing the expression of the target gene (e.g., SnRK1 and/or SnRK2) is obtained by double-stranded RNA (dsRNA) interference. A double stranded RNA silencing element or dsRNA comprises at least one transcript that is capable of forming a dsRNA. Thus, a dsRNA silencing element includes a dsRNA, a transcript or polyribonucleotide capable of forming a dsRNA or more than one transcript or polyribonucleotide capable of forming a dsRNA. Double stranded RNA or dsRNA refers to a polyribonucleotide structure formed either by a single self-complementary RNA molecule or a polyribonucleotide structure formed by the expression of least two distinct RNA strands. The dsRNA molecule(s) employed in the methods and compositions mediate the decrease of expression of a target sequence, for example, by mediating RNA interference RNAi or gene silencing in a sequence-specific manner. The dsRNA is capable of decreasing or eliminating the level or expression of a target polynucleotide or the polypeptide, for example, SnRK1 and/or SnRK2.
[0252] The dsRNA can decrease or eliminate the expression level of the target sequence by influencing the level of the target RNA transcript, by influencing translation and thereby affecting the level of the encoded polypeptide, or by influencing expression at the pre-transcriptional level (i.e., via the modulation of chromatin structure, methylation pattern, etc., to alter gene expression). See, e.g., Verdel et al., (2004) Science 303:672-76; Pal-Bhadra et al., (2004) Science 303:669-72; All shire (2002) Science 297:1818-19; Volpe et al., (2002) Science 297:1833-37; Jenuwein (2002) Science 297:2215-18; and Hall et al., (2002) Science 297:2232-37. As used herein, the term dsRNA is meant to encompass other terms used to describe nucleic acid molecules that are capable of mediating RNA interference or gene silencing, including, e.g., short-interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), hairpin RNA, short hairpin RNA (shRNA), post-transcriptional gene silencing RNA (ptgsRNA), etc.
[0253] For dsRNA interference, a sense RNA molecule like that described above for cosuppression and an antisense RNA molecule that is fully or partially complementary to the sense RNA molecule are expressed in the same cell, resulting in inhibition of the expression of the corresponding endogenous messenger RNA.
[0254] Expression of the sense and antisense molecules may be accomplished by designing the expression cassette to comprise both a sense sequence and an antisense sequence. Alternatively, separate expression cassettes may be used for the sense and antisense sequences. Multiple plant lines transformed with the dsRNA interference expression cassette or expression cassettes are then screened to identify plant lines that show the desired degree of inhibition of polypeptide expression. Methods for using dsRNA interference to inhibit the expression of endogenous plant genes are described in Waterhouse et al., (1998) Proc. Natl. Acad. Sci. USA 95:13959-64, Liu et al., (2002) Plant Physiol. 129:1732-43 and WO 1999/49029, WO 1999/53050, WO 1999/61631 and WO 2000/49035, each of which is herein incorporated by reference.
D. Hairpin RNA Interference and Intron-Containing Hairpin RNA Interference
[0255] In some embodiments, decreasing the expression of the target gene (e.g., SnRK1 and/or SnRK2) is obtained by hairpin RNA (hpRNA) interference or intron-containing hairpin RNA (ihpRNA) interference. These methods are highly efficient at inhibiting the expression of endogenous genes. See, Waterhouse & Helliwell, (2003) Nat. Rev. Genet. 4:29-38, and the references cited therein.
[0256] For hpRNA interference, the expression cassette is designed to express an RNA molecule that hybridizes with itself to form a hairpin structure that comprises a single-stranded loop region and a base-paired stem. The base-paired stem region comprises a sense sequence corresponding to all or part of the endogenous messenger RNA encoding the gene whose expression is to be inhibited, and an antisense sequence that is fully or partially complementary to the sense sequence. Alternatively, the base-paired stem region may correspond to a portion of a promoter sequence controlling expression of the gene whose expression is to be inhibited. Thus, the base-paired stem region of the molecule generally determines the specificity of the RNA interference. hpRNA molecules are highly efficient at inhibiting the expression of endogenous genes and the RNA interference they induce is inherited by subsequent generations of plants. See, e.g., Chuang & Meyerowitz, (2000) Proc. Natl. Acad. Sci. USA 97:4985-90; Stoutjesdijk et al., (2002) Plant Physiol. 129:1723-31; and Waterhouse & Helliwell, (2003) Nat. Rev. Genet. 4:29-38. Methods for using hpRNA interference to inhibit or silence the expression of genes are described, e.g., in Chuang & Meyerowitz, (2000) Proc. Natl. Acad. Sci. USA 97:4985-90; Stoutjesdijk et al., (2002) Plant Physiol. 129:1723-31; Waterhouse &d Helliwell, (2003) Nat. Rev. Genet. 4:29-38; Pandolfini et al., BMC Biotechnology 3:7; and US Patent Application Publication No. 2003/0175965, each of which is herein incorporated by reference. A transient assay for the efficiency of hpRNA constructs to silence gene expression in vivo has been described by Panstruga et al., (2003) Mol. Biol. Rep. 30:135-40, herein incorporated by reference.
[0257] For ihpRNA, the interfering molecules have the same general structure as for hpRNA, but the RNA molecule additionally comprises an intron that is capable of being spliced in the cell in which the ihpRNA is expressed. The use of an intron minimizes the size of the loop in the hairpin RNA molecule following splicing, and this increases the efficiency of interference. See, e.g., Smith et al., (2000) Nature 407:319-20. In fact, Smith et al., show 100% suppression of endogenous gene expression using ihpRNA-mediated interference. Methods for using ihpRNA interference to inhibit the expression of endogenous plant genes are described, for example, in Smith et al., (2000) Nature 407:319-20; Wesley et al., (2001) Plant J. 27:581-90; Wang & Waterhouse, (2001) Curr. Opin. Plant Biol. 5:146-50; Waterhouse & Helliwell, (2003) Nat. Rev. Genet. 4:29-38; Helliwell & Waterhouse, (2003) Methods 30:289-95; and US Patent Application Publication No. 2003/0180945, each of which is herein incorporated by reference.
[0258] Any region of the target polynucleotide can be used to design the domain of the silencing element that shares sufficient sequence identity to allow expression of the hairpin transcript to decrease the level of the target polynucleotide. For instance, the domain can be designed to share sequence identity to the 5 untranslated region of the target polynucleotide(s), the 3 untranslated region of the target polynucleotide(s), exonic regions of the target polynucleotide(s), intronic regions of the target polynucleotide(s), and any combination thereof. In specific embodiments, a domain of the silencing element shares sufficient homology to at least about 15, 16, 17, 18, 19, 20, 22, 25 or 30 consecutive nucleotides from about nucleotides 1-50, 25-75, 75-125, 50-100, 125-175, 175-225, 100-150, 150-200, 200-250, 225-275, 275-325, 250-300, 325-375, 375-425, 300-350, 350-400, 425-475, 400-450, 475-525, 450-500, 525-575, 575-625, 550-600, 625-675, 675-725, 600-650, 625-675, 675-725, 650-700, 725-825, 825-875, 750-800, 875-925, 925-975, 850-900, 925-975, 975-1025, 950-1000, 1000-1050, 1025-1075, 1075-1125, 1050-1100, 1125-1175, 1100-1200, 1175-1225, 1225-1275, 1200-1300, 1325-1375, 1375-1425, 1300-1400, 1425-1475, 1475-1525, 1400-1500, 1525-1575, 1575-1625, 1625-1675, 1675-1725, 1725-1775, 1775-1825, 1825-1875, 1875-1925, 1925-1975, 1975-2025, 2025-2075, 2075-2125, 2125-2175, 2175-2225, 1500-1600, 1600-1700, 1700-1800, 1800-1900, 1900-2000 of the target sequence. In some instances, to optimize the siRNA sequences employed in the hairpin, the synthetic oligodeoxyribonucleotide/RNAse H method can be used to determine sites on the target mRNA that are in a conformation that is susceptible to RNA silencing. See, e.g., Vickers et al., (2003) J. Biol. Chem. 278:7108-18 and Yang et al., (2002) Proc. Natl. Acad. Sci. USA 99:9442-47, herein incorporated by reference. These studies indicate that there is a significant correlation between the RNase-H-sensitive sites and sites that promote efficient siRNA-directed mRNA degradation.
[0259] The expression cassette for hpRNA interference may also be designed such that the sense sequence and the antisense sequence do not correspond to an endogenous RNA. In this embodiment, the sense and antisense sequence flank a loop sequence that comprises a nucleotide sequence corresponding to all or part of the endogenous messenger RNA of the target gene. Thus, it is the loop region that determines the specificity of the RNA interference. See, e.g., WO 2002/00904; Mette et al., (2000) EMBO J 19:5194-201; Matzke et al., (2001) Curr. Opin. Genet. Devel. 11:221-27; Scheid et al., (2002) Proc. Natl. Acad. Sci. USA 99:13659-62; Aufsaftz et al., (2002) Proc. Natl. Acad. Sci. 99:16499-506; Sijen et al., Curr. Biol. (2001) 11:436-40, herein incorporated by reference.
[0260] In addition, transcriptional gene silencing (TGS) may be accomplished through use of a hairpin suppression element where the inverted repeat of the hairpin shares sequence identity with the promoter region of a target polynucleotide to be silenced. See, for example, Aufsatz et al., (2002) Proc. Natl. Acad. Sci. 99:16499-506 and Mette et al., (2000) EMBO J. 19:5194-201.
E. Amplicon Mediated Interference
[0261] Amplicon expression cassettes comprise a plant virus-derived sequence that contains all or part of the target gene but generally not all of the genes of the native virus. The viral sequences present in the transcription product of the expression cassette allow the transcription product to direct its own replication. The transcripts produced by the amplicon may be either sense or antisense relative to the target sequence (i.e., the messenger RNA for the polypeptide). Methods of using amplicons to inhibit the expression of endogenous plant genes are described, for example, in Angell and Baulcombe, (1997) EMBO J. 16:3675-3684; Angell and Baulcombe, (1999) Plant 20:357-362; and U.S. Pat. No. 6,646,805, each of which is herein incorporated by reference.
F. Ribozymes
[0262] In some embodiments, the polynucleotide expressed by the expression cassette is a catalytic RNA or has ribozyme activity specific for the messenger RNA of the polypeptide. Thus, the polynucleotide causes the degradation of the endogenous messenger RNA, resulting in decreased expression of the polypeptide. This method is described, e.g., in U.S. Pat. No. 4,987,071, herein incorporated by reference.
G. Small Interfering RNA or Micro RNA
[0263] In some embodiments of the disclosure, decreasing the expression of the target gene (e.g., SnRK1 and/or SnRK2) is obtained by RNA interference by expression of a gene encoding a micro RNA (miRNA) or short-interfering RNA (siRNA) (Meister & Tuschl (2004) Nature 431:343-49 and Bonetta et al., (2004) Nature Methods 1:79-86). miRNAs are regulatory agents consisting of about 22 ribonucleotides. miRNAs are highly efficient at inhibiting the expression of endogenous genes. See, e.g., Palatnik et al., (2003) Nature 425:257-63, herein incorporated by reference. The miRNA can be an artificial miRNA or amiRNA which comprises a miRNA sequence that is synthetically designed to silence a target sequence.
[0264] For miRNA interference, the expression cassette is designed to express an RNA molecule that is modeled on an endogenous miRNA gene. For example, the miRNA gene encodes an RNA that forms a hairpin structure containing a 22-nucleotide sequence that is complementary to another endogenous gene (target sequence). In some embodiments, the 22-nucleotide sequence is selected from a transcript sequence from the target gene (e.g., SnRK1 and/or SnRK2) and contains 22 nucleotides of the target gene in sense orientation and 21 nucleotides of a corresponding antisense sequence that is complementary to the sense sequence. In some embodiments, in addition to targeting the target gene directly, genes involved in recombination may also be targeted. Accordingly, in some embodiments, the 22-nucleotide sequence is selected from a transcript sequence from a gene involved in recombination and contains 22 nucleotides of the gene involved in recombination in sense orientation and 21 nucleotides of a corresponding antisense sequence that is complementary to the sense sequence. miRNA molecules are highly efficient at inhibiting the expression of endogenous genes, and the RNA interference they induce is inherited by subsequent generations of plants.
[0265] The heterologous polynucleotide being expressed need not form the dsRNA by itself, but can interact with other sequences in the plant cell to allow the formation of the dsRNA. For example, a chimeric polynucleotide that can selectively silence the target polynucleotide can be generated by expressing a chimeric construct comprising the target sequence for a miRNA or siRNA to a sequence corresponding to all or part of the gene or genes to be silenced. In this embodiment, the dsRNA is formed when the target for the miRNA or siRNA interacts with the miRNA present in the cell. The resulting dsRNA can then decrease the level of expression of the gene or genes to be silenced. See, for example, US Application Publication 2007-0130653, entitled Methods and Compositions for Gene Silencing, herein incorporated by reference. The construct can be designed to have a target for an endogenous miRNA or, alternatively, a target for a heterologous and/or synthetic miRNA can be employed in the construct. If a heterologous and/or synthetic miRNA is employed, it can be introduced into the cell on the same nucleotide construct as the chimeric polynucleotide or on a separate construct. As discussed elsewhere herein, any method can be used to introduce the construct comprising the heterologous miRNA.
[0266] While the various target sequences disclosed herein can be used to design any silencing element that encodes a miRNA; or active variants or fragments thereof.
H. Polypeptide-Based Inhibition of Gene Expression
[0267] In one embodiment, the polynucleotide encodes a zinc finger protein that binds to a gene encoding a polypeptide, resulting in decreased expression of the gene. In other embodiments, the zinc finger protein binds to a messenger RNA encoding a polypeptide and prevents its translation. Methods of selecting sites for targeting by zinc finger proteins have been described, for example, in U.S. Pat. No. 6,453,242, and methods for using zinc finger proteins to inhibit the expression of genes in plants are described, for example, in US Patent Application Publication No. 2003/0037355, each of which is herein incorporated by reference.
I. Polypeptide-Based Inhibition of Protein Activity
[0268] In some embodiments of the disclosure, the polynucleotide encodes an antibody that binds to at least one polypeptide and decreases the activity of the polypeptide. In another embodiment, the binding of the antibody results in increased turnover of the antibody complex by cellular quality control mechanisms. The expression of antibodies in plant cells and the inhibition of molecular pathways by expression and binding of antibodies to proteins in plant cells are well known in the art. See, for example, Conrad & Sonnewald, (2003) Nature Biotech. 21:35-36, incorporated herein by reference.
Expression Constructs
[0269] In some non-limiting implementations, the silencing element is operably linked to a cis-regulatory element active in germline cells, germline associated tissues, or both. In other non-limiting implementations, the silencing element is operably linked to a cis-regulatory element active in megaspore mother cells (megasporocytes), nucellar cells, or both.
[0270] Methods and compositions are provided to modify the level of expression or activity of a target gene (e.g., endogenous SnRK1 and/or SnRK2) polypeptide in the eukaryote (e.g., a plant cell), for example, in a female germline cell. In some embodiments, a plant cell is transformed with a DNA construct or expression cassette for expression of at least one silencing element. In specific embodiments, modulation of target gene expression level and/or activity of the target gene polypeptide promotes non-reduction, or non-reduction and non-recombination, during meiosis resulting in the production of non-reduced, or non-reduced and non-recombined, female gametes. Such methods and compositions can employ an expression construct comprising an element that when expressed decreases target gene polynucleotide and/or target gene polypeptide expression level or activity and is operably linked to a promoter functional in a plant cell. In certain embodiments, the promoter is a female sporogenesis-related promoter, in particular a promoter expressing in ovule primordia or ovule tissue, including but not limited to a target gene promoter.
[0271] The expression cassette can include 5 and 3 regulatory sequences operably linked to a polynucleotide of interest, e.g., a silencing element, or an active variant or fragment thereof Operably linked is intended to mean a functional linkage between two or more elements. For example, an operable linkage between a polynucleotide of interest and a regulatory sequence (i.e., a promoter) is a functional link that allows for expression of the polynucleotide of interest, for example, a silencing element. Operably linked elements may be contiguous or non-contiguous. When used to refer to the joining of two protein coding regions, by operably linked is intended that the coding regions are in the same reading frame. The cassette may additionally contain at least one additional gene to be cotransformed into the organism. Alternatively, the additional polynucleotides can be provided on multiple expression cassettes. Such an expression cassette is provided with a plurality of restriction sites and/or recombination sites for insertion of the element to be under the transcriptional regulation of the promoter. The expression cassette may additionally contain selectable marker genes.
[0272] In some embodiments, the expression cassette will include in the 5-3 direction of transcription an ovule-specific promoters, ovule-preferred promoters, female-gametophyte specific promoters, female-gametophyte preferred promoters, female-gamete-specific promoters, female-gamete-preferred promoters, a female sporogenesis-related promoter or an active variant or fragment thereof, a silencing element and a transcriptional and translational termination region (i.e., termination region) functional in the host cell (i.e., the plant). The regulatory regions and/or the silencing elements may be heterologous to the host cell, e.g. plant cell, or to each other.
[0273] As used herein, heterologous in reference to a sequence is a sequence that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by deliberate human intervention. For example, a promoter operably linked to a heterologous polynucleotide is from a species different from the species from which the polynucleotide was derived, or, if from the same/analogous species, one or both are substantially modified from their original form and/or genomic locus, or the promoter is not the native promoter for the operably linked polynucleotide. As used herein, a chimeric gene comprises a coding sequence operably linked to a transcription initiation region that is heterologous to the coding sequence. In an aspect, the promoter is a heterologous promoter.
[0274] The termination region may be native with the transcriptional initiation region, may be native with the operably linked silencing element or with the ovule tissue-preferred promoter sequences, may be native with the plant host, or may be derived from another source (i.e., foreign or heterologous) to the promoter, the silencing element, the plant host, or any combination thereof. Convenient termination regions are available from the Ti-plasmid of Agrobacterium tumefaciens, such as the octopine synthase and nopaline synthase gene termination regions. See also Guerineau et al., (1991) Mol. Gen. Genet. 262:141-44; Proudfoot, (1991) Cell 64:671-74; Sanfacon et al., (1991) Genes Dev. 5:141-49; Mogen et al., (1990) Plant Cell 2:1261-72; Munroe et al., (1990) Gene 91:151-58; Ballas et al., (1989) Nucleic Acids Res. 17:7891-903; and Joshi et al., (1987) Nucleic Acids Res. 15:9627-39.
[0275] Where appropriate, the polynucleotides may be optimized for increased expression in the transformed plant. That is, the polynucleotides can be synthesized using plant-preferred codons for improved expression. See, for example, Campbell & Gown, (1990) Plant Physiol. 92:1-11 for a discussion of host-preferred codon usage. Methods are available in the art for synthesizing plant-preferred genes. See, for example, U.S. Pat. Nos. 5,380,831 and 5,436,391, and Murray et al., (1989) Nucleic Acids Res. 17:477-98, herein incorporated by reference.
[0276] Additional sequence modifications are known to enhance gene expression in a cellular host. These include elimination of sequences encoding spurious polyadenylation signals, exon-intron splice site signals, transposon-like repeats and other such well-characterized sequences that may be deleterious to gene expression. The G-C content of the sequence may be adjusted to levels average for a given cellular host, as calculated by reference to known genes expressed in the host cell. When possible, the sequence is modified to avoid predicted hairpin secondary mRNA structures.
[0277] The constructs or expression cassettes may additionally contain 5 leader sequences. Such leader sequences can act to enhance translation. Translation leaders are known in the art and include: picornavirus leaders, for example, EMCV leader (Encephalomyocarditis Virus 5 noncoding region) (Elroy-Stein et al., (1989) Proc. Natl. Acad. Sci. USA 86:6126-30); potyvirus leaders, for example, TEV leader (Tobacco Etch Virus) (Gallie et al., (1995) Gene 165:233-38), MDMV leader (Maize Dwarf Mosaic Virus) (Johnson et al., (1986) Virology 154:9-20), and human immunoglobulin heavy-chain binding protein (BiP) (Macejak et al., (1991) Nature 353:90-94); untranslated leader from the coat protein mRNA of Alfalfa Mosaic Virus (AMV RNA 4) (Jobling et al., (1987) Nature 325:622-25); tobacco mosaic virus (TMV) leader (Gallie et al., (1989) in Molecular Biology of RNA, ed. Cech (Liss, N.Y.), pp. 237-56), and Maize Chlorotic Mottle Virus (MCMV) leader (Lommel et al., (1991) Virology 81:382-85). See also Della-Cioppa et al., (1987) Plant Physiol. 84:965-68. Other methods known to enhance translation can also be utilized, for example, introns, and the like.
[0278] In preparing the expression cassette, the various DNA fragments may be manipulated, so as to provide for the DNA sequences in the proper orientation and, as appropriate, in the proper reading frame. Toward this end, adapters or linkers may be employed to join the DNA fragments or other manipulations may be involved to provide for convenient restriction sites, removal of superfluous DNA, removal of restriction sites, or the like. For this purpose, in vitro mutagenesis, primer repair, restriction, annealing, substitutions, e.g., transitions and transversions, may be involved.
[0279] The expression cassette can also comprise a selectable marker gene for the selection of transformed cells. Selectable marker genes are utilized for the selection of transformed cells or tissues. Marker genes include genes encoding antibiotic resistance, such as those encoding neomycin phosphotransferase II (NEO) and hygromycin phosphotransferase (HPT), as well as genes conferring resistance to herbicidal compounds, such as glufosinate ammonium, bromoxynil, imidazolinones, and 2,4-di chlorophenoxyacetate (2,4-D). Additional selectable markers include phenotypic markers, such as 0-galactosidase and fluorescent proteins, for example green fluorescent protein (GFP) (Su et al., (2004) Biotechnol Bioeng 85:610-19 and Fetter et al., (2004) Plant Cell 16:215-28), cyan florescent protein (CYP) (Bolte et al., (2004) J. Cell Science 117:943-54 and Kato et al., (2002) Plant Physiol 129:913-42), yellow florescent protein (PhiYFP from Evrogen, see Bolte et al., (2004) J. Cell Science 117:943-54), and red fluorescent protein (DsRED, see Baird et al., (2000) Proc. Natl. Acad. Sci. USA. 97:11984-89). For additional selectable markers, see, generally, Yarranton, (1992) Curr. Opin. Biotech 3:506-11; Christopherson et al., (1992) Proc. Natl. Acad. Sci. USA 89:6314-18; Yao et al., (1992) Cell 71:63-72; Reznikoff, (1992) Mol. Microbiol. 6:2419-22; Barkley et al., (1980) in The Operon, pp. 177-220; Hu et al., (1987) Cell 48:555-66; Brown et al., (1987) Cell 49:603-612; Figge et al., (1988) Cell 52:713-22; Deuschle et al., (1989) Proc. Natl. Acad. Aci. USA 86:5400-04; Fuerst et al., (1989) Proc. Natl. Acad. Sci. USA 86:2549-53; Deuschle et al., (1990) Science 248:480-483; Gossen, (1993) Ph.D. Thesis, University of Heidelberg; Reines et al., (1993) Proc. Natl. Acad. Sci. USA 90:1917-21; Labow et al., (1990) Mol. Cell. Biol. 10:3343-56; Zambretti et al., (1992) Proc. Natl. Acad. Sci. USA 89:3952-56; Baim et al., (1991) Proc. Natl. Acad. Sci. USA 88:5072-76; Wyborski et al., (1991) Nucleic Acids Res. 19:4647-53; Hillenand-Wissman, (1989) Topics Mol. Struc. Biol. 10:143-62; Degenkolb et al., (1991) Antimicrob Agents Chemother 35:1591-95; Kleinschnidt et al., (1988) Biochemistry 27:1094-104; Bonin, (1993) Ph.D. Thesis, University of Heidelberg; Gossen et al., (1992) Proc. Natl. Acad. Sci. USA 89:5547-51; Oliva et al., (1992) Antimicrob Agents Chemother 36:913-19; Hlavka et al., (1985) Handbook of Experimental Pharmacology, Vol. 78 (Springer-Verlag, Berlin); Gill et al., (1988) Nature 334:721-24. Such disclosures are herein incorporated by reference. The above list of selectable marker genes is not meant to be limiting. Any selectable marker gene can be used.
[0280] It is further recognized that various expression constructs other than the target gene silencing expression construct are described herein. For example, expression constructs having silencing elements for genes involved in recombination and/or sequences encoding marker sequences are also described herein. One of skill will understand how to apply the language discussed above, to any expression construct.
[0281] SnRK1 or SnRK2 sequence can be derived from members of the SnRK family members known to date and their EMBL, PLRJ, or Genbank accession numbers. Non-limiting examples of SnRK family can be found (e.g., Halford & Hardie, Plant Mol. Biol. (37) 735-48 (1998)).
Apomixis to Meiosis and/or Parthenogenesis to Syngamy
[0282] In accordance with another of its embodiments, the invention involves treating the preapomeiotic germline and/or associated tissues of apomictic eukaryotes with chemicals that induce sexual reproduction and suppress apomictic reproduction. In accordance with this aspect of the invention, we show that compounds belonging to the class of compounds consisting of reactive oxygen species (ROS) when applied to female germline cells or germline-associated tissues of apomictic plants prior to when apomeiosis typically occurs prevent apomeiosis from occurring and instead induce the occurrence of sexual meiosis. This aspect of the invention accomplishes a metabolic shift from lower to higher oxidative stress or stress perception in germline cells or associated tissues, and it anticipates the use of other chemicals that might also accomplish the same shift, i.e., from lower to higher oxidative stress or stress perception. This invention also anticipates either exogenously applied chemicals or chemicals that are synthesized by the organism endogenously because of genetic transformation or other manmade genetic manipulation, either with or without an external induction signal. The invention therefore enables induction of sexual reproduction in apomictic eukaryotes thereby enabling improvement by conventional breeding.
[0283] In a non-limiting embodiment of the present invention, there is provided a method of inducing meiosis, syngamy, or both in an apomictic eukaryote, which method comprises decreasing glucose signaling, increasing osmotic stress, increasing oxidative stress, increasing perceived oxidative stress, or a combination thereof in a female germline cell and/or a female germline-associated tissue in the apomictic eukaryote.
[0284] In some implementations, the frequency or probability of switching from apomixis to meiosis, parthenogenesis to syngamy, or both is between 1% and 100%, or any percent range in between, e.g., 1-75%, 1-50%, 1-25%, 5-100%, 5-95%, 5-90%, 5-85%, 5-80%, 5-75%, 5-70%, 5-65%, 5-60%, 5-55%, 5-50%, 5-45%, 5-40%, 5-35%, 5-30%, 5-25%, 5-20%, 5-15%, 5-10%, 10-100%, 10-90%, 10-80%, 10-70%, 10-60%, 10-50%, 10-40%, 10-30%, 10-20%, 20-80%, 25-100%, 25-75%, 25-50%, 30-100%, 30-95%, 30-90%, 30-85%, 30-80%, 30-75%, 30-70%, 30-65%, 30-60%, 30-55%, 30-50%, 40-100%, 40-90%, 40-80%, 40-70%, 40-60%, 40-50%, 50-100%, 50-95%, 50-90%, 50-80%, 50-75%, 50-70%, or 75-100%, etc. in the sexual eukaryote. In other embodiments, the frequency or probability of switching from apomixis to meiosis, parthenogenesis to syngamy, or both is at least 10%, for example, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%, etc. in the apomictic eukaryote.
[0285] In some embodiments, the apomictic eukaryote is a plant induced to be apomictic. Non-limiting examples of such plants include grains (e.g., rice, wheat, durum wheat, maize (corn), Job's tears, barley, millet, sorghum, oat, rye, triticale, teff, fonio, wild rice, spelt, canary grass, quinoa, amaranth, buckwheat, kaniwa, pitseed goosefoot, etc.), cash crops (e.g., oilseeds such as sunflowers, rapeseed, cotton, peanuts, flax (linseed), castor beans, coffee, cacao, etc.), legumes (e.g., soybeans, cowpea, alfalfa, clover, peas, beans, chickpeas, lentils, lupin beans, mesquite, carob, peanuts, tamarind, etc.), vegetables (e.g., tuber-included tomatoes, cucurbits, squashes, melons, cucumbers, onions, chilis, peppers, lettuce, beets, potatoes, asparagus, carrots, turnips, etc.) In a non-limiting embodiment, the apomictic eukaryote is a Brassicaceae (e.g., Arabidopsis or Drummond's rockcress) or a legume (e.g., cowpea). Chemical treatments that induce sexual reproduction in apomictic plants could be used by plant breeders to introduce additional genetic variation into important apomictic forage and turf grasses including bahiagrass (Paspalum notatum), signalgrass (Brachiaria, the most widely used forage grass in Central and South America), weeping lovegrass (Eragrostis curvula), Kentucky bluegrass (Poa pratensis), buffalograss (Bouteloua dactyloides), and Bermuda grass (Cynodon dactylon). In some implementations, the apomictic eukaryote is selected from the group consisting of: apomictic forage grass and turf grass. In other implementations, the apomictic eukaryote is selected from the group consisting of: bahiagrass (Paspalum notatum), signalgrass (Brachiaria), weeping lovegrass (Eragrostis curvula), Kentucky bluegrass (Poa pratensis), buffalograss (Bouteloua dactyloides), Bermuda grass (Cynodon dactylon), and combinations thereof.
