Xanthone derivatives for the treatment of hepatitis B virus disease

10611748 ยท 2020-04-07

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention provides novel compounds having the general formula: ##STR00001## wherein R.sup.1 to R.sup.6, X, Y, A.sup.1 and A.sup.2 are as described herein, compositions including the compounds and methods of using the compounds.

Claims

1. A compound of formula I, ##STR00173## wherein: R.sup.1 is halogen or haloC.sub.1-6alkyl; R.sup.2 is hydrogen or halogen; R.sup.3 is hydrogen, halogen, C.sub.1-6alkyl, halo.sub.1-6alkyl, cyano or hydroxy; R.sup.4 is hydrogen; R.sup.5 and R.sup.6 together with nitrogen to which they are attached form pyrrolidinyl, oxopyrrolidinyl, azepanyl, diazepanyl, piperidinyl, hydroxypiperidinyl, carboxypiperidinyl, C.sub.1-6alkylpiperazinyl, morpholinyl, 2,6-diazaspiro[3.4]octan-6-yl or 2,7-diazaspiro[4.4]nonan-2-yl, wherein pyrrolidinyl is unsubstituted or substituted with one, two or three substituents independently selected from: C.sub.1-6alkyl, C.sub.1-6alkoxy, hydroxy, carboxy, carboxyC.sub.1-6alkyl, hydroxyC.sub.1-6alky, amino, C.sub.1-6alkoxycarbonyl, halophenyl, pyridinyl, (diC.sub.1-6alkylamino)carbonyl and morpholinylcarbonyl; X is C(O) or C(R.sup.9)(R.sup.10), wherein R.sup.9 and R.sup.10 are independently selected from hydrogen, C.sub.1-6alkyl, haloC.sub.1-6alkyl, C.sub.1-6alkoxy, hydroxy, oxetanyl and halophenyl-CH(O-carbonylC.sub.1-6alkyl)-; or R.sup.9 and R.sup.10 together with carbon to which they are attached form ##STR00174## A.sup.1 is N or CR.sup.7, wherein R.sup.7 is hydrogen, halogen or C.sub.1-6alkyl; A.sup.2 is N or CR.sup.8, wherein R.sup.8 is hydrogen or halogen; and Y is O or S; with the proviso that 1-[5-fluoro-9-(oxetan-3-yl)-9H-xanthen-3-yl]pyrrolidine is excluded; or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

2. A compound according to claim 1, wherein: R.sup.1 is halogen or haloC.sub.1-6alkyl; R.sup.2 is hydrogen or halogen; R.sup.3 is hydrogen, halogen, C.sub.1-6alkyl, haloC.sub.1-6alkyl, cyano or hydroxy; R.sup.4 is hydrogen; R.sup.5 and R.sup.6 together with nitrogen to which they are attached form pyrrolidinyl, oxopyrrolidinyl, azepanyl, diazepanyl, piperidinyl, hydroxypiperidinyl, carboxypiperidinyl, C.sub.1-6alkylpiperazinyl, morpholinyl, 2,6-diazaspiro[3.4]octan-6-yl or 2,7-diazaspiro[4.4]nonan-2-yl, wherein pyrrolidinyl is unsubstituted or substituted with one, two or three substituents independently selected from C.sub.1-6alkyl, C.sub.1-6alkoxy, hydroxy, carboxy, haloC.sub.1-6alkyl, carboxyC.sub.1-6alkyl, hydroxyC.sub.1-6alky, amino, C.sub.1-6alkoxycarbonyl, halophenyl, pyridinyl, (diC.sub.1-6alkylamino)carbonyl and morpholinylcarbonyl; X is C(O); A.sup.1 is N or CR.sup.7, wherein R.sup.7 is hydrogen, halogen or C.sub.1-6alkyl; A.sup.2 is N or CH; and Y is O; or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

3. A compound according to claim 2, wherein: R.sup.1 is halogen or haloC.sub.1-6alkyl; R.sup.2 is hydrogen or halogen; R.sup.3 is hydrogen, halogen, C.sub.1-6alkyl, haloC.sub.1-6alkyl, cyano or hydroxy; R.sup.4 is hydrogen; R.sup.5 and R.sup.6 together with nitrogen to which they are attached form pyrrolidinyl unsubstituted or substituted with one, two or three substituents independently selected from: C.sub.1-6alkyl, C.sub.1-6alkoxy, hydroxy, carboxy, haloC.sub.1-6alkyl, carboxyC.sub.1-6alkyl, hydroxyC.sub.1-6alky, amino, C.sub.1-6alkoxycarbonyl, halophenyl, pyridinyl, (diC.sub.1-6alkylamino)carbonyl and morpholinylcarbonyl; X is C(O); A.sup.1 is N or CR.sup.7, wherein R.sup.7 is hydrogen, halogen or C.sub.1-6alkyl; A.sup.2 is N or CH; and Y is O; or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

4. A compound according to claim 3, wherein: R.sup.1 is halogen or haloC.sub.1-6alkyl; R.sup.2 is hydrogen or halogen; R.sup.3 is hydrogen, halogen, C.sub.1-6alkyl, cyano or hydroxy; R.sup.4 is hydrogen; R.sup.5 and R.sup.6 together with nitrogen to which they are attached form pyrrolidinyl, hydroxypyrrolidinyl, C.sub.1-6alkoxypyrrolidinyl, carboxypyrrolidinyl or C.sub.1-6alkoxycarbonylpyrrolidinyl; X is C(O); A.sup.1 is CR.sup.7, wherein R.sup.7 is hydrogen, halogen or C.sub.1-6alkyl; A.sup.2 is CH; and Y is O; or a pharmaceutically acceptable salt, or enantiomer, or diastereomer thereof.

5. A compound according to claim 4, wherein: R.sup.1 is fluoro, chloro, bromo or trifluoromethyl; R.sup.2 is hydrogen, fluoro or chloro; R.sup.3 is hydrogen, fluoro, chloro, methyl, trifluoromethyl, cyano or hydroxy; R.sup.4 is hydrogen; R.sup.5 and R.sup.6 together with nitrogen to which they are attached form pyrrolidinyl, hydroxypyrrolidinyl, methoxyprrolidinyl, carboxypyrrolidinyl or methoxycarbonylpyrrolidinyl; X is C(O); A.sup.1 is CR.sup.7, wherein R.sup.7 is hydrogen, fluoro, chloro or methyl; A.sup.2 is CH; and Y is O; or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

6. A compound according to claim 4, or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof, wherein R.sup.1 is fluoro or chloro.

7. A compound according to claim 4, or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof, wherein, R.sup.2 is hydrogen.

8. A compound according to claim 4, or pharmaceutically acceptable salt, enantiomer, or diastereomer thereof, wherein, R.sup.3 is hydrogen, fluoro, chloro or trifluoromethyl.

9. A compound according to claim 4, or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof, wherein, R.sup.5 and R.sup.6 together with nitrogen to which they are attached form pyrrolidinyl or carboxypyrrolidinyl.

10. A compound according to claim 4, or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof, wherein, A.sup.1 is CH.

11. A compound according to claim 4, wherein: R.sup.1 is halogen; R.sup.2 is hydrogen; R.sup.3 is hydrogen, halogen or haloC.sub.1-6alkyl; R.sup.4 is hydrogen; R.sup.5 and R.sup.6 together with nitrogen to which they are attached form pyrrolidinyl or carboxypyrrolidinyl; X is-C(O); A.sup.1 is CH; A.sup.2 is CH; and Y is O; or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

12. A compound according to claim 11, wherein: R.sup.1 is fluoro or chloro; R.sup.2 is hydrogen; R.sup.3 is hydrogen, fluoro, chloro or trifluoromethyl; R.sup.4 is hydrogen; R.sup.5 and R.sup.6 together with nitrogen to which they are attached form pyrrolidinyl or carboxypyrrolidinyl; X is-C(O); A.sup.1 is CH; A.sup.2 is CH; and Y is O; or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

13. A compound according to claim 4, selected from: 5-chloro-3-pyrrolidin-1-yl-xanthen-9-one; 1-(5-chloro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid; (3R)-1-(5-chloro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid; (3S)-1-(5-chloro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid; 1-(5-fluoro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid; 1-(5-bromo-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid; methyl 1-(5-chloro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylate; 5-fluoro-3-pyrrolidin-1-yl-xanthen-9-one; 1-chloro-4-fluoro-6-pyrrolidin-1-yl-xanthen-9-one; 5-fluoro-3-(3-hydroxypyrrolidin-1-yl)xanthen-9-one; 5-fluoro-2-methyl-3-pyrrolidin-1-yl-xanthen-9-one; 1-(5,8-dichloro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid; 5-chloro-3-[(3S)-3-hydroxypyrrolidin-1-yl]xanthen-9-one; 2,5-difluoro-3-pyrrolidin-1-yl-xanthen-9-one; 5-chloro-3-[(3R)-3-hydroxypyrrolidin-1-yl]xanthen-9-one; 5-fluoro-3-[(3S)-3-hydroxypyrrolidin-1-yl]xanthen-9-one; 5-fluoro-3-[(3R)-3-hydroxypyrrolidin-1-yl]xanthen-9-one; 5-fluoro-3-(3-methoxypyrrolidin-1-yl)xanthen-9-one; 2-chloro-4-fluoro-6-pyrrolidin-1-yl-xanthen-9-one; 1-(5-chloro-9-oxo-xanthen-3-yl)pyrrolidine-2-carboxylic acid; 1-[9-oxo-5-(trifluoromethyl)xanthen-3-yl]pyrrolidine-3-carboxylic acid; 1-(5-chloro-2-methyl-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid; 1-(5-chloro-8-methyl-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid; 1-(5-chloro-2-fluoro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid; 1-(2,5-dichloro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid; 1-(5-chloro-8-cyano-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid; 1-(5-chloro-8-hydroxy-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid; 1-(5-chloro-8-fluoro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid; 1-[5-chloro-9-oxo-8-(trifluoromethyl)xanthen-3-yl]pyrrolidine-3-carboxylic acid; 2-chloro-5-fluoro-3-pyrrolidin-1-yl-xanthen-9-one; (3R)-1-(5,8-dichloro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid; 1-(5,7-dichloro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid; 1-(5-chloro-7-fluoro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid; and (3R)-1-(5-chloro-2-methyl-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid; or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

14. A compound according to claim 4, selected from: 5-chloro-3-pyrrolidin-1-yl-xanthen-9-one; 1-(5-chloro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid; (3R)-1-(5-chloro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid; (3 S)-1-(5-chloro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid; 5-fluoro-3-pyrrolidin-1-yl-xanthen-9-one; 1-(5-chloro-8-fluoro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid; 1-[5-chloro-9-oxo-8-(trifluoromethyl)xanthen-3-yl]pyrrolidine-3-carboxylic acid; 1-(5,8-dichloro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid; and (3R)-1-(5,8-dichloro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid; or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

15. A compound according to claim 3, or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof, wherein R.sup.5 and R.sup.6 together with the nitrogen to which they are attached form aminopyrrolidinyl, carboxy(methyl)pyrrolidinyl, carboxy(dimethyl)pyrrolidinyl, carboxy(trifluoromethyl)pyrrolidinyl, carboxy(fluorophenyl)pyrrolidinyl, carboxy(chlorophenyl)pyrrolidinyl, carboxy(pyridinyl)pyrrolidinyl, carboxymethylpyrrolidinyl, dimethylaminocarbonylprrolidinyl, hydroxymethylpyrrolidinyl, morpholinylcarbonylpyrrolidinyl or pyridinylpyrrolidinyl.