[0286] Chemical treatments for inducing sex in apomictic eukaryotes include reactive oxygen species such as hydrogen peroxide administered in an effective dose to derepress the epigenome and/or metabalome responsible for sex or repress the epigenome and/or metabalome responsible for apomixis.
[0287] In one implementation, decreasing glucose signaling, increasing osmotic stress, increasing oxidative stress, increasing perceived oxidative stress, or a combination thereof comprises decreasing sugar, increasing reactive oxygen species, increasing BR activity, inhibiting brassinosteroid biosynthesis, or a combination thereof.
[0288] In a non-limiting implementation, decreasing glucose signaling, increasing oxidative stress, increasing perceived oxidative stress, or a combination thereof comprises decreasing sugar level, decreasing fatty acid catabolism by beta-oxidation, decreasing brassinosteroid (BR) activity, increasing osmotic stress, decreasing antioxidant activity, increasing reactive oxygen species (ROS), increasing abscisic acid (ABA) activity, increasing sucrose non-fermenting 1 related kinase (SnRK) activity, decreasing target of rapamycin complex 1 (TORC1) activity, increasing meiosis-specific RNA directed DNA methylation (RdDM), or a combination thereof.
[0289] In another non-limiting implementation, the decrease in sugar level, the decrease in fatty acid catabolism by beta-oxidation, the decrease in BR activity, the increase in osmotic stress, the decrease in antioxidant activity, the decrease in TORC1 activity, the increase in ROS, the increase in ABA activity, the increase in SnRK activity, the increase in RdDM, or a combination thereof is in an amount and time sufficient to induce meiosis. In a further non-limiting implementation, the time sufficient to induce meiosis is between 0.05 and 72 hours.
[0290] In another embodiment, decreasing glucose signaling, increasing oxidative stress, increasing perceived oxidative stress, or a combination thereof comprises contracting the female germline cell and/or the female germline-associated tissue with at least one compound selected from the group consisting of: hydrogen peroxide, PEG 6,000, brassinazole, abscisic acid, and a combination thereof.
[0291] In one non-limiting implementation, decreasing sugar level comprises restricting a monosaccharide, a disaccharide, a short-chain polysaccharide, or a combination thereof; decreasing BR activity comprises applying brassinazole; increasing osmotic stress comprises applying PEG 6,000; increasing ROS comprises applying hydrogen peroxide; increasing ABA activity comprises applying ABA, decreasing the activity of CYP707A, protein phosphatase 2C (PP2C), or a combination thereof; increasing SnRK activity comprises increasing an activity of SnRK1, SnRK2, or both; increasing meiosis specific RdDM comprises increasing an activity of RING/FYVE/PHD zinc finger superfamily protein, SUVH1, MED17, HEAT INTOLERANT 4 (HIT4), HISTONE 1.2 (H1.2), ANTHESIS PROMOTING FACTOR 1 (APRF1), SUO, THO1, HISTONE H2A 11 (HTA11), or a combination thereof.
[0292] In one non-limiting implementation, decreasing glucose signaling comprises restricting glucose applied to the female germline cell and/or the female germline-associated tissue (e.g., a pistil). In a non-limiting implementation, glucose is applied in a restricted amount and time to induce meiosis, syngamy, or both in the apomictic eukaryote. In a non-limiting implementation, glucose is applied in an amount between 0 and 30 mmol/liter (mM), or any number range in between, e.g., 0-25 mM, 0-20 mM, 0-15 mM, 0-10 mM, 0-6 mM, 0-5 mM, 0-4 mM, 0-3 mM, 0-2 mM, 0-1 mM, 0-0.05 mM, etc. In another non-limiting implementation, the duration of glucose restriction is less than 60 minutes, e.g., less than 55 minutes, less than 50 minutes, less than 45 minutes, less than 40 minutes, less than 35 minutes, less than 30 minutes, less than 25 minutes, less than 20 minutes, less than 15 minutes, or about 10 minutes, etc. In yet another non-limiting implementation, the duration of glucose restriction is between 0.1 and 60 minutes, or any length of time in between, e.g., 0.1-50 minutes, 0.1-10 minutes, 2-50 minutes, 2-45 minutes, 3-45 minutes, 3-40 minutes, 4-40 minutes, 4-35 minutes, 5-35 minutes, 5-30 minutes, 6-30 minutes, 6-25 minutes, 7-25 minutes, 7-20 minutes, 7-13 minutes, 8-12 minutes, or 9-11 minutes, etc. In a further non-limiting implementation, to induce meiosis, the time to begin glucose restriction is between 0.2 and 72 hours before megasporogenesis onset, or any length of time in between, e.g. 0.2-60 hours, 0.2-48 hours, 0.2-36 hours, 0.2-24 hours, 0.2-12 hours, 12-68 hours, 13-68 hours, 13-64 hours, 14-64 hours, 14-60 hours, 15-60 hours, 15-56 hours, 16-56 hours, 16-52 hours, 17-52 hours, 17-48 hours, 18-48 hours, 21-48 hours, 21-46 hours, 24-46 hours, 24-44 hours, 27-44 hours, 27-42 hours, 30-42 hours, 30-40 hours, 33-40 hours, 33-38 hours, or 34-38 hours, etc.
[0293] In one non-limiting implementation, increasing oxidative stress comprises applying hydrogen peroxide to the female germline cell and/or the female germline-associated tissue (e.g., a pistil). In a non-limiting implementation, hydrogen peroxide is applied in an amount and time sufficient to induce meiosis, syngamy, or both in the apomictic eukaryote. In a non-limiting implementation, hydrogen peroxide is applied in an amount between 20 and 500 mmol/liter (mM), or any number range in between, e.g., 20-400 mM, 20-350 mM, 35-350 mM, 35-300 mM, 50-300 mM, 50-250 mM, 65-250 mM, 65-200 mM, 80-200 mM, 80-150 mM, 85-150 mM, 85-130 mM, 90-130 mM, 90-110 mM, or 95-105 mM, etc. In another non-limiting implementation, the duration of hydrogen peroxide application (e.g., pre-treatment emersion) is between 2 and 90 minutes, or any length of time in between, e.g., 2-75 minutes, 3-75 minutes, 3-50 minutes, 4-50 minutes, 4-25 minutes, 5-60 minutes, 5-25 minutes, 5-23 minutes, 7-23 minutes, 7-21 minutes, 9-21 minutes, 9-19 minutes, 11-19 minutes, 11-17 minutes, 13-17 minutes, or 14-16 minutes, etc. In a further non-limiting implementation, to induce meiosis, the time to begin hydrogen peroxide application is between 1 and 96 hours before megasporogenesis onset, or any length of time in between, e.g. 1-84 hours, 2-84 hours, 1-72 hours, 2-72 hours, 3-72 hours, 3-60 hours, 3-48 hours, 4-48 hours, 4-36 hours, 5-36 hours, 5-24 hours, 6-24 hours, 6-22 hours, 7-22 hours, 7-20 hours, 8-20 hours, 8-18 hours, 9-18 hours, 9-16 hours, 10-16 hours, 10-14 hours, 11-14 hours, or 11-13 hours, etc. before megasporogenesis onset.
[0294] In one non-limiting implementation, increasing osmotic stress comprises applying PEG 6,000 to the female germline cell and/or the female germline-associated tissue (e.g., a pistil). In a non-limiting implementation, PEG 6,000 is applied in an amount and time sufficient to induce meiosis, syngamy, or both in the apomictic eukaryote. In a non-limiting implementation, PEG 6,000 is applied in an amount between 10 and 60 g/liter, or any number range in between, 10-54 g/liter, 10-40 g/liter, 12-54 g/liter, 12-48 g/liter, 14-48 g/liter, 14-42 g/liter, 16-42 g/liter, 16-36 g/liter, 18-36 g/liter, 18-30 g/liter, 20-30 g/liter, 21-29 g/liter, 22-28 g/liter, 23-27 g/liter, or 24-26 g/liter, etc. In another non-limiting implementation, the duration of PEG 6,000 application (e.g., pre-treatment emersion) is between 0.05 and 480 minutes, or any length of time in between, e.g., 0.1-480 minutes, 0.1-450 minutes, 0.5-450 minutes, 0.5-400 minutes, 1-400 minutes, 1-350 minutes, 1-300 minutes, 2-300 minutes, 2-250 minutes, 2-90 minutes, 2-75 minutes, 2-50 minutes, 2-45 minutes, 3-250 minutes, 3-200 minutes, 3-75 minutes, 3-50 minutes, 3-45 minutes, 3-40 minutes, 4-200 minutes, 4-150 minutes, 4-50 minutes, 4-25 minutes, 5-480 minutes, 5-150 minutes, 5-100 minutes, 5-25 minutes, 5-23 minutes, 4-40 minutes, 4-35 minutes, 5-35 minutes, 5-30 minutes, 6-30 minutes, 6-25 minutes, 7-25 minutes, 7-23 minutes, 7-21 minutes, 7-20 minutes, 7-13 minutes, 8-12 minutes, 9-21 minutes, 9-19 minutes, 9-11 minutes, 11-19 minutes, 11-17 minutes, 13-17 minutes, or 14-16 minutes, etc. In a further non-limiting implementation, to induce meiosis, the time to begin PEG 6,000 application is between 1 and 96 hours before megasporogenesis onset, or any length of time in between, e.g. 1-84 hours, 1-72 hours, 2-84 hours, 2-72 hours, 3-72 hours, 3-60 hours, 3-48 hours, 4-48 hours, 4-36 hours, 5-36 hours, 5-24 hours, 6-72 hours, 6-24 hours, 6-22 hours, 7-22 hours, 7-20 hours, 8-20 hours, 8-18 hours, 9-18 hours, 9-16 hours, 10-16 hours, 10-14 hours, 11-14 hours, or 11-13 hours, etc. before megasporogenesis onset.
[0295] In one non-limiting implementation, decreasing BR activity comprises applying brassinazole to the female germline cell and/or the female germline-associated tissue (e.g., a pistil). In a non-limiting implementation, brassinazole is applied in an amount and time sufficient to induce meiosis, syngamy, or both in the apomictic eukaryote. In a non-limiting implementation, brassinazole is applied in an amount between 0.1 and 10 micromol/liter (M), or any number range in between, e.g., 0.2-10 M, 0.2-9 M, 0.3-9 M, 0.3-7 M, 0.4-7 M, 0.4-5 M, 0.5-5 M, 0.5-4 M, 0.6-4 M, 0.6-3 M, 0.7-3 M, 0.7-2 M, 0.7-1.3 M, 0.8-2 M, 0.8-1.2 M, or 0.9-1.1 M, etc. In another non-limiting implementation, the duration of brassinazole application (e.g., pre-treatment emersion) is between 0.05 and 480 minutes, or any length of time in between, e.g., 0.1-480 minutes, 0.1-450 minutes, 0.5-450 minutes, 0.5-400 minutes, 1-400 minutes, 1-350 minutes, 1-300 minutes, 1-60 minutes, 1-50 minutes, 2-300 minutes, 2-250 minutes, 2-90 minutes, 2-75 minutes, 2-50 minutes, 2-45 minutes, 3-250 minutes, 3-200 minutes, 3-75 minutes, 3-50 minutes, 3-45 minutes, 3-40 minutes, 4-200 minutes, 4-150 minutes, 4-50 minutes, 4-40 minutes, 4-35 minutes, 4-25 minutes, 5-480 minutes, 5-150 minutes, 5-100 minutes, 5-35 minutes, 5-30 minutes, 5-25 minutes, 5-23 minutes, 6-30 minutes, 6-25 minutes, 7-25 minutes, 7-23 minutes, 7-21 minutes, 7-20 minutes, 7-13 minutes, 8-12 minutes, 9-21 minutes, 9-19 minutes, 9-11 minutes, 11-19 minutes, 11-17 minutes, 13-17 minutes, or 14-16 minutes, less than 60 minutes, e.g., less than 55 minutes, less than 50 minutes, less than 45 minutes, less than 40 minutes, less than 35 minutes, less than 30 minutes, less than 25 minutes, less than 20 minutes, or less than 15 minutes, etc. In a further non-limiting implementation, to induce meiosis, the time to begin brassinazole application is between 1 and 96 hours before megasporogenesis onset, or any length of time in between, e.g. 1-84 hours, 1-72 hours, 2-84 hours, 2-72 hours, 3-72 hours, 3-60 hours, 3-48 hours, 4-48 hours, 4-36 hours, 5-36 hours, 5-24 hours, 6-72 hours, 6-24 hours, 6-22 hours, 7-22 hours, 7-20 hours, 8-20 hours, 8-18 hours, 9-18 hours, 9-16 hours, 10-16 hours, 10-14 hours, 11-14 hours, or 11-13 hours, etc. before megasporogenesis onset.
[0296] In one non-limiting implementation, increasing ABA activity comprises applying abscisic acid to the female germline cell and/or the female germline-associated tissue (e.g., a pistil). In a non-limiting implementation, abscisic acid is applied in an amount and time sufficient to induce meiosis, syngamy, or both in the apomictic eukaryote. In a non-limiting implementation, abscisic acid is applied in an amount between 0.1 and 10 micromol/liter (M), or any number range in between, e.g., 0.2-10 M, 0.2-9 M, 0.3-9 M, 0.3-7 M, 0.4-7 M, 0.4-5 M, 0.5-10 M, 0.5-5 M, 0.5-4 M, 0.6-4 M, 0.6-3 M, 0.7-3 M, 0.7-2 M, 0.7-1.3 M, 0.8-2 M, 0.8-1.2 M, or 0.9-1.1 M, etc. In another non-limiting implementation, the duration of abscisic acid application (e.g., pre-treatment emersion) is between 0.05 and 480 minutes, or any length of time in between, e.g., 0.1-480 minutes, 0.1-450 minutes, 0.5-450 minutes, 0.5-400 minutes, 1-400 minutes, 1-350 minutes, 1-300 minutes, 1-60 minutes, 1-50 minutes, 2-300 minutes, 2-250 minutes, 2-90 minutes, 2-75 minutes, 2-50 minutes, 2-45 minutes, 3-250 minutes, 3-200 minutes, 3-75 minutes, 3-50 minutes, 3-45 minutes, 3-40 minutes, 4-200 minutes, 4-150 minutes, 4-50 minutes, 4-40 minutes, 4-35 minutes, 4-25 minutes, 5-480 minutes, 5-150 minutes, 5-100 minutes, 5-35 minutes, 5-30 minutes, 5-25 minutes, 5-23 minutes, 6-30 minutes, 6-25 minutes, 7-25 minutes, 7-23 minutes, 7-21 minutes, 7-20 minutes, 7-13 minutes, 8-12 minutes, 9-21 minutes, 9-19 minutes, 9-11 minutes, 11-19 minutes, 11-17 minutes, 13-17 minutes, or 14-16 minutes, less than 60 minutes, e.g., less than 55 minutes, less than 50 minutes, less than 45 minutes, less than 40 minutes, less than 35 minutes, less than 30 minutes, less than 25 minutes, less than 20 minutes, or less than 15 minutes, etc. In a further non-limiting implementation, to induce meiosis, the time to begin abscisic acid application is between 1 and 96 hours before megasporogenesis onset, or any length of time in between, e.g. 1-84 hours, 1-72 hours, 2-84 hours, 2-72 hours, 3-72 hours, 3-60 hours, 3-48 hours, 4-48 hours, 4-36 hours, 5-36 hours, 5-24 hours, 6-72 hours, 6-24 hours, 6-22 hours, 7-22 hours, 7-20 hours, 8-20 hours, 8-18 hours, 9-18 hours, 9-16 hours, 10-16 hours, 10-14 hours, 11-14 hours, or 11-13 hours, etc. before megasporogenesis onset.
[0297] In a further aspect of the invention, there is provided sexual eukaryotes that reproduce apomictically, an apomictic eukaryote produced from a sexual eukaryote, an apomictic eukaryote that reproduces sexually according to the methods of the invention.
[0298] The following examples are illustrative only and are not intended to limit the disclosure in any way.
EXAMPLES
[0299] The following non-limiting examples illustrate further aspects of the invention.
Example 1. Genes Associated with Aposporous Embryo Sac Formation in Sorghum as Identified by Expression Profiling
[0300] Background.
[0301] In sorghum, complete apomixis has not been observed, but aposporous embryo sacs occasionally form in some genotypes (50). The studies in sorghum described here involved expression profiling to identify genes associated with apospory.
[0302] Materials and Methods.
[0303] These methods are sufficiently detailed to provide one skilled in the art with information needed to repeat the experiments.
[0304] We used an F.sub.2 sorghum mapping population as previously described (50). For expression profiling, we used two sibs from the F.sub.2 population, plant 151, with 14% aposporous embryo sac (ES) formation, and plant 264, with no aposporous ES formation (50). These were cloned by excising and growing tillers. For expression profiling, ovules were excised in nuclease free water, measured, and retained if their length matched a designated length corresponding to the MMC, meiocyte or ES stages (50). Excised ovules were placed in RNAlater (Ambion), and five samples were collected for each of the six sib/stage combinations for a total of 601, 699 and 499 ovules for the MMC, meiocyte and ES stages of the non-AES forming sib, respectively and 508, 604 and 499 for the AES-forming sib, respectively. RNA was extracted, quality checked, amplified and labeled with Cy3 or Cy5. Quality of antisense RNA (aRNA) was checked, and 10 g from each sample was labeled and purified on the day of microarray hybridization. Labeled aRNA (3 g) was fragmented, and final aRNA concentrations and labeling efficiencies were measured. A saturated loop microarray design was used, which compared all two-way transcriptome comparisons among the six sib/stage combinations (15 microarrays total). Microarray probe sequences were designed and synthesized by CombiMatrix, Inc., on their CustomArray 12K format (Mukilteo, Wash.). Twelve thousand unique 35 nt sequences were designed from the sorghum Unigene EST database. Most ESTs represented on the microarray originated from reproductive tissues (ovules, embryos, panicles, pollen). Between 25-32% of sorghum open reading frames were represented (61). Microarray hybridizations were scanned, and all images were saved. Image analysis and data extraction were completed using Imogene (Biodiscovery, Inc., El Segundo, Calif.) microarray analysis software. Median pixel intensity values for each probe were used for data input. Data normalization and statistical analysis were performed using R/maanova and the Java interface J/maanova (62, 63). p values were false discovery rate (FDR) corrected, and significance was set at p=0.05.
[0305] Several genes identified as differentially expressed (DE) in this study were selected for quantitative RT-PCR (qPCR) validation. Primers were designed, checked for secondary structures, and subjected to BLAST searches to identify short, nearly exact sequences (word size, 7; expect value, 1000). Only sequences unique to sorghum were retained. Primer pairs, designed from S. bicolor sequence data, were tested for amplification of the expected cDNA region. Total RNA was isolated, digested, and cDNA synthesis was carried out. qPCR reactions were carried out using the following reaction conditions: 50 C., 2 min, 95 C., 10 min, 40 cycles of 95 C. for 30 sec, 54 C. for 30 sec and 72 C. for 30 sec. All reactions were set up in triplicate. Melting curves were used to determine specificity, and relative quantification values and standard deviations were calculated using the comparative CT method. Values were normalized to the expression of the reference. Differences in expression were identified using the Student's t-test.
[0306] For each gene found to be significantly up or down-regulated, the set of homologous EST sequences in the UniGene set was downloaded and aligned into a single consensus sequence. Each consensus sequence was BLASTx searched to determine its amino acid sequence homology to other plant sequences in the NCBI database. Where possible, putative gene names were assigned based on homologies to other annotated sequences. The significant genes were then located on the ten chromosomes of Sorghum bicolor by BLAST (64) searching the probe sequences against the genome assembly available through Phytozome.
[0307] Using TAIR accession identifiers, sorghum DE genes statistically up-regulated in experimental comparisons (up regulated in the treatments used as numerators in the gene expression ratios) were used to identify gene ontology (GO) categories (biological process, molecular function, cellular component) that were overrepresented by the respective up regulated genes. Panther Overrepresentation Tests (Apr. 13, 2017 release, Nov. 27, 2017 GO Ontology database release, Panther Classification System(65), Ver. 13.0) were used for these analyses. DE genes down regulated in the respective experimental comparisons (up regulated in the treatments used as denominators in the gene expression ratios) were likewise analyzed. Bonferroni corrections are conservative in overrepresentation and enrichment analyses. In this respect, our overrepresentation and enrichment objectives did not include identifying GO categories with extremely high levels of confidence. Instead, we i) identify molecular pathways that putatively cause sex apomixis switching (based on less conservative GO analyses), and ii) conducted thereafter specific experiments (Section III and Examples) to test the postulated pathways. While GO analyses were conducted at the P<0.05 level of confidence, Bonferroni corrections were not performed.
[0308] Results and Discussion.
[0309] For DE gene detection, samples of stage 1 and 2 ovules from the sexual line were combined and compared to samples of stage 1 and 2 from the weakly aposporous line. This analysis identified 96 genes and 20 genes that were upregulated in the sexual and weakly aposporous samples, respectively. When stage 3 samples were compared, only two genes were upregulated in the sexual line, but 229 genes were upregulated in the weakly aposporous line. When Panther GO analyses were conducted, genes upregulated in stage 1 and 2 ovules from the sexual line identified 405 overrepresented GO categories. Genes upregulated in stage 1 and 2 ovules from the weakly aposporous line identified 258 overrepresented GO categories. The two genes upregulated in stage 3 ovules from the sexual line did not produce overrepresented GO categories. The 229 genes upregulated in stage 3 ovules from the weakly aposporous line identified 486 overrepresented GO categories.
[0310] Of all overrepresented GO categories identified, several loosely associated groups of categories are intriguing in terms of their possible involvement in shifting reproduction between apomixis and sex. In the stage 1 and 2 analyses (
Example 2. Gene Expression Profiles Associated with Sexual Reproduction and Aposporous and Diplosporous Reproduction in Boechera
[0311] Background Boechera A. Love & D. Love (Brassicaceae), a close relative of Arabidopsis (66), evolved ca. 2.5 myr ago (67) and contains ca. 83 inbreeding sexual species, many of which are localized endemics with restricted geographic ranges. It also contains many thousands of diploid to tetraploid interspecific hybrids, which sexually are semisterile. While producing some seeds sexually, in general the majority of these hybrids produce their seeds apomictically. This dual capability of producing seeds sexually or apomictically (facultative apomixis) is characteristic of most if not all angiospermous apomicts (1). Additionally, most angiospermous apomicts also exhibit geographic parthenogenesis, meaning their niche preferences extend from in to well beyond the habitats of their sexual relatives (8). In these respects, Boechera is no exception (68-74). Among the many thousands of naturally occurring apomictic hybrids of Boechera, 40 are recognized as having obtained broad distributions and being taxonomically distinct, and these have been elevated to species status (69-71, 75).
[0312] Apomixis in Boechera is gametophytic, i.e., ovules produce genetically unreduced embryo sacs (gametophytes), and the unreduced eggs in the embryo sacs develop into embryos parthenogenetically. Taraxacum-type diplospory (1st division restitution,
[0313] Materials and Methods.
[0314] These methods provide one skilled in the art with sufficient information to repeat the experiments.
[0315] Cytological analyses of reproductive mode were performed using fixed floral buds of plants growing in native habitats, plants transplanted from native habitats to greenhouses or growth chambers, or plants grown from seeds (
[0316] Clusters of floral buds at the pre-anthesis stage were fixed in formalin acetic acid alcohol (FAA) for 48 h. The buds were then cleared in 2:1 benzyl benzoate to dibutyl phthalate (BBDP) (80) as follows: 70% EtOH, 30 min; 95% EtOH, 4 h (2); 2:1 95% EtOH to BBDP, 2 h; 1:2 95% EtOH to BBDP, 4 h; 100% BBDP, 4 h; and 100% BBDP overnight. Pistils were then dissected from the floral buds. Pistil lengths, measured from the base of the pedicel to the top of the stigma (0.05 mm), were then obtained using a dissection microscope, and the pistils were mounted on slides with a minimal amount of 2:1 BBDP clearing solution. The developmental stages of each ovule in each pistil were studied using a BX53 microscope (Olympus, Center Valley, Pa., USA) equipped with differential interference contrast (DIC) optics. Photographs of ovule development were taken using a MicroFire 599809 camera (Olympus).
[0317] Ovules were scored based on germline development. The following conditions were quantified: i) pre-meiotic megaspore mother cell (MMC), ii) meiotic or diplosporous dyad, iii) sexual tetrad of megaspores, iv) enlarged functional megaspore (FM) with three degenerating megaspores (sexually derived), v) early-stage 1 or 2-nucleate embryo sac with three degenerating megaspore remnants visible, vi) enlarged functional megaspore (FM) with only one degenerating megaspore (derived by Taraxacum-type diplospory), vii) early-stage 1 or 2-nucleate embryo sac with only one degenerating megaspore remnant (derived by Taraxacum-type diplospory), viii) early-stage 1 or 2-nucleate embryo sac with no degenerating megaspores present (derived by Antennaria-type diplospory), ix) presence of one or more enlarged non-vacuolate nucellar cells (aposporous initial, AI) that equal or surpass the size of the meiocyte (meiotically active MMC, dyad or early-stage tetrad), x) enlarged nucellar cell with one or more distinct vacuoles and 1-2 nuclei (early-stage aposporous embryo sac, AES). Because of increased uncertainties, the origins of embryo sacs (sexual, diplosporous or aposporous) were not reported beyond the 2-nucleate stage. Pistil length and the developmental stage of the majority of scorable ovules in the pistil were recorded for each pistil.
[0318] Relative levels of nuclear DNA in embryo and endosperm cells of single seeds and small groups of seeds were determined. Nuclei of mature seeds were isolated using a mortar, pestle and a few drops of DAPI (4,6-diamidino-2-phenylindole) containing Partec (Partec North America, Inc., Swedesboro, N.J., USA) buffer. Pestles were used to crack the seeds, and seed fragments were lightly crushed. Fragments were exposed to buffer for several minutes, and the nuclei-containing solutions were then filtered through 30 m nylon filters into 1.2 mL tubes. Nuclear fluorescence was determined using a Partec I flow cytometer according to the manufacturer's instructions. Seeds with a 2:3 C embryo to endosperm ratio were considered to have formed sexually, while seeds with 2:5, 2:6, 2:7 or 3:9 C ratios were considered to have formed apomictically (2).
[0319] For expression profiling of sexual B. stricta, diplosporously apomictic B. lignifera and aposporously apomictic B. microphylla, average pistil lengths (n=20) for two embryological stages of ovule development were obtained: i) premeiotic megaspore mother cell (MMC) stage to the meiotic tetrad stage, and ii) early embryo sac stage to the pre-fertilized mature embryo sac (MES) stage. These averages were used to select pistils for expression profiling. Pistils from each species were excised in nuclease-Free water. Total RNA was extracted from pistils (100 per replication), excised ovules (1500 per replication), or excised anthers (80 per replication) as above and purified. mRNA samples from four stages (two replications per stage) were prepared for B. lignifera and B. microphylla ovules: pre-MMC, active meiocyte, early embryo sac, and late embryo sac to early embryony. mRNA samples from two stages (two replications per stage) were prepared for B. stricta and B. lignifera pistils: pre-MMC to active meiocyte and early to late embryo sac formation. Affymetrix (Santa Clara, Calif.) two-cycle cDNA synthesis kits were used for cDNA synthesis and RNA amplification. cRNA were fragmented and loaded on Affymetrix A. thaliana GeneChip microarrays (ATH1), one ATH1 microarray per biological replicate. Raw CEL files were assessed for quality using RMAExpress (chips with RLE-NUSE T2 values above the cautionary line were excluded from analyses), and lists of expressed genes were generated in BRB-ArrayTools, Version 4.6 using RMA normalization of only those CEL files involved in each differential expression test.
[0320] For downstream analyses, genes were excluded when <20% of their expression data (spots on arrays) had a 1.2 fold change in either direction from the gene's median (invariant or non-expressed genes) or when percent missing values exceeded 50%. After removal of the excluded genes, the BRB Class Comparison program was used to identify DE genes as determined by the significance threshold of univariate tests (P<0.001). Using TAIR accession identifiers, DE genes statistically up-regulated in experimental comparisons (up regulated in the treatments used as numerators in the gene expression ratios) were used to identify gene ontology (GO) categories (biological process, molecular function, cellular component) that were overrepresented by the respective up regulated genes. Panther Overrepresentation Tests (Apr. 13, 2017 release, 10/23/2017 GO Ontology database release, Panther Classification System (65), Ver. 13.0) were used for these analyses. DE genes down regulated in the respective experimental comparisons (up regulated in the treatments used as denominators in the gene expression ratios) were likewise analyzed. Log base 2 values of expression ratios of genes that passed the BRB filter (significant or not) for each comparison were used to identify significantly enriched GO categories using Panther Enrichment Tests. EntrezID numbers were used for these enrichment analyses. When EntrezID numbers were represented by multiple A. thaliana Affymetrix probe set IDs, fold change values across the probe set IDs were averaged. Bonferroni corrections are conservative in overrepresentation and enrichment analyses. In this respect, our overrepresentation and enrichment objectives did not include identifying GO categories with extremely high levels of confidence. Instead, we i) identify molecular pathways that putatively cause sex apomixis switching (based on less conservative GO analyses), and ii) conducted thereafter specific experiments (Section III and Examples) to test the postulated pathways. While GO analyses were conducted at the P<0.05 level of confidence, Bonferroni corrections were not performed.
[0321] qPCR verification for ZCW32 (At1g59640), MYC2 (At1g32640), PI (At5g20240), AP1 (AT1G69120), AGP22 (At5g53250), SHP1 (At3g58780), AGL6 (At2g45650), SEP3 (At1g24260), STK (At4g09960) and CDKB2 (At1g20930) were performed as above except that primers were designed from A. thaliana cDNA sequence data so as to amplify 150-250 bp from each Boechera gene and an 18S rRNA control gene (
[0322] Results and Discussion.
[0323] We cytoembryologically analyzed 67 Boechera taxa (species and species hybrids,
[0324] Some accessions of B. microphylla were more strongly aposporous than others (
[0325] From our cytological analyses of Boechera (
[0326] In the following list of comparisons, numbers of DE genes identified per comparison are shown in parentheses:
[0327] 1. ovules, diplosporous B. lignifera, MMC to 4-nucleate vs. 4-nucleate to mature embryo sac stages (0),
[0328] 2. ovules, aposporous B. microphylla, MMC to 4-nucleate vs. 4-nucleate to mature embryo sac stages (14),
[0329] 3. ovules, B. lignifera vs. B. microphylla, MMC to 4-nucleate embryo sac stages (211),
[0330] 4. ovules, B. lignifera vs. B. microphylla, 4-nucleate to mature embryo sac stages (64),
[0331] 5. ovules, B. lignifera vs. B. microphylla, MMC to mature embryo sac stages (359),
[0332] 6. anthers vs. ovules, B. microphylla, sporocyte to early gametophyte development (1345),
[0333] 7. anthers vs. ovules, B. lignifera, sporocyte to early gametophyte development (802),
[0334] 8. anthers, B. lignifera vs. B. microphylla, sporocyte to early gametophyte development (1378).
[0335] Comparisons 1-5 involved gene expression in ovules of diplosporous B. lignifera (1.sup.st division restitution) and/or ovules of aposporous B. microphylla (normal meiosis, surviving megaspore abortion, aposporous embryo sac formation). No DE genes were identified when early vs. late staged B. lignifera ovules were compared, and only 14 DE genes were identified between these stages for B. microphylla. Hence, stages within species were combined, and overrepresentation and enrichment GO analyses were conducted only for Comparison 5. This analysis identified more DE genes than Comparisons 3 and 4 (early vs. early and late vs. late).
[0336] Overrepresented and enriched GO categories in B. microphylla ovules (meiotically successful but sexually aborted and aposporous) compared to B. lignifera ovules (diplosporous) included those suggestive of energy deficient conditions, e.g., cellular stresses, meiosis and autophagy, as well as opposite categories suggestive of energy rich conditions, e.g., ribosome biosynthesis, gene expression and embryo sac formation. Those suggestive of energy deprived conditions and meiosis included:
[0337] hypoxia
[0338] alternative respiration
[0339] glycolysis
[0340] ROS
[0341] superoxide
[0342] senescence
[0343] programmed cell death
[0344] catabolism
[0345] other stresses
[0346] meiosis.
[0347] Those suggestive of energy rich conditions and the onset of aposporous embryo sac formation include:
[0348] antioxidant activity
[0349] histone methylation
[0350] ribosome biosynthesis and function, a strong indicator of active TOR (17)
[0351] transcription factor activity
[0352] cell signaling
[0353] embryo sac formation.
[0354] Hypoxia, as observe in B. microphylla ovules, can suppress ROS detoxification processes and increase ROS and superoxide levels, alternative respiration, catabolism and glycolysis (81-83). These data suggest that severe hypoxia and related stresses may have not only induced meiosis but also functional megaspore abortion. This stress may have also caused nucellar cells to abort their normal route of programmed cell death and to instead undergo apospory. Alternatively, apospory might have been induced by a temporally delayed expression of the apomixis phenism, which would have then silenced sex post-meiotically, at the functional megaspore stage (causing all megaspores to abort), and induced aposporous embryo sac formation. Interestingly, the up-regulated genes associated with ribosome synthesis and transcription factor activity suggest an energy rich environment, which contrasts sharply with the observed stress associated GO categories. Cells undergoing stress-induced autophagy may have supplied aposporous nucellar cells with sufficient nutrients to support embryo sac development.
[0355] Ovules with their nucellar cells are evolutionary innovations of sporangia (84), which in lower plants, e.g., ferns, contain multiple spore mother cells (evolutionary progenitors of nucellar cells) that in many species are meiosis, apomeiosis and apogamy competent (adventitious embryo formation from gametophytes) (38). Hence, from an evolutionary perspective, nucellar cells could reasonably possess latent capacities to form meiotic or apomeiotic mother cells, sexual or asexual spores, sexual or asexual gametophytes, or complete embryos adventitiously.
[0356] Evidence that post-meiotic abortion and autophagy coupled with apospory in B. microphylla was caused by either oxidative stress or a delayed onset of apomixis was also obtained from comparisons of B. microphylla ovules vs. B. microphylla anthers. In ovules, sex advanced through meiosis and then aborted, but in anthers sex continued through to functional pollen formation. The following GO categories were associated with meiosis followed by sexual failure and apospory in B. microphylla ovules (compared to anthers). Those putatively associated with inducing meiosis and causing its collapse include:
[0357] low energy levels
[0358] ROS and superoxide formation
[0359] unfolded protein response
[0360] meiosis.
[0361] Those putatively associated with late onset of the apomixis (apospory) program: steroid production; epigenetic silencing; ribosome biogenesis, transcription and translation.
[0362] It remained unclear from these data as to what induced the apomixis phenism in B. microphylla ovules, the tissues of which experienced high levels of oxidative stress. However, when apomixis was induced, genes required to complete the sex phenism were apparently silenced (
[0363] Silenced genes in apomictic ovules of B. lignifera and B. microphylla included those that would have encoded (had they not been silenced) the progression of the sexual phenism, i.e., meiosis, reduced embryo sac formation, parthenogenesis suppression, and establishment of a requirement that syngamy precede embryony (fertilization requirement or dependence). Notable among the upregulated epigenetic silencing machinery in apomictic ovules were:
[0364] heterochromatin maintenance genes
[0365] RNA polymerase IV genes, which produce siRNAs that silence genes by RNA directed DNA methylation
[0366] histone H3-K9 genes that silence genes by methylation
[0367] deacetylation genes
[0368] chromatin silencing genes in general
[0369] genes responsible for negative epigenetic regulation of gene expression.
[0370] That gene silencing coincided temporally with the cytologically detectable silencing of sex is evidence that gene silencing machinery, putatively part of the apomixis phenism machinery, was responsible for silencing sex.
[0371] From an evolutionary perspective, it seems reasonable that apomixis would keep sex silenced during favorable growth conditions (maintain a heterochromatic state upon genes required for sex). Apomixis in the life cycles of many protists and extant cyclical animal apomicts, e.g., many species of water fleas, aphids and other insects (9), is responsible for rapid population expansion in favorable environments. In contrast, stress suppresses apomixis and induces sex in many organisms, which thereafter produce dormant spores or overwintering eggs. Our profiling results are consistent with these life cycle observations. For example, GO categories associated with epigenetic silencing were overrepresented and enriched to a greater extent in diplosporously apomictic B. lignifera ovules compared to aposporously apomictic B. microphylla ovules. The latter suppress sex much later in ovule development, i.e., after meiosis. This suggests that the difference between diplospory and apospory is one of timing, i.e., the timing in which the apomixis phenism is expressed, early for diplospory and later (after meiosis) for apospory.
[0372] Cells and tissues of diplosporous B. lignifera ovules were experiencing favorable metabolic conditions as evidenced by the following overrepresented and enriched categories (compared to ovules of aposporous B. microphylla):
[0373] oxygen and energy production by photosynthesis
[0374] ATP production by mitochondrial respiration
[0375] ROS production (byproduct of active photosynthesis and respiration) but with mechanisms that effectively detoxify it
[0376] gene silencing, i.e., production of epigenetic regulation enzymes, which regulate the expression and silencing of genes, presumably silencing genes required for the expression of the sexual phenism
[0377] production of enzymes that produce and regulate hormones, which in turn regulate the active growth and development processes expected if apomixis is induced by favorable metabolic and growth and development conditions.
[0378] While ovules of diplosporous B. lignifera were experiencing favorable conditions, they were also epigenetically silencing genes that in B. microphylla ovules were encoding meiosis, i.e., genes that were upregulated in B. microphylla ovules (presumably because of stress) compared to B. lignifera ovules. These observations are consistent with our teachings and methods that i) favorable metabolic conditions induce the apomixis phenism, which includes epigenetic silencing of meiosis (sex), and ii) stressful conditions induce the sexual phenism, which includes the silencing of the apomixis phenism possibly through H3-K9 methylation.
[0379] Ovules and anthers differ morphologically. During development individual ovules produce and nourish a single gametophyte. In contrast, a single anther produces and nourishes thousands of gametophytes. The latter is accomplished by episodes of programmed cell death (autophagy) where dying anther cells relinquish nutrients that are absorbed by developing gametophytes(85). The following overrepresented GO categories in B. microphylla anthers (compared to B. microphylla ovules) may be indicative of these autophagic episodes:
[0380] ROS stress nitric oxide stress and programmed cell death
[0381] antioxidant production and function.
[0382] As noted above, apomeiotic B. lignifera and meiotic B. microphylla ovules developed in metabolically stable and unstable conditions, respectively. Boechera lignifera anthers, which produce unreduced pollen, also developed in metabolically stable conditions. Cellular energy resources between apomeiotic B. lignifera ovules and anthers differed. In ovules, photosynthesis appeared to provide glucose for respiration, while in anthers sugars were imported. Levels of oxidative stress did not differ between ovules and anthers of B. lignifera, but were, as noted above, lower compared to those in B. microphylla ovules. GO categories associated with antioxidants were overrepresented in anthers, which might reflect the ROS induced programmed cell death experienced by autophagic anther tissues during pollen development.
[0383] Gene silencing as observed in apomeiotic B. lignifera ovules vs. meiotic B. microphylla ovules was also seen in apomeiotic B. lignifera anthers compared to meiotic B. microphylla anthers (Comparison 8). GO categories that were overrepresented or enriched in B. lignifera anthers and relevant to energy production and use, ROS detoxification, and gene silencing included:
[0384] active mitochondrial respiration
[0385] ribosome biogenesis and function (indicative of a high energy status)
[0386] brassinosteroid (BR) biosynthesis and function
[0387] ROS detoxification
[0388] gene silencing and heterochromatin maintenance.
[0389] GO categories overrepresented or enriched in B. microphylla anthers and relevant to metabolic stress and photosynthesis included:
[0390] hypoxia
[0391] alternative respiration
[0392] endoplasmic reticulum stress, including responses to unfolded proteins
[0393] other stresses
[0394] photosynthesis and glucose transport.
[0395] Apparently, the observed photosynthesis in B. microphylla anthers was not producing sufficient oxygen and energy to avoid the observed stresses. As discussed below, photosynthesis, autophagy, and the tricarboxylic acid cycle can be activated by stress (13, 17).
[0396] Cellular stress and photosynthesis, as observed in meiotic B. microphylla ovules and anthers, is consistent with energy reserves being regulated by stress-activated SNF1-Related Kinase 1 (SnRK1). During stress, this enzyme regulates energy production and use by i) activating photosynthesis enzymes and other enzymes by phosphorylation, ii) inducing transcription of autophagy enzymes, and iii) suppressing growth and development by silencing TARGET OF RAPAMYCIN (TOR) (13, 16, 17). Compared with stressed and meiotically active ovules and anthers of B. microphylla, ovules and anthers of apomeiotic B. lignifera were developing in high-energy environments where they actively respired, detoxified ROS, silenced genes and regulated energy and growth (
[0397] Putative components of a stress-regulated apomixis-sex switch are presented in
[0398] In responding to metabolically favorable or stressful cellular conditions, the antagonistic interactions between SnRK1 (or its orthologs in other Kingdoms) and TOR constitute the central molecular switch system that pits energy use or conservation against growth and development in diverse cells and tissues across all eukaryotes. Based on our gene expression results, we discovered that i) rather massive changes in gene expression occur in germline cells when active forms of SNF, AMPK and SnRK1 are present, and ii) these gene expression changes, when they occur in epigenetically determined germline cells, will induce meiosis. We also discovered that gene expression changes induced by TOR activation in germline cells will silence meiosis and induce apomeiosis (
[0399] Our teachings, as represented in
[0400] 1. diplosporous B. lignifera pistils vs. sexual B. stricta pistils, MMC to 4-nucleate embryo sac stages (836)
[0401] 2. diplosporous B. lignifera ovules vs. diplosporous B. lignifera pistils, MMC to 4-nucleate embryo sac stages (159)
[0402] 3. diplosporous B. lignifera ovules vs. sexual B. stricta pistils, MMC to 4-nucleate embryo sac stages (309)
[0403] 4. aposporous B. microphylla ovules vs. sexual B. stricta pistils, MMC to 4-nucleate embryo sac stages (1006)
[0404] Using pistils for gene analyses, not ovules, introduced to our analyses additional tissue types, e.g., immature ovary walls, styles, stigmas, and additional vascular tissues. Such tissues were avoided when microexcised ovules were analyzed. Also, different Boechera species contain different numbers of ovules per pistil. Sexual B. stricta pistils contain 110-216 ovules, while B. lignifera pistils contain 48-74 (75). However, silique lengths at maturity differ, which compensates for differences in ovule numbers per pistil such that ovule to ovary tissue ratios are likely similar across species. In an attempt to parse confounding influences of pistil tissues from ovule tissues, we made pistil vs. pistil and ovule vs. pistil comparisons within and across species.
[0405] Consistent with meiotic ovules (and anthers) of B. microphylla, gene expression in pistil tissues of meiotic B. stricta (compared to diplosporous B. lignifera, analysis 9) was characterized during megasporogenesis by overrepresented or enriched GO categories related to ROS and ER stress, cell detoxification, and meiosis.
[0406] ROS stress
[0407] ER stress, apoptosis, catabolism, and abscisic acid
[0408] ROS induced Ca.sup.+ transport and glycolysis
[0409] meiosis.
[0410] However, the B. stricta pistils also showed signs of energetic development.
[0411] respiration
[0412] ribosome biosynthesis and function
[0413] gene expression.
[0414] A possible interpretation of these findings, which is consistent with our teachings (
[0415] photosynthesis
[0416] respiration
[0417] ROS detoxification
[0418] gene silencing
[0419] However, pistils of both species experienced various levels of stress and active hormone activity.
[0420] stress
[0421] hormone activity
[0422] Stress-related gene expression in B. lignifera pistils is not initially consistent with our teaching. To better locate the source of this stress, whether from internal ovules, external pistil tissues, or both, we conducted two additional analyses (10-11). Analysis 10, B. lignifera ovules vs. B. lignifera pistils, failed to locate the source, i.e., stress response GO categories were not overrepresented or enriched in pistil samples. This would have suggested that the stress was coming from exterior pistil tissues. However, pistils contain ovules, and together, these were compared to samples of just ovules. The presence of ovules in both samples may have diluted the comparison. Even with ovule dilution, GO categories associated with epigenetic silencing were overrepresented in the ovule-only samples. This supports our teachings that silencing mechanisms are active in ovules of apomicts where they silence, or keep silent, the sex phenism. In like manner, photosynthesis GO categories were overrepresented or enriched in ovules. Thus, the photosynthetically active ovules of B. lignifera apparently caused the photosynthesis differences noted above between B. lignifera pistils and B. stricta pistils. Photoperiodism related GO categories were also overrepresented or enriched in ovules. In contrast, external B. lignifera pistil tissues were energetically active as suggested by the following GO categories that were overrepresented or enriched in pistils:
[0423] respiration and gluconeogenesis
[0424] ribosome biosynthesis and function
[0425] transcription.
[0426] Multiple but mostly different stress related GO categories were overrepresented or enriched in pistils of both diplosporous B. lignifera and sexual B. stricta (when compared, analysis 9). Also, the B. lignifera ovule vs. pistil analyses (analysis 10) failed to exonerate B. lignifera ovules from exhibiting stress responses. However, when B. lignifera ovules were compared to sexual B. stricta pistils (analysis 11), stress response GO categories, and those associated with meiosis, were only overrepresented or enriched in the B. stricta pistils.
[0427] various stresses
[0428] ROS and ER stress
[0429] meiosis
[0430] Thus, stress responses observed in B. lignifera pistils (vs. B. stricta pistils) likely originated from the external pistil tissues. As expected, photosynthesis and gene silencing activities were largely restricted to B. lignifera ovules (analysis 11). Evidence of BR signaling in the apomictic ovules was also observed.
[0431] photosynthesis
[0432] gene silencing
[0433] BR signaling
[0434] The following GO categories were overrepresented or enriched in B. stricta pistils compared to B. lignifera ovules, and this indicates that B. stricta pistils contain energetic tissues, which are probably located among the external tissues of the pistil.
[0435] respiration
[0436] ribosome biosynthesis and function
[0437] gene expression
[0438] Our analyses of diplosporous B. lignifera ovules and anthers compared to like tissues of meiotically successful but aposporous B. microphylla and to pistils of sexual B. stricta reveal large swings in gene expression (1000s of genes), which resemble those regulated by SnRK1 and RAPTOR TOR in response to energy abundance or scarcity. Apomeiotic (diplosporous) embryo sac formation in ovules and unreduced pollen formation in anthers of B. lignifera (onset of the apomixis phenism) occurred when germline cells and associated ovule or anther tissues were bioenergetically active. In contrast, meiosis occurred (onset of the sex phenism) in aposporous B. microphylla and sexual B. stricta (male and female) when these tissues were (or appeared to be) bioenergetically starved. From these observations, we recognized that the highly conserved stress vs. growth regulation functions of SnRK1 and RAPTOR TOR (and their orthologs throughout Eukaryota) likely regulate apomixis sex switching among eukaryotes (
[0439] The situation in aposporous B. microphylla does not conform to that observed in diplosporous B. lignifera. In B. lignifera, apomeiosis involves a modification of meiosis that causes the 1.sup.st meiotic division to fail. Thereafter, the apomixis phenism takes over, and a dyad of unreduced spores forms. Within only a few days, one of these develops into the unreduced embryo sac, the egg of which is parthenogenetically competent. In B. microphylla, meiosis is induced by stress, as detailed above, and it generally produces four reduced spores. Sex is then terminated, i.e., all four spores degenerate. Occurring simultaneously with this failed onset of sex is the adventitious formation of one or more unreduced embryo sacs from sporogenous nucellar cells of the ovule wall. These unreduced embryo sacs also produce parthenogenetically competent eggs. As discussed above, the distinction between apospory and diplospory may simply be one of timing. In diplospory, the apomixis phenism is induced earlier than in apospory resulting in conversion of meiosis to apomeiosis by a 1.sup.st division restitution. In apospory, the apomixis phenism is induce as meiosis is being completed. The sexual phenism, which includes gene expression required to form syngamy dependent eggs, is then epigenetically silenced. The apomixis phenism rarely converts a sexually formed spore to an embryo sac that contains a genetically reduced and parthenogenetically competent egg. Instead, all four spores abort. Simultaneously, the process of adventitious embryo sac formation (apomixis phenism, which produces syngamy independent eggs) begins.
[0440] In the B. microphylla vs. B. lignifera ovule comparison (detailed above), strong indicators of stress were observed in the meiotically active B. microphylla ovules. In general, these indicators of stress were also observed in B. microphylla ovules in the B. microphylla ovule vs. B. stricta pistil comparison (analysis 12), but additional differences were also observed. GO categories overrepresented or enriched in B. microphylla ovules that support the notion of stress-induced meiosis include:
[0441] hypoxia and ER stress
[0442] autophagy and catabolism
[0443] other stresses
[0444] meiosis
[0445] GO categories overrepresented or enriched in B. microphylla ovules that might reflect a post-meiosis derailment of the sexual phenism followed by an energy requiring apomixis phenism (apospory) include:
[0446] positive regulation of TOR, in the midst of indicators of strong stress
[0447] imprinting
[0448] photoperiodism
[0449] photosynthesis
[0450] epigenetic silencing, which presumably includes post-meiotic termination of the sexual phenism
[0451] Analysis 12, like previous analyses involving sexual B. stricta pistils, revealed a mixture of GO categories representing both bioenergetically stressed and non-stressed conditions. This likely reflects differences between ovule tissues and exterior pistil tissues. Overrepresented or enriched GO categories in B. stricta pistils that suggest a stress-induced meiosis include:
[0452] ROS and ER stress
[0453] other stresses
[0454] meiosis
[0455] Overrepresented or enriched GO categories in B. stricta pistils that suggest the presence of bioenergetically active tissues include:
[0456] aerobic respiration
[0457] ribosome biosynthesis and activity
[0458] gene expression
[0459] A visual summarization of GO category divergences between pistils of sexual B. stricta, pistils and ovules of diplosporous B. lignifera, and ovules of aposporous B. microphylla is presented in
[0460] Comparisons of aposporous B. microphylla ovules and anthers against those of diplosporous B. lignifera and against pistils of sexual B. stricta revealed large differences in gene expression. Overrepresentation and enrichment of meiosis related GO categories consistently occurred in conjunction with those associated with metabolic stress, as seen in sexual ovules and anthers of B. microphylla and sexual pistils of B. stricta. In contrast, diplosporous ovules and anthers of B. lignifera consistently revealed metabolically favorable cellular environments when compared to sexual ovules, anthers or pistils (
[0461] Our data indicate that the total numbers of genes and their expression levels required for sex differ substantially from those required for apomixis. We hypothesized that such differences control whether sex or apomixis occurs. This is an important and novel hypothesis because, if it is correct, genes specific to apomixis (but not sex) or genes specific to sex (but not apomixis) do not exist, i.e., sex and apomixis are polyphenic. Accordingly, the same eukaryote genome can express sex or apomixis depending on its epigenetic status. Our data further indicate that the epigenetic status, which putatively controls the mode of reproduction expressed, depends on the bioenergetic status of germline cells and associated tissues. This observation suggests that female germline cells or associated tissues of eukaryotes that have evolved obligate apomixis or sex will experience during meiosis bioenergetic stability or stress (real or perceived), respectively.
[0462] Genes controlled by BR signaling promote growth (25) and ROS detoxification (87). Interestingly, the molecular pathways appear to be bioenergetically revved up in the apomicts and functioning cyclically, i.e., active TOR enhances BR synthesis and photosynthesis, BR promotes ROS detoxification, absence of ROS and presence of sugars inactivate SnRK1, and inactivated SnRK1 permits TOR activation (
[0463] The profiling experiments reported herein involved mRNA extraction from ca. 20,000 microexcised ovules (each ca. 40-80 m in diameter) and additional extractions from hundreds of whole pistils and anthers. To our knowledge, this is the most extensive expression profiling comparison made to date of closely related apomictic and sexual organisms. The results are consistent with ovules and anthers of sexual Boechera either being unable to molecularly dissipate levels of metabolic stress, a condition that induces sexual reproduction (meiosis followed by an epigenetics based syngamy requirement), or to perceive low levels of stress or no stress incorrectly as sex inducing high levels of stress. Alternatively, as suggested above, ovules and anthers of apomictic Boechera may possess a capacity to either i) eliminate the metabolic stress that normally would induce sexual reproduction or ii) incorrectly perceive normal levels of stress as an absence of stress. The experiments described in the following section were designed to test these alternative scenarios.
Example 3. Heat and Drought Stress Induce Sexual Reproduction in Apomictic Boechera and Cause their Pistil Expression Profiles to Mimic Those of Sexual Boechera
[0464] Background.
[0465] In 1951, Bocher (76) reported stress-induced shifts from apomeiosis to meiosis in pollen mother cells (PMC) of Boechera. Four reduced (1n) spores tended to form by meiosis (tetrads) instead of two unreduced (2n) spores by apomeiosis (dyads). He speculated that these stress-induced shifts might also occur in ovules of apomictic Boechera, a stress-induced phenomenon that was later documented in several other angiospermous apomicts (88-91). To investigate Bocher's suspicion, we grew sexual and apomictic Boechera in well-watered, droughted, and droughted plus high heat conditions. We also collected sufficient numbers of pistils to produce qPCR and RNASeq expression profiles of pistils (MMC to early embryo sac stages) of well-watered and droughted plants. Effects of stress on reproductive mode were then determined cytologically (percentage apomictic or sexual) and on gene expression profiles for apomictic and sexual Boechera.
[0466] Assuming stress would shift reproduction from apomixis to sex, as seen in Boechera anthers and in pistils of other angiospermous apomicts, we were particularly interested in determining if the effects of stress on gene expression would be greater in pistils of apomictic plants compared to those of sexual plants. Larger shifts in apomictic plants, especially if they produced profiles typical of pistils from sexual Boechera, would suggest that apomictic plants possess mechanisms for dissipating low levels of metabolic stress, i.e., levels that in sexual plants would otherwise induce sexual reproduction. When stress becomes excessive in apomictic plants, surpassing a threshold, then sex would be induced. Such results would also suggest that apomixis, as the fair-weather reproductive phenism (in Boechera and possibly other eukaryotes), actively suppresses (silences or keeps silent) gene expression required for sexual reproduction. If this is correct, it should be possible to induce apomixis in sexual Boechera and other eukaryotes by strengthening each organisms' capacity to dissipate metabolic stress in its germline or germline associated cells.
[0467] Materials and Methods.
[0468] These methods are sufficiently detailed to provide one skilled in the art with information needed to repeat the experiments.
[0469] Seeds of sexual B. stricta (ST2) and apomictic B. lignifera (LI3), B. cf. gunnisoniana (GU cf), B. exilis x retrofracta (ExR1), and B. microphylla (MI2) (
[0470] Pistil samples for RNA-Seq were collected from well-watered and droughted plants of all taxa except B. microphylla, which performed too poorly under stress conditions to obtain sufficient numbers of pistils for RNA-Seq. Pistil length intervals corresponding to ovules in the MMC to early 8-nucleate embryo sac stage were identified cytologically. To avoid sampling bias, pistil length intervals for each species were divided into four sub-intervals, and 15 pistils per sub-interval were collected (60 total). To reduce circadian rhythm bias, pistils were excised between 9:30 A.M. and 12:30 P.M., immediately placed in RNALater and stored at 80 C. Total RNA was isolated using RNeasy kits (Qiagen), and 24 sequencing libraries (4 taxa2 treatments3 rep) were prepared using TruSeq mRNA-Seq kits (Illumina, San Diego, Calif.). The purified libraries were checked for quality and quantity before normalization and sample pooling. Sample pools were clustered and sequenced on an Illumina HiSeq 2500 system with TruSeq SBS Rapid v1 chemistry. Samples were single end sequenced (50 cycles) to a target depth of 10 M reads per sample. A python script was used to truncate reads at the first base with a quality score <16. Remaining reads <24 bp were stripped. Libraries were aligned to the B. stricta genome (JGIphytozome, v1.2) using bowtie2 2.1.0(92) and tophat 2.0.9(93) with two as the maximum read mismatch, gap length and edit distance. Maximum insertion and deletion lengths were set to three. Reads were also aligned using a value of four for the maximum read mismatch, gap length and edit distance, and the two criteria were compared by principle component analyses (PCA) following normalization by library size. Samtools 0.1.19(94) was used to sort gene alignments. Expressed genes were counted using htseq-count 0.6.1p1 using B. stricta annotations (JGIphytozome, v1.2). Splice variants were not counted.
[0471] For differential gene expression and gene ontology analyses, Boechera genes that mapped to a single TAIR10 locus were summed. Genes were retained if their replicate mean transcript count was 5 for each taxa by treatment category and if at least one replicate mean transcript count among the categories was 10. The retained genes were then used to produce pairwise correlation and multidimensional scaling (principal component) plots of TAIR10-mapped genes plus Boechera unique genes. Sixteen gene expression comparisons were then conducted, four that compared control versus treatment samples within taxa, six that compared control samples across taxa, and six that compared treatment samples across taxa. For each of these sixteen analyses, genes were retained if their replicate mean transcript count was 5 for each treatment being compared and if at least one replicate mean transcript count for the treatments being compared was 10. Retained genes for each of the 16 analyses were then DESeq normalized (95) and BRB-ArrayTools 4.6.0 (developed by Dr. Richard Simon and the BRB-ArrayTools Development Team) was used to identify DE genes (FDR, P<0.05).