16. A compound according to claim 15, selected from: 2-[1-(5-chloro-9-oxo-xanthen-3-yl)pyrrolidin-3-yl]acetic acid; 5-chloro-3-[3-(hydroxymethyl)pyrrolidin-1-yl]xanthen-9-one; (3R,4S)-1-(5-chloro-9-oxo-xanthen-3-yl)-4-(4-fluorophenyl)pyrrolidine-3-carboxylic acid; 1-(5-chloro-9-oxo-xanthen-3-yl)-3-methyl-pyrrolidine-3-carboxylic acid; 1-(5-chloro-9-oxo-xanthen-3-yl)-4,4-dimethyl-pyrrolidine-3-carboxylic acid; (3R,4S)-1-(5-chloro-9-oxo-xanthen-3-yl)-4-(3-pyridyl)pyrrolidine-3-carboxylic acid; 1-(5-chloro-9-oxo-xanthen-3-yl)-3-(trifluoromethyl)pyrrolidine-3-carboxylic acid; (3S,4R)-1-(5-chloro-9-oxo-xanthen-3-yl)-4-(4-chlorophenyl)pyrrolidine-3-carboxylic acid; 5-fluoro-3-[3-(4-pyridyl)pyrrolidin-1-yl]xanthen-9-one; 1-(5-chloro-9-oxo-xanthen-3-yl)-N,N-dimethyl-pyrrolidine-3-carboxamide; 3-[(3S)-3-aminopyrrolidin-1-yl]-5-fluoro-xanthen-9-one; 3-[(3R)-3-aminopyrrolidin-1-yl]-5-fluoro-xanthen-9-one; and 5-chloro-3-[3-(morpholine-4-carbonyl)pyrrolidin-1-yl]xanthen-9-one; or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

17. A compound according to claim 3, or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof, wherein one of A.sup.1 and A.sup.2 is N, and the other one is CH.

18. A compound according to claim 17, selected from: 1-(6-chloro-10-oxo-chromeno[3,2-c]pyridin-3-yl)pyrrolidine-3-carboxylic acid; 6-fluoro-3-pyrrolidin-1-yl-chromeno[3,2-c]pyridin-10-one; 9-chloro-2-pyrrolidin-1-yl-chromeno[2,3-b]pyridin-5-one; and 5-chloro-3-[3-(morpholine-4-carbonyl)pyrrolidin-1-yl]xanthen-9-one; or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

19. A compound according to claim 2, or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof, wherein R.sup.5 and R.sup.6 together with the nitrogen to which they are attached form oxopyrrolidinyl, azepanyl, diazepanyl, piperidinyl, hydroxypiperidinyl, carboxypiperidinyl, C.sub.1-6alkylpiperazinyl, morpholinyl, 2,6-diazaspiro[3.4]octan-6-yl or 2,7-diazaspiro[4.4]nonan-2-yl.

20. A compound according to claim 19, selected from: 5-fluoro-3-(1-piperidyl)xanthen-9-one; 5-chloro-3-(3-hydroxy-1-piperidyl)xanthen-9-one; 3-(azepan-1-yl)-5-fluoro-xanthen-9-one; 1-(5-chloro-9-oxo-xanthen-3-yl)piperidine-3-carboxylic acid; 1-(5-fluoro-9-oxo-xanthen-3-yl)pyrrolidin-2-one; 5-fluoro-3-morpholino-xanthen-9-one; 5-fluoro-3-(4-methylpiperazin-1-yl)xanthen-9-one; 3-(2,6-diazaspiro[3.4]octan-6-yl)-5-fluoro-xanthen-9-one; 3-(2,7-diazaspiro[4.4]nonan-2-yl)-5-fluoro-xanthen-9-one; and 3-(1,4-diazepan-1-yl)-5-fluoro-xanthen-9-one; or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

21. A compound according to claim 1, wherein: R.sup.1 is halogen; R.sup.2, R.sup.3 and R.sup.4 are hydrogen; R.sup.5 and R.sup.6 together with nitrogen to which they are attached form pyrrolidinyl or 3-carboxy-pyrrolidinyl; X is C(R.sup.9)(R.sup.10), wherein R.sup.9 and R.sup.10 are independently selected from: hydrogen, C.sub.1-6alkyl, haloC.sub.1-6alkyl, C.sub.1-6alkoxy, hydroxy, oxetanyl and halophenyl-CH(O-carbonylC.sub.1-6alkyl)-; or R.sup.9 and R.sup.10 together with carbon to which they are attached form ##STR00175## A.sup.1 is CR.sup.7, wherein R.sup.7 is hydrogen or halogen; A.sup.2 is CR.sup.8, wherein R.sup.8 is hydrogen or halogen; and Y is O; or a pharmaceutically acceptable salt, enantiomers, or diastereomer thereof.

22. A compound according to claim 21, wherein: R.sup.1 is fluoro or chloro; R.sup.2, R.sup.3 and R.sup.4 are hydrogen; R.sup.5 and R.sup.6 together with nitrogen to which they are attached form pyrrolidinyl or 3-carboxy-pyrrolidinyl; X is C(R.sup.9)(R.sup.10), wherein R.sup.9 and R.sup.10 are independently selected from: hydrogen, methyl, trifluoromethyl, methoxy, hydroxy, oxetanyl and fluorochlorophenyl-CH(O-carbonylmethyl)-; or R.sup.9 and R.sup.10 together with carbon to which they are attached form ##STR00176## A.sup.1 is CR.sup.7, wherein R.sup.7 is hydrogen or chloro; A.sup.2 is CR.sup.8, wherein R.sup.8 is hydrogen or chloro; and Y is O; or a pharmaceutically acceptable salt, enantiomers or diastereomer thereof.

23. A compound according to claim 21, selected from: 1-(5-fluorospiro[tetrahydrofuran-2,9-xanthene]-3-yl)pyrrolidine; 1-(5-chloro-9-methyl-9H-xanthen-3-yl)pyrrolidine; 1-(5-chloro-9H-xanthen-3-yl)pyrrolidine; 1-(2,4,5-trichloro-9H-xanthen-3-yl)pyrrolidine; 1-[5-chloro-9-(oxetan-3-yl)-9H-xanthen-3-yl]pyrrolidine; [(2-chloro-3-fluoro-phenyl)-(5-chloro-3-pyrrolidin-1-yl-9H-xanthen-9-yl)methyl]acetate; 5-chloro-3-pyrrolidin-1-yl-9-(trifluoromethyl)xanthen-9-ol; 1-[5-chloro-9-m ethoxy-9-(trifluoromethyl)xanthen-3-yl]pyrrolidine; 1-[5-chloro-9-(trifluoromethyl)-9H-xanthen-3-yl]pyrrolidine; 1-(5-fluoro-9H-xanthen-3-yl)pyrrolidine; and 1-(5-chloro-9-methyl-9H-xanthen-3-yl)pyrrolidine-3-carboxylic acid; or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

24. A compound according to claim 1, selected from: 1-(5-chloro-9-oxo-thioxanthen-3-yl)pyrrolidine-3-carboxylic acid; (3S)-1-(5-chloro-9-oxo-thioxanthen-3-yl)pyrrolidine-3-carboxylic acid; and (3R)-1-(5-chloro-9-oxo-thioxanthen-3-yl)pyrrolidine-3-carboxylic acid; or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

25. A process for preparing a compound according to claim 2, or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof, the process comprising: (a) coupling a compound of formula (A) ##STR00177## with a compound of formula (B)
NHR.sup.5R.sup.6 (B) in the presence of a catalyst, a ligand and a base; wherein M is F, Cl, Br or I.

26. A pharmaceutical composition comprising a compound according to claim 1, or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof, and a therapeutically inert carrier.

27. A method for the treatment of HBV infection, which method comprises administering to a patient in need thereof an effective amount of a compound according to according to claim 1, or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

28. A method for the inhibition of cccDNA, which method comprises administering to a patient in need thereof an effective amount of a compound according to claim 1, or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

29. A method for the inhibition of HBeAg, which method comprises administering to a patient in need thereof an effective amount of a compound according to claim 1, or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

30. A method for the inhibition of HBsAg, which method comprises administering to a patient in need thereof an effective amount of a compound according to claim 1, or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

31. A method for the inhibition of HBV DNA which method comprises administering to a patient in need thereof an effective amount of a compound according to claim 1, or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

Description

BRIEF DESCRIPTION OF THE FIGURE(S)

(1) FIG. 1: the result of Example 2 in cccDNA Southern Blot assay, it indicates that Example 2 dose-dependently reduced cccDNA level in HepDES19 cells.

(2) FIG. 2: the result of Example 3 in cccDNA Southern Blot assay, it indicates that Example 3 dose-dependently reduced cccDNA level in HepDES19 cells.

(3) FIG. 3: the result of Example 4 in cccDNA Southern Blot assay, it indicates that Example 4 dose-dependently reduced cccDNA level in HepDES19 cells.

(4) FIG. 4: the result of Example 5 in cccDNA Southern Blot assay, it indicates that Example 5 dose-dependently reduced cccDNA level in HepDES19 cells.

(5) FIG. 5: the result of Example 7 in cccDNA Southern Blot assay, it indicates that Example 7 dose-dependently reduced cccDNA level in HepDES19 cells.

(6) FIG. 6: the result of Example 26 in cccDNA Southern Blot assay, it indicates that Example 26 dose-dependently reduced cccDNA level in HepDES19 cells.

EXAMPLES

(7) The invention will be more fully understood by reference to the following examples. They should not, however, be construed as limiting the scope of the invention.