[0472] Boechera loci that mapped to TAIR10 genes were used for GO analyses. DE genes up-regulated in experimental comparisons (up regulated in treatments used as numerators in the gene expression ratios) were used to identify GO categories (biological process, molecular function, cellular component) that were overrepresented by the respective up regulated genes. Panther Overrepresentation Tests (4/13/2017 release, 12/27/2017 GO Ontology database release, Panther Classification System76, Ver. 13.0) were used for these analyses. DE genes down regulated in the respective experimental comparisons (up regulated in the treatments used as denominators in the gene expression ratios) were likewise analyzed. Log base 2 values of expression ratios of all retained genes of each comparison were used to identify enriched GO categories by Panther Enrichment Tests. GO analyses were conducted at the P<0.05 level of confidence, but, for reasons stated in Section II, Bonferroni corrections were not performed.
[0473] qPCR analyses of five genes, AT2G40140, AT4G02730, AT3G52940, AT3G13580 and AT2G48020, were performed, and results were compared to those obtained by RNA-Seq. Pistils for qPCR (ovules in the MMC to early embryo sac formation stages) were excised from control and drought-stressed sexual B. stricta and diplosporously-apomictic B. lignifera and B. retrofracta x exilis. Three samples of 80-150 pistils each were collected for each set of control plants and for each set of drought-stressed plants. The pistils were immediately placed in RNALater (Qiagen), and stored at 80 C. RNA was extracted and treated with DNasel, cDNA was synthesized, and qPCR reactions were performed using a DNA Engine, Opticon 2, Continuous Fluorescence Detection System (Bio-Rad), and primers as shown in
[0474] Results and discussion. Pistil lengths used to quantify mode of reproduction and to obtain samples for RNASeq (meiocyte to early embryo sac formation stages) were as follows: B. stricta (1.6-2.7 mm), B. lignifera (1.1-2.6 mm), B. cf. gunnisoniana (1.4-2.5 mm) and B. exilis x retrofracta (1.3-2.0 mm). As Bocher (76) suspected, stress (drought or drought plus heat) shifted apomeiosis to meiosis in diplosporous B. lignifera and B. cf. gunnisoniana (
[0475] Heat prevented flowering from occurring in the mesic-favoring B. stricta and B. microphylla. Thus, a heat effect could not be measured for these lines. In addition to drought induced meiosis in ovules of the diplosporous triploid B. cf. gunnisoniana, extra meiotic divisions occurred in some ovules. These produced genetically-unbalanced pentads and hexads (
[0476] For RNASeq, three replicate samples of immature pistils of sexual B. stricta, diplosporous B. lignifera, diplosporous B. cf. gunnisoniana and diplosporous and aposporous B. exilis x retrofracta were obtained from well-watered and droughted plants. These produced 306 M reads (12.761.94 M SD per library), which represented 26,072 B. stricta genes (a mapping efficiency of 0.900.03 SD), of which 18,911 corresponded to separate Arabidopsis TAIR10 genes. An additional 6324 B. stricta genes corresponded to 2413 TAIR10 genes (21,324 TAIR10 matches total). Of these 6324 genes, two Boechera genes corresponded to each of 1765 TAIR10 genes, three corresponded to 594, four to 226, and 5-56 to 577. Blastn to TAIR10 failed for 837 Boechera genes (27).
[0477] PCA were performed on expression counts normalized by library size and by expression counts based on 7,192 genes that showed considerable expression variation among taxa (
[0478] As expected from PCA, numbers of DE genes were low between treatment but within species, the average being 153 DE genes per species, but high between species but within treatments, the average being 3973 DE genes between species pairs but within treatments. Even though numbers of DE genes were relatively low for within-species between-treatment comparisons, numbers of overrepresented GO categories (based on DE genes) and enriched GO categories (based on all genes meeting minimum expression criteria, see Materials and Methods), were informative and averaged 387, 493, 423 and 790 GO categories for B. stricta, B. lignifera, B cf. gunnisoniana and B. exilis x retrofracta, respectively. Numbers of DE genes were much higher for comparisons among the control treatments of each species and among the droughted treatments of each species.
[0479] The expression of meiosis specific genes in the four taxa followed closely the observation of meiosis in these taxa as affected by stress. While overrepresented or enriched GO categories associated with epigenetic regulation often accompanied those related to meiosis, this was not consistently observed. For example, GO categories associated with epigenetic regulation tended to be overrepresented or enriched in the controls of diplosporous B. lignifera though meiosis was induced by stress in this taxon (
[0480] As expected from the PCA, many genes and overrepresented and enriched GO categories were identified when comparisons across taxa were made. As shown in
[0481] The following examples are illustrative only and are not intended to limit the disclosure in any way.
Example 4. Converting Apomeiosis to Meiosis in MMC and Death of Nucellar Cells to Apospory by Osmotic Stress Imposed within 48 Hours of Apomeiosis
[0482] Based on our gene expression profiling studies, we questioned whether the stress-induced genomic, epigenomic and/or biochemical reprogramming required for shifts from apomictic to sexual reproductive development occur gradually during flower development, i.e., requiring long exposures to stress, or can such shifts be induced by short exposures to stress, e.g., as late as immediately prior to the onset of apomeiosis in MMC just hours before they undergo apomeiosis? Herein multiple stress treatments were used to determine how temporally close to the onset of apomeiosis in MMC a stress could be applied and still achieve a pronounced effect. In previous studies (26), the effects of drought and heat were synergistic. Here, drought or related stresses were applied individually and at specific stages of ovule development.
[0483] To study the effects of short-term drought on converting apomictic development to sexual development, pistils of apomictic B. retrofracta x stricta, B. cf. gunnisoniana and B. lignifera were excised and cultured at pre-apomeiotic stages of ovule development. Pistils exposed to treatments in vitro were harvested when they had grown to a length that corresponded with those of greenhouse grown plants that contained ovules that had concluded meiosis or apomeiosis. For pistils grown on basal medium (MS with sucrose), growth averaged 0.2 mm
[0484] From 40-100% of ovules in B. retrofracta x stricta pistils were producing aposporous embryo sacs (includes a degenerating sexual tetrad) at the end of culture, and this high frequency of apospory coupled with sexual megaspore degeneration was most pronounced (80-100% of ovules) in pistils that had been cultured at the earliest stage of ovule development regardless of treatment. A sharp increase in apospory and sexual tetrad formation was observed in response to the least severe drop in (0.55 MPa treatment), but only in the most mature pistils (
[0485] Triploid B. cf. gunnisoniana is highly diplosporous, but when pistils were exposed to low , the frequency of sexual meiosis increased to 55% (
[0486] Significance of discovery: As reviewed above, the fact that stress can shift reproduction from apomixis to sex is well understood, especially for cyclical apomicts such as aphids and water fleas. However, how this shift occurs and the duration of stress required to induce the shift has not previously been reported. Of the many molecular pathways influenced by stress, we show that drought stress imposed within 48 hours of apomeiosis (in the germ cell) is sufficient to reprogram the biology (metabolome and genome) of the germ cell to pursue a different mode of reproductive development.
Example 5. Converting Apomeiosis to Meiosis in MMC and Death of Nucellar Cells to Apospory by Bioenergetic Starvation Imposed within 48 Hours of Apomeiosis
[0487] Since drought drains carbohydrates from tissues, we tested whether changes in sugar signaling, induced by sucrose starvation, constitutes part of the signal transduction pathway responsible for stress-induced shifts from apomeiosis to meiosis. Pistils were cultured on basal medium with and without sucrose. Preliminary experiments indicated that sucrose starvation killed ovules when pistils were cultured too young. Hence, 2-III and 2-IV staged pistils (Arabidopsis scale) were used. The small B. lignifera pistils were too sensitive to sucrose starvation, so data for this species was not obtained. When the experiment was conducted using stage 2-IV pistils (late MMC stage) of aposporous B. retrofracta x stricta, no differences were induced by sucrose starvation in frequencies of aposporous, diplosporous or sexual development (
[0488] Significance of discovery: As with osmotic stress, sugar starvation, in the absence of osmotic stress, imposed within 48 hours of apomeiosis (in the germ cell) was sufficient to reprogram the biology (metabolome and genome) of the apomictic germ cell to pursue sexual development. This discovery indicates that bioenergetics stress is sufficient in the absence of osmotic stress to shift reproduction from apomixis to sex.
Example 6. Converting Apomeiosis to Meiosis in MMC and Death of Nucellar Cells to Apospory by 11202 Treatments Imposed within 48 Hours of Apomeiosis
[0489] TARGET OF RAPAMYCIN (TOR) is a major regulator of cell energetics that is highly-conserved among eukaryotes. This serine/threonine protein kinase activates or inactivates enzymes by its serine-threonine phosphorylation function(18). As a regulator of bioenergetics, TOR is inactivated by ROS, and its inactivation suppresses growth. Furthermore, high levels of ROS accumulate in plant cells in response to low glucose levels (98). However, glucose/TOR signaling in high ROS low glucose environments is selective, with cell cycle regulation being specifically targeted (21). Interestingly, this is consistent with the somewhat surprising results that stress-induced switching from apomeiosis to meiosis can occur very late in MMC development, possibly after apomeiotic prophase has initiated. Since major cell cycle alterations are central to apomixis/sex switching, we asked whether ROS/TOR signaling functions downstream from stress (drought or sugar starvation) perception. To address this question, we pretreated for 5 min appropriately staged pistils in solutions containing H.sub.2O.sub.2, cultured the pistils under otherwise favorable and sucrose conditions, and observed, one to a few days later, whether apomeiosis to meiosis shifts had been induced. H.sub.2O.sub.2 is a relatively long-lived ROS that permeates whole cells and cell organelles (48). A ROS-induced reduction in apomeiosis to meiosis ratios would be consistent with TOR being part of the causal signal transduction (switch mechanism) pathway.
[0490] The 50 and/or 100 mmol L1 H.sub.2O.sub.2 treatments effectively switched apomeiosis to meiosis in apomictic B. retrofracta x stricta (
[0491] The most effective timing in the 2-IV stage for inducing meiosis with H.sub.2O.sub.2 treatments differed depending on the species. For B. cf. gunnisoniana, the best timing occurred when pistils were 2.1 mm long, which is near the end of the 2-IV stage. For B. lignifera, the best timing was when pistils were 1.5 mm long, which was near the middle of 2-IV stage. For B. retrofracta x stricta, the best time was when the pistils were 2.0 mm long, which is at the beginning of the 2-IV stage.
[0492] Significance of discovery: As with osmotic stress and sugar starvation, H.sub.2O.sub.2 imposed within 48 hours of apomeiosis (in the germ cell), in the absence of either osmotic stress or sugar starvation, was sufficient to reprogram the biology (metabolome and genome) of the apomictic germ cell to pursue sexual development. This discovery indicates that H.sub.2O.sub.2 is sufficient in the absence of osmotic stress or bioenergetic starvation to shift reproduction from apomixis to sex. This is an important discovery. With this experiment, we narrowed in on the molecular pathway responsible for sex apomixis switching, from innumerable potential stress-induced pathways, down to a single chemical, H.sub.2O.sub.2, that functions within the switch pathway.
Example 7. Converting Apomeiosis to Meiosis in MMC and Death of Nucellar Cells to Apospory by Inhibiting Brassinosteroid Signaling within 48 Hours of Apomeiosis
[0493] The observed rapid shift from apomeiosis to meiosis in late-stage MMC as affected by H2O2 treatments is consistent with the activity status of TOR being a key regulator of the apomixis/sex switch. By a mechanism not yet elucidated (25), TOR stimulates the production of brassinosteroids (BR), which are plant steroids that regulate growth, including many growth and development functions of ovules (25). By dephosphorylation, BR activates BRASSINAZOLE-RESISTANT 1 (BZR1), which is a major BR-regulated transcription factor that targets ca. 2000 genes. Thus, to determine if BR functions downstream of TOR in the apomeiosis meiosis switch, we treated sets of B. cf. gunnisoniana pistils with the BR biosynthesis inhibitor brassinozole (BRZ). Pistils were collected during the 2-III and 2-IV stages. Pistils in the 2-III stage did not grow sufficiently to collect data. However, for pistils cultured at the 2-IV stage, BR synthesis inhibition caused a significant shift (P<0.05) from apomeiosis to meiosis and from apoptosis to apospory (
[0494] To determine if apomixis to sex switching by H.sub.2O.sub.2 involves pathways independent of BR, we compared three treatments to controls, BRZ alone (1.0 mol), H.sub.2O.sub.2 alone (500 mol), and BRZ and H.sub.2O.sub.2 combined (
[0495] Significance of discovery: These experiments indicate that BR synthesis suppression reverts apomeiosis to meiosis, and they point to a likely BR regulated transcription factor, BZR1 (
[0496] The experiments described in Examples I-IV elucidate major components of the molecular pathway responsible for apomixis to sex switching. This information does not appear in the literature. Our discovery of this pathway enabled us to reverse the process, i.e., to chemically induce apomixis in sexual plants without genetic modifications.
Example 8. Converting Taraxacum-Type Diplospory to Antennaria-Type Diplospory by Suppressing MMC DNA Methylation in B. cf. Gunnisoniana
[0497] Gametophytic apomixis in angiosperms involves the formation of a genetically unreduced gametophyte that produces an unreduced egg that develops into an embryo parthenogenetically, with endosperm forming either pseudogamously (with fertilization of the gametophyte central cell) or autonomously (without central cell fertilization). There are several developmental pathways through which the embryo sac (gametophyte) may form, and these constitute different types of gametophytic apomixis. The most common types are Hieracium-type apospory, where the embryo sac forms from a nucellar cell after meiotic failure, Taraxacum-type diplospory, where meiosis fails at the 1st division and the embryo sac forms from an unreduced product of a mitotic-like meiosis, and Antennaria-type diplospory, where meiosis fails prior to the 1st meiotic division and the embryo sac forms directly from the MMC (1, 7, 10). Multiple types of apomixis occurring in the same species has only rarely been observed (1), and this has led scientists to suspect that these three major types of apomixis are regulated by different genetic mechanisms. As described above, we have shown that Taraxacum type diplospory and Hieracium-type apospory are common in Boechera and that Antennaria-type diplospory also occurs, apparently rarely, in the genus. Here, we hypothesized that T-type diplospory represents a partial suppression of meiosis, while A-type diplospory represents complete meiotic suppression.
[0498] The observations that i) epigenome reprogramming is required for sexual reproduction (35) and ii) inactivation of DNA methylation can induce apomixis-like phenotypes (7) suggest that apomixis may be the default pathway with sex being the more derived add-on program. Thus, if methylation in sexual plants can be prevented, or if DNA can be demethylated, the apomictic pathway might surface as the default pathway. 5-azaC, an inhibitor of DNA-cytosine methyltransferases, produces upon DNA replication hypomethylated DNA. It is a chemical analogue of cytosine that is incorporated into DNA by competition with cytosine during DNA synthesis. In 5-azaC, the carbon-5 of the cytosine ring, which is essential to DNA methyltransferase function, is replaced by nitrogen, and this causes failure of methylation at each 5-azaC site(99). Here, we incorporated 5-azaC into archesporial nucellar cells of Taraxacum-type diplosporous B. cf. gunnisoniana prior to the mitoses that produce the MMC from the archesporial cell. The highest concentration of 5-azaC (500 mol L1) induced Antennaria-type diplospory in 10% of the ovules (
[0499] Significance of discovery: In Examples I-IV, we repeatedly demonstrated that ovules of Taraxacum-type diplosporous apomicts can readily switch to Hieracium-type apospory when their metabolic states are altered. Here we show that Taraxacum-type diplospory switches to Antennaria-type diplospory when epigenetic modifications associated with Taraxacum-type diplospory are prevented from occurring. Collectively, these experiments indicate that the three major types of apomixis in angiosperms are interchangeable within a common genotype. We demonstrate below that sexual reproduction is also interchangeable with apomixis within common genotypes. These demonstrations are counterintuitive with regard to the present state of the art of apomixis research, which has (for over 100 years) provided evidence that apomixis is under genetic, not metabolic, control. We understand that different genotypes have different capacities for expressing sex or apomixis. But we suspect that the genetic differences in most cases reflect differences in how ovules interpret or detoxify their metabolic environments, and not in genetic mutations that somehow directly affect sexual or apomictic development.
Example 9. Converting Meiosis to Apomeiosis with BR or Glucose
[0500] epiBL is the naturally occurring and most biologically active form of BR. Applications of epiBL to pistils of sexual B. stricta, in vivo or in vitro, caused MMC to abort meiosis and instead produce dyads (
[0501] The B. stricta accession we used is an obligate sexual plant (26), and the sexual dyad stage, during meiosis, is very short. It is often difficult to catch the sexual dyad stage in pistil fixations because it is so brief (usually less than 10% of meiocyte-staged fixations). In contrast, the dyad stage of Taraxacum-type diplosporous apomixis (1st division restitution resulting in a dyad of unreduced megaspores) is a lengthy stage, like the tetrad stage of sexual plants. Hence, the dyad stage is readily observed in ovule fixations of diplosporous Boechera. Although ratios of observed dyads increased to 30% in the epiBL treatments (higher than expected for sexual meiosis), unreduced embryo sacs forming from epiBL-induced dyads (with prominent embryo sac vacuoles) were only rarely observed (
[0502] Treatment of intact pistils of Arabidopsis with BR or glucose solutions induced high frequency apomeiotic dyad formation. Most of the functional megaspores from these treatments originated by Taraxacum-type diplospory (
[0503] Significance of discovery: In B. stricta, the inability of BR alone to rapidly induce apomixis may reflect the overall metabolic state of the ovules in question. From our expression profiling studies, ovules of sexual plants consistently exhibited overrepresented or enriched GO categories associated with bioenergetic stress and redox instability (
Example 10. Converting Meiosis to Apomeiosis in Sexual B. Stricta, Arabidopsis and Cowpea with 5-azaC, BR, Antioxidants and Sugars
[0504] To address redox instability, pistils were exposed to the antioxidant DTBA, an antioxidant that protects thiol groups in proteins from oxidization. To address bioenergetic stress, pistils were exposed to sugars. Glucose signaling is one of the most ancient and central signaling pathways in animals and plants and is involved in gene expression, primary and secondary metabolism, and regulation of growth and development (98). In Arabidopsis, rates of glycolysis and mitochondrial bioenergetics are sensed by TOR, which then control root meristem activation (18). If sufficient sugar is supplied, TOR should be activated. Active TOR protects BZR1 and other important BR-regulated enzymes from degradation, and this leads to plant growth (25). Factorial experiments were designed to test the effects of sucrose, glucose, epiBL, DTBA and 5-azaC on apomixis induction. These were designed for each of three sexual species, B. stricta, arabidopsis and cowpea. The experiments were performed and ratios of apomeiosis to meiosis were documented.
[0505] Two factorial experiments were conducted using immature Arabidopsis pistils. In the first experiment, no 5-azaC, 5-azaC in the pretreatment only, or 5-azaC in both the pretreatment and the tissue culture medium were tested. 5-azaC effectively induced onset of aposporous embryo sac formation from nucellar cells (
[0506] In the factorial experiment conducted using immature B. stricta pistils, all treatments, including glucose instead of sucrose, induced Taraxacum-type diplospory (
[0507] The cowpea experiment involved 34 ovules from among multiple treatments. Of the 34 ovules, 24 had initiated Antennaria-type diplospory (
[0508] Significance of discovery: By providing sexual ovules with favorable metabolic states as observed in apomictic ovules (as observed in the expression profiling results), apomixis was induced at high frequencies. This discovery will enable the development of plants, and probably many animals as well, e.g., aquaculture (crustacean and fish farming), that undergo apomeiosis instead of meiosis.
Example 11. Inducing Parthenogenesis and Autonomous Endosperm Formation in Arabidopsis with epiBL, Antioxidants and Sugars
[0509] Functional apomixis requires not only apomeiosis but also parthenogenesis and, in plants, endosperm formation. By inducing apomeiosis, we hypothesized, based on strong correlations observed between epigenetic GO categories and modes of reproduction (
[0510] Significance of discovery: Birth of the gametophyte generation in short-lived annuals such as Arabidopsis begins at the end of meiosis or apomeiosis and ends only a few days later when either the egg is fertilized or begins to develop parthenogenetically. Our results indicate that ovules and embryo sacs of sexual plants that are provided, during this time frame, with metabolic conditions consistent with those observed in ovules of apomictic plants will undergo all three phases of apomixis, i.e., apomeiosis, parthenogenesis and autonomous endosperm formation. These discoveries provide new and promising directions for achieving fully functional apomixis technologies.
Examples 12-14
[0511] Gametophytic apomixis in angiosperms terminates sexual reproduction and produces unreduced embryo sacs (apomeiosis) that generally contain an unreduced egg and two polar nuclei. These undergo parthenogenesis and autonomous or pseudogamous endosperm formation, respectively. Progeny of apomicts are maternal, a property viewed by seed producers as a potential tool for efficiently producing hybrid seed. Apomixis does not occur in major crops, but termination of meiosis coupled with apomeiosis occasionally occurs at low frequencies in sorghum. Using sorghum F.sub.2 and recombinant inbred line populations, we identified apomeiosis associated quantitative trait loci. We then identified differentially expressed genes and gene ontology categories that differentiate immature ovules of an apomeiotic F.sub.2 sib from those of a sexual sib. Ovules of the apomeiotic sib experienced high-energy low-stress cellular metabolism conditions, including glucose, ethylene and brassinosteroid signaling, ribosome and protein biosynthesis, and reactive oxygen species scavenger production. From these, we identified gene networks that putatively regulate apomixis sex switching, and we tested these networks using pharmacological treatments designed to shift energy and stress signaling from meiosis to apomeiosis. Different treatments induced different types of apomeiosis (Antennaria, Taraxacum, Hieracium) in sexual Arabidopsis thaliana and Boechera stricta (Brassicaceae). Antennaria type apomeiosis was also induced in the legume crop cowpea (Vigna unguiculata, Fabaceae). Herewith we add apomeiosis to parthenogenesis as an apomixis process that is readily inducible by modifying wild type gene expression. These findings encourage a rethinking of apomixis evolution and regulation theory and should accelerate the development of apomixis technologies for crop improvement.
[0512] Asexual seed formation (apomixis) in angiosperms involves four single cell processes. The first is termination of sexual reproduction. This occurs either before, during or after female meiosis. The second is apomeiosis, which is the formation of a genetically unreduced egg or egg-like cell. The third is parthenogenesis, which produces a clonal embryo from the unreduced egg or egg-like cell, and the fourth is fertilization dependent or independent central cell activation, which produces endosperm (7). Apomixis in other eukaryotes involves three processes, termination of sexual reproduction, apomeiosis and parthenogenesis. Across eukaryotes, a broad diversity of specialized life cycles, life cycle morphologies, and life cycle components have evolved around these three defining processes. Examples include apomictic parasites, which have sexual and apomictic life cycle phases that include multiple hosts, and apomictic insects, which employ genetic reduction followed by parthenogenesis to produce haploid males or females (9, 100). Apomixis occurs as an alternative to sex at multiple taxonomic levels in single or multi-celled organisms of all eukaryote kingdoms (1, 9, 34, 38). However, we do not know how expansive such occurrences are among extant eukaryotes. Of the 8.7 million eukaryote species (101), ecotype-intensive cytological verifications of reproductive mode are available for relatively few (9, 45, 102). Furthermore, the fossil record is completely silent concerning how frequent the expression of apomixis may have been among extinct progenitors of modern eukaryotes.
[0513] In cyclically apomictic protists and animals, favorable conditions induce apomixis, while stress induces sex (9, 34). Likewise, many facultatively apomictic angiosperms tend to switch from apomixis to sex when confronted with stress (26, 103-106). That apomixis occurs alternatively with sex in certain species from all eukaryote kingdoms suggests that sex and apomixis may be anciently polyphenic. Polyphenisms are alternative phenotypes (phenisms), which often are induced by changing seasons (107). In cyclically apomictic aphids and water fleas, fecundity is exponentially driven by apomictic females during the summer. In the fall, apomictic females produce sexual males and females. These produce fertilized eggs that remain dormant during the winter but hatch into apomictic females in the spring (108, 109).
[0514] Apomixis researchers in the 20.sup.th century considered apomixis to be a derived trait where one to a few mutations changed meiosis to apomeiosis and mixis to parthenogenesis (39, 110). It was hypothesized late in the century that apomixis arises fortuitously due to confusions in gene expression following interspecific hybridization or polyploidization (10, 103). This hypothesis is consistent with apomixis arising, apparently without mutation, after hybridization in animals (110) and plants (74, 103, 111, 112). However, thousands of eukaryote genera contain apomictic species, and hypotheses that rely on fortuitous mutations or confusions in gene expression to produce functional alternatives to sex seem incomplete at best. Here we provide evidence for a third hypothesis, that the molecular processes of meiosis and mixis are anciently polyphenic with those of apomeiosis and parthenogenesis, and that switching between phenisms, as suggested by cyclical apomicts, is metabolically regulated (8, 50). Accordingly, apomixis genes might not be mutated meiosis or mixis genes, but genes that regulate metabolic homeostasis. This hypothesis represents a major shift in visualizing apomixis evolution and regulation, and we provide herein important supporting evidence for it.
[0515] In a previous study (50), we verified weakly penetrant apomeiosis in certain Sorghum bicolor (L.) Moench (sorghum; Poaceae) genotypes. Three groups of plants were studied, 150 genotypes from 65 accessions, 300 F.sub.2 segregates, and 116 segregates of a recombinant inbred line (RIL) population. Plants with the highest frequencies of apomeiosis were identified by K-means separation. In these plants, sexual meiosis and ES formation occurred at less advanced physical stages of ovule development. We considered three explanations for what triggered this precocious meiosis and apomeiosis: i) a simple tendency for early germline development, ii) meiotic instability due to recent hybridity, ill) heterozygosity due to recent hybridity, and iv) weak expression of an apomixis program that induces precocious germline development. We dismissed explanations 1-3 because not all precociously meiotic plants were apomeiotic and because some apomeiotic plants were RIL that had not experienced recent hybridization. We concluded that weak expression of an apomeiosis-inducing process induced precocious reproduction, whether sexual or apomeiotic.
[0516] Herein we report quantitative trait loci (QTL) for apomeiosis associated traits in sorghum (50). We also report differentially expressed genes (DEG) between ovules excised from two sorghum sibs, one apomeiotic and one sexual. Molecular pathways regulating sex apomixis switching are postulated. Components of these pathways were tested by exposing pistils of two sexual Brassicaceae species, Arabidopsis thaliana (L.) Heynh. (Arabidopsis) and Boechera stricta (A. Gray) A. Love & D. Love (Drummond's rockcress), and a sexual legume (Fabaceae) species, Vigna unguiculata (L.) Walp. (cowpea) to chemicals that enhance or suppress stress signaling or DNA methylation. Several treatments induced high frequency apomeiosis. To our knowledge, this is the first report of metabolism-induced apomeiosis in sexual plants.
Example 12. QTL Mapping
[0517] Materials and Methods Mapping populations were grown at Logan, Utah (41.7587 N 111.8126 W). Forty-six RIL were tiller propagated and also grown at Crosbyton, Tex.) (33.6637-101.2378. Publically available chromosome linkage maps and genotype data (113) were used for RIL mapping (Table 8, Datafile S2). F.sub.2 linkage maps were produced at Texas A&M University as in Menz et al. (114) using 175 of the 302 F.sub.2 (Table 9, Datafile S3). Pearson correlation coefficients across environments (Texas and Utah) were obtained for all apospory associated traits. Means for the Utah grown F.sub.es and the Texas and Utah grown RIL (averaged across tiller-replicated plants) were used for mapping by MapQTL (115). Interval mapping (116) was performed initially for presence of a QTL for each position on the map (p<0.05) (117, 118). Nearest flanking markers in putative QTL regions were chosen as co-factors for multiple QTL mapping using backward elimination (119). Thousand-permutation tests were used to decide logarithm of odds thresholds (p<0.05) (120). Phenotypic variance explained by each QTL was calculated as the square of the partial correlation coefficient (R.sup.2) of each variable adjusted for co-factors. Additive effects of each QTL were estimated as half the difference between the two homozygous classes. Numbers after dashes in QTL names represent chromosome numbers. usu denotes Utah State University. Sub-numbering indicates more than one QTL per trait per chromosome. Markers and QTL were drawn using MapChart (121).
[0518] Results QTL mapping was performed using F.sub.2 (50) and RIL (113) populations. Mapped traits (
[0519] Eighteen apospory associated QTL were identified among the RIL (Table 2). Two of these, Qaes.usu-1.1 and Qaes.usu-1.3, accounted for 8.0 and 49.6% of the AES variation, respectively, and these were closely linked on chromosome 1 (
[0520] Twenty-four QTL were identified among the F.sub.2 (Table 3). Four were AES specific and occurred on chromosomes 1 (Qaes.usu-1), 5 (Qaes.usu-5) and 6 (Qaes.usu-6.1, Qaes.usu-6.2) (
Example 13. Expression Profiling
[0521] Materials and Methods
[0522] Two sibs from the F.sub.2 population, 151 and 264, with 13.6 and 0.0% AES formation, respectively (50), were selected for gene expression profiling of ovule tissues. Twenty tiller-propagated clones of each were grown as previously described (50). Three germline stages were chosen for profiling: early MMC, early meiocyte, and mid ES stages. Pistil length categories were determined by staging germline development in 240 pistils from sib 151 (170 to 580 m long), and 257 pistils from sib 264 (250 to 670 m long). Ovules were excised from pistils in nuclease free water and placed in RNAlater (Qiagen, Germantown, Md., USA). Thirty samples (90-150 ovules each), five for each sib by stage combination, were collected for a total of 601, 699 and 499 ovules and 508, 604 and 499 ovules for the MMC, meiocyte and early ES stages of sexual sib 264 and aposporous sib 151, respectively. Excised ovules were stored at 20 C. To reduce effects of diurnal shifts in gene expression, ovules were excised between 9:00 AM and 1:00 PM. Dissection equipment was cleaned periodically with RNaseZAP (Thermo Fisher, Waltham, Mass.). Ovule samples were transferred to Microcon YM-100 Centrifugal Filter Columns (MilliporeSigma, Burlington, Mass.) containing 200 L of lysis solution and centrifuged (12,500g, 10 min, 4 C.). Samples were then rinsed with 100 L RNase free water, centrifuged again, resuspended in 200 L of lysis solution plus 20 L Plant RNA Isolation Aid (Thermo Fisher), ground (on ice) for 2 min using RNAse-free pestles, centrifuged (12,500g, 2 min, 4 C.), and ground for 1 min. Pestles were rinsed with 100 L 100% ethanol, which was collected in the grinding tubes. Samples were transferred to Micro Filter Cartridges, and total RNA was isolated using RNAqueous Micro kits (Thermo Fisher). RNA concentrations and quality were checked by Nanodrop-1000 spectrophotometry (Thermo Fisher) and by an Agilent 2100 Bioanalyzer with an RNA 6000 Nano Series II kit (Agilent Technologies, Santa Clara, Calif.). RNA samples were dried in a Vacufuge Concentrator (Eppendorf, Westbury, N.Y.) and amplified using Amino Allyl MessageAmp II kits (Thermo Fisher). Antisense RNA (aRNA) was Nanodrop and Bioanalyzer checked and stored at 80 C. aRNA samples (10 g each) were Cy3 or Cy5 labeled and purified within 12 h of array hybridization.
[0523] Two color microarrays were synthesized from 12,000 35 nt probes by CombiMatrix (Irvine, Calif.) based on unigene EST from sorghum panicles. About 25% of sorghum open reading frames were represented (61). No gap sequences with a 94% BLASTN (122) match (33 of 35 nt) to the S. bicolor V3.1.1 NCBI reference genome (123) were retained (8664 of 12,000 probes). Annotations to Arabidopsis and Oryza sativa L. (rice) were made using Phytozome 12.1.6 (Datafile 51). Labeled 3 g aRNA samples were fragmented (Thermo Fisher reagents), verified by Nanodrop for concentration and labeling, and applied to 15 two-color arrays. A saturated loop design was used to distribute the 30 sib/stage/replication samples (2:3:5) evenly among the 15 arrays. Arrays were incubated at 45 C. for 16 h and scanned using a ScanArray Express HT (Perkin Elmer, Waltham, Mass.) microarray scanner (5 m resolution). Median pixel intensities were captured using Imagene software (Biodiscovery, Inc., El Segundo, Calif.). Median probe intensities were Lowess normalized within arrays and median normalized across arrays. Normalized minimum or maximum values for each set of five replicate values (sib by stage by probe) that differed from the mean of the remaining four values by more than 2.5 times the standard deviation (remaining four values) were removed. Of the 51,984 sets of five replicate values, 89% retained all five values after filtering, and no set had less than four replicate values.
[0524] Normalized data were log 2 transformed, and DEG (FDR<0.05) were identified by class comparison (BRB-ArrayTools 4.6.0, developed by Dr. Richard Simon and the BRB-ArrayTools Development Team). DEG were located to sorghum chromosomes using Phytozome 12.1.6. Overrepresented GO categories (Panther Overrepresentation test, released Nov. 13, 2018) were identified using Arabidopsis orthologs of up or down regulated DEG (Panther 13.1 release; Panther GO Ontology database, released Nov. 15, 2018). For Panther GO Enrichment analyses, expression data corresponding to Arabidopsis orthologs were sorted by Log 2 values of fold change ratios. Where multiple probes represented the same Arabidopsis gene, the most highly up or down regulated probe per gene was retained. Lists of enriched and overrepresented GO categories were produced. Enrichment and overrepresentation tests were performed using Fisher's Exact Test (FDR<0.05).
[0525] qPCR
[0526] Six DEG were selected for qPCR. Primers were designed, checked for secondary structures (PrimerSelect), and searched by BLAST for similar sequences (word size, 7; expect value, 1000). Sequences unique to sorghum were retained. Sequences predicted to form internal loops or dimers, or those homologous to other genes, were discarded. Primer pairs were tested using gDNA from the aposporous and non-aposporous sibs, and qPCR analyses were performed (Table 10).
[0527] Results
[0528] Genes putatively influencing AES formation were identified by comparing expression profiles of ovules excised from the highest AES forming F.sub.2 sib, A151 (13.6% AES), against those of a completely sexual F.sub.2 sib, 5264 (
[0529] Using Arabidopsis orthologs, Panther enrichment analyses (65) identified 108 enriched gene ontology (GO) terms, 105 of which were enriched in A151. Like DEG, the highest numbers of enriched GO were detected at the MMC stage (Table 5;
Example 14. Pistil Culture Experiments
[0530] Material and Methods
[0531] Pharmacological Experiments.
[0532] Plants of Arabidopsis (Col-0), Drummond's rockcress (Duchesne County, Utah, USU Intermountain Herbarium no. UTC00275884) and cowpea (California Blackeye No. 5, W. Atlee Burpee & Co., Warminster, Pa.) were grown in Sunshine Mix #1 potting soil (Sun Gro Horticulture Canada Ltd, Vancouver, BC) in a walk in growth chamber that maintained 22/16 day/night temperatures and a 16/8 h day/night photoperiod. Lighting was supplied by soft white florescent bulbs, incandescent lights, and 1000 W high-pressure sodium-vapor lamps, which provided a photosynthetic photon flux of c. 300 mol m.sup.2 s.sup.1 at the canopy surface for Arabidopsis and rockcress and c. 500 mol m.sup.2 s.sup.1 for cowpea. Plants were watered regularly with a dilute solution (250 mg L.sup.1) of Peters Professional 20:20:20 fertilizer (Scotts, Maryville, Ohio).
[0533] Cytological Analyses.
[0534] Arabidopsis, Drummond's rockcress and cowpea floral buds were fixed in FAA (v/v: 3.7% formaldehyde, 5% acetic acid, 50% ethanol) for 48 h and cleared in 2:1 benzyl benzoate dibutyl phthalate (BBDP) (80): 1) 70% EtOH, 30 min; 95% EtOH, 4 h (2); 95% EtOH:BBDP (2:1), 2 h; 95% EtOH:BBDP (1:2), 4 h; BBDP, 4 h; BBDP, overnight. Cleared pistils were mounted (up to 16 per slide) and measured from the pedicel base to the top of the stigma. Ovule development stages were studied using a BX53 microscope equipped with differential interference contrast optics and a MicroFire 599809 camera (Olympus, Center Valley, Pa., USA). For chromosome staining, pistils were soaked in 95% ethanol that contained 0.1 mg L.sup.1 4,6-diamidino-2-phenylindole (DAPI). Callose was stained by soaking DAPI stained pistils in aqueous aniline blue (Millipore Sigma, Darmstadt, Germany) (124). DAPI fluorescence was detected with a Zeiss LSM 510 confocal microscope with excitation at 408 nm, dichroic reflector at HFT488 nm and detection at 450-650 nm. Callose was distinguished from DAPI by detection at 550-650 nm.
[0535] Presence of the following ovule characteristics were recorded: MMCs, Antennaria type diplosporous 1-2 nucleate ES, sexual or Taraxacum type diplosporous dyads, sexual tetrads, sexual or Taraxacum type diplosporous 1-2 nucleate ES, AI and AES. Developmental stages for the majority of ovules per pistil were recorded, and pistil lengths for the following stages (125) were recorded: 1-II, ovule meristems protruding from placentae (precedes MMC formation); 2-IV, meiosis; 3-111, vacuole in immature ES beginning to appear; 4-VI, nuclear divisions in endosperm underway. To determine average timing of meiosis onset, pistils primarily containing premeiotic (2-III) ovules were located under low light conditions 1 h before the lights came on in the morning. Corresponding sepals were marked with a small point permanent marker. Pistils were then randomly harvested for analysis when the lights came on and 3 h thereafter.
[0536] Results
[0537] Pistils were aseptically excised, but not disinfested, at the early pre-MMC to MMC stages and incubated in vitro. The basal culture medium for Arabidopsis and Drummond's rockcress was MS (126) (Caisson Laboratories, Inc., Smithfield, Utah USA) with 20 g L.sup.1 sucrose or glucose and solidified with 1.45 g L.sup.1 Phytogel (MilliporeSigma). Basal medium for cowpea was the same except it contained 60 g L.sup.1 sucrose or 30 g L.sup.1 glucose, 0.5 mol L.sup.1 naphthalene acetic acid, 5.0 mol L.sup.1 6-benzylaminopurine, and Gamborg's B5 vitamins. Media were supplemented with 0.5 or 1.0 mol L.sup.1 BR (epibrassinolide); 0.5 or 1.0 mol L.sup.1 DTBA; and/or 0.1 or 0.5 mmol L.sup.1 5-azaC (MilliporeSigma). Media were pH adjusted to 5.75 and autoclaved for 20 min at 121 C. BR was added after autoclaving by filter sterilization. Prior to culturing, pistils were presoaked for 60 min in solutions corresponding to their treatment (same concentrations but without basal media components). In another experiment, pistils were presoaked for 7 min in 250 mmol L.sup.1 H.sub.2O.sub.2. Petri dishes with pistils were incubated for 2-6 d under low light (c. 80 mol m.sup.2 s.sup.1) (temperature and photoperiod as above). Ovules that were too young (MMC stage or earlier), too old (ES2 stage or older), or poorly oriented were not scored. Cross-tabulation data were analyzed by Pearson chi-square tests (97).
[0538] For topical applications, sepals of floral buds were separated, and pistil lengths were measured using a dissecting microscope. Pistils whose length corresponded to the 2-I (prior to integument budding) or 2-III (active integument budding) stages were identified, and these were treated with a bead of solution containing either 2.0 mol L.sup.1 BR, 50 mmol L.sup.1 glucose, or deionized water. The bead was wrapped around the pistil inside the flower bud. After soaking for 60 s, the tip of the inflorescence was inserted into a PCR tube containing the treatment solution. Pistils were soaked for c. 5 h, rinsed with water and air dried. Pistils were harvested for analysis 12-72 h later.
[0539] From our profiling results, we derived a model of environment regulated apomixis sex switching (see discussion). Four locations in the model were identified where switching might be induced: 1) antioxidant homeostasis, 2) brassinosteroid (BR) signaling, 3) glucose signaling, and 4) meiosis specific RNA directed DNA methylation (RdDM) (
[0540] To determine whether apomeiosis is inducible by interrupting peroxide signaling (
[0541] Endogenous peroxide is required to activate the transcription factor BRASSINAZOLE-RESISTANT 1 (BZR1) (127). Hence, we tested whether cultured pistils exposed to a 7 min pretreatment in dilute H.sub.2O.sub.2 might induce apomeiosis by activating BZR1 (
[0542] We next asked whether BR alone or in combination with dilute H.sub.2O.sub.2 or DTBA would induce apomeiosis. BR alone stopped meiosis early during meiotic prophase in 45% of ovules, and MMC in these ovules were undergoing Taraxacum type dyad or ES formation. Low levels of AES formation also occurring (
[0543] In other projects, whole plants of apomictic Boechera were chronically stressed by drought (26) and pistils of well-watered apomictic Boechera were acutely stressed by H.sub.2O.sub.2 applications, sugar starvation, or osmotic stress shortly before apomeiosis (106). In each of these experiments, high frequency shifts from Taraxacum-type diplosporous apomeiosis to normal meiosis were observed. Identical switching also occurred when BZR1 was inactivated (106). Also, when pre-MMC staged pistils of triploid Boechera cf. gunnisoniana were demethylated using 5-azacytidine (5-azaC), 10% of ovules switched from Taraxacum-type diplospory (termination of sexual development during meiotic prophase) to Antennaria-type diplospory (termination of sexual development prior to meiosis) (106). Here, demethylation appears to have interrupted the RdDM required for meiosis (130), including the early meiotic events of prophase that characterize Taraxacum-type diplospory.
[0544] The switch in B. cf. gunnisoniana from Taraxacum to Antennaria-type diplospory in response to 5-azaC (106) suggested that 5-azaC might also switch meiosis to apomeiosis. To test this, we soaked pre-MMC staged Arabidopsis pistils in 5-azaC for 60 min and then cultured them on either control medium or media containing 5-azaC, BR, or 5-azaC plus BR and DTBA. Greater than 90% of treated ovules developed apomeiotically. At the time of fixation, most ovules were developing by Taraxacum-type diplospory or apospory (
[0545] To determine if apomeiosis is inducible in other sexual angiosperms, we exposed pistils of Drummond's rockcress and cowpea to similar treatments (
[0546] Model Derivation. To identify gene networks putatively responsible for apomixis sex switching, we first evaluated DEG and GO categories that differentiated A151 from 5264. A151 ovules experienced high metabolic activity, with many respiration, ribosome biogenesis, and gene expression GO terms being enriched or overrepresented (Tables S5-6). In contrast, S264 ovules were characterized by terms associated with chloroplasts, chemotaxis and mitosis (Tables S5, S7). We initially posited that the high metabolic activity in A151 was caused by efficient energy production or import systems. However, A151 was not characterized by photosynthesis DEG or GO categories, and the immature ovules sampled were generally void of photosynthetic pigments. Likewise, there was no evidence that sugar transport proteins were differentially expressed between sibs. However, cycles of fatty acid synthesis, fatty acid catabolism by beta oxidation, and gluconeogenesis may have occurred to a greater extent in A151 (Table 4: 2-20, 36-41). This suggests that the energy associated differences observed between A151 and S264 involved shifts in carbon usage rather than differences in carbon availability.
[0547] In eukaryote cells, switching between metabolic processes responsible for growth (energy usage) and no growth (energy conservation) is regulated by two conserved kinases. Orthologs of these are SUCROSE NONFERMENTING 1 (SNF1) and target of rapamycin (TOR) in yeast, AMP-activated protein kinase (AMPK) and mTOR in animals, and sucrose non-fermenting 1-related kinase (SnRK) and TOR in plants (13, 131). In plants, during high-energy and low-stress conditions, TOR, RAPTOR and LETHAL WITH SEC THIRTEEN 8 (LST8) assemble to form the TORC1 complex. This complex induces rapid growth through enzyme activation, transcriptional reprogramming, and new protein synthesis (13). Included in this high energy metabolic activity is BR synthesis and downstream growth and development processes, which are regulated by the transcription factors BZR1 and BRASSINAZOLE-RESISTANT 2 (BES1, BZR2) (25, 127) (
[0548] Growth cessation and decreased metabolic activity occur when TORC1 is inactivated. In plants, this happens in two ways, by glucose starvation or by accumulation of abscisic acid (ABA). Both processes involve multistep molecular pathways (
[0549] The 40 sorghum plants used for ovule collections in this study (20 ramets of each sib) were grown together under ideal conditions. Hence, differences in the expression of stress response genes between these sibs should reflect differences in stress perception processes. Ovules of both sibs were characterized by stress associated DEG and GO terms (Tables 4-7). For A151 ovules, DEG reflect a general perception and tolerance or suppression of drought stress (Table 4: 70-108), which is expected for high energy (glucose containing) tissues (135). In contrast, DEG characterizing 5264 ovules included genes associated with inflammatory responses, ABA, and other stress hormone pathways (Table 4: 110-137; 163-185).
[0550] The expression levels of two genes (Table 4: 139, 157) could explain the differences in SnRK TOR regulation as observed in our data. The first of these, a LAMMER-type protein kinase gene, sorghum ortholog of Arabidopsis FUS3-COMPLEMENTING GENE 2 (AFC2), is normally upregulated by ethylene and activates TORC1 by facilitating glucose signaling through spliceosomal activity of protein ARGININE/SERINE-RICH 45 (SR45) (133, 136) (
[0551] Two additional genes (Table 4: 70, 141), which regulate downstream processes in the SnRK TOR BR pathway, were also upregulated in A151. These suppress BR signaling downstream of TORC1 (
[0552] Apospory in A151 may have been caused by upregulated AFC2 and AIP1. However, the genes for these proteins were not linked to AES QTL. Moreover, ethylene upregulates AFC2 (139), and other ethylene regulated genes were also upregulated in A151 (Table 4: 140-143, 250). This suggests that A151 ovules may have produced more ethylene. In support of this, the stress/pathogen related MAPKKK5 was also upregulated in ovules of A151 (Table 4: 145). This kinase is upregulated by osmotic stress as well as BR signaling (140), both of which are consistent with A151 gene expression. MAPKKK5 increases ethylene biosynthesis by activating ATMAPK3 and ATMAPK6. These in turn activate by phosphorylation the ethylene synthesis enzyme 1-aminocyclopropane-1-carboxylic acid synthase (141). Accordingly, our data suggest that elevated glucose levels (possibly from increased beta oxidation of fatty acids), instead of a variant AFC2 allele, triggered the osmotic stress, glucose signaling, and ethylene signaling that differentiated A151 ovules from those of 5264. Ethylene signaling also maintains ROS homeostasis through ethylene response factors. These impart resistances to stress by triggering oxidative bursts that induce ROS scavenger production (142, 143). A comparison of ROS detoxification genes in A151 (Table 4: 71-78) with those in S264 (Table 4: 110-111, 125-126) suggests an enhanced ROS scavenging capability in A151. H.sub.2O.sub.2 produced by stress inactivates PP2C (87). This permits SnRK activation (by autophosphorylation) and subsequent silencing of TORC1 (
[0553] Meiosis in plants requires de novo RdDM, which generates a meiosis specific transcriptome in a cell-lineage-specific manner (130). We posited that i) stress or low-energy-activated SnRK are responsible for meiosis-specific RdDM in plant meiocytes and ii) metabolism-regulated stress avoidance in meiocytes stops meiosis and induces apomeiosis. Since our expression profiling data were not restricted to meiocytes, differences between sibs in gene expression associated with RdDM could not be assessed. However, nine DEG associated with small-RNA-regulated gene expression were detected. Three were upregulated in ovules of S264, and these participate in DNA acetylation, methylation and miRNA production (Table 4: 255-257). Two of the six genes upregulated in A151, HEAT INTOLERANT 4 and HISTONE 1.2 (H1.2) (Table 4: 246-247) suppress gene silencing and H1.2 also suppresses recombination (144, 145). These are functions that could reasonably occur as part of an apomeiosis program. The four remaining silencing-associated genes upregulated in A151 participate in DNA methylation or post transcriptional gene silencing (Table 4: 248-251).