(8) Abbreviations used herein are as follows:

(9) L: microliter m: micrometer M: micromoles per liter M: molarity MHz: megahertz min: minute hr(s): hour(s) mM: millimole per liter nM: Nanomolar per liter rt: room temperature TFA: trifluoroacetic acid Sphos: 2-dicyclohexylphosphino-2,6-dimethoxybiphenyl NMP: N-methyl-2-pyrrolidone PPh.sub.3: triphenylphosphine PE: petroleum ether DDQ: 2,3-Dichloro-5,6-dicyano-1,4-benzoquinone DBU: 1,8-Diazabicyclo[5.4.0]undec-7-ene DMAP: 4-dimethylaminopyridine DMF: N,N-dimethylformamide EtOAc: ethyl acetate FBS: fetal bovine serum HPLC: high performance liquid chromatography MS (ESI): mass spectroscopy (electron spray ionization) NMR: nuclear magnetic resonance : chemical shift obsd.: observed TEA: triethylamine IC.sub.50: the concentration of a compound, which produces 50% of the inhibition effect for that target HATU: 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate NCS: N-chlorosuccinimide Tet: Tetracycline DMEM-F12: Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12 NEAA: Non-Essential Amino Acids PS: Penicillin Streptomycin G418: Geneticin DMSO: Dimethyl sulfoxide EDTA: ethylenediaminetetraacetic acid SDS: sodium dodecyl sulfate RPM: revolutions per minute TAE: tris-acetate electrophoresis DIG: Digoxigenin PHH: primary human hepatocytes CLIA: Chemiluminescence Immuno Assay PEG: polyethylene glycol RCF: relative centrifugal force

GENERAL EXPERIMENTAL CONDITIONS

(10) Intermediates and final compounds were purified by flash chromatography using one of the following instruments: i) Biotage SP1 system and the Quad 12/25 Cartridge module. ii) ISCO combi-flash chromatography instrument. Silica gel Brand and pore size: i) KP-SIL 60 , particle size: 40-60 m; ii) CAS registry NO: Silica Gel: 63231-67-4, particle size: 47-60 micron silica gel; iii) ZCX from Qingdao Haiyang Chemical Co., Ltd, pore: 200-300 or 300-400.

(11) Intermediates and final compounds were purified by preparative HPLC on reversed phase column using X Bridge Perp C.sub.18 (5 m, OBD 30100 mm) column or SunFire Perp C.sub.18 (5 m, OBD 30100 mm) column.

(12) LC/MS spectra were obtained using a Waters UPLC-SQD Mass. Standard LC/MS conditions were as follows (running time 3 minutes): Acidic condition: A: 0.1% formic acid and 1% acetonitrile in H.sub.2O; B: 0.1% formic acid in acetonitrile; Basic condition: A: 0.05% NH.sub.3H.sub.2O in H.sub.2O; B: acetonitrile.

(13) Mass spectra (MS): generally only ions which indicate the parent mass are reported, and unless otherwise stated the mass ion quoted is the positive mass ion (M+H).sup.+.

(14) NMR Spectra were obtained using Bruker Avance 400 MHz.

(15) All reactions involving air-sensitive reagents were performed under an argon atmosphere.

(16) Reagents were used as received from commercial suppliers without further purification unless otherwise noted.

PREPARATIVE EXAMPLES

Intermediate 1: 3-bromo-5-chloro-xanthen-9-one

(17) ##STR00014##

(18) Intermediate 1 was prepared according to Scheme 3.

(19) ##STR00015##

Step 1: Preparation of 2-(3-bromophenoxy)-3-chloro-benzaldehyde

(20) ##STR00016##

(21) To a solution of 3-chloro-2-fluoro-benzaldehyde (10.0 g, 63.29 mmol) in NMP (100 mL) was added 3-bromophenol (13.1 g, 75.95 mmol), CuCl.sub.2 (0.42 g, 3.165 mmol), K.sub.3PO.sub.4 (26.8 g, 126.6 mmol) and PPh.sub.3 (1.24 g, 4.747 mmol) at 25 C., then the mixture was stirred at 120 C. for 16 h. The reaction was quenched by addition of water (500 mL) and the resulting mixture was extracted with EtOAc (500 mL) for three times. The combined organic phase was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated under reduced pressure. The residue was purified by column chromatography on silica gel (elution with PE:EtOAc=20:1) to give 2-(3-bromophenoxy)-3-chloro-benzaldehyde (14.1 g, 71%) as oil. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 311.0.

Step 2: Preparation of 3-bromo-5-chloro-xanthen-9-one

(22) ##STR00017##

(23) To a mixture of 2-(3-bromophenoxy)-3-chloro-benzaldehyde (12.0 g, 38.72 mmol) in 1,2-dichloroethane (200 mL) was added 2,3-dichloro-5,6-dicyano-1,4-benzoquinone (26.2 g, 116.2 mmol) and FeCl.sub.3.6H.sub.2O (31.2 g, 116.2 mmol) at 25 C. Then the mixture was stirred at 100 C. for 16 hours. The resulting reaction mixture was poured into water (250 mL) and extracted with DCM (500 mL) for three times. The combined organic phase was dried with anhydrous Na.sub.2SO.sub.4 and concentrated under reduced pressure. The residue was purified by column chromatography on silica gel (elution with PE:EtOAc=20:1) to give 3-bromo-5-chloro-xanthen-9-one (7.6 g, 63.0%) as a pale green solid, MS obsd. (ESI.sup.+) [(M+H).sup.+]: 309.0.

Intermediate 2: 3-bromo-5-fluoro-2-methyl-xanthen-9-one

(24) ##STR00018##

(25) Intermediate 2 was prepared according to Scheme 4.

(26) ##STR00019##

Step 1: Preparation of Methyl 4-bromo-2-fluoro-5-methyl-benzoate

(27) ##STR00020##

(28) To a mixture of 4-bromo-2-fluoro-5-methyl-benzoic acid (1.5 g, 6.44 mmol) in MeOH (25 mL) was added SOCl.sub.2 (2.3 g, 19.31 mmol) dropwise at 0 C. and the mixture was then stirred at 70 C. for 2 hours. After the reaction was complete, the mixture was concentrated under reduced pressure to afford the crude of methyl 4-bromo-2-fluoro-5-methyl-benzoate (1.6 g, 100%) as a pale solid, which was used in the next step without further purification.

Step 2: Preparation of Methyl 4-bromo-2-(2-fluorophenoxy)-5-methyl-benzoate

(29) ##STR00021##

(30) To a solution of methyl 4-bromo-2-fluoro-5-methyl-benzoate (1.9 g, 7.69 mmol) in DMF (25 mL) was added 2-fluorophenol (1.0 g, 9.23 mmol), Cu powder (2.9 g, 46.14 mmol) and K.sub.2CO.sub.3 (2.1 g, 15.38 mmol) at 20 C., the mixture was then stirred at 100 C. for 16 hours. The resulting mixture was cooled to 20 C. and filtered, the obtained cake was washed with EtOAc (100 mL). The combined filtrate was washed with water (50 mL) and brine (100 mL), dried over anhydrous Na.sub.2SO.sub.4 and concentrated under reduced pressure. The residue was purified by column chromatography on silica gel (elution with PE:EtOAc=100:1 to 5:1) to afford methyl 4-bromo-2-(2-fluorophenoxy)-5-methyl-benzoate (600.0 mg, yield: 23.08%) and recycled 4-bromo-2-fluoro-5-methyl-benzoate (890.0 mg). Methyl 4-bromo-2-(2-fluorophenoxy)-5-methyl-benzoate, MS obsd. (ESI.sup.+) [(M+H).sup.+]: 339.0.

Step 3: Preparation of 4-bromo-2-(2-fluorophenoxy)-5-methyl-benzoic acid

(31) ##STR00022##

(32) A mixture of methyl 4-bromo-2-(2-fluorophenoxy)-5-methyl-benzoate (0.5 g, 1.47 mmol), NaOH (180.0 mg, 4.42 mmol) in MeOH/H.sub.2O (20 mL/4 mL) was stirred at 60 C. for 4 hours. The resulting mixture was concentrated under reduced pressure and the residue was redissolved in water (20 mL). The solution was adjusted to pH=3-4 by addition of 1N HCl dropwise and the resulting mixture was extracted with EtOAc (80 mL) three times. The combined organic layer was dried over anhydrous Na.sub.2SO.sub.4 and concentrated under reduced pressure to afford 4-bromo-2-(2-fluorophenoxy)-5-methyl-benzoic acid (550.0 mg, crude) as a pale-white solid, which was used in the next step without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 324.8.

Step 4: Preparation of 3-bromo-5-fluoro-2-methyl-xanthen-9-one

(33) ##STR00023##

(34) A solution of 4-bromo-2-(2-fluorophenoxy)-5-methyl-benzoic acid (0.45 g, 0.308 mmol) in condensed sulfuric acid (20 mL) was stirred at 90 C. for 15 hours under N.sub.2 atmosphere. The reaction mixture was poured into ice and stirred for 15 min. The resulting mixture was extracted with EtOAc (60 mL) and the organic layer was dried over anhydrous Na.sub.2SO.sub.4 and concentrated under reduced pressure to afford 3-bromo-5-fluoro-2-methyl-xanthen-9-one (0.4 g, 61.54%) as a pale-white solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 312.4.

Intermediate 3: 3-bromo-5-fluoro-xanthen-9-one

(35) ##STR00024##

(36) Intermediate 3 was prepared according to Scheme 5.

(37) ##STR00025##

Step 1: Preparation of Methyl 4-bromo-2-fluoro-benzoate

(38) ##STR00026##

(39) To a mixture of 4-bromo-2-fluoro-benzoic acid (1.5 g, 6.44 mmol) in MeOH (25 mL) was added SOCl.sub.2 (2.3 g, 19.31 mmol) dropwise at 0 C. and the mixture was then stirred at 70 C. for 2 hours. After the reaction was complete, the mixture was concentrated under reduced pressure to afford the crude of methyl 4-bromo-2-fluoro-benzoate (1.6 g, 100%, crude) as a pale solid, which was used in the next step without further purification.

Step 2: Preparation of Methyl 4-bromo-2-(2-fluorophenoxy)benzoate

(40) ##STR00027##

(41) A mixture of methyl 4-bromo-2-fluoro-benzoate (8.3 g, 35.6 mmol), 2-fluorophenol (4.8 g, 42.7 mmol), K.sub.2CO.sub.3 (9.8 g, 71.2 mmol) and Cu (13.6 g, 213.7 mmol) in dry DMF (100 mL) was stirred at 100 C. for 16 hours. The resulting mixture was then filtered and the filtrate was partitioned between EtOAc (300 mL) and water (300 mL). The organic layer was separated and the aqueous phase was extracted with EtOAc (300 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated under reduced pressure to give methyl 4-bromo-2-(2-fluorophenoxy)benzoate (crude, 10.0 g) as a brown oil, which was used in the next step without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 325.0.

Step 3: Preparation of 4-bromo-2-(2-fluorophenoxy) benzoic acid

(42) ##STR00028##

(43) A mixture of methyl 4-bromo-2-(2-fluorophenoxy)benzoate (9.75 g, 30.0 mmol, crude prepared above), NaOH (3.6 g, 90.0 mmol) in a mixed solvent of methanol (100 mL) and water (20 mL) was stirred at 60 C. for 4 hours. The resulting mixture was adjusted to pH 4 with concentrated HCl to yield a suspension. The solid was collected by filtration and dried to give 4-bromo-2-(2-fluorophenoxy) benzoic acid (crude, 5.1 g) as a white solid, which was used in the next step without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 311.0.