[0554] Implications.
[0555] We metabolically induced high frequency apomeiosis in sexual Arabidopsis, Drummond's rockcress and cowpea. We have used similar procedures to induce parthenogenesis in Arabidopsis (106, 146). In each case, our approach was to i) silence the sexual pathway and upregulate growth by deactivating SnRK (
[0556] Herein, we associated apomixis sex switching with SnRK activation or silencing and the downstream processes of RdDM, TORC1 activation, and steroid signaling (
[0557] Apomeiosis in A151 was associated with upregulation of bioenergetically active genes and GO categories, whereas meiosis in 5264 was associated with gene silencing (Tables S4-7). Likewise, apomeiosis induction in Arabidopsis, rockcress and cowpea occurred readily when bioenergetics related metabolic processes were activated and/or when DNA methylation was prevented (
TABLE-US-00001 TABLE 1 Transgressive segregation among RIL for apospory and apospory associated traits (Texas and Utah combined). RIL parents RIL Trait IS3620C BTx 623 Min Max Mean AES 4.8 1.7 0 5.8 0.7 AI 8.0 2.0 0 22.1 3.1 LSC 33.8 2.1 0 39.5 7.4 TT 1.2 0.4 0 1.6 0.2 OC1 119 128 110 141 125 OC2 141 146 121 157 142
TABLE-US-00002 TABLE 2 QTL for apospory associated traits in the RIL population grown in Texas and Utah (combined). QTL Distance to SBI location Flanking marker nearest Additive Trait QTL name no. (cM) Left Right marker (cM) LOD R.sup.2 effect AI Qai.usu-1 1 28.8 phyC txa2084* 0.7 3.07 11.9 1.85 LSC Qlsc.usu-1.1 1 28.8 phyC txa2084* 0.7 2.9 9.0 3.75 AES Qaes.usu-1.1 1 29.5 phyC txa2084* 0.0 2.63 8.0 0.48 TT Qtt.usu-1 1 42.7 rz474* umc27 2.0 11.84 51.7 0.45 AES Qaes.usu-1.3 1 43.7 rz474 umc27* 1.5 10.34 49.6 1.70 OC2 Qoc2.usu-1.2 1 166.4 isu51 phyB* 0.0 2.51 5.6 1.56 OC1 Qoc1.usu-1.4 1 195.3 cdo1387 txp61* 0.0 3.08 5.3 1.46 OC1 Qoc1.usu-3.1 3 8.7 txa6154 umc121* 0.3 7.08 13.4 2.29 OC2 Qoc2.usu-3.1 3 9 txa6154 umc121* 0.0 4.11 9.7 2.02 OC1 Qoc1.usu-3.3 3 133.3 isu74.2 isu121* 0.0 3.15 5.4 1.54 OC2 Qoc2.usu-3.4 3 140 txa235* txa422 0.0 2.57 5.9 1.67 LSC Qlsc.usu-3 3 161.4 isu166 txa2027* 0.0 2.24 5.5 1.99 OC2 Qoc2.usu-6 6 23.9 txa4103* txa6233 1.0 3.67 8.9 1.99 AI Qai.usu-8 8 99.2 txa558 cdo459* 0.0 2.68 8.7 1.07 LSC Qlsc.usu-8 8 100.2 cdo459* txa6348 1.0 4.95 13.5 3.11 OC1 Qoc1.usu-9.2 9 111.7 txa3014* cdo89 2.0 5.03 9.3 1.91 OC2 Qoc2.usu-9.2 9 126.4 txa4122 umc135.2* 2.8 3.42 9.3 2.00 LSC Qlsc.usu-10.2 10 89.7 txa381 bnl5.04* 0.0 4.01 10.1 2.74 *Indicates closest marker to QTL R.sup.2: percentage of phenotypic variation explained by QTL Additive effect: positive implies that the low apospory parent BTx623 allele increased the phenotypic value, negative implies that the BTx623 allele decreased the phenotypic value
TABLE-US-00003 TABLE 3 QTL for apospory associated traits in the F.sub.2 population grown in Utah. QTL Distance to SBI location Flanking marker nearest Additive Trait QTL name no. (cM) Left Right marker (cM) LOD R.sup.2 effect AES Qaes.usu-1 1 48.865 M10* M11 18.0 12.8 17.8 1.02 PT Qpt.usu-1.1 1 49.865 M10* M11 19.0 39.1 36.7 0.31 PT Qpt.usu-1.2 1 118.864 M17 M18* 6.9 21.6 69.0 0.36 OV1 Qov1.usu-1 1 143.917 M20txp61 M21* 3.0 5.2 11.4 0.50 OV1 Qov1.usu-2.1 2 88.042 M36txp13 M37* 0.0 4.2 8.1 0.35 OV3 Qov3.usu-2 2 92.587 M38* M39txp1 2.0 4.3 9.6 2.59 OV1 Qov1.usu-2.2 2 152.127 M42txp207 M44txp8* 2.4 3.6 6.9 0.33 OV1 Qov1.usu-3 3 56.297 M54 M53* 0.0 3.6 7.2 0.12 OV2 Qov2.usu-4 4 101.179 M74* M75txp60 5.0 3.6 10.7 1.87 OV3 Qov3.usu-4 4 116.577 M74 M75txp60* 0.0 4.5 9.3 2.74 OC2 Qoc2.usu-4 4 127.577 M75txp60 M76* 4.2 6.6 15.2 1.94 OC1 Qoc1.usu-4 4 132.825 M76 M77* 0.7 9.1 14.7 2.66 AES Qaes.usu-5 5 0.000 M151* M152txa4096 0.0 12.0 17.0 0.89 TT Qtt.usu-5.1 5 43.052 M154 M155* 0.1 16.7 45.0 1.50 TT Qtt.usu-5.2 5 47.341 M158* M156 0.0 17.2 44.9 1.65 AES Qaes.usu-6.1 6 42.86 M142txa4032* M143txp274 0.0 9.3 29.1 2.35 LSC Qlsc.usu-6 6 93.851 M146 M147* 0.1 8.6 20.4 33.44 OC1 Qoc1.usu-6 6 98.923 M147 M148* 3.6 5.5 10.5 2.77 OC2 Qoc22.usu-6 6 99.923 M147 M148* 2.6 4.2 10.0 1.99 AES Qaes.usu-6.2 6 108.006 M149txp17* M150 1.0 4.5 5.0 1.24 OC2 Qoc2.usu-7 7 97.298 M92txa4088 M93* 1.4 4.8 19.2 4.33 OV2 Qov2.usu-7 7 104.614 M94* M95txp295 1.0 3.7 8.9 1.70 OC1 Qoc1.usu-8 8 82.929 M128txp354 M129txp18* 1.3 6.6 10.9 2.47 OC1 Qoc1.usu-10 10 61.033 M111txp217 M112txp130* 1.3 4.6 7.4 1.92 *Indicates closest marker to QTL R.sup.2: percentage of phenotypic variation explained by QTL Additive effect: positive implies that the low apospory parent allele increased the phenotypic value, negative implies that the low apospory parent allele decreased the phenotypic value
TABLE-US-00004 TABLE 4
indicates data missing or illegible when filed
TABLE-US-00005 TABLE 5 Enriched GO terms (FDR 0.05) based on average A151 to S264 expression ratios (all detected genes per GO category) for each stage separately and for all stages combined. Significant GO terms were not detected at the meiocyte stage. Early MMC Mid ES All stages combined Line Up (+) or down () Up (+) or down () Up (+) or down () no. GO term Genes in A151 P value FDR in A151 P value FDR in A151 P value FDR 1 Biological Process 2 Cellular protein and macromolecule processes 3 cellular protein metabolic process (GO: 0044267) 884 + 7.24E06 1.51E03 + 1.96E04 2.84E02 4 cellular macromolecule metabolic process 1157 + 2.94E05 4.26E03 + 1.86E04 2.98E02 (GO: 0044260) 5 macromolecule metabolic process (GO: 0043170) 1477 + 5.50E05 6.93E03 6 protein metabolic process (GO: 0019538) 974 + 1.01E05 1.87E03 + 1.14E04 2.27E02 7 organonitrogen compound metabolic process 1363 + 1.11E04 1.26E02 + 1.19E04 2.27E02 (GO: 1901564) 8 nitrogen compound metabolic process 1790 + 1.93E04 1.97E02 9 cellular macromolecule biosynthetic process 404 + 3.29E08 2.62E05 + 3.99E06 3.18E03 + 1.21E08 9.62E06 (GO: 0034645) 10 macromolecule biosynthetic process 416 + 6.31E08 3.36E05 + 1.90E05 1.01E02 + 6.39E08 4.37E05 11 peptide biosynthetic process (GO: 0043043) 204 + 1.84E12 8.82E09 + 4.50E08 2.16E04 + 2.09E11 9.99E08 12 peptide metabolic process (GO: 0006518) 228 + 5.00E12 7.98E09 + 4.03E07 4.82E04 + 5.94E11 9.49E08 13 cellular amide metabolic process (GO: 0043603) 277 + 5.88E10 5.63E07 + 1.69E06 1.62E03 + 1.86E09 1.78E06 14 cellular nitrogen compound metabolic process 942 + 4.22E06 9.62E04 + 1.06E05 4.63E03 (GO: 0034641) 15 organonitrogen compound biosynthetic process 510 + 2.47E06 6.96E04 + 2.69E05 1.29E02 + 4.22E07 2.25E04 (GO: 1901566) 16 amide biosynthetic process (GO: 0043604) 232 + 8.70E11 1.04E07 + 1.19E07 1.90E04 + 3.75E10 4.49E07 17 cellular nitrogen compound biosynthetic process 449 + 4.85E07 2.32E04 + 1.88E05 1.12E02 + 8.44E08 5.05E05 (GO: 0044271) 18 Gene expression 19 gene expression (GO: 0010467) 531 + 5.32E08 3.18E05 + 2.05E06 9.81E04 20 translation (GO: 0006412) + 4.50E08 1.08E04 + 2.09E11 4.99E08 21 Intracellular transport and localization 22 cellular protein localization (GO: 0034613) 246 + 2.76E05 4.13E03 + 1.77E04 2.93E02 23 protein localization (GO: 0008104) 290 + 1.44E05 2.46E03 + 1.03E04 2.23E02 24 macromolecule localization (GO: 0033036) 355 + 2.26E04 2.25E02 25 cellular macromolecule localization (GO: 0070727) 255 + 3.96E05 5.42E03 + 2.23E04 3.14E02 26 intracellular transport (GO: 0046907) 259 + 2.56E04 2.40E02 27 establishment of localization in cell (GO: 0051649) 272 + 2.27E04 2.21E02 28 protein transport (GO: 0015031) 258 + 2.95E06 7.85E04 + 2.98E05 9.51E03 29 establishment of protein localization (GO: 0045184) 260 + 3.67E06 8.77E04 + 3.69E05 1.10E02 30 peptide transport (GO: 0015833) 277 + 1.84E04 1.92E02 31 amide transport (GO: 0042886) 285 + 5.19E04 4.28E02 32 Ribosome complex processes 33 ribonucleoprotein complex assembly 64 + 9.84E07 3.62E04 + 1.35E04 2.40E02 34 ribonucleoprotein complex subunit organization 66 + 4.52E06 9.84E04 (GO: 0071826) 35 protein-containing complex subunit organization 202 + 2.04E06 6.51E04 (GO: 0043933) 36 cellular component organization (GO: 0016043) 808 + 1.15E04 1.28E02 37 cellular component organization or biogenesis 923 + 4.39E05 5.84E03 (GO: 0071840) 38 ribonucleoprotein complex biogenesis 170 + 1.37E06 4.68E04 39 cellular component biogenesis (GO: 0044085) 408 + 9.69E06 1.85E03 + 1.80E05 6.17E03 40 cellular protein-containing complex assembly 147 + 3.51E08 2.40E05 + 1.44E05 5.75E03 (GO: 0034622) 41 protein-containing complex assembly 172 + 8.69E07 3.46E04 + 9.29E05 2.22E02 42 cellular component assembly (GO: 0022607) 243 + 3.03E05 4.27E03 + 9.88E05 2.25E02 43 ribosomal large subunit biogenesis (GO: 0042273) 31 + 2.13E05 3.28E03 44 ribosome biogenesis (GO: 0042254) 133 + 1.87E05 2.98E03 45 ribosome assembly (GO: 0042255) 25 + 5.37E07 2.34E04 46 organelle assembly (GO: 0070925) 52 + 2.52E04 2.41E02 47 organelle organization (GO: 0006996) 530 + 4.10E04 3.57E02 48 Proteasomal processes 49 proteasomal protein catabolic process 82 + 1.58E04 1.68E02 (GO: 0010498) 50 proteolysis involved in cellular protein catabolic 193 + 8.41E05 1.01E02 + 3.53E04 4.69E02 process (GO: 0051603) 51 proteolysis (GO: 0006508) 318 + 3.56E04 3.21E02 52 cellular protein catabolic process (GO: 0044257) 198 + 5.10E05 6.60E03 + 1.94E04 2.90E02 53 cellular macromolecule catabolic process 248 + 4.97E04 4.18E02 (GO: 0044265) 54 macromolecule catabolic process (GO: 0009057) 291 + 4.26E04 3.64E02 55 protein catabolic process (GO: 0030163) 218 + 1.28E05 2.26E03 + 1.71E05 6.29E03 56 organonitrogen compound catabolic process 291 + 1.25E04 1.37E02 + 7.58E05 1.91E02 (GO: 1901565) 57 ubiquitin-dependent protein catabolic process 156 + 1.76E05 2.91E03 (GO: 0006511) 58 modification-dependent protein catabolic process 162 + 2.23E06 6.67E04 + 5.23E05 1.39E02 (GO: 0019941) 59 modification-dependent macromolecule catabolic 165 + 8.00E06 1.60E03 + 1.14E04 2.37E02 process (GO: 0043632) 60 Chemotaxis processes 61 positive chemotaxis (GO: 0050918) 9 6.44E04 5.06E02 62 chemotaxis (GO: 0006935) 9 6.44E04 4.90E02 63 taxis (GO: 0042330) 9 6.44E04 5.14E02 64 Molecular Function 65 Structural molecule activity 66 structural molecule activity (GO: 0005198) 162 + 0.00E+00 0.00E+00 + 1.54E09 3.56E06 67 Nucleic acid binding 68 RNA binding (GO: 0003723) 433 + 5.51E07 3.18E04 69 nucleic acid binding (GO: 0003676) 859 + 8.84E05 1.70E02 70 organic cyclic compound binding (GO: 0097159) 1559 + 1.35E05 6.21E03 71 binding (GO: 0005488) 2792 + 3.65E04 4.21E02 72 heterocyclic compound binding (GO: 1901363) 1554 + 1.79E05 6.90E03 73 guanyl ribonucleotide binding (GO: 0032561) 87 + 9.00E05 1.60E02 74 guanyl nucleotide binding (GO: 0019001) 87 + 9.00E05 1.22E02 75 purine ribonucleoside binding (GO: 0032550) 87 + 9.00E05 1.48E02 76 purine nucleoside binding (GO: 0001883) 87 + 9.00E05 1.39E02 77 nucleoside binding (GO: 0001882) 89 + 8.46E05 1.78E02 78 ribonucleoside binding (GO: 0032549) 89 + 8.46E05 1.95E02 79 Cellular Component 80 Cytosole components 81 cytosolic part (GO: 0044445) 133 + 1.11E16 3.29E14 + 2.38E10 2.11E07 82 cytosol (GO: 0005829) 981 + 4.52E10 3.35E08 + 3.02E06 4.47E04 83 Ribosome components 84 large ribosomal subunit (GO: 0015934) 58 + 7.72E10 4.90E08 + 4.70E06 5.96E04 85 ribosomal subunit (GO: 0044391) 99 + 2.22E16 4.93E14 + 2.12E09 6.28E07 86 ribonucleoprotein complex (GO: 1990904) 331 + 2.13E13 3.15E11 + 2.99E04 1.66E02 87 protein-containing complex (GO: 0032991) 1089 + 0.00E+00 0.00E+00 + 8.43E06 9.35E04 88 intracellular organelle part (GO: 0044446) 1964 + 1.59E07 7.04E06 89 organelle part (GO: 0044422) 1966 + 1.27E07 6.26E06 90 ribosome (GO: 0005840) 155 + 1.55E15 2.76E13 + 7.61E09 1.69E06 91 intracellular non-membrane-bounded organelle 537 + 2.36E11 2.99E09 + 4.63E05 4.56E03 (GO: 0043232) 92 non-membrane-bounded organelle (GO: 0043228) 537 + 2.36E11 2.62E09 + 4.63E05 4.11E03 93 cytosolic ribosome (GO: 0022626) 112 + 1.11E16 4.93E14 + 4.14E10 1.84E07 94 small ribosomal subunit (GO: 0015935) 41 + 3.10E08 1.84E06 + 9.68E05 7.16E03 95 Nuclear components 96 nuclear lumen (GO: 0031981) 351 + 2.41E07 1.02E05 97 intracellular organelle lumen (GO: 0070013) 441 + 1.38E10 1.36E08 + 2.18E04 1.49E02 98 organelle lumen (GO: 0043233) 441 + 1.38E10 1.12E08 + 2.18E04 1.29E02 99 membrane-enclosed lumen (GO: 0031974) 441 + 1.38E10 1.23E08 + 2.18E04 1.38E02 100 nuclear part (GO: 0044428) 470 + 4.40E07 1.50E05 101 Mitochondrial components 102 mitochondrial respirasome (GO: 0005746) 43 + 2.85E07 1.15E05 103 mitochondrial inner membrane (GO: 0005743) 118 + 4.56E04 1.01E02 104 mitochondrial membrane (GO: 0031966) 136 + 2.19E04 5.56E03 105 organelle membrane (GO: 0031090) 700 + 1.62E03 2.94E02 106 mitochondrial envelope (GO: 0005740) 145 + 3.31E04 7.95E03 107 mitochondrial part (GO: 0044429) 209 + 2.92E07 1.08E05 + 4.81E04 2.51E02 108 respirasome (GO: 0070469) 50 + 5.51E06 1.75E04 109 mitochondrial membrane part (GO: 0044455) 90 + 4.81E06 1.58E04 110 respiratory chain complex I (GO: 0045271) 32 + 8.61E06 2.47E04 111 respiratory chain complex (GO: 0098803) 43 + 2.85E07 1.10E05 112 membrane protein complex (GO: 0098796) 258 + 2.82E05 7.36E04 113 NADH dehydrogenase complex (GO: 0030964) 32 + 8.61E06 2.64E04 114 catalytic complex (GO: 1902494) 370 + 9.12E06 2.53E04 115 inner mitochondrial membrane protein complex 66 + 3.31E07 1.18E05 (GO: 0098800) 116 mitochondrial protein complex (GO: 0098798) 86 + 1.27E07 5.94E06 117 oxidoreductase complex (GO: 1990204) 60 + 4.38E04 9.98E03 118 Symplast components 119 symplast (GO: 0055044) 338 + 5.23E04 1.08E02 120 Cell junction components 121 cell-cell junction (GO: 0005911) 338 + 5.23E04 1.11E02 122 cell junction (GO: 0030054) 338 + 5.23E04 1.06E02 123 Proteasome components 124 endopeptidase complex (GO: 1905369) 39 + 7.40E04 1.43E02 125 peptidase complex (GO: 1905368) 45 + 4.19E04 9.79E03 126 Endomembrane components 127 endomembrane system (GO: 0012505) 792 + 3.30E04 8.13E03
TABLE-US-00006 TABLE 6 GO terms overrepresented (FDR 0.05) by DEG upregulated in A151 for each stage separately and for all stages combined. Significant GO terms were not detected at the meiocyte stage. Early MMC Line Raw P no. GO term Obs. Exp. value FDR 1 Biological Process 2 Response to Stimuli 3 response to cytokinin 8 0.9 2.78E06 3.29E03 4 negative regulation of response to stimulus 5 Gene expression 6 translation 12 2.0 1.09E06 3.21E03 7 cellular protein metabolic process 25 10.5 4.42E05 2.01E02 8 cellular macromolecule metabolic process 29 14.0 1.21E04 3.77E02 9 cellular metabolic process 48 26.1 3.24E06 3.20E03 10 cellular process 61 37.5 2.46E06 3.64E03 11 metabolic process 49 30.0 7.47E05 2.45E02 12 protein metabolic process 26 11.6 6.57E05 2.29E02 13 organonitrogen compound metabolic process 32 15.7 4.72E05 1.99E02 14 cellular macromolecule biosynthetic process 15 4.4 3.82E05 1.88E02 15 macromolecule biosynthetic process 15 4.6 5.45E05 2.15E02 16 peptide biosynthetic process 12 2.1 1.19E06 2.34E03 17 peptide metabolic process 12 2.3 4.30E06 3.18E03 18 cellular amide metabolic process 13 2.8 4.57E06 3.00E03 19 cellular nitrogen compound metabolic process 25 10.8 6.12E05 2.26E02 20 organonitrogen compound biosynthetic process 17 5.0 1.12E05 6.00E03 21 amide biosynthetic process 13 2.3 5.07E07 3.00E03 22 cellular nitrogen compound biosynthetic process 17 4.6 3.67E06 3.10E03 23 gene expression 18 5.5 9.78E06 5.78E03 24 Molecular Function 25 Ribosome function 26 structural constituent of ribosome 9 1.3 8.20E06 1.26E02 27 structural molecule activity 10 1.8 1.77E05 1.81E02 28 Binding 29 binding 63 36.3 1.03E07 3.15E04 30 Cellular Component 31 Ribosome components 32 cytosolic small ribosomal subunit 6 0.4 3.20E06 5.72E04 33 small ribosomal subunit 7 0.5 6.93E07 3.71E04 34 ribosomal subunit 9 1.2 3.31E06 5.07E04 35 ribonucleoprotein complex 13 3.3 2.97E05 2.12E03 36 protein-containing complex 28 11.5 5.58E06 7.48E04 37 cytoplasmic part 64 44.9 1.76E04 7.27E03 38 cytoplasm 70 53.2 8.99E04 3.44E02 39 intracellular organelle part 41 19.6 8.84E07 3.16E04 40 organelle part 41 19.6 9.02E07 2.42E04 41 ribosome 10 1.7 9.60E06 9.36E04 42 intracellular non-membrane-bounded organelle 17 6.1 1.13E04 5.03E03 43 non-membrane-bounded organelle 17 6.1 1.13E04 4.83E03 44 cytosolic ribosome 9 1.1 2.57E06 5.52E04 45 cytosolic part 9 1.3 7.03E06 8.37E04 46 cytosol 35 8.4 1.12E13 1.20E10 47 Mitochondrial components 48 respirasome 4 0.5 1.30E03 4.63E02 49 membrane 46 28.4 2.15E04 8.54E03 50 mitochondrial part 8 2.0 9.26E04 3.42E02 51 Vacuole components 52 vacuolar membrane 10 2.3 1.08E04 5.27E03 53 whole membrane 13 3.5 5.40E05 2.89E03 54 vacuolar part 10 2.3 1.12E04 5.24E03 55 vacuole 15 4.0 1.13E05 9.34E04 56 bounding membrane of organelle 15 4.6 5.40E05 2.76E03 57 organelle membrane 19 6.6 2.71E05 2.07E03 58 Plasma membrane components 59 plasmodesma 13 3.5 4.81E05 3.22E03 60 symplast 13 3.5 4.81E05 3.03E03 61 cell-cell junction 13 3.5 4.91E05 2.92E03 62 cell junction 13 3.5 4.91E05 2.77E03 63 plasma membrane 30 13.0 8.41E06 9.01E04 64 cell periphery 33 15.4 1.06E05 9.48E04 65 Nuclear components 66 nucleolus 67 nuclear lumen 68 intracellular organelle lumen 69 organelle lumen 70 membrane-enclosed lumen 71 organelle part 72 Chloroplast components 73 chloroplast part 74 plastid part Mid ES All stages combined Line Raw P Raw P no. Obs. Exp. value FDR Obs. Exp. value FDR 1 2 3 4 6 0.5 1.52E05 4.48E02 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 20 8.4 1.67E04 1.63E02 37 52 32.9 9.76E06 1.74E03 38 55 39.0 1.63E04 1.74E02 39 36 14.3 1.44E08 1.54E05 40 41 42 43 44 45 46 18 6.1 2.75E05 4.21E03 47 48 49 50 7 1.5 6.67E04 4.47E02 51 52 53 54 55 56 57 58 59 60 61 62 63 22 9.6 1.50E04 1.79E02 64 24 11.3 2.36E04 2.11E02 65 66 8 1.2 3.43E05 4.60E03 67 10 2.7 3.85E04 3.18E02 68 15 3.3 9.43E07 3.37E04 69 15 3.3 9.43E07 2.02E04 70 15 3.3 9.43E07 2.53E04 71 36 14.4 1.48E08 7.92E06 72 73 12 3.8 4.26E04 3.26E02 74 12 3.9 5.00E04 3.57E02
TABLE-US-00007 TABLE 7 GO terms overrepresented (FDR 0.05) by DEG downregulated in A151 for each stage separately and for all stages combined. Significant GO terms were not detected across stages. Early MMC Meiocyte Mid ES Line Raw P Raw P Raw P no. GO term Obs. Exp. value FDR Obs. Exp. value FDR Obs. Exp. value FDR 1 Cellular Component 2 Chloroplast component 3 chloroplast 36 17.3 5.71E06 3.06E03 4 plastid 37 17.5 2.85E06 3.05E03 5 cytoplasm 66 47.9 1.32E04 4.72E02 6 Vacuole component 7 vacuolar membrane 4 0.2 4.97E05 5.33E02 8 vacuolar part 4 0.2 5.07E05 2.72E02 9 Mitosis components 10 nucleosome 2 0.0 1.38E04 4.92E02 11 DNA packaging complex 2 0.0 1.67E04 4.49E02 12 preprophase band 2 0.0 1.68E04 4.50E02 13 microtubule cytoskeleton 4 0.3 1.46E04 5.21E02 14 cytoskeletal part 4 0.3 2.46E04 5.27E02 15 intracellular organelle part 14 5.4 2.65E04 4.74E02 16 organelle part 14 5.4 2.68E04 4.11E02 17 cortical microtubule 2 0.0 3.69E04 4.94E02 cytoskeleton 18 phragmoplast 4 0.1 1.78E06 1.91E03 19 spindle 3 0.1 7.28E05 3.90E02