Step 4: Preparation of 3-bromo-5-fluoro-xanthen-9-one

(44) ##STR00029##

(45) A mixture of 4-bromo-2-(2-fluorophenoxy) benzoic acid (5.1 g, 16.4 mmol, crude prepared above) and H.sub.2SO.sub.4 (50.0 mL) was stirred at 100 C. for 16 hours. The mixture was poured into ice (100.0 g) and extracted with EtOAc (400 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated under reduced pressure to give 3-bromo-5-fluoro-xanthen-9-one (3.2 g, crude) as a white solid, which was used in next step without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 293.0.

Intermediate 4: 3-bromo-5-chloro-2-methyl-xanthen-9-one

(46) ##STR00030##

(47) Intermediate 4 was prepared in analogy to the procedure described for the preparation of intermediate 3 by using methyl 3-chloro-2-fluoro-benzoate and 3-bromo-4-methyl-phenol as the starting materials instead of methyl 4-bromo-2-fluoro-benzoate and 2-fluorophenol in Step 2.

Intermediate 5: 3-bromo-2-chloro-5-fluoro-xanthen-9-one

(48) ##STR00031##

(49) Intermediate 5 was prepared in analogy to the procedure described for the preparation of intermediate 2 by using 4-bromo-5-chloro-2-fluoro-benzoic acid as the starting material instead of 4-bromo-2-fluoro-5-methyl-benzoic acid in Step 1.

Intermediate 6: 6-bromo-2-chloro-4-fluoro-xanthen-9-one

(50) ##STR00032##

(51) Intermediate 6 was prepared in analogy to the procedure described for the preparation of intermediate 3 by using 4-chloro-2-fluoro-phenol as the starting material instead of 2-fluorophenol in Step 2.

Intermediate 7: 3-bromo-5-(trifluoromethyl)xanthen-9-one

(52) ##STR00033##

(53) Intermediate 7 was prepared in analogy to the procedure described for the preparation of intermediate 3 by using 2-(trifluoromethoxy)phenol as the starting material instead of 2-fluorophenol in Step 2.

Intermediate 8: 6-bromo-4-chloro-1-methoxy-xanthen-9-one

(54) ##STR00034##

(55) Intermediate 8 was prepared in analogy to the procedure described for the preparation of intermediate 3 by using 2-chloro-5-methoxy-phenol as the starting material instead of 2-fluorophenol in Step 2.

Intermediate 9: 6-bromo-1-chloro-4-fluoro-xanthen-9-one

(56) ##STR00035##

(57) Intermediate 9 was prepared in analogy to the procedure described for the preparation of intermediate 3 by using 5-chloro-2-fluoro-phenol as the starting material instead of 2-fluorophenol in Step 2.

Intermediate 10: 6-bromo-1,4-dichloro-xanthen-9-one

(58) ##STR00036##

(59) Intermediate 10 was prepared in analogy to the procedure described for the preparation of intermediate 3 by using 2,5-dichlorophenol as the starting material instead of 2-fluorophenol in Step 2.

Intermediate 11: 6-bromo-4-chloro-1-methyl-xanthen-9-one

(60) ##STR00037##

(61) Intermediate 11 was prepared in analogy to the procedure described for the preparation of intermediate 3 by using 2-dichloro-5-methyl-phenol as the starting material instead of 2-fluorophenol in Step 2.

Intermediate 12: 3,6-dichlorochromeno[3,2-c]pyridin-10-one

(62) ##STR00038##

(63) Intermediate 12 was prepared in analogy to the procedure described for the preparation of intermediate 3 by using methyl 4,6-dichloropyridine-3-carboxylate and 2-chlorophenol as the starting materials instead of methyl 4-bromo-2-fluoro-benzoate and 2-fluorophenol in Step 2.

Intermediate 13: 3-bromo-5-chloro-2-fluoro-xanthen-9-one

(64) ##STR00039##

(65) Intermediate 13 was prepared in analogy to the procedure described for the preparation of intermediate 3 by using 4-bromo-2,5-difluoro-benzoic acid as the starting material instead of 4-bromo-2-fluoro-5-methyl-benzoic acid in Step 1 and using 2-chlorophenol as the starting material instead of 2-fluorophenol in Step 2.

Intermediate 14: 3-bromo-2,5-dichloro-xanthen-9-one

(66) ##STR00040##

(67) Intermediate 14 was prepared in analogy to the procedure described for the preparation of intermediate 3 by using 3-chloro-2-fluoro-benzoic acid as the starting material instead of 4-bromo-2-fluoro-5-methyl-benzoic acid in Step 1 and using 3-bromo-4-chloro-phenol as the starting material instead of 2-fluorophenol in Step 2.

Intermediate 15: 6-bromo-4-chloro-9-oxo-xanthene-1-carbonitrile

(68) ##STR00041##

(69) Step 1: Preparation of 6-bromo-4-chloro-1-fluoro-xanthen-9-one

(70) ##STR00042##

(71) 6-Bromo-4-chloro-1-fluoro-xanthen-9-one was prepared in analogy to the procedure described for the preparation of intermediate 3 by using 2-chloro-5-fluoro-phenol as the starting material instead of 2-fluorophenol in Step 2.

Step 2: Preparation of 6-bromo-4-chloro-9-oxo-xanthene-1-carbonitrile

(72) ##STR00043##

(73) To a mixture of methyl 4-bromo-2-fluoro-5-methyl-benzoate (0.3 g, 0.920 mmol) in DMSO (3.0 mL) was added NaCN (30.0 mg, 0.612 mmol) at 25 C. After being stirred at 90 C. for 16 hours, the resulting mixture was poured into water (20.0 mL) and then extracted with EtOAc (50.0 mL). The organic phase was dried over Na.sub.2SO.sub.4 and concentrated under reduced pressure. The residue was purified by column chromatograph on silica gel (elution with PE:EtOAc=20:1 to 5:1) to give 6-bromo-4-chloro-9-oxo-xanthene-1-carbonitrile (0.1 g, 32.6%) as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 323.9.

Intermediate 16: 3-bromo-2,5-difluoro-xanthen-9-one

(74) ##STR00044##

(75) Intermediate 16 was prepared in analogy to the procedure described for the preparation of intermediate 2 by using 4-bromo-2,5-difluoro-benzoic acid as the starting material instead of 4-bromo-2-fluoro-5-methyl-benzoic acid in Step 1.

Intermediate 17: 2-chloro-9-fluoro-chromeno[2,3-b]pyridin-5-one

(76) ##STR00045##

(77) Intermediate 17 was prepared in analogy to the procedure described for the preparation of intermediate 2 by using 4,6-dichloropyridine-3-carboxylic acid as starting material instead of 4-bromo-2-fluoro-5-methyl-benzoic acid in the Step 1.

Intermediate 18: 6-bromo-4-chloro-1-(trifluoromethyl)xanthen-9-one

(78) ##STR00046##

(79) Intermediate 18 was prepared in analogy to the procedure described for the preparation of intermediate 3 by using 2-chloro-5-(trifluoromethyl)phenol as the starting material instead of 2-fluorophenol in Step 2.

Intermediate 19: 3-bromo-2-chloro-5-fluoro-xanthen-9-one

(80) ##STR00047##

(81) Intermediate 19 was prepared in analogy to the procedure described for the preparation of intermediate 1 by using 2,3-difluorobenzaldehyde and 3-bromo-4-chloro-phenol as the starting materials instead of 3-chloro-2-fluoro-benzaldehyde and 3-bromophenol in Step 1.

Example 1: 5-chloro-3-pyrrolidin-1-yl-xanthen-9-one

(82) ##STR00048##

(83) To a mixture of 3-bromo-5-chloro-xanthen-9-one (intermediate 1, 0.1 g, 0.325 mmol) in NMP (2 mL) was added pyrrolidine (46.2 mg, 0.650 mmol) and K.sub.3PO.sub.4 (0.14 g, 0.650 mmol) at 25 C. Then the mixture was stirred at 90 C. for 16 hours. The resulting mixture was poured into water (30 mL) and extracted with EtOAc (50 mL) for three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated under reduced pressure. The residue was purified by recrystallization (EtOAc, 10 mL) to give 5-chloro-3-pyrrolidin-1-yl-xanthen-9-one (33.0 mg, 33.8%) as a yellow solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6): ppm 8.091-8.071 (d, J=8.0 Hz, 1H), 7.973-7.933 (m, 2H), 7.425-7.386 (m, 1H), 6.784-6.757 (m, 1H), 6.509-6.505 (d, J=1.6 Hz, 1H), 3.449-3.418 (t, J=6.8 Hz, 4H), 2.032-1.998 (t, J=6.5 Hz, 4H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 300.1.

Example 2: 1-(5-chloro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid

(84) ##STR00049##

(85) To a mixture of 3-bromo-5-chloro-xanthen-9-one (intermediate 1, 0.07 g, 0.226 mmol) in NMP (2.0 mL) was added pyrrolidine-3-carboxylic acid (39.1 mg, 0.339 mmol, vendor: Accela ChemBio Inc., CAS #: 59378-87-9, Cat.#: as SY008997) and K.sub.3PO.sub.4 (0.096 g, 0.452 mmol) at 25 C. Then the mixture was stirred at 90 C. for 16 hours. The resulting mixture was poured into water (30 mL) and extracted with EtOAc (50 mL) for three times. The combined organic phase was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated under reduced pressure. The residue was purified by preparative HPLC to give 1-(5-chloro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid (35.0 mg, 45.0%) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 12.61 (br s, 1H), 8.08 (dd, J=7.9, 1.6 Hz, 1H), 7.83-8.01 (m, 2H), 7.41 (t, J=7.8 Hz, 1H), 6.78 (dd, J=9.0, 2.3 Hz, 1H), 6.54 (d, J=2.3 Hz, 1H), 3.56-3.76 (m, 2H), 3.42-3.56 (m, 2H), 3.22-3.31 (m, 1H), 2.12-2.40 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 344.1.

Example 3: (3R)-1-(5-chloro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid

(86) ##STR00050##

(87) To a mixture of 3-bromo-5-chloro-xanthen-9-one (intermediate 1, 0.12 g, 0.388 mmol) in NMP (5.0 mL) was added (R)-pyrrolidine-3-carboxylic acid (89.3 mg, 0.775 mmol, vendor: Accela ChemBio Inc., CAS #: 72580-54-2, Cat.#: as SY010178) and K.sub.3PO.sub.4 (0.165 g, 0.452 mmol) at 25 C. Then the mixture was stirred at 90 C. for 16 hours. The resulting mixture was poured into water (30 mL) and extracted with EtOAc (50 mL) for three times. The combined organic phase was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated under reduced pressure. The residue was purified by preparative HPLC to give (3R)-1-(5-chloro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid (48.0 mg, 36.0%) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 12.60 (br s, 1H), 8.07 (dd, J=1.59, 7.95 Hz, 1H), 7.94 (t, J=9.51 Hz, 2H), 7.40 (t, J=7.89 Hz, 1H), 6.77 (dd, J=2.26, 8.99 Hz, 1H), 6.52 (d, J=2.20 Hz, 1H), 3.57-3.68 (m, 2H), 3.37-3.54 (m, 2H), 3.23-3.31 (m, 1H), 2.16-2.33 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 343.9.

Example 4: (3S)-1-(5-chloro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid

(88) ##STR00051##

(89) To a mixture of 3-bromo-5-chloro-xanthen-9-one (intermediate 1, 0.10 g, 0.323 mmol) in NMP (5.0 mL) was added (S)-pyrrolidine-3-carboxylic acid (74.4 mg, 0.646 mmol, vendor: Accela ChemBio Inc., CAS #: 72580-53-1, Cat.#: as SY010177) and K.sub.3PO.sub.4 (0.137 g, 0.646 mmol) at 25 C. Then the mixture was stirred at 90 C. for 16 hours. The resulting mixture was poured into water (30 mL) and extracted with EtOAc (50 mL) for three times. The combined organic phase was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated under reduced pressure. The residue was purified by preparative HPLC to give (3S)-1-(5-chloro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid (48.0 mg, 30.6%) as a yellow solid. .sup.1H NMR (methanol-d.sub.4, 400 MHz): ppm 8.15 (dd, J=1.51, 8.03 Hz, 1H), 8.06 (d, J=8.78 Hz, 1H), 7.84 (dd, J=1.51, 7.78 Hz, 1H), 7.36 (t, J=7.91 Hz, 1H), 6.78 (dd, J=2.26, 9.03 Hz, 1H), 6.57 (d, J=2.26 Hz, 1H), 3.72 (d, J=6.78 Hz, 2H), 3.42-3.66 (m, 2H), 3.34-3.40 (m, 1H), 2.29-2.57 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 344.0.

Example 5: 1-(5-fluoro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid

(90) ##STR00052##

Step 1: Preparation of Methyl 1-(5-fluoro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylate

(91) ##STR00053##

(92) A mixture of 3-bromo-5-fluoro-xanthen-9-one (intermediate 3, 0.2 g, 0.68 mmol), methyl pyrrolidine-3-carboxylate hydrochloride (0.264 g, 2.05 mmol, vendor: Accela ChemBio Inc., CAS #: 198959-37-4, Cat.#: as SY008084), K.sub.2CO.sub.3 (0.189 g, 1.36 mmol), Cu (0.26 g, 4.09 mmol) in DMF (4.0 mL) was stirred at 140 C. for 10 hours. The mixture was cooled to room temperature and filtered, and the filtrate was partitioned between ethyl acetate (20 mL) and water (20 mL). The organic phase was separated out and the aqueous phase was extracted with EtOAc (30 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated under reduced pressure to give the crude of methyl 1-(5-fluoro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylate (0.12 g) as a brown oil, which was used in the next step without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 342.2.

Step 2: Preparation of 1-(5-fluoro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid

(93) ##STR00054##

(94) A mixture of methyl 1-(5-fluoro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylate (0.12 g, 0.35 mmol, crude, prepared above), NaOH (0.07 g, 1.76 mmol) in a mixed solvent of THF (2 mL), MeOH (2 mL) and water (0.5 mL) was stirred at 50 C. for 3 hours. The resulting mixture was adjusted to pH around 4 with 2N HCl and then extracted with EtOAc (25 mL). The organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated under reduced pressure to give the crude of 1-(5-fluoro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid, which was recrystallized in MeOH to give 1-(5-fluoro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid (0.024 g, 20.8%) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 12.43-12.81 (m, 1H), 7.88-7.98 (m, 2H), 7.68-7.77 (m, 1H), 7.32-7.41 (m, 1H), 6.72-6.79 (m, 1H), 6.55 (d, J=1.5 Hz, 1H), 3.56-3.68 (m, 2H), 3.44-3.51 (m, 2H), 3.22-3.28 (m, 1H), 2.16-2.31 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 328.2.

Example 6: 1-(5-chloro-9-oxo-thioxanthen-3-yl)pyrrolidine-3-carboxylic acid

(95) ##STR00055##

(96) Example 6 was prepared according to Scheme 6:

(97) ##STR00056##

Step 1: Preparation of 4-bromo-2-(2-chlorophenyl)sulfanyl-benzonitrile

(98) ##STR00057##

(99) To a solution of 4-bromo-2-fluoro-benzonitrile (0.8 g, 4.0 mmol), 2-chlorobenzenethiol (0.58 g, 4.0 mmol) in dioxane (15 mL) was added K.sub.2CO.sub.3 (1.7 g, 12.0 mmol) at 25 C. After being stirred at 60 C. for 10 hours, the resulting mixture was filtered and the filtrate was concentrated under reduced pressure. The residue was stirred with petroleum ether (30 mL) and then filtered to give 4-bromo-2-(2-chlorophenyl)sulfanyl-benzonitrile (0.7 g, 54.3%) as a white solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 324.1.

Step 2: Preparation of 4-bromo-2-(2-chlorophenyl)sulfanyl-benzoic acid

(100) ##STR00058##

(101) To a solution of 4-bromo-2-(2-chlorophenyl)sulfanyl-benzonitrile (200.0 mg, 0.616 mmol) in EtOH (5.0 mL) was added aqueous NaOH solution (3 mol/L, 5 mL, 15 mmol) and the mixture was stirred at 90 C. for 10 hours. Then the resulting mixture was adjusted to pH=4 with conc. HCl to yield a white suspension. The suspension was then filtered and the solid was collected and dried in vacuo to give 4-bromo-2-(2-chlorophenyl)sulfanyl-benzoic acid (150.0 mg, 70.8%) as a white solid.

Step 3: Preparation of 3-bromo-5-chloro-thioxanthen-9-one

(102) ##STR00059##

(103) A solution of 4-bromo-2-(2-chlorophenyl)sulfanyl-benzoic acid (100 mg, 0.29 mmol) in condensed sulfuric acid (5 mL) was stirred at 90 C. for 8 hours under N.sub.2 atmosphere. The reaction mixture was poured into water (25 mL). The resulting mixture was extracted with EtOAc (30 mL) three times. The combined organic layer was washed by brine (20 mL), dried over anhydrous Na.sub.2SO.sub.4 and concentrated under reduced pressure to afford the crude of 3-bromo-5-chloro-thioxanthen-9-one (100 mg, 100%) as a white solid. The crude product was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 326.9.

Step 4: Preparation of Methyl 1-(5-chloro-9-oxo-thioxanthen-3-yl)pyrrolidine-3-carboxylate

(104) ##STR00060##

(105) To a solution of 3-bromo-5-chloro-thioxanthen-9-one (50.0 mg, 0.154 mmol) in DMF (2.0 mL) was added methyl pyrrolidine-3-carboxylate (50.0 mg, 0.3 mmol) and Na.sub.2CO.sub.3 (163.0 mg, 1.54 mmol), then the mixture was stirred at 110 C. for 12 hours. The reaction mixture was then filtered and the filtrate was concentrated under reduced pressure to give the crude of methyl 1-(5-chloro-9-oxo-thioxanthen-3-yl)pyrrolidine-3-carboxylate (50.0 mg, 86.8%), which was used in the next step without further purification.

Step 5: Preparation of 1-(5-chloro-9-oxo-thioxanthen-3-yl)pyrrolidine-3-carboxylic acid

(106) ##STR00061##

(107) To a solution of methyl 1-(5-chloro-9-oxo-thioxanthen-3-yl)pyrrolidine-3-carboxylate (50.0 mg, 0.154 mmol) in H.sub.2O (1.0 mL) and DMF (5.0 mL) was added NaOH (61.6 mg, 1.54 mmol) and the mixture was stirred at 25 C. for 12 hours. The mixture was poured into water (50 mL) and adjusted to pH=5-6 by addition of hydrochloric acid (2 mol/L). The resulting mixture was extracted with DCM (50 mL) three times. The combined organic layer was concentrated under reduced pressure. The residue was purified by column chromatography on silica gel (elution with DCM:MeOH=20:1) to give 1-(5-chloro-9-oxo-thioxanthen-3-yl)pyrrolidine-3-carboxylic acid (31.0 mg, 55.9%) as a yellow solid. .sup.1H NMR (methanol-d.sub.4, 400 MHz): ppm 8.39-8.51 (m, 1H), 8.30 (d, J=9.0 Hz, 1H), 7.73 (s, 1H), 7.46 (t, J=8.0 Hz, 1H), 6.81 (dd, J=9.2, 2.3 Hz, 1H), 6.69 (d, J=2.3 Hz, 1H), 3.67 (d, J=7.0 Hz, 2H), 3.43-3.61 (m, 2H), 3.34-3.38 (m, 1H), 2.27-2.44 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 360.0.

Example 7: 1-(5-bromo-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid

(108) ##STR00062##

(109) Example 7 was prepared according to Scheme 7.

(110) ##STR00063##

Step 1: Preparation of 4-bromo-2-(2-bromophenoxy)benzonitrile

(111) ##STR00064##

(112) To a mixture of 2-bromophenol (3.0 g, 15.08 mmol) and 4-bromo-2-fluoro-benzonitrile (2.85 g, 16.59 mmol) in DMF (40 mL) was added K.sub.2CO.sub.3 (4.17 g, 30.16 mmol) and Cu (5.8 g, 90.48 mmol) at 25 C. After being stirred at 60 C. for 16 hours, the resulting mixture was poured into water (50 mL) and extracted with EtOAc (100 mL) three times. The combined organic layer was dried over anhydrous Na.sub.2SO.sub.4 and concentrated under reduced pressure to give the crude of 4-bromo-2-(2-bromophenoxy)benzonitrile (4.2 g, 78.7%) as a yellow oil, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 353.9.

Step 2: Preparation of 4-bromo-2-(2-bromophenoxy)benzoic acid

(113) ##STR00065##

(114) To a mixture of 4-bromo-2-(2-bromophenoxy)benzonitrile (2.0 g, 5.7 mmol) in dioxane (15 mL) and H.sub.2O (15 mL) was added NaOH (0.68 g, 17.1 mmol) at 25 C. After being stirred at 90 C. for 16 hours, the resulting mixture was poured into water (50 mL) and adjusted to pH=7 with conc. HCl and then extracted with EtOAc (100 mL) three times. The combined organic layer was dried over anhydrous Na.sub.2SO.sub.4 and concentrated under reduced pressure to give the crude of 4-bromo-2-(2-bromophenoxy)benzoic acid (1.5 g, 70.5%) as a brown oil, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 373.0.

Step 3: Preparation of 3,5-dibromoxanthen-9-one

(115) ##STR00066##

(116) A solution of 4-bromo-2-(2-bromophenoxy)benzoic acid (0.5 g, 1.352 mmol) in condensed sulfuric acid (10 mL) was stirred at 90 C. for 15 hours under N.sub.2 atmosphere. The reaction mixture was poured into water (50 mL). The resulting mixture was extracted with EtOAc (60 mL) three times. The combined organic layer was dried over anhydrous Na.sub.2SO.sub.4 and concentrated under reduced pressure to afford the crude of 3,5-dibromoxanthen-9-one (0.4 g, 65.8%) as a yellow solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 354.1.

Step 4: Preparation of Methyl 1-(5-bromo-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylate

(117) ##STR00067##

(118) To a mixture of 3,5-dibromoxanthen-9-one (0.2 g, 0.568 mmol) and methyl pyrrolidine-3-carboxylate (73.4 mg, 0.568 mmol) in DMF (3 mL) was added K.sub.2CO.sub.3 (0.12 g, 0.853 mmol) at 25 C. After being stirred at 90 C. for 16 hours, the resulting mixture was poured into water (50 mL) and extracted with EtOAc (300 mL). The organic phase was dried over anhydrous Na.sub.2SO.sub.4 and concentrated under reduced pressure to give the crude of methyl 1-(5-bromo-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylate (0.2 g, 87.5%) as a yellow solid, which was used in the next step without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 402.1.

Step 5: Preparation of 1-(5-bromo-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid

(119) ##STR00068##

(120) To a mixture of methyl 1-(5-bromo-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylate (0.2 g, 0.499 mmol, crude, prepared above) in a mixed solvent of THF (3 mL) and H.sub.2O (2 mL) was added LiOH.H.sub.2O (62.9 mg, 1.496 mmol) at 25 C. and the mixture was then stirred at 25 C. for 16 hours. The resulting mixture was poured into water (50 mL) and adjusted to pH=5-6 by addition of hydrochloric acid (2 mol/L). The resulting mixture was extracted with EtOAc (300 mL). The organic phase washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated under reduced pressure to give the crude of 1-(5-fluoro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid, which was recrystallized in EtOAc (20 mL) to give 1-(5-bromo-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid (0.07 g, 36.0%) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 8.12-8.06 (m, 2H), 7.96-7.94 (d, J=8.8 Hz, 1H), 7.36-7.32 (t, 1H), 6.78-6.75 (t, 1H), 6.50-6.50 (d, J=2.0 Hz, 1H), 3.66-3.61 (m, 2H), 3.50-3.47 (m, 2H), 3.27-3.25 (m, 1H), 2.29-2.20 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 389.1.

Example 8: 2-[1-(5-chloro-9-oxo-xanthen-3-yl)pyrrolidin-3-yl]acetic Acid

(121) ##STR00069##

(122) Example 8 was prepared in analogy to the procedure described for the preparation of Example 2 by using 2-pyrrolidin-3-ylacetic acid as the starting material instead of pyrrolidine-3-carboxylic acid in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 12.12-12.39 (m, 1H), 8.04-8.12 (m, 1H), 7.89-8.00 (m, 2H), 7.35-7.46 (m, 1H), 6.68-6.78 (m, 1H), 6.41-6.50 (m, 1H), 3.61-3.70 (m, 1H), 3.49-3.59 (m, 1H), 3.37-3.48 (m, 1H), 3.06-3.16 (m, 1H), 2.61-2.73 (m, 1H), 2.43-2.48 (m, 2H), 2.16-2.28 (m, 1H), 1.64-1.82 (m, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 358.0.

Example 9: 5-fluoro-3-(1-piperidyl)xanthen-9-one

(123) ##STR00070##

(124) Example 9 was prepared in analogy to the procedure described for the preparation of Example 1 by using 3-bromo-5-fluoro-xanthen-9-one (intermediate 3) and piperidine as the starting materials instead of 3-bromo-5-chloro-xanthen-9-one (intermediate 1) and pyrrolidine in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 7.86-8.03 (m, 2H), 7.75 (ddd, J=11.04, 8.03, 1.25 Hz, 1H), 7.39 (td, J=8.03, 4.52 Hz, 1H), 7.11 (dd, J=9.29, 2.26 Hz, 1H), 6.93 (d, J=2.26 Hz, 1H), 3.47-3.59 (m, 4H), 1.53-1.70 (m, 6H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 298.1.

Example 10: 5-chloro-3-[3-(hydroxymethyl)pyrrolidin-1-yl]xanthen-9-one

(125) ##STR00071##

(126) Example 10 was prepared in analogy to the procedure described for the preparation of Example 1 by using pyrrolidin-3-ylmethanol as the starting material instead of pyrrolidine in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 8.08 (dd, J=7.9, 1.6 Hz, 1H), 7.88-8.01 (m, 2H), 7.40 (t, J=7.8 Hz, 1H), 6.76 (dd, J=9.0, 2.3 Hz, 1H), 6.39-6.56 (m, 1H), 4.78 (t, J=5.3 Hz, 1H), 3.38-3.60 (m, 4H), 3.23 (dd, J=10.2, 6.7 Hz, 1H), 2.44-2.48 (m, 1H), 1.97-2.19 (m, 1H), 1.83 (br dd, J=12.2, 7.2 Hz, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 330.1.

Example 11: Methyl 1-(5-chloro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylate

(127) ##STR00072##

(128) Example 11 was prepared in analogy to the procedure described for the preparation of Example 1 by using methyl pyrrolidine-3-carboxylate as the starting material instead of pyrrolidine in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 8.08 (dd, J=1.63, 7.91 Hz, 1H), 7.92-8.00 (m, 2H), 7.38-7.44 (m, 1H), 6.76-6.82 (m, 1H), 6.55 (d, J=2.26 Hz, 1H), 3.70-3.75 (m, 1H), 3.68 (s, 3H), 3.58-3.65 (m, 1H), 3.46-3.57 (m, 2H), 3.37-3.43 (m, 1H), 2.27-2.36 (m, 1H), 2.17-2.27 (m, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 358.1.

Example 12: 5-chloro-3-(3-hydroxy-1-piperidyl)xanthen-9-one

(129) ##STR00073##

(130) Example 12 was prepared in analogy to the procedure described for the preparation of Example 1 by using piperidin-3-ol as the starting material instead of pyrrolidine in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 8.08 (dd, J=8.0, 1.5 Hz, 1H), 7.87-7.99 (m, 2H), 7.41 (t, J=7.8 Hz, 1H), 7.09 (dd, J=9.2, 2.4 Hz, 1H), 6.86 (d, J=2.5 Hz, 1H), 4.93 (d, J=4.0 Hz, 1H), 3.70-3.95 (m, 2H), 3.60 (td, J=8.3, 4.0 Hz, 1H), 3.08-3.23 (m, 1H), 3.03 (dd, J=12.8, 8.5 Hz, 1H), 1.84-1.99 (m, 1H), 1.69-1.84 (m, 1H), 1.37-1.60 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 330.1.

Example 13: 3-(azepan-1-yl)-5-fluoro-xanthen-9-one

(131) ##STR00074##

(132) Example 13 was prepared in analogy to the procedure described for the preparation of Example 1 by using 3-bromo-5-fluoro-xanthen-9-one (intermediate 3) and azepane as the starting materials instead of 3-bromo-5-chloro-xanthen-9-one (intermediate 1) and pyrrolidine in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 8.02 (d, J=9.3 Hz, 1H), 7.97 (dt, J=8.0, 1.4 Hz, 1H), 7.55 (ddd, J=10.8, 8.0, 1.5 Hz, 1H), 7.27-7.37 (m, 1H), 6.90 (dd, J=9.2, 2.4 Hz, 1H), 6.67 (d, J=2.5 Hz, 1H), 3.57-3.71 (m, 3H), 3.33 (dt, J=3.3, 1.6 Hz, 3H), 1.87 (br s, 3H), 1.54-1.69 (m, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 312.1.

Example 14: 1-(5-chloro-9-oxo-xanthen-3-yl)piperidine-3-carboxylic acid

(133) ##STR00075##

(134) Example 14 was prepared in analogy to the procedure described for the preparation of Example 2 by using piperidine-3-carboxylic acid as the starting material instead of pyrrolidine-3-carboxylic acid in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 12.47 (s, 1H), 8.08 (dd, J=7.9, 1.6 Hz, 1H), 7.87-7.98 (m, 2H), 7.40 (t, J=7.9 Hz, 1H), 7.13 (dd, J=9.2, 2.4 Hz, 1H), 6.91 (d, J=2.3 Hz, 1H), 4.01 (dd, J=13.4, 3.4 Hz, 1H), 3.86 (br d, J=13.1 Hz, 1H), 3.25-3.41 (m, 1H), 3.09-3.24 (m, 1H), 2.53-2.61 (m, 1H), 1.91-2.04 (m, 1H), 1.67-1.80 (m, 2H), 1.46-1.63 (m, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 358.1.

Example 15: (3R,4S)-1-(5-chloro-9-oxo-xanthen-3-yl)-4-(4-fluorophenyl)pyrrolidine-3-carboxylic Acid

(135) ##STR00076##

(136) Example 15 was prepared in analogy to the procedure described for the preparation of Example 2 by using (3S,4R)-4-(4-fluorophenyl)pyrrolidine-3-carboxylic acid (CAS #: 1047651-77-3) as the starting material instead of pyrrolidine-3-carboxylic acid in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 8.15 (br d, J=6.52 Hz, 1H), 8.09 (br d, J=8.78 Hz, 1H), 7.81-7.86 (m, 1H), 7.41-7.49 (m, 2H), 7.36 (s, 1H), 7.06-7.12 (m, 2H), 6.80-6.86 (m, 1H), 6.60-6.64 (m, 1H), 3.88-4.08 (m, 4H), 3.79 (m, 1H), 3.57 (m, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 438.0.

Example 16: 1-(5-chloro-9-oxo-xanthen-3-yl)-3-methyl-pyrrolidine-3-carboxylic Acid

(137) ##STR00077##

(138) Example 16 was prepared in analogy to the procedure described for the preparation of Example 2 by using 3-methylpyrrolidine-3-carboxylic acid (CAS #: 885953-27-5) as the starting material instead of pyrrolidine-3-carboxylic acid in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 12.68 (br s, 1H), 8.08 (dd, J=7.9, 1.6 Hz, 1H), 7.80-8.01 (m, 2H), 7.41 (t, J=7.9 Hz, 1H), 6.77 (dd, J=8.9, 2.1 Hz, 1H), 6.53 (d, J=2.3 Hz, 1H), 3.85 (d, J=10.5 Hz, 1H), 3.37-3.69 (m, 3H), 2.36-2.48 (m, 1H), 1.86-2.05 (m, 1H), 1.36 (s, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 358.1.