TABLE-US-00008 TABLE 8 RIL framework markers. CS Name LOD cM LG-01 txa3383 22.5 0.0 LG-01 txa2704 29.6 2.6 LG-01 isu63.2 9.17 7.6 LG-01 txa6198 30 8.4 LG-01 txa6003 36.93 8.4 LG-01 umc84 20.94 11.9 LG-01 cdo457 28.14 13.2 LG-01 txa3632 36.33 13.2 LG-01 isu70 26.42 16.1 LG-01 txa6286 25.59 19.0 LG-01 txa3257 32.83 19.8 LG-01 txp208 24.76 23.4 LG-01 txs1082 31.95 24.4 LG-01 phyC 32.37 24.8 LG-01 txp325 28.46 26.5 LG-01 txa2084 32.3 29.5 LG-01 txa3488 32.01 30.6 LG-01 txp302 31.9 31.7 LG-01 cdo121 31.32 33.3 LG-01 txa357 23.31 38.2 LG-01 rz474 23.9 40.7 LG-01 txs1075.1 28.53 42.4 LG-01 isu76 28.18 45.2 LG-01 umc27 37.23 45.2 LG-01 txa3953 29.03 48.5 LG-01 txa3126 19.05 54.8 LG-01 txa4031 27.56 61.7 LG-01 txa2615 23.12 66.1 LG-01 umc166 22.71 70.1 LG-01 txa2655 24.07 73.9 LG-01 txa2217 32.18 75.5 LG-01 txa6133 40.23 75.5 LG-01 umc124.3 28.35 78.2 LG-01 txa6014 37.13 78.6 LG-01 txa440 31.72 80.4 LG-01 umc115 29.9 81.6 LG-01 txa3411 36.33 83.5 LG-01 txa2847 29.03 86.1 LG-01 txa3334 37.42 86.5 LG-01 umc167 89.4 LG-01 txs361.1 22.77 93.7 LG-01 txa2091 26.75 95.5 LG-01 txa42 25.65 97.5 LG-01 txa2285 26.01 100.6 LG-01 isu73 25.45 103.4 LG-01 txa148 23.23 107.8 LG-01 txa2623 27.09 109.6 LG-01 txa6185 30.78 110.5 LG-01 txa6297 37.53 110.5 LG-01 cdo20 27.67 112.4 LG-01 txa216 26.23 114.3 LG-01 txa494 21.85 117.4 LG-01 isu165 120.0 LG-01 txa2059 21.13 124.3 LG-01 txa243 24.67 127.8 LG-01 txa2355 38.43 127.8 LG-01 txa2644 36.83 128.2 LG-01 txa2609 28.25 130.0 LG-01 txa6334 25.89 132.6 LG-01 txa6277 24.49 136.6 LG-01 txa2658 28.17 138.6 LG-01 rz251 28.53 139.9 LG-01 txa3812 29.69 141.3 LG-01 txa6088 32.54 144.9 LG-01 txs1225 21.66 149.7 LG-01 umc95 21.13 153.8 LG-01 txp58 25.73 156.3 LG-01 txa4021 23.27 160.1 LG-01 txa3826 24.52 163.4 LG-01 cdo938 33.03 163.4 LG-01 isu51 27.05 165.5 LG-01 phyB 31.66 166.4 LG-01 txp75 28.24 168.8 LG-01 txp279 26.03 172.3 LG-01 txa2837 26.42 175.4 LG-01 txa3660 25.86 178.4 LG-01 txa4101 27.89 180.3 LG-01 txa6208 28.46 182.3 LG-01 txa2304 31.72 183.6 LG-01 txa203 38.73 183.6 LG-01 txa3580 26.97 186.4 LG-01 txa3795 25.86 189.2 LG-01 cdo1387 25.36 190.6 LG-01 txa6057 23.96 193.3 LG-01 txa4241 32.54 194.1 LG-01 txp61 31.43 195.3 LG-01 txa4149 33.12 196.0 LG-01 txa6215 18.96 203.7 LG-01 txa200 29.69 205.5 LG-01 txa3629 35.73 205.5 LG-01 txa298 23.9 209.8 LG-01 txp319 31.14 211.3 LG-01 rz329 29.6 213.0 LG-01 txa3958 31.95 213.9 LG-01 umc157 217.7 LG-01 txa2945 31.07 218.4 LG-01 txp340 29.98 219.6 LG-01 txa6274 27.12 223.7 LG-01 rz273 21.48 228.1 LG-01 txa3303 22.68 231.6 LG-02 txa2851 25.49 0.0 LG-02 txs1267 32.88 5.3 LG-02 txs1573.2 33.93 5.3 LG-02 txp63 7.46 7.5 LG-02 txa3726 34.75 7.9 LG-02 txa472 25.04 11.1 LG-02 txa3341 20.93 16.4 LG-02 txa591 25.21 20.4 LG-02 txa3329 28.18 23.1 LG-02 isu67 25.5 LG-02 txa6150 23.39 30.0 LG-02 txp211 35.13 30.0 LG-02 txa6355 26.57 32.9 LG-02 txa3547 30.16 34.8 LG-02 txa2501 28.18 36.7 LG-02 txa55 25.73 39.1 LG-02 txa2142 34.75 39.5 LG-02 txa2717 26.97 42.6 LG-02 txa3604 29.88 44.5 LG-02 txa3451 27.9 48.5 LG-02 txs1891 50.8 LG-02 txa280 25.61 52.6 LG-02 txa2792 20.87 56.9 LG-02 txa414 33.46 58.0 LG-02 isu97.2 26.49 60.3 LG-02 isu71 32.67 60.8 LG-02 txa426 30.85 62.4 LG-02 txa172 32.59 63.6 LG-02 txa609 32.01 64.8 LG-02 txa251 23.12 68.3 LG-02 isu151 71.0 LG-02 txa4071 24.8 73.3 LG-02 txa3358 26.57 75.7 LG-02 txa2724 39.03 75.7 LG-02 txa3648 39.33 75.7 LG-02 txa602 29.6 77.3 LG-02 txa2832 37.23 77.3 LG-02 txa211 39.03 77.3 LG-02 txa3697 30.75 78.9 LG-02 txp13 26.39 79.7 LG-02 isu94 27.33 82.2 LG-02 txa6074 16.58 89.7 LG-02 umc88.1 33.93 90.0 LG-02 txa2201 34.75 90.4 LG-02 txa2008 32.54 91.7 LG-02 txa2159 33.42 92.5 LG-02 txa3763 28.18 94.9 LG-02 umc139 26.49 97.6 LG-02 txa6138 24.13 101.1 LG-02 txa3420 34.59 101.9 LG-02 txa2616 28.8 104.3 LG-02 txa2514 39.33 104.3 LG-02 txa3397 39.63 104.3 LG-02 txa3153 25.21 107.8 LG-02 txa409 25.73 110.4 LG-02 txs1111 24.52 113.9 LG-02 umc5 32.24 114.8 LG-02 txp56 23.53 118.5 LG-02 txa481 24.8 121.0 LG-02 txa612 22.03 124.6 LG-02 txa6165 32.97 125.0 LG-02 txa3866 30.78 126.1 LG-02 txa6164 30.48 127.2 LG-02 isu117 129.3 LG-02 isu43 27.89 131.9 LG-02 txs645.1 37.23 131.9 LG-02 umc22.1 30.27 134.1 LG-02 txa6076 36.63 134.1 LG-02 umc88.2 31.48 134.5 LG-02 txa264 30.78 137.1 LG-02 txa598 23.39 141.1 LG-02 cdo385 23.31 145.2 LG-02 txa6045 27.4 148.0 LG-02 umc4 24.9 151.2 LG-02 txa313 25.08 153.8 LG-02 txa6115 33.12 154.6 LG-02 umc149 157.5 LG-02 txp207 28.17 159.9 LG-02 txa6338 33.26 160.4 LG-02 txs1845 34.15 160.8 LG-02 umc125 17.62 168.3 LG-02 umc122 22.96 171.2 LG-02 bnl8.37 30.89 171.7 LG-02 rz395 25.17 175.4 LG-02 isu75.2 27.05 178.2 LG-02 txs283 180.5 LG-02 txa6117 23.04 184.2 LG-02 isu123.2 23.04 187.5 LG-02 bnl16.06 24.34 189.9 LG-02 txp8 21.43 193.4 LG-02 txa311 22.5 196.9 LG-02 txa493 20.63 201.5 LG-02 txa6044 28.53 202.9 LG-02 txs1610 26.46 205.0 LG-03 txa3395 25.21 0.0 LG-03 txa2580 30.85 1.9 LG-03 txa3461 28.8 4.3 LG-03 txa6154 36.53 4.7 LG-03 txa2105 7.32 6.6 LG-03 umc121 25.45 9.0 LG-03 txs1178 28.17 11.9 LG-03 txa4134 22.77 15.2 LG-03 txa376 26.8 16.7 LG-03 umc124.1 23.67 20.3 LG-03 txa3498 32.67 20.8 LG-03 txa6160 29.89 22.4 LG-03 txa6272 27.8 25.2 LG-03 txa2734 26.01 28.6 LG-03 txa2614 29.32 31.6 LG-03 txs1092 33.3 LG-03 txa3003 21.66 37.4 LG-03 txa2096 29.03 39.4 LG-03 txa2714 29.59 41.4 LG-03 txa3848 29.88 43.4 LG-03 txa3552 19.8 49.4 LG-03 txa2546 28.52 51.8 LG-03 txa267 28.53 53.3 LG-03 txa29 27.03 55.3 LG-03 txa30 36.83 55.7 LG-03 txa3021 28.24 58.1 LG-03 txa2260 39.33 58.1 LG-03 txa3837 25.21 61.6 LG-03 txa2899 24.13 65.1 LG-03 txs578 68.3 LG-03 isu148 24.13 71.8 LG-03 txa2171 25.17 74.4 LG-03 umc152.1 26.75 76.1 LG-03 rz244 23.67 79.5 LG-03 cdo920 25.36 81.9 LG-03 isu114 25.08 84.3 LG-03 txa3261 24.21 88.2 LG-03 txa4054 28.18 90.6 LG-03 txp183 21.03 94.0 LG-03 txa2735 18.96 98.8 LG-03 txa2607 25.31 102.6 LG-03 txa4106 28.14 104.8 LG-03 txa6309 32.54 105.9 LG-03 umc93 27.61 108.2 LG-03 umc63 36.33 108.2 LG-03 txp120 27.68 110.9 LG-03 txa2595 37.53 111.6 LG-03 txa2074 34.59 111.6 LG-03 cdo1160 15.62 118.4 LG-03 txa2110 20.35 125.2 LG-03 txa389 35.43 125.2 LG-03 txs1175 28.17 127.5 LG-03 isu74.2 30.19 128.6 LG-03 cdo470 26.51 130.1 LG-03 txa4019 28.25 133.3 LG-03 isu121 34.53 133.3 LG-03 umc17 36.33 134.7 LG-03 txa2984 32.08 135.6 LG-03 txa235 20.87 140.0 LG-03 txa2961 26.01 142.5 LG-03 txa2877 30.85 144.4 LG-03 txs422 31.66 145.5 LG-03 txs1927 38.13 145.5 LG-03 bnl15.20 29.03 147.3 LG-03 bcd738 21.73 149.1 LG-03 txa4063 28.17 149.1 LG-03 txa2986 32.59 150.3 LG-03 txa2937 28.17 151.9 LG-03 isu166 156.2 LG-03 txa2271 22.77 158.3 LG-03 txa2027 20.76 161.4 LG-03 txa6283 23.58 165.1 LG-03 txa2051 28.74 166.9 LG-03 txa3448 28.18 169.0 LG-03 isu68 174.5 LG-03 txa3891 23.39 177.4 LG-03 txa3610 27.4 179.8 LG-03 txa2056 24.67 183.0 LG-03 txa3904 31.36 183.8 LG-03 txa4073 31.95 184.6 LG-03 txa341 18.41 190.0 LG-03 txa3859 24.9 192.5 LG-03 isu52.1 16.71 198.5 LG-03 txa4138 22.2 202.4 LG-03 txi5 35.43 202.4 LG-04 txa2353 14.17 0.0 LG-04 isu61.3 21.97 5.0 LG-04 txs754 22.2 9.7 LG-04 txa50 25.17 12.5 LG-04 txa2605 29.32 14.2 LG-04 txa3921 30.56 15.5 LG-04 txa3997 31.19 17.5 LG-04 txa3882 29.03 19.1 LG-04 txa6 25.92 22.3 LG-04 txa2348 30.27 24.0 LG-04 txa6339 30.45 25.9 LG-04 umc40.2 16.45 33.8 LG-04 txa4132 25.92 36.4 LG-04 isu56 43.1 LG-04 txa3854 33.63 43.1 LG-04 txa495 16.41 48.6 LG-04 txa2669 31.23 48.6 LG-04 txa4212 28.25 50.5 LG-04 txa6268 29.03 52.7 LG-04 txa4036 37.23 52.7 LG-04 txa257 20.63 57.7 LG-04 txa2204 18.96 63.7 LG-04 txa2178 24.4 67.3 LG-04 txa3537 20.37 72.5 LG-04 txa345 24.67 75.8 LG-04 txa548 15.62 82.9 LG-04 txa2577 34.45 83.3 LG-04 txa3796 32.3 84.4 LG-04 txa3955 29.32 85.9 LG-04 txa2029 27.12 88.2 LG-04 txa6172 36.93 88.2 LG-04 txa6285 38.13 88.2 LG-04 txa6166 39.33 88.2 LG-04 txs1146.2 38.43 88.2 LG-04 txa4011 34.45 88.6 LG-04 txa6189 35.94 89.7 LG-04 txa6258 30.75 91.6 LG-04 txa2085 30.73 93.5 LG-04 txp12 94.1 LG-04 txa218 18.55 100.5 LG-04 txa2095 13.37 110.4 LG-04 isu42 26.49 112.4 LG-04 txa2017 24.52 117.9 LG-04 umc54 120.6 LG-04 isu132 25.73 123.8 LG-04 txp24 31.78 124.4 LG-04 isu35 28.46 126.9 LG-04 txs604 26.01 129.9 LG-04 txa516 26.14 133.5 LG-04 txa2068 35.77 134.2 LG-04 txa6013 26.97 137.8 LG-04 txa4016 29.98 139.4 LG-04 txp51 25.86 142.4 LG-04 txa2706 26.29 147.2 LG-04 txa6257 38.43 147.2 LG-04 txa6269 27.4 150.1 LG-04 bec1427 26.46 152.6 LG-04 cdo516.1 25.61 155.0 LG-04 txs1103 157.6 LG-04 txp21 18.03 165.4 LG-04 txa2633 27.9 167.6 LG-04 umc104 16.71 174.4 LG-05 txa3948 26.77 0.0 LG-05 isu84.2 20.89 2.9 LG-05 txa160 34.45 4.1 LG-05 txa518 27.9 5.7 LG-05 txa4199 27.33 8.4 LG-05 txa6065 35.64 10.8 LG-05 txp65 11.2 LG-05 txa2037 18.16 18.7 LG-05 txp94 20.48 24.0 LG-05 txa2893 26.42 26.7 LG-05 txs722 37.53 26.7 LG-05 txa350 25.51 29.2 LG-05 txa6047 30.18 31.3 LG-05 txa3190 33.17 32.4 LG-05 txa6284 32.01 33.5 LG-05 txa4135 32.83 34.2 LG-05 txa2284 28.74 35.8 LG-05 umc52 9.9 41.0 LG-05 txa2256 11.71 50.1 LG-05 txa2545 37.23 50.1 LG-05 isu120 22.57 53.6 LG-05 txp225 18.03 56.9 LG-05 txa3429 25.36 58.2 LG-05 txa2038 27.24 61.1 LG-05 txa169 23.04 64.8 LG-05 txa507 29.03 67.0 LG-05 isu36.2 34.75 68.2 LG-05 isu59 37.23 68.2 LG-05 txa6216 38.13 68.2 LG-05 txa6278 39.93 68.2 LG-05 txa68 34.89 68.9 LG-05 txa2141 26.42 71.8 LG-05 txa290 20.42 77.0 LG-05 txa3444 34 77.8 LG-05 txa324 32.54 78.6 LG-05 txa2152 29.02 79.5 LG-05 txa4081 22.73 83.7 LG-05 txa2071 33.71 84.5 LG-05 txa3452 39.63 84.5 LG-05 txa3886 31.04 86.1 LG-05 txp23 24.07 90.0 LG-05 txa3109 24.88 93.7 LG-05 txa3398 22.5 98.1 LG-05 txa2093 34.53 98.1 LG-05 txa2323 18.12 106.7 LG-05 txa221 36.93 106.7 LG-05 txa2836 27.05 113.9 LG-05 txp123 115.8 LG-05 txa6092 33.42 116.2 LG-05 txp136 25.64 118.1 LG-05 txa2902 22.5 121.3 LG-05 txa312 20.16 130.0 LG-05 txa4048 23.53 138.2 LG-06 txp6 10.35 0.0 LG-06 cdo718 11.6 LG-06 txa7 26.29 13.5 LG-06 txa462 23.18 15.9 LG-06 txa2124 29.6 21.1 LG-06 txa2926 24.94 24.5 LG-06 txa4103 29.6 27.7 LG-06 txa3407 30.75 29.2 LG-06 txa6233 27.05 32.2 LG-06 isu142 24.9 35.8 LG-06 txa445 29.03 38.0 LG-06 txa2568 31.61 39.6 LG-06 umc119 23.94 43.0 LG-06 txa202 25.36 49.3 LG-06 txa3011 28.46 51.4 LG-06 txa2221 31.95 53.4 LG-06 txa410 35.94 53.8 LG-06 isu138 54.8 LG-06 txa238 32.83 55.3 LG-06 txa605 28.74 56.8 LG-06 txa6281 33.33 58.4 LG-06 txa294 27.09 58.4 LG-06 txa176 35.43 62.2 LG-06 txa2530 24.34 62.2 LG-06 txa2150 34.53 62.2 LG-06 umc53 32.37 63.1 LG-06 txp274 27.61 65.5 LG-06 isu58 34.15 66.4 LG-06 txa33 36.63 66.4 LG-06 txa4009 31.61 67.9 LG-06 umc34 25.92 70.1 LG-06 txa278 23.62 72.0 LG-06 txa555 24.24 74.4 LG-06 txa4052 28.25 75.6 LG-06 txs1906 77.9 LG-06 txa6313 22.78 79.6 LG-06 bnl10.13 29.98 81.4 LG-06 umc44 37.83 81.4 LG-06 txa3110 29.03 83.7 LG-06 txp176 17.99 86.5 LG-06 txa3496 21.13 88.5 LG-06 txa2039 24.13 92.3 LG-06 txa6222 32.47 93.9 LG-06 txa4062 26.03 97.2 LG-06 txs2063 27.33 99.6 LG-06 txa6140 35.05 100.0 LG-06 isu147 29.89 102.0 LG-06 txp17 105.4 LG-06 txa3457 31.43 106.5 LG-06 txa587 37.53 106.5 LG-06 txa2549 31.95 107.3 LG-06 txa528 33.03 107.3 LG-06 txa3926 30.19 108.6 LG-06 txa6261 28.74 110.3 LG-06 txa6062 36.53 110.8 LG-06 umc58.2 26.8 112.5 LG-06 txa2721 23.24 115.9 LG-06 txa6061 34.59 118.6 LG-06 txa6322 25.49 119.4 LG-06 txa6026 39.93 120.2 LG-06 txa342 31.01 122.1 LG-07 txp40 14.29 0.0 LG-07 txa3944 27.32 6.5 LG-07 isu139 8.4 LG-07 txa4023 25.32 10.9 LG-07 txa2650 24.62 14.3 LG-07 txa3692 36.83 14.7 LG-07 txa2844 39.03 14.7 LG-07 rz143.2 17.75 21.0 LG-07 txs1931 29.7 21.6 LG-07 txa3336 27.89 23.7 LG-07 txa3146 24.4 27.7 LG-07 txa2286 25.49 31.0 LG-07 txa2896 27.52 35.2 LG-07 txp159 37.9 LG-07 txs1096 19.97 43.5 LG-07 txp312 27.12 45.9 LG-07 txa3935 25.86 48.6 LG-07 txa2708 27.12 50.9 LG-07 txa2624 24.4 54.6 LG-07 txa3017 31.14 55.9 LG-07 txa219 31.36 57.2 LG-07 txa16 32.73 57.2 LG-07 isu38 58.2 LG-07 txa3888 16.24 66.4 LG-07 bec147 20.87 71.8 LG-07 txa307 25.89 73.8 LG-07 txa358 22.68 76.4 LG-07 txa2578 28.17 77.9 LG-07 txa2333 36.33 78.1 LG-07 txs2014.2 36.33 78.3 LG-07 txa2076 36.93 79.0 LG-07 txa3901 37.53 79.4 LG-07 isu98.2 36.63 79.4 LG-07 txa166 38.43 79.4 LG-07 umc47.2 35.64 79.8 LG-07 txa13 24.06 83.1 LG-07 txa604 24.62 85.6 LG-07 txa4088 25.64 87.7 LG-07 umc23 27.32 89.4 LG-07 txa11 24.9 91.9 LG-07 txp92 20.37 96.9 LG-07 txa79 30.18 98.6 LG-07 txa6362 29.31 100.6 LG-07 txa3581 16.96 108.4 LG-07 txa584 25.04 112.2 LG-07 txa2796 29.89 114.2 LG-07 txa2053 20.07 119.1 LG-07 isu116 29.36 121.7 LG-07 txs1579 124.0 LG-07 txa487 21.16 128.8 LG-07 txa486 32.73 128.8 LG-07 txa601 20.89 134.4 LG-07 txa2007 25.59 137.5 LG-07 txa419 30.75 139.2 LG-07 txa354 21.4 143.7 LG-07 txa2639 26.49 146.1 LG-07 txa3228 31.72 147.7 LG-07 txa406 30.27 149.3 LG-07 txa2548 32.67 149.7 LG-07 txs1554 150.9 LG-07 txa6102 23.04 155.6 LG-08 txp273 18.38 0.0 LG-08 txa4058 11.49 6.1 LG-08 txa2317 23.04 13.1 LG-08 txa3517 23.27 16.8 LG-08 txa3513 24.67 20.1 LG-08 txa4214 23.79 22.9 LG-08 txa3855 25.36 25.2 LG-08 txa6029 31.19 26.3 LG-08 bnl3.04 32.13 26.3 LG-08 txa2780 26.2 30.1 LG-08 txa3386 24.67 33.2 LG-08 txa2117 32.97 33.6 LG-08 txp47 38.7 LG-08 txa4117 17.31 45.5 LG-08 txa2866 20.23 51.0 LG-08 txa416 23.24 55.3 LG-08 txa2612 26.69 58.2 LG-08 txa3650 26.29 60.5 LG-08 txa3861 29.9 61.4 LG-08 isu54 63.8 LG-08 txa348 21.66 68.1 LG-08 txa6174 29.88 70.0 LG-08 txa6211 27.52 72.7 LG-08 umc18 25.04 76.4 LG-08 umc130 28.43 77.5 LG-08 rz261 25.36 80.2 LG-08 txp294 28.17 82.5 LG-08 txa3856 24.21 86.0 LG-08 txs645.2 27.05 88.2 LG-08 txa3853 25.73 90.7 LG-08 isu145.2 26.14 92.7 LG-08 txa3130 27.33 94.7 LG-08 txa3771 27.32 96.2 LG-08 txa558 32.13 96.2 LG-08 cdo459 99.2 LG-08 txa6348 21.15 104.2 LG-08 txa6347 26.57 109.5 LG-08 txs560 30.85 111.2 LG-08 txa6090 34.75 111.6 LG-08 txp250 27.32 113.4 LG-08 txa4084 24.9 116.6 LG-08 txa4112 19.65 122.7 LG-08 txp105 24.9 126.1 LG-08 txa2778 31.78 126.6 LG-08 txa3709 28.82 128.0 LG-08 txa2789 29.11 129.4 LG-08 txa4014 28.25 132.9 LG-08 txa588 23.79 136.8 LG-08 txa3876 23.27 140.4 LG-08 isu146 26.01 143.3 LG-08 txa6304 26.01 146.3 LG-08 txa2332 33.71 147.1 LG-08 txa189 28.17 149.4 LG-08 txa2948 26.29 152.3 LG-09 txs2148.1 31.43 0.0 LG-09 rz390 24.06 3.0 LG-09 txs1703 6.47 6.6 LG-09 cdo580 23.5 LG-09 txs1150 27.92 24.1 LG-09 umc64 30.2 LG-09 txa4137 18.52 36.6 LG-09 txa3845 25.86 39.4 LG-09 txa4213 37.23 39.4 LG-09 txa6214 29.31 41.7 LG-09 txa6132 35.13 41.7 LG-09 txp287 27.03 43.6 LG-09 txa2326 26.58 45.5 LG-09 txa3526 28.52 47.8 LG-09 txa4184 26.85 50.1 LG-09 txp67 25.92 52.5 LG-09 txa2542 27.89 54.4 LG-09 txa567 38.13 54.4 LG-09 txa2600 22.98 58.8 LG-09 txa3160 22.71 62.8 LG-09 txa2011 27.68 65.1 LG-09 txa3379 36.53 65.5 LG-09 sBAC120 68.8 LG-09 txa393 26.77 71.0 LG-09 txa2098 35.64 71.4 LG-09 txa3248 32.01 72.8 LG-09 txa2517 27.09 74.5 LG-09 txa21 33.33 74.5 LG-09 txa3716 34.83 74.5 LG-09 txa2063 29.69 75.9 LG-09 txa3380 35.64 76.3 LG-09 txa3315 39.03 76.3 LG-09 txa3733 36.83 76.7 LG-09 txa2933 35.18 77.5 LG-09 txs943 33.56 78.5 LG-09 txs1383 26.29 81.6 LG-09 txa4113 24.52 85.0 LG-09 bcd454 87.7 LG-09 txa6308 23.39 91.7 LG-09 txa2599 27.4 94.0 LG-09 txa509 28.46 95.5 LG-09 txa66 33.56 96.1 LG-09 txa590 35.64 96.7 LG-09 txa2135 37.83 97.1 LG-09 txa415 29.59 99.4 LG-09 txa2351 29.08 101.7 LG-09 txa547 23.27 105.3 LG-09 txa411 32.24 106.1 LG-09 txa3772 21.16 109.7 LG-09 txa3014 34.53 109.7 LG-09 cdo89 114.9 LG-09 txa4122 23.86 118.4 LG-09 umc135.2 36.63 129.2 LG-09 umc132 129.2 LG-09 cdo393 8.81 143.1 LG-09 cdo542 36.03 143.1 LG-09 isu140 12.92 153.0 LG-10 txa2678 15.92 0.0 LG-10 txs1146.1 24.4 5.9 LG-10 txa385 27.85 8.4 LG-10 txa6105 36.03 10.2 LG-10 txa6066 37.83 10.2 LG-10 cdo590 6.15 10.2 LG-10 txa3245 23.67 13.3 LG-10 txa6210 25.73 15.6 LG-10 txs1078 27.09 17.2 LG-10 cdo475 24.24 20.5 LG-10 txa2968 23.39 24.0 LG-10 txa4225 28.46 26.0 LG-10 txa2720 29.03 28.0 LG-10 txa3924 28.74 30.4 LG-10 txa3872 36.63 30.4 LG-10 txa3961 28.74 32.4 LG-10 txa6009 22.71 36.5 LG-10 txa3503 30.75 38.2 LG-10 isu136 41.4 LG-10 txa6327 29.89 43.2 LG-10 umc113 29.59 45.1 LG-10 txa453 29.59 47.0 LG-10 txa2556 38.13 47.0 LG-10 txa398 26.42 49.7 LG-10 cdo516.2 20.87 54.1 LG-10 txa4156 17.62 59.9 LG-10 txs558 30.48 60.7 LG-10 txa2343 26.77 62.8 LG-10 txa3607 29.4 64.3 LG-10 txp20 22.56 68.1 LG-10 cdo17 30.59 70.0 LG-10 txa156 26.75 72.0 LG-10 txa2786 38.73 72.0 LG-10 txa452 26.03 75.1 LG-10 txa2555 38.43 75.1 LG-10 txa4064 35.94 75.8 LG-10 umc61.2 22.89 77.4 LG-10 txa3998 31.07 77.9 LG-10 txa2148 24.49 80.3 LG-10 rz476 25.89 81.1 LG-10 txa3821 28.82 82.5 LG-10 txs443 32.24 83.4 LG-10 txa2104 32.01 84.9 LG-10 isu128.1 36.93 84.9 LG-10 txa381 36.63 85.3 LG-10 bnl5.04 89.7 LG-10 umc114.3 25.04 93.1 LG-10 txa2522 35.13 93.1 LG-10 txa309 21.66 97.8 LG-10 txa6098 28.17 99.8 LG-10 cdo400 27.03 101.8 LG-10 txa3881 18.38 106.7 LG-10 umc150 25.49 110.7 LG-10 txa2005 32.08 111.1 LG-10 umc218 114.0 LG-10 txs1684 31.36 114.9 LG-10 txa4040 26.75 117.0 LG-10 txa2537 31.66 118.0 LG-10 txa3376 31.43 119.2 LG-10 txa2156 18.55 126.2 LG-10 txa37 38.43 126.2 LG-10 txa259 28.18 128.5 LG-10 txs758 25.92 130.8 LG-10 txa3596 24.49 133.5 LG-10 txa2069 34 134.2 LG-10 txa3601 29.89 135.7 LG-10 txa6251 31.14 136.8 LG-10 txa413 29.4 138.3 LG-10 isu45 26.97 139.7 LG-10 txa2727 28.46 142.3 LG-10 rz143.1 16.36 148.4
TABLE-US-00009 TABLE 9 Placed F.sub.2 framework markers. cS Name cM LG-01 M1txa3905a 0.0 LG-01 M2TS068a 5.6 LG-01 M3a 6.1 LG-01 M4a 8.2 LG-01 M5CS004Na 12.6 LG-01 M6a 13.1 LG-01 M7txp302a 16.6 LG-01 M8txp482a 18.3 LG-01 M9txa6387a 22.7 LG-01 M10a 30.9 LG-01 M11a 70.5 LG-01 M12a 78.5 LG-01 M13a 84.7 LG-01 M14a 86.2 LG-01 M15a 98.7 LG-01 M16a 105.8 LG-01 M17a 105.9 LG-01 M18a 125.8 LG-01 M19a 137.4 LG-01 M20txp61a 140.9 LG-01 M21a 153.6 LG-01 M22a 158.4 LG-01 M23txp46a 167.8 LG-01 M24a 172.3 LG-02 M25txp96b 0.0 LG-02 M26txp197b 0.6 LG-02 M27txp211b 21.3 LG-02 M28b 36.3 LG-02 M29b 41.2 LG-02 M30b 44.4 LG-02 M31b 46.1 LG-02 M32b 51.2 LG-02 M33b 62.3 LG-02 M34txp72b 66.8 LG-02 M36txp13b 73.1 LG-02 M37b 88.0 LG-02 M38b 90.6 LG-02 M39txp1b 103.0 LG-02 M40b 109.6 LG-02 M41b 124.2 LG-02 M42txp207b 136.1 LG-02 M44txp8b 154.5 LG-03 M45c 0.0 LG-03 M46txp492c 8.9 LG-03 M47c 14.4 LG-03 M48c 19.7 LG-03 M49txp500c 35.9 LG-03 M50c 45.3 LG-03 M51txp461c 49.5 LG-03 M52c 54.4 LG-03 M54c 55.8 LG-03 M53c 56.3 LG-03 M55txp336c 63.6 LG-03 M56c 77.7 LG-03 M57c 84.4 LG-03 M58c 86.3 LG-03 M59txa4107c 89.5 LG-03 M60txa3390c 107.7 LG-03 M61txi7c 119.7 LG-04 M62txp506d 0.0 LG-04 M63d 6.5 LG-04 M64d 22.6 LG-04 M65d 30.7 LG-04 M66d 34.2 LG-04 M67txa3635d 52.0 LG-04 M68d 62.1 LG-04 M69txp12d 65.3 LG-04 M70d 68.1 LG-04 M71txa4091d 69.9 LG-04 M72txa4231d 70.5 LG-04 M73d 82.3 LG-04 M74d 96.2 LG-04 M75TXP60d 116.6 LG-04 M76d 131.8 LG-04 M77d 133.5 LG-04 M78d 134.8 LG-04 M79d 137.8 LG-04 M80d 140.9 LG-05 M151j 0.0 LG-05 M152txa4096j 15.1 LG-05 M153txp303j 25.0 LG-05 M154j 34.1 LG-05 M155j 43.2 LG-05 M158j 47.3 LG-05 M156j 49.4 LG-05 M157j 51.3 LG-05 M159j 57.0 LG-05 M161j 61.7 LG-05 M162txp23j 72.9 LG-05 M163j 87.3 LG-05 M164txp123j 93.0 LG-05 M165j 98.5 LG-05 M166txa4048j 105.4 LG-05 M167j 107.1 LG-05 M168j 112.1 LG-06 M135i 0.0 LG-06 M136i 5.3 LG-06 M137i 13.3 LG-06 M138TXP6i 19.1 LG-06 M139i 27.2 LG-06 M140i 28.8 LG-06 M141i 31.4 LG-06 M142txa4032i 42.9 LG-06 M143txp274i 69.8 LG-06 M144txa3860i 72.6 LG-06 M145txa4090i 75.7 LG-06 M146i 86.9 LG-06 M147i 93.9 LG-06 M148i 102.5 LG-06 M149txp17i 107.0 LG-06 M150i 110.0 LG-07 M81e 0.0 LG-07 M82txp36e 6.2 LG-07 M83txp40e 6.2 LG-07 M84e 19.7 LG-07 M85txp159e 28.2 LG-07 M86e 58.3 LG-07 M87txa4110e 69.2 LG-07 M88e 71.4 LG-07 M89txp278e 71.8 LG-07 M90e 73.9 LG-07 M91txa4046e 81.0 LG-07 M92txa4088e 86.3 LG-07 M93e 98.7 LG-07 M94e 103.6 LG-07 M95txp295e 117.9 LG-07 M96e 129.0 LG-08 M120txp273h 0.0 LG-08 M121h 15.4 LG-08 M122txp47h 16.5 LG-08 M123txa3861h 33.0 LG-08 M124h 44.9 LG-08 M125h 52.3 LG-08 M126txa4109h 56.9 LG-08 M127h 60.2 LG-08 M128txp354h 69.9 LG-08 M129txp18h 84.2 LG-08 M130txp321h 84.6 LG-08 M132h 99.5 LG-08 M133txa4014h 100.2 LG-08 M134h 103.6 LG-09 M97f 0.0 LG-09 M98f 5.4 LG-09 M99txp258f 8.4 LG-09 M100f 22.4 LG-09 M101txa4113f 41.4 LG-10 M102g 0.0 LG-10 M103g 4.7 LG-10 M104g 9.0 LG-10 M105g 13.0 LG-10 M106g 17.6 LG-10 M107g 18.2 LG-10 M108g 39.5 LG-10 M109txa4049g 49.3 LG-10 M110g 52.1 LG-10 M111txp217g 59.0 LG-10 M112txp130g 62.4 LG-10 M113g 64.2 LG-10 M114g 69.8 LG-10 M115g 79.6 LG-10 M116txa4236g 82.1 LG-10 M117txa4040g 90.1 LG-10 M118g 101.1 LG-10 M119g 104.8
TABLE-US-00010 TABLE10 ForwardandreverseprimersusedforqPCR. SEQ Gene ID Primername (Sobic.3) Sequence NO. 3004G202500F 4G202500 CAGATCGGCACTCTGACAAA 39 3004G202500R TGCTGTTAAACGGTCTGCTG 40 3003G024800F 3G024800 GGGATGTAAAGCCCCAAAAT 41 3003G024800R GGGATGTAAAGCCCCAAAAT 42 3004G197600F 4G197600 AGAACGCACCACCCTTTATG 43 3004G197600R GGAAGCACATAGCATCAGCA 44 3004G295800F 4G295800 GGGTCAAGCTGATGAAGCTC 45 3004G295800R GCCTTGTGTTGACCTGGTTT 46 3004G333500F 4G333500 GCATGAAGAGGGAGATCAGC 47 3004G333500R CATCCAGGGAACCTGTCAGT 48 3001G195600F 1G195600 TGGAGCTATGGGACAGGAAC 49 3001G195600R CGAGAGATTTGTCGATGCAA 50 Total RNA was isolated using TRIzol Reagent (Thermo Fisher). RNA was digested with RNase-free DNase I (Thermo Fisher), and cDNA synthesis was performed using Superscript III First-Strand Synthesis System for RT-PCR (Thermo Fisher). qPCR reactions were performed using a DNA Engine, Opticon 2, Continuous Florescence Detection System (Bio-Rad, Hercules, CA) in MicroAmp Optical 96-well 12 reaction plates with optical covers. The Real Time PCR volume of 25 L contained 12.5 L 2X SYBR GreenER qPCR SuperMix Universal (Thermo Fisher), 200 nM each of forward and reverse primers, and 5 L of diluted DNA sample. Reaction conditions were as follows: 50 C. for 2 min, 95 C. for 10 min, 40 cycles of 95 C. for 30 sec, 54 C. for 30 sec, and 72 C. for 30 sec. Reactions were performed in triplicate, and melting curve analyses were performed. Relative quantification values and standard deviations were calculated using the comparative CT method. Values were normalized to the expression of the reference. Differences in expression were identified by Student's t-tests.