Example 17: 1-(5-chloro-9-oxo-xanthen-3-yl)-4,4-dimethyl-pyrrolidine-3-carboxylic Acid

(139) ##STR00078##

(140) Example 17 was prepared in analogy to the procedure described for the preparation of Example 2 by using 4,4-dimethylpyrrolidine-3-carboxylic acid (CAS #: 261896-35-9) as the starting material instead of pyrrolidine-3-carboxylic acid in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 12.56-12.68 (m, 1H), 8.06-8.12 (m, 1H), 7.92-7.99 (m, 2H), 7.38-7.44 (m, 1H), 6.74-6.78 (m, 1H), 6.49-6.53 (m, 1H), 3.71 (d, J=8.03 Hz, 2H), 3.41 (d, J=10.04 Hz, 1H), 3.29 (s, 1H), 2.99 (t, J=8.03 Hz, 1H), 1.28 (s, 3H), 1.04 (s, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 372.0.

Example 18: (3R,4S)-1-(5-chloro-9-oxo-xanthen-3-yl)-4-(3-pyridyl)pyrrolidine-3-carboxylic Acid

(141) ##STR00079##

(142) Example 18 was prepared in analogy to the procedure described for the preparation of Example 2 by using (3R,4S)-4-(3-pyridyl)pyrrolidine-3-carboxylic acid (CAS #: 1330830-30-2) as the starting material instead of pyrrolidine-3-carboxylic acid in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 8.78 (br s, 1H), 8.57-8.70 (m, 1H), 8.18 (br d, J=6.8 Hz, 1H), 8.09 (dd, J=8.0, 1.5 Hz, 1H), 7.89-8.02 (m, 2H), 7.67 (br s, 1H), 7.42 (t, J=7.9 Hz, 1H), 6.85 (br d, J=8.8 Hz, 1H), 6.64 (s, 1H), 3.96-4.12 (m, 2H), 3.84-3.95 (m, 1H), 3.74 (brt, J=9.4 Hz, 1H), 3.54-3.66 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 421.1.

Example 19: 1-(5-chloro-9-oxo-xanthen-3-yl)-3-(trifluoromethyl)pyrrolidine-3-carboxylic Acid

(143) ##STR00080##

(144) Example 19 was prepared in analogy to the procedure described for the preparation of Example 2 by using 3-(trifluoromethyl)pyrrolidine-3-carboxylic acid (CAS #: 916423-57-9) as the starting material instead of pyrrolidine-3-carboxylic acid in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 14.12 (br s, 1H), 8.07-8.17 (m, 1H), 7.99 (br d, J=9.03 Hz, 2H), 7.42 (s, 1H), 6.82-6.90 (m, 1H), 6.65-6.72 (m, 1H), 4.06-4.16 (m, 1H), 3.86 (m, 1H), 3.64-3.74 (m, 1H), 3.52-3.61 (m, 1H), 2.64-2.72 (m, 1H), 2.40-2.48 (m, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 412.0.

Example 20: (3S,4R)-1-(5-chloro-9-oxo-xanthen-3-yl)-4-(4-chlorophenyl)pyrrolidine-3-carboxylic Acid

(145) ##STR00081##

(146) Example 20 was prepared in analogy to the procedure described for the preparation of Example 2 by using (3S,4R)-4-(4-chlorophenyl)pyrrolidine-3-carboxylic acid (CAS #: 1047651-82-0) as the starting material instead of pyrrolidine-3-carboxylic acid in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 12.73 (br s, 1H), 8.09 (dd, J=7.8, 1.5 Hz, 1H), 7.85-8.02 (m, 2H), 7.26-7.57 (m, 5H), 6.76-6.90 (m, 1H), 6.54-6.69 (m, 1H), 3.88-4.09 (m, 2H), 3.61-3.86 (m, 2H), 3.38-3.59 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 455.1.

Example 21: 5-fluoro-3-pyrrolidin-1-yl-xanthen-9-one

(147) ##STR00082##

(148) Example 21 was prepared in analogy to the procedure described for the preparation of Example 1 by using 3-bromo-5-fluoro-xanthen-9-one (intermediate 3) as the starting material instead of 3-bromo-5-chloro-xanthen-9-one (intermediate 1) in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 7.96 (d, J=9.03 Hz, 1H), 7.91 (d, J=8.03 Hz, 1H), 7.69-7.78 (m, 1H), 7.37 (td, J=7.91, 4.52 Hz, 1H), 6.75 (dd, J=9.03, 1.76 Hz, 1H), 6.55 (s, 1H), 3.42 (m., 4H), 2.01 (m, 4H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 284.1.

Example 22: 1-chloro-4-fluoro-6-pyrrolidin-1-ylxanthen-9-one

(149) ##STR00083##

(150) Example 22 was prepared in analogy to the procedure described for the preparation of Example 1 by using 6-bromo-1-chloro-4-fluoro-xanthen-9-one (intermediate 9) as the starting material instead of 3-bromo-5-chloro-xanthen-9-one (intermediate 1) in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 8.02-8.09 (m, 1H), 7.24 (s, 1H), 7.17 (br. s., 1H), 6.56 (dd, J=8.9, 2.2 Hz, 1H), 6.33 (d, J=1.9 Hz, 1H), 3.36 (t, J=6.4 Hz, 4H), 1.97-2.07 (m, 4H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 318.1.

Example 23: 1-(5-fluoro-9-oxo-xanthen-3-yl)pyrrolidin-2-one

(151) ##STR00084##

(152) Example 23 was prepared in analogy to the procedure described for the preparation of Example 1 by using 3-bromo-5-fluoro-xanthen-9-one (intermediate 3) and pyrrolidin-2-one as the starting materials instead of 3-bromo-5-chloro-xanthen-9-one (intermediate 1) and pyrrolidine in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 8.18-8.16 (d, J=8.8 Hz, 1H), 8.00-7.96 (m, 2H), 7.87-7.80 (m, 2H), 7.47-7.44 (m, 1H), 3.98-3.95 (t, 2H), 2.63-2.59 (t, 2H), 2.14-2.10 (t, 2H) MS obsd. (ESI.sup.+) [(M+H).sup.+]: 298.0.

Example 24: 5-fluoro-3-(3-hydroxypyrrolidin-1-yl)xanthen-9-one

(153) ##STR00085##

(154) Example 24 was prepared in analogy to the procedure described for the preparation of Example 1 by using 3-bromo-5-fluoro-xanthen-9-one (intermediate 3) and pyrrolidin-3-ol as the starting materials instead of 3-bromo-5-chloro-xanthen-9-one (intermediate 1) and pyrrolidine in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 7.98-7.95 (d, J=9.2 Hz, 1H), 7.92-7.90 (d, J=8.4 Hz, 1H), 7.76-7.72 (t, 1H), 7.41-7.37 (m, 1H), 6.76-6.73 (t, 1H), 6.54 (s, 1H), 5.12-5.11 (d, J=4.0 Hz, 1H), 4.46 (s, 1H), 3.57-3.53 (m, 3H), 3.35-3.27 (m, 1H), 2.10-2.05 (m, 1H), 1.99-1.98 (m, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 300.1.

Example 25: 5-fluoro-2-methyl-3-pyrrolidin-1-yl-xanthen-9-one

(155) ##STR00086##

(156) Example 25 was prepared in analogy to the procedure described for the preparation of Example 1 by using 3-bromo-5-fluoro-2-methyl-xanthen-9-one (intermediate 2) as the starting material instead of 3-bromo-5-chloro-xanthen-9-one (intermediate 1) in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 8.09 (td, J=1.3, 8.0 Hz, 1H), 7.97 (s, 1H), 7.44 (ddd, J=1.6, 8.0, 10.6 Hz, 1H), 7.28-7.23 (m, 1H), 6.68 (s, 1H), 3.58-3.52 (t, J=8.0 Hz, 4H), 2.52 (s, 3H), 2.05-2.02 (m, 4H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 298.1.

Example 26: 1-(5,8-dichloro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic Acid

(157) ##STR00087##

(158) Example 26 was prepared in analogy to the procedure described for the preparation of Example 5 by using 6-bromo-1,4-dichloro-xanthen-9-one (intermediate 10) as the starting material instead of 3-bromo-5-fluoro-xanthen-9-one (intermediate 3) in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 14.54-11.04 (m, 1H), 7.93-7.81 (m, 2H), 7.46-7.35 (m, 1H), 6.77-6.68 (m, 1H), 6.42 (s, 1H), 3.72-3.53 (m, 2H), 3.52-3.43 (m, 2H), 3.30-3.20 (m, 1H), 2.38-2.13 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 378.1.

Example 27: 5-chloro-3-[(3S)-3-hydroxypyrrolidin-1-yl]xanthen-9-one

(159) ##STR00088##

(160) Example 27 was prepared in analogy to the procedure described for the preparation of Example 1 by using (3S)-pyrrolidin-3-ol as the starting material instead of pyrrolidine in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 8.09-8.07 (d, J=7.6 Hz, 1H), 7.97-7.93 (t, 2H), 7.42-7.38 (t, 1H), 6.77-6.74 (d, J=8.8 Hz, 1H), 6.49 (s, 1H). 5.11-5.10 (d, J=3.6 Hz, 1H), 4.47 (s, 1H), 3.58-3.49 (m, 3H), 3.31-3.28 (m, 1H), 2.10-1.99 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 316.1.

Example 28: 2,5-difluoro-3-pyrrolidin-1-yl-xanthen-9-one

(161) ##STR00089##

(162) Example 28 was prepared in analogy to the procedure described for the preparation of Example 1 by using 3-bromo-2,5-difluoro-xanthen-9-one (intermediate 16) as the starting material instead of 3-bromo-5-chloro-xanthen-9-one (intermediate 1) in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 7.95 (d, J=8.0 Hz, 1H), 7.65 (d, J=14 Hz, 1H), 7.36-7.31 (m, 1H), 7.19-7.14 (m, 1H), 6.41 (d, J=7.0 Hz, 1H), 3.51-3.47 (m, 4H), 1.94 (t, J=6.5 Hz, 4H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 302.1.

Example 29: 5-fluoro-3-morpholino-xanthen-9-one

(163) ##STR00090##

(164) Example 29 was prepared in analogy to the procedure described for the preparation of Example 1 by using 3-bromo-5-fluoro-xanthen-9-one (intermediate 3) and morpholine as the starting materials instead of 3-bromo-5-chloro-xanthen-9-one (intermediate 1) and pyrrolidine in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 7.31 (d, J=9.29 Hz, 1H), 7.21 (d, J=8.03 Hz, 1H), 6.75-6.86 (m, 1H), 6.57 (td, J=7.91, 4.52 Hz, 1H), 6.33 (dd, J=9.16, 2.13 Hz, 1H), 6.19 (d, J=2.01 Hz, 1H), 3.01-3.12 (m, 4H), 2.64-2.74 (m, 4H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 300.0.

Example 30: 5-chloro-3-[(3R)-3-hydroxypyrrolidin-1-yl]xanthen-9-one

(165) ##STR00091##

(166) Example 30 was prepared in analogy to the procedure described for the preparation of Example 1 by using (3R)-pyrrolidin-3-ol as the starting material instead of pyrrolidine in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 8.09-8.07 (m, 1H), 7.98-7.93 (m, 2H), 7.43-7.39 (t, 1H), 6.77-6.75 (m, 1H), 6.50-6.49 (d, J=2.0 Hz, 1H), 5.11-5.10 (d, J=3.6 Hz, 1H), 4.46 (s, 1H), 3.57-3.49 (m, 3H), 3.31-3.28 (m, 1H), 2.14-1.99 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 316.1.

Example 31: 5-fluoro-3-[(3S)-3-hydroxypyrrolidin-1-yl]xanthen-9-one

(167) ##STR00092##

(168) Example 31 was prepared in analogy to the procedure described for the preparation of Example 1 by using 3-bromo-5-fluoro-xanthen-9-one (intermediate 3) and (3S)-pyrrolidin-3-ol as the starting materials instead of 3-bromo-5-chloro-xanthen-9-one (intermediate 1) and pyrrolidine in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 7.98-7.95 (d, J=9.2 Hz, 1H), 7.92-7.90 (d, J=8.4 Hz, 1H), 7.76-7.72 (m, 1H), 7.40-7.37 (m, 1H), 6.75-6.73 (t, 1H), 6.54 (s, 1H), 5.12-5.11 (d, J=4.0 Hz, 1H), 4.46 (s, 1H), 3.57-3.53 (m, 3H), 3.35-3.27 (m, 1H), 2.10-2.05 (m, 1H), 1.99-1.98 (m, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 300.1.

Example 32: 5-fluoro-3-[(3R)-3-hydroxypyrrolidin-1-yl]xanthen-9-one

(169) ##STR00093##

(170) Example 32 was prepared in analogy to the procedure described for the preparation of Example 1 by using 3-bromo-5-fluoro-xanthen-9-one (intermediate 3) and (3R)-pyrrolidin-3-ol as the starting materials instead of 3-bromo-5-chloro-xanthen-9-one (intermediate 1) and pyrrolidine in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 7.98-7.95 (d, J=9.2 Hz, 1H), 7.92-7.90 (d, J=8.0 Hz, 1H), 7.76-7.71 (m, 1H), 7.40-7.37 (m, 1H), 6.76-6.74 (d, J=9.2 Hz, 1H), 6.54 (s, 1H), 5.11-5.10 (d, J=5.2 Hz, 1H), 4.46 (s, 1H), 3.57-3.53 (m, 3H), 3.34-3.27 (m, 1H), 2.10-2.06 (m, 1H), 1.99-1.98 (m, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 300.1.

Example 33: 5-fluoro-3-(3-methoxypyrrolidin-1-yl)xanthen-9-one

(171) ##STR00094##

(172) Example 33 was prepared in analogy to the procedure described for the preparation of Example 1 by using 3-bromo-5-fluoro-xanthen-9-one (intermediate 3) and 3-methoxypyrrolidine as the starting materials instead of 3-bromo-5-chloro-xanthen-9-one (intermediate 1) and pyrrolidine in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 7.98-7.95 (d, J=9.2 Hz, 1H), 7.92-7.90 (d, J=8.0 Hz, 1H), 7.76-7.71 (m, 1H), 7.40-7.37 (m, 1H), 6.76-6.74 (d, J=9.2 Hz, 1H), 6.54 (s, 1H), 4.45 (s, 1H), 3.56-3.52 (m, 3H), 3.40 (s, 3H), 3.34-3.27 (m, 1H), 2.10-2.06 (m, 1H), 1.99-1.98 (m, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 314.1.

Example 34: 5-fluoro-3-[3-(4-pyridyl)pyrrolidin-1-yl]xanthen-9-one

(173) ##STR00095##

(174) Example 34 was prepared in analogy to the procedure described for the preparation of Example 1 by using 3-bromo-5-fluoro-xanthen-9-one (intermediate 3) and 4-pyrrolidin-3-ylpyridine (CAS #: 150281-47-3) as the starting materials instead of 3-bromo-5-chloro-xanthen-9-one (intermediate 1) and pyrrolidine in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 8.74-8.95 (m, 2H), 8.05-8.20 (m, 3H), 7.95-8.02 (m, 1H), 7.54-7.64 (m, 1H), 7.31-7.40 (m, 1H), 6.78-6.89 (m, 1H), 6.65 (br. s., 1H), 3.94-4.14 (m, 2H), 3.63-3.82 (m, 3H), 2.65-2.77 (m, 1H), 2.27-2.44 (m, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 361.2.

Example 35: 2-chloro-4-fluoro-6-pyrrolidin-1-yl-xanthen-9-one

(175) ##STR00096##

(176) Example 35 was prepared in analogy to the procedure described for the preparation of Example 1 by using 6-bromo-2-chloro-4-fluoro-xanthen-9-one (intermediate 6) as the starting material instead of 3-bromo-5-chloro-xanthen-9-one (intermediate 1) in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 8.12 (d, J=9.03 Hz, 1H), 8.01-8.06 (m, 1H), 7.41 (dd, J=9.91, 2.38 Hz, 1H), 6.63 (dd, J=9.03, 2.26 Hz, 1H), 6.43 (d, J=2.01 Hz, 1H), 3.43 (t, J=6.40 Hz, 4H), 2.01-2.18 (m, 4H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 318.1.

Example 36: 1-(5-chloro-9-oxo-xanthen-3-yl)pyrrolidine-2-carboxylic Acid

(177) ##STR00097##

(178) Example 36 was prepared in analogy to the procedure described for the preparation of Example 5 by using methyl pyrrolidine-2-carboxylate as the starting material instead of methyl pyrrolidine-3-carboxylate in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 8.04-8.11 (m, 1H), 7.90-8.01 (m, 2H), 7.36-7.45 (m, 1H), 6.64-6.79 (m, 1H), 6.33-6.56 (m, 1H), 4.39-4.54 (m, 1H), 3.56-3.65 (m, 1H), 3.46-3.53 (m, 1H), 2.27-2.38 (m, 1H), 2.08 (m., 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 343.9.

Example 37: 1-[9-oxo-5-(trifluoromethyl)xanthen-3-yl]pyrrolidine-3-carboxylic Acid

(179) ##STR00098##

(180) Example 37 was prepared in analogy to the procedure described for the preparation of Example 5 by using 3-bromo-5-(trifluoromethyl)xanthen-9-one (intermediate 7) as the starting material instead of 3-bromo-5-fluoro-xanthen-9-one (intermediate 3) in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 8.52 (d, J=7.8 Hz, 1H), 8.16 (d, J=9.0 Hz, 1H), 7.94 (d, J=7.5 Hz, 1H), 7.40 (t, J=7.7 Hz, 1H), 6.65 (dd, J=2.0, 9.0 Hz, 1H), 6.45 (d, J=2.0 Hz, 1H), 3.56-3.76 (m, 2H), 3.42-3.56 (m, 2H), 3.22-3.31 (m, 1H), 2.12-2.40 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 378.1.

Example 38: 5-fluoro-3-(4-methylpiperazin-1-yl)xanthen-9-one

(181) ##STR00099##

(182) Example 34 was prepared in analogy to the procedure described for the preparation of Example 1 by using 3-bromo-5-fluoro-xanthen-9-one (intermediate 3) and 1-methylpiperazine as the starting materials instead of 3-bromo-5-chloro-xanthen-9-one (intermediate 1) and pyrrolidine in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 7.86-8.05 (m, 2H), 7.73 (t, J=8.85 Hz, 1H), 7.38 (m, 1H), 7.11 (d, J=8.29 Hz, 1H), 6.94 (br. s., 1H), 3.46 (m, 4H), 2.43 (m, 4H), 2.22 (br. s., 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 313.1.

Example 39: 1-(5-chloro-2-methyl-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic Acid

(183) ##STR00100##

(184) Example 39 was prepared in analogy to the procedure described for the preparation of Example 5 by using 3-bromo-5-chloro-2-methyl-xanthen-9-one (intermediate 4) as the starting material instead of 3-bromo-5-fluoro-xanthen-9-one (intermediate 3) in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 8.05-8.10 (m, 1H), 7.94 (d, J=7.5 Hz, 1H), 7.78 (s, 1H), 7.40 (t, J=7.9 Hz, 1H), 6.64 (s, 1H), 3.67-3.77 (m, 2H), 3.52-3.60 (m, 2H), 3.10 (td, J=6.0, 2.0 Hz, 1H), 2.48 (br. s., 3H), 2.10-2.21 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 358.0.

Example 40: 1-(5-chloro-8-methyl-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic Acid

(185) ##STR00101##

(186) Example 40 was prepared in analogy to the procedure described for the preparation of Example 5 by using 6-bromo-4-chloro-1-methyl-xanthen-9-one (intermediate 11) as the starting material instead of 3-bromo-5-fluoro-xanthen-9-one (intermediate 3) in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 12.61 (s, 1H), 7.90-7.88 (d, J=8.8 Hz, 1H), 7.76-7.74 (d, J=8.0 Hz, 1H), 7.14-7.12 (d, J=8.0 Hz, 1H), 6.72-6.70 (d, J=8.4 Hz, 1H), 6.42 (s, 1H), 3.63-3.58 (m, 2H), 3.47-3.43 (m, 2H), 3.36-3.29 (m, 1H), 2.79 (s, 3H), 2.28-2.20 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 358.2.

Example 41: 1-(6-chloro-10-oxo-chromeno[3,2-c]pyridin-3-yl)pyrrolidine-3-carboxylic Acid

(187) ##STR00102##

(188) Example 41 was prepared in analogy to the procedure described for the preparation of Example 5 by using 3,6-dichlorochromeno[3,2-c]pyridin-10-one (intermediate 12) as the starting material instead of 3-bromo-5-fluoro-xanthen-9-one (intermediate 3) in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 12.58 (br. s., 1H), 8.88 (s, 1H), 8.05 (d, J=7.8 Hz, 1H), 7.95 (d, J=7.5 Hz, 1H), 7.41 (t, J=7.8 Hz, 1H), 6.39 (s, 1H), 3.52-3.86 (m, 4H), 3.14-3.27 (m, 1H), 2.06-2.36 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 345.2.

Example 42: 1-(5-chloro-2-fluoro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic Acid

(189) ##STR00103##

(190) Example 42 was prepared in analogy to the procedure described for the preparation of Example 5 by using 3-bromo-5-chloro-2-fluoro-xanthen-9-one (intermediate 13) as the starting material instead of 3-bromo-5-fluoro-xanthen-9-one (intermediate 3) in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 8.12-8.10 (d, J=8.0 Hz, 1H), 8.02-7.99 (d, J=8.0 Hz, 1H), 7.71-7.68 (d, J=6.8 Hz, 1H), 7.45-7.49 (m, 1H), 6.71-6.68 (d, J=6.8 Hz, 1H), 3.83-3.82 (m, 2H), 3.67-3.66 (m, 2H), 3.21-3.19 (m, 1H), 2.26-2.22 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 362.0.

Example