TABLE-US-00011 TABLE 11 Concentration Duration of pre- range treatment (minutes) most most Method preferred preferred preferred preferred Inducing sex in apomictic plants sugar starvation (mmol Culture pistils on sugar free media <6 0 <10 0 sucrose equivalents in media per liter) hydrogen peroxide Directly expose pistils, in vitro or in situ, to 80-150 100 5-25 15 (mmol per liter) solution prior to megasporogenesis PEG 6000 Directly expose pistils, in vitro and/or in situ, to 20-30 25 5-25 15 (g per liter) solution prior to megasporogenesis brassinazole Directly expose pistils, in vitro and/or in situ, to 0.5-5 1 <20 10 (mol per liter) solution prior to megasporogenesis Inducing apomeiosis in sexual plants epibrassinolide (epiBL) Directly expose pistils, in vitro and/or in situ, to 0.05-15 0.1-10 <20 10 (mol per liter) solution prior to megasporogenesis fluridone Directly expose pistils, in vitro and/or in situ, to 2-20 10 <20 10 (mol per liter) solution prior to megasporogenesis 5-azacytidine Directly expose pistils, in vitro and/or in situ, to 50-1000 500 <20 10 (mol per liter) solution prior to megasporogenesis DTBA Directly expose pistils, in vitro and/or in situ, to 0.5-2 1 <20 10 (mol per liter) solution prior to megasporogenesis Glucose Directly expose pistils in situ to solution prior 30-90 70 180-480 360 (mmol per liter) to megasporogenesis Glucose Directly expose pistils in vitro to solution prior 30-90 70 4-120 10 (mmol per liter) to megasporogenesis Sucrose Directly expose pistils, in vitro and/or in situ, to 30-70 50 <20 10 (mmol per liter) solution prior to megasporogenesis Inducing parthenogenesis in sexual plants fluridone Directly expose pistils, in vitro and/or in situ, to 2-20 10 <20 10 (mol per liter) solution prior to megasporogenesis epiBL Directly expose pistils in situ to solution prior 0.5-4 2 180-480 360 (mol per liter) to anthesis or fertilization glucose 50-140 110 (mmol per liter) DTBA Directly expose pistils in vitro and/or in situ to 0.05-0.5 0.1 <20 10 (mol per liter) solution prior to anthesis or fertilization glucose 50-140 110 (mmol per liter) Begin application (hours before megasporogenesis Begin application to onset) harvest (days) most most Method preferred preferred preferred preferred Inducing sex in apomictic plants sugar starvation (mmol Culture pistils on sugar free media 48-18 36 1-3 2 sucrose equivalents in media per liter) hydrogen peroxide Directly expose pistils, in vitro or in situ, to 24-1 12 Pretreatment only (mmol per liter) solution prior to megasporogenesis 1-3 2 PEG 6000 Directly expose pistils, in vitro and/or in situ, to 24-1 12 1-3 1 (g per liter) solution prior to megasporogenesis brassinazole Directly expose pistils, in vitro and/or in situ, to 24-1 12 1-3 1 (mol per liter) solution prior to megasporogenesis Inducing apomeiosis in sexual plants epibrassinolide (epiBL) Directly expose pistils, in vitro and/or in situ, to 24-6 12 1-3 1 (mol per liter) solution prior to megasporogenesis fluridone Directly expose pistils, in vitro and/or in situ, to 24-6 12 1-3 1 (mol per liter) solution prior to megasporogenesis 5-azacytidine Directly expose pistils, in vitro and/or in situ, to 24-6 12 1-3 1 (mol per liter) solution prior to megasporogenesis DTBA Directly expose pistils, in vitro and/or in situ, to 24-6 12 1-3 1 (mol per liter) solution prior to megasporogenesis Glucose Directly expose pistils in situ to solution prior 24-6 12 Pretreatment only (mmol per liter) to megasporogenesis 1-3 1 Glucose Directly expose pistils in vitro to solution prior 24-6 12 1-3 1 (mmol per liter) to megasporogenesis Sucrose Directly expose pistils, in vitro and/or in situ, to 24-6 12 1-3 1 (mmol per liter) solution prior to megasporogenesis Inducing parthenogenesis in sexual plants fluridone Directly expose pistils, in vitro and/or in situ, to 24-6 12 1-3 (mol per liter) solution prior to megasporogenesis epiBL Directly expose pistils in situ to solution prior 24-48 36 Pretreatment only (mol per liter) to anthesis or fertilization glucose 2-5 4 (mmol per liter) DTBA Directly expose pistils in vitro and/or in situ to 24-48 36 2-5 4 (mol per liter) solution prior to anthesis or fertilization glucose (mmol per liter)
REFERENCES
[0558] 1. Asker S E & Jerling L (1992) Apomixis in Plants (CRC Press, Inc., Boca Raton, Fla.) p 298. [0559] 2. Matzk F, Meister A, & Schubert I (2000) An efficient screen for reproductive pathways using mature seeds of monocots and dicots. Plant Journal 21(1):97-108. [0560] 3. Naumova T N, et al. (2001) Reproductive development in apomictic populations of Arabis holboellii (Brassicaceae). Sex Plant Reprod 14(4):195-200. [0561] 4. Taskin K M, Turgut K, & Scott R J (2004) Apomictic development in Arabis gunnisoniana. Israel Journal of Plant Sciences 52(2):155-160. [0562] 5. Aliyu O M, Schranz M E, & Sharbel T F (2010) Quantitative variation for apomictic reproduction in the genus Boechera (Brassicaceae). Am J Bot 97(10):1719-1731. [0563] 6. Dobes C, Koch M, & Sharbel T F (2006) Embryology, karyology, and modes of reproduction in the North American genus Boechera (Brassicaceae): A compilation of seven decades of research. Annals of the Missouri Botanical Garden 93(3):517-534. [0564] 7. Hand M L & Koltunow A M (2014) The genetic control of apomixis: asexual seed formation. Genetics 197(2):441-450. [0565] 8. Hojsgaard D, Klatt S, Baier R, Carman J G, & Horandl E (2014) Taxonomy and Biogeography of Apomixis in Angiosperms and Associated Biodiversity Characteristics. Critical Reviews in Plant Sciences 33(5):414-427. [0566] 9. Suomalainen E, Saura A, & Lokki J (1987) Cytology and Evolution in Parthenogenesis (CRC Press, Inc., Boca Raton, Fla., USA) p 216. [0567] 10. Carman J G (1997) Asynchronous expression of duplicate genes in angiosperms may cause apomixis, bispory, tetraspory, and polyembryony. Biological Journal of the Linnean Society 61(1):51-94. [0568] 11. Yuan L P (1993) Progress of two-line system in hybrid rice breeding. New Frontiers in Rice Research, eds Muralidhoran K & Siddig E A (Directorate of Rice Research, Hyderabad, India), pp 86-93. [0569] 12. Toenniessen G H (2001) Feeding the world in the 21st century: plant breeding, biotechnology and the potential role of apomixis. The flowering of apomixis: from mechanisms to genetic engineering, eds Savidan Y, Carman J G, & Dresselhaus T (CIMMYT, IRD, European Commission DG VI (FAIR), Mexico, D.F.). [0570] 13. Broeckx T, Hulsmans S, & Rolland F (2016) The plant energy sensor: evolutionary conservation and divergence of SnRK1 structure, regulation, and function. J Exp Bot 67(22):6215-6252. [0571] 14. Mittler R & Blumwald E (2015) The roles of ROS and ABA in systemic acquired acclimation. Plant Cell 27(1):64-70. [0572] 15. Dong Y, et al. (2017) Sulfur availability regulates plant growth via glucose-TOR signaling. Nat Commun 8(1):1174. [0573] 16. Soto-Burgos J & Bassham D C (2017) SnRK1 activates autophagy via the TOR signaling pathway in Arabidopsis thaliana. PLoS One 12(8):e0182591. [0574] 17. Nukarinen E, et al. (2016) Quantitative phosphoproteomics reveals the role of the AMPK plant ortholog SnRK1 as a metabolic master regulator under energy deprivation. Sci Rep 6:31697. [0575] 18. Xiong Y, et al. (2013) Glucose-TOR signalling reprograms the transcriptome and activates meristems. Nature 496(7444):181-186. [0576] 19. Xiong Y & Sheen J (2015) Novel links in the plant TOR kinase signaling network. Curr Opin Plant Biol 28:83-91. [0577] 20. Paul M J, Oszvald M, Jesus C, Rajulu C, & Griffiths C A (2017) Increasing crop yield and resilience with trehalose 6-phosphate: targeting a feast-famine mechanism in cereals for better source-sink optimization. J Exp Bot 68(16):4455-4462. [0578] 21. Li X, et al. (2017) Differential TOR activation and cell proliferation in Arabidopsis root and shoot apexes. Proc Natl Acad Sci USA 114(10):2765-2770. [0579] 22. Rahikainen M, Pascual J, Alegre S, Durian G, & Kangasjarvi S (2016) PP2A Phosphatase as a Regulator of ROS Signaling in Plants. Antioxidants (Basel) 5(1). [0580] 23. Tsai A Y & Gazzarrini S (2014) Trehalose-6-phosphate and SnRK1 kinases in plant development and signaling: the emerging picture. Front Plant Sci 5:119. [0581] 24. Iordachescu M & Imai R (2011) Trehalose and abiotic stress in biological systems. Abiotic Stress in PlantsMechanisms and Adaptations, ed Shanker A (INTECH, Rijeka, Croatia). [0582] 25. Zhang Z, et al. (2016) TOR Signaling Promotes Accumulation of BZR1 to Balance Growth with Carbon Availability in Arabidopsis. Curr Biol 26(14):1854-1860. [0583] 26. Mateo de Arias M (2015) Effects of plant stress on facultative apomixis in Boechera (Brassicaceae). PhD Dissertation (Utah State University, Logan, Utah, USA). [0584] 27. Shilling M P (2016) Hybridization, population genetic structure and gene expression in the genus Boechera. PhD (Utah State University, All Graduate Theses and Dissertations. 5192.). [0585] 28. Sailer C, Schmid B, & Grossniklaus U (2016) Apomixis Allows the Transgenerational Fixation of Phenotypes in Hybrid Plants. Curr Biol 26(3):331-337. [0586] 29. Mangelsdorf P C & Reeves R G (1931) Hybridisation of maize, Tripsacum and Euchlaena. Journal of Heredity 22:329-343. [0587] 30. Rao N G P & Narayana L L (1968) Apomixis in grain sorghums. Indian Journal of Genetics and Plant Breeding 28:121-127. [0588] 31. Asker S (1979) Progress in apomixis research. Hereditas 91:231-240. [0589] 32. Hanna W W & Bashaw E C (1987) ApomixisIts Identification and Use in Plant-Breeding. Crop Science 27(6):1136-1139. [0590] 33. Barcaccia G & Albertini E (2013) Apomixis in plant reproduction: a novel perspective on an old dilemma. Plant Reprod 26(3):159-179. [0591] 34. Bilinski C A, Marmiroli N, & Miller J J (1989) Apomixis in Saccharomyces cerevisiae and other eukaryotic micro-organisms. Adv Microb Physiol 30:23-52. [0592] 35. Grimanelli D (2012) Epigenetic regulation of reproductive development and the emergence of apomixis in angiosperms. Curr Opin Plant Biol 15(1):57-62. [0593] 36. Neiman M, Sharbel T F, & Schwander T (2014) Genetic causes of transitions from sexual reproduction to asexuality in plants and animals. J Evol Biol 27(7):1346-1359. [0594] 37. Nogler G A (1984) Gametophytic apomixis. Embryology of angiosperms, ed Johri B M (Springer-Verlag, New York), pp 475-518. [0595] 38. Mogie M (1992) The evolution of asexual reproduction in plants (Chapman & Hall, London) p 276. [0596] 39. Savidan Y (2000) Apomixis: Genetics and Breeding. Plant Breeding Reviews, ed Janick J (John Wiley & Sons, Inc., New York), Vol 18, pp 13-86. [0597] 40. Crevillen P, et al. (2014) Epigenetic reprogramming that prevents transgenerational inheritance of the vernalized state. Nature 515(7528):587-590. [0598] 41. Crisp P A, Ganguly D, Eichten S R, Borovitz J O, & Pogson B J (2016) Reconsidering plant memory: intersections between stress recovery, RNA turnover, and epigenetics. Science Advances 2(2):e1501733 [0599] 42. Bonasio R (2015) The expanding epigenetic landscape of non-model organisms. J Exp Biol 218(Pt 1):114-122. [0600] 43. Cavalier-Smith T (2010) Origin of the cell nucleus, mitosis and sex: roles of intracellular coevolution. Biol Direct 5:7. [0601] 44. Bernstein H & Bernstein C (2013) Evolutionary Origin and Adaptive Function of Meiosis. Meiosis, eds Bernstein H & Bernstein C (InTech, Rijeka, Croatia), p 123. [0602] 45. Adl S M, et al. (2012) The revised classification of eukaryotes. J Eukaryot Microbiol 59(5):429-493. [0603] 46. Speijer D, Lukes J, & Elias M (2015) Sex is a ubiquitous, ancient, and inherent attribute of eukaryotic life. P Natl Acad Sci USA 112(29):8827-8834. [0604] 47. McKenney P T, Driks A, & Eichenberger P (2013) The Bacillus subtilis endospore: assembly and functions of the multilayered coat. Nat Rev Microbiol 11(1):33-44. [0605] 48. Horandl E & Hadacek F (2013) The oxidative damage initiation hypothesis for meiosis. Plant Reprod 26(4):351-367. [0606] 49. Shimkets L J (2013) Prokaryotic life cycles. The Prokaryotes, ed Rosenberg E (Springer-Verlag, Berlin Heidelberg), pp 318-336. [0607] 50. Carman J G, Jamison M, Elliott E, Dwivedi K K, & Naumova T N (2011) Apospory appears to accelerate onset of meiosis and sexual embryo sac formation in sorghum ovules. BMC Plant Biol 11:9. [0608] 51. Tashiro T, et al. (2017) Early trace of life from 3.95 Ga sedimentary rocks in Labrador, Canada. Nature 549(7673):516-518. [0609] 52. Brukhin V (2017) Molecular and genetic regulation of apomixis. Russian Journal of Genetics 53(9):943-964. [0610] 53. Nedelcu A M (2005) Sex as a response to oxidative stress: stress genes co-opted for sex. P Roy Soc B-Biol Sci 272(1575):1935-1940. [0611] 54. Sabbe K, Chepurnov V A, Vyverman W, & Mann D G (2004) Apomixis in Achnanthes (Bacillariophyceae); development of a model system for diatom reproductive biology. European Journal of Phycology 39(3):327-341. [0612] 55. Liu Q, Yu R-C, Yan T, Zhang Q-C, & Zhou M-J (2014) Laboratory study on the life history of bloom-forming Ulva prolifera in the Yellow Sea. Estuarine, Coastal and Shelf Science 163:82-88. [0613] 56. Hanson S J, et al. (2013) Inventory and phylogenetic analysis of meiotic genes in monogonont rotifers. J Hered 104(3):357-370. [0614] 57. Schurko A M & Logsdon J M, Jr. (2008) Using a meiosis detection toolkit to investigate ancient asexual scandals and the evolution of sex. BioEssays 30:579-589. [0615] 58. Patil S, et al. (2015) Identification of the meiotic toolkit in diatoms and exploration of meiosis-specific SPO11 and RAD51 homologs in the sexual species Pseudo-nitzschia multistriata and Seminavis robusta. BMC Genomics 16:930. [0616] 59. Wang P, et al. (2018) Reciprocal Regulation of the TOR Kinase and ABA Receptor Balances Plant Growth and Stress Response. Mol Cell 69(1):100-112 e106. [0617] 60. Jamsheer K M, et al. (2018) FCS-like zinc finger 6 and 10 repress SnRK1 signalling in Arabidopsis. Plant J 94(2):232-245. [0618] 61. Kim J S, et al. (2005) Comprehensive molecular cytogenetic analysis of sorghum genome architecture: distribution of euchromatin, heterochromatin, genes and recombination in comparison to rice. Genetics 171(4):1963-1976. [0619] 62. Woo Y, et al. (2004) A comparison of cDNA, oligonucleotide, and Affymetrix GeneChip gene expression microarray platforms. J Biomol Tech 15(4):276-284. [0620] 63. Wu H, Kerr K, & Chruchill G (2002) The Analysis of Gene Expression Data: Methods and Software, eds Parmigiani ESGG, Irizarry R A, & Seger S L (Springer, New York), pp 313-431. [0621] 64. Altschul S F, et al. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research 25(17):3389-3402. [0622] 65. Mi H, et al. (2017) PANTHER version 11: expanded annotation data from Gene Ontology and Reactome pathways, and data analysis tool enhancements. Nucleic Acids Res 45(D1):D183-D189. [0623] 66. Bailey C D, et al. (2006) Toward a global phylogeny of the Brassicaceae. Mol Biol Evol 23(11):2142-2160. [0624] 67. Mandakova T, Schranz M E, Sharbel T F, de Jong H, & Lysak M A (2015) Karyotype evolution in apomictic Boechera and the origin of the aberrant chromosomes. Plant J 82(5):785-793. [0625] 68. Windham M D & Al-Shehbaz I A (2006) New and noteworth species of Boechera (Brassicaceae) I: sexual diploids. Harvard Papers in Botany 11(1):61-88. [0626] 69. Alexander P J, et al. (2013) Molecular Phylogenetics and Taxonomy of the Genus <I>Boechera</I> and Related Genera (Brassicaceae: Boechereae). Systematic Botany 38(1):192-209. [0627] 70. Alexander P J, et al. (2015) Weaving a Tangled Web: Divergent and Reticulate Speciation in Boechera fendleri sensu lato (Brassicaceae: Boechereae). Systematic Botany 40(2):572-596. [0628] 71. Windham M D, et al. (2015) Searching for Diamonds in the Apomictic Rough: A Case Study Involving Boechera lignifera (Brassicaceae). Systematic Botany 40(4):1031-1044. [0629] 72. Mau M, et al. (2015) Hybrid apomicts trapped in the ecological niches of their sexual ancestors. Proc Natl Acad Sci USA 112(18):E2357-2365. [0630] 73. Shah J N, et al. (2016) Depletion of Key Meiotic Genes and Transcriptome-Wide Abiotic Stress Reprogramming Mark Early Preparatory Events Ahead of Apomeiotic Transition. Front Plant Sci 7:1539. [0631] 74. Li F W, Rushworth C A, Beck J B, & Windham M D (2017) Boechera microsatellite website: an online portal for species identification and determination of hybrid parentage. Database (Oxford) 2017(1). [0632] 75. Al-Shehbaz I A & Windham M D (2010) Boechera. Flora of North America North of Mexico, ed Committee FoNA (Oxford University Press, Oxford), pp 347-412. [0633] 76. Bocher T W (1951) Cytological and embryological studies in the amphi-apomictic Arabis holboellii complex. KongelDanske Vidensk-SelskabBiolSkr 6:1-59. [0634] 77. Carman J G (2007) Do duplicate genes cause apomixis. Apomixis: Evolution, Mechanisms and Perspectives, eds Horandl E, Grossniklaus U, van Dijk P J, & Sharbel T F (A. R. G. Gantner Verlag K. G., Liechtenstein), pp 63-91. [0635] 78. Sharbel T F, et al. (2010) Apomictic and sexual ovules of Boechera display heterochronic global gene expression patterns. Plant Cell 22(3):655-671. [0636] 79. Schmidt A, et al. (2014) Apomictic and sexual germline development differ with respect to cell cycle, transcriptional, hormonal and epigenetic regulation. PLoS Genet 10(7):e1004476. [0637] 80. Crane C F & Carman J G (1987) Mechanisms of Apomixis in Elymus-Rectisetus from Eastern Australia and New-Zealand. American Journal of Botany 74(4):477-496. [0638] 81. Michelakis E D, et al. (2002) Diversity in mitochondrial function explains differences in vascular oxygen sensing. Circ Res 90(12):1307-1315. [0639] 82. Metallo C M & Vander Heiden M G (2013) Understanding metabolic regulation and its influence on cell physiology. Mol Cell 49(3):388-398. [0640] 83. Bertero T, Rezzonico R, Pottier N, & Mari B (2017) Impact of MicroRNAs in the Cellular Response to Hypoxia. Int Rev Cell Mol Biol 333:91-158. [0641] 84. Herr J M J (1995) The origin of the ovule. American Journal of Botany 82(4):547-564. [0642] 85. Goldberg R B, Beals T P, & Sanders P M (1993) Anther development: basic principles and practical applications. Plant Cell 5(10):1217-1229. [0643] 86. Suttangkakul A, Li F, Chung T, & Vierstra R D (2011) The ATG1/ATG13 protein kinase complex is both a regulator and a target of autophagic recycling in Arabidopsis. Plant Cell 23(10):3761-3779. [0644] 87. Vardhini B V & Anjum N A (2015) Brassinosteroids make plant life easier under abiotic stresses mainly by modulating major components of antioxidant defense system. Frontiers in Environmental Science 2. [0645] 88. Knox R B & Heslop-Harrison J (1963) Experimental control of aposporous apomixis in a grass of the Andropogoneae. Bot Not 116:127-141. [0646] 89. Knox R B (1967) Apomixis: seasonal and population differences in a grass. Science 157(3786):325-326. [0647] 90. Saran S & Dewet J M J (1976) Environmental-Control of Reproduction in Dichanthium-Intermedium. J Cytol Genet 11:22-28. [0648] 91. Evans L T & Knox R B (1969) Environmental control of reproduction in Themeda australis. Australian Journal of Botany 17:375-389. [0649] 92. Langmead B, Trapnell C, Pop M, & Salzberg S L (2009) Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol 10(3):R25. [0650] 93. Trapnell C, Pachter L, & Salzberg S L (2009) TopHat: discovering splice junctions with RNA-Seq. Bioinformatics 25(9):1105-1111. [0651] 94. Li H, et al. (2009) The Sequence Alignment/Map format and SAMtools. Bioinformatics 25(16):2078-2079. [0652] 95. Anders S & Huber W (2010) Differential expression analysis for sequence count data. Genome Biol 11(10):R106. [0653] 96. Pellino M, Sharbel T F, Mau M, Amiteye S, & Corral J M (2011) Selection of reference genes for quantitative real-time PCR expression studies of microdissected reproductive tissues in apomictic and sexual Boechera. BMC Res Notes 4:303. [0654] 97. SYSTAT (2004) SYSTAT for Windows (SYSTAT Software, Inc 2004, Ver. No. 11.00.01). [0655] 98. Sheen J (2014) Master Regulators in Plant Glucose Signaling Networks. Journal of Plant Biology 57(2):67-79. [0656] 99. Stresemann C & Lyko F (2008) Modes of action of the DNA methyltransferase inhibitors azacytidine and decitabine. Int J Cancer 123(1):8-13. [0657] 100. Schmid Hempel P (2011) Evolutionary parasitology. The integrated study of infections, immunology, ecology, and genetics. (Oxford University Press, Oxford). [0658] 101. Mora C, Tittensor D P, Adl S, Simpson A G, & Worm B (2011) How many species are there on Earth and in the ocean? PLoS Biol 9(8):e1001127. [0659] 102. John B M, Ambegaokar K B, & Srivastava P S (1992) Comparative Embryology of Angiosperms (Springer-Verlag, New York). [0660] 103. Carman J G (2000) The evolution of gametophytic apomixis. Embryology of Flowering Plants, Vol. 3: The Systems of Reproduction, ed Batygina T B (Russian Academy of Sciences, St. Petersburg), pp 218-245. [0661] 104. Klatt S, et al. (2016) Photoperiod Extension Enhances Sexual Megaspore Formation and Triggers Metabolic Reprogramming in Facultative Apomictic Ranunculus auricomus. Frontiers in Plant Science 7. [0662] 105. Rodrigo J M, et al. (2017) Apomixis frequency under stress conditions in weeping lovegrass (Eragrostis curvula). PLoS One 12(4):e0175852. [0663] 106. Gao L (2018) Pharmacologically Induced Meiosis Apomeiosis Interconversions in Boechera, Arabidopsis and Vigna. Ph.D. (Utah State University, https://digitalcommons.usu.edu/etd/7222). [0664] 107. Projecto-Garcia J, Biddle J F, & Ragsdale E J (2017) Decoding the architecture and origins of mechanisms for developmental polyphenism. Curr Opin Genet Dev 47:1-8. [0665] 108. Ogawa K & Miura T (2014) Aphid polyphenisms: trans-generational developmental regulation through viviparity. Front Physiol 5:1. [0666] 109. Zhang Y N, et al. (2016) Reproductive switching analysis of Daphnia similoides between sexual female and parthenogenetic female by transcriptome comparison. Sci Rep 6:34241. [0667] 110. Simon J-C, Delmotte F, Rispe C, & Crease T (2003) Phylogenetic relationships between parthenogens and their sexual relatives: the possible routes to parthenogenesis in animals. Biological Journal of the Linnean Society 79:151-163. [0668] 111. Hojsgaard D, et al. (2014) Emergence of apospory and bypass of meiosis via apomixis after sexual hybridisation and polyploidisation. New Phytol 204(4):1000-1012. [0669] 112. Barke B H, Daubert M, & Horandl E (2018) Establishment of Apomixis in Diploid F2 Hybrids and Inheritance of Apospory From F1 to F2 Hybrids of the Ranunculus auricomus Complex. Front Plant Sci 9:1111. [0670] 113. Burow G B, et al. (2011) Registration of the BTx623/IS3620C recombinant inbred mapping population of sorghum. Journal of Plant Registrations 5(1):141-145. [0671] 114. Menz M A, et al. (2002) A high-density genetic map of Sorghum bicolor (L.) Moench based on 2926 AFLP, RFLP and SSR markers. Plant Mol Biol 48(5-6):483-499. [0672] 115. Van Ooij en J W (2009) MapQTL 6, Software for the mapping of quantitative trait loci in experimental populations of diploid species Kyazma BV, Wageningen, Netherlands). [0673] 116. Lander E S & Botstein D (1989) Mapping Mendelian factors underlying quantitative traits using RFLP linkage maps. Genetics 121:185-199. [0674] 117. Lander E & Kruglyak L (1995) Genetic dissection of complex traits: guidelines for interpreting and reporting linkage results. Nat Genet 11(3):241-247. [0675] 118. Van Ooij en J W (1999) LOD significance thresholds for QTL analysis in experimental populations of diploid species. Heredity (Edinb) 83 (Pt 5):613-624. [0676] 119. Jansen R C & Stam P (1994) High resolution of quantitative traits into multiple loci via interval mapping. Genetics 136:1447-1455. [0677] 120. Churchill G A & Doerge R W (1994) Empirical threshold values for quantitative trait mapping. Genetics 138:963-971. [0678] 121. Voorrips R E (2002) MapChart: Software for the Graphical Presentation of Linkage Maps and QTLs. Journal of Heredity 93(1):77-78. [0679] 122. Johnson M, et al. (2008) NCBI BLAST: a better web interface. Nucleic Acids Res 36(Web Server issue):W5-9. [0680] 123. McCormick R F, et al. (2018) The Sorghum bicolor reference genome: improved assembly, gene annotations, a transcriptome atlas, and signatures of genome organization. Plant J 93(2):338-354. [0681] 124. Peel M, Carman J G, & Leblanc O (1997) Megasporocyte callose in apomictic buffelgrass, Kentucky bluegrass, Pennisetum squamulatum Fresen, Tripsacum L. and weeping lovegrass. Crop Science 37:724-732. [0682] 125. Schneitz K, Hulskamp M, & Pruitt R E (1995) Wild-type ovule development in Arabidopsis thaliana: a light microscope study of cleared whole-mount tissue. The Plant Journal 7(5):731-749. [0683] 126. Murashige T & Skoog F (1962) A revised medium for rapid growth and bio assays with tobacco tissue cultures. Phsiologia Plantarum 15:473-497. [0684] 127. Tian Y, et al. (2018) Hydrogen peroxide positively regulates brassinosteroid signaling through oxidation of the BRASSINAZOLE-RESISTANT1 transcription factor. Nat Commun 9(1):1063. [0685] 128. Musial K & Koscinska-Pajak M (2017) Pattern of callose deposition during the course of meiotic diplospory in Chondrilla juncea (Asteraceae, Cichorioideae). Protoplasma 254(4):1499-1505. [0686] 129. Luna E, et al. (2011) Callose deposition: a multifaceted plant defense response. Mol Plant Microbe Interact 24(2):183-193. [0687] 130. Walker J, et al. (2018) Sexual-lineage-specific DNA methylation regulates meiosis in Arabidopsis. Nat Genet 50(1):130-137. [0688] 131. Siqueira J A, Hardoim P, Ferreira P C G, Nunes-Nesi A, & Hemerly A S (2018) Unraveling Interfaces between Energy Metabolism and Cell Cycle in Plants. Trends Plant Sci 23 (8):731-747. [0689] 132. Arve L E, et al. (2015) Growth in continuous high air humidity increases the expression of CYP707A-genes and inhibits stomatal closure. Environmental and Experimental Botany 115:11-19. [0690] 133. Carvalho R F, et al. (2016) The Arabidopsis SR45 Splicing Factor, a Negative Regulator of Sugar Signaling, Modulates SNF1-Related Protein Kinase 1 Stability. Plant Cell 28(8):1910-1925. [0691] 134. Li Q F, et al. (2018) The brassinosteroid-regulated transcription factors BZR1/BES1 function as a coordinator in multisignal-regulated plant growth. Biochim Biophys Acta Gene Regul Mech 1861(6):561-571. [0692] 135. Mittler R (2017) ROS Are Good. Trends Plant Sci 22(1):11-19. [0693] 136. Xing D, Wang Y, Hamilton M, Ben-Hur A, & Reddy A S (2015) Transcriptome-Wide Identification of RNA Targets of Arabidopsis SERINE/ARGININE-RICH45 Uncovers the Unexpected Roles of This RNA Binding Protein in RNA Processing. Plant Cell 27(12):3294-3308. [0694] 137. Youn J H & Kim T W (2015) Functional insights of plant GSK3-like kinases: multi-taskers in diverse cellular signal transduction pathways. Mol Plant 8(4):552-565. [0695] 138. Liu Y, Huang X, Li M, He P, & Zhang Y (2016) Loss-of-function of Arabidopsis receptor-like kinase BIR1 activates cell death and defense responses mediated by BAK1 and SOBIR1. New Phytol 212(3):637-645. [0696] 139. Sessa G, Raz V, Savaldi S, & Fluhr R (1996) PK12, a plant dual-specificity protein kinase of the LAMMER family, is regulated by the hormone ethylene. The Plant Cell 8:2223-2234. [0697] 140. Yan H, et al. (2018) BRASSINOSTEROID-SIGNALING KINASE1 Phosphorylates MAPKKK5 to Regulate Immunity in Arabidopsis. Plant Physiol 176(4):2991-3002. [0698] 141. Liu Y & Zhang S (2004) Phosphorylation of 1-aminocyclopropane-1-carboxylic acid synthase by MPK6, a stress-responsive mitogen-activated protein kinase, induces ethylene biosynthesis in Arabidopsis. Plant Cell 16(12):3386-3399. [0699] 142. Yao Y, et al. (2017) ETHYLENE RESPONSE FACTOR 74 (ERF74) plays an essential role in controlling a respiratory burst oxidase homolog D (RbohD)-dependent mechanism in response to different stresses in Arabidopsis. New Phytol 213(4):1667-1681. [0700] 143. Muller M & Munne-Bosch S (2015) Ethylene Response Factors: A Key Regulatory Hub in Hormone and Stress Signaling. Plant Physiol 169(1):32-41. [0701] 144. Wang L C, Wu J R, Hsu Y J, & Wu S J (2015) Arabidopsis HIT4, a regulator involved in heat-triggered reorganization of chromatin and release of transcriptional gene silencing, relocates from chromocenters to the nucleolus in response to heat stress. New Phytol 205(2):544-554. [0702] 145. Downs J A, Kosmidou E, Morgan A, & Jackson S P (2003) Suppression of homologous recombination by the Saccharomyces cerevisiae linker histone. Molecular Cell 11:1685-1692. [0703] 146. Sherwood D A (2018) A simple metabolic switch may activate apomixis in Arabidopsis thaliana. Ph.D. (Utah State University, Logan, Utah). [0704] 147. Narula J, Fujita M, & Igoshin O A (2016) Functional requirements of cellular differentiation: lessons from Bacillus subtilis. Curr Opin Microbiol 34:38-46. [0705] 148. Khanday I, Skinner D, Yang B, Mercier R, & Sundaresan V (2018) A male-expressed rice embryogenic trigger redirected for asexual propagation through seeds. Nature. [0706] 149. Kirk H, Choi Y H, Kim H K, Verpoorte R, & van der Meij den E (2005) Comparing metabolomes: the chemical consequences of hybridization in plants. New Phytol 167(2):613-622. [0707] 150. Rosenberger C L & Chen J (2018) To Grow or Not to Grow: TOR and SnRK2 Coordinate Growth and Stress Response in Arabidopsis. Mol Cell 69(1):3-4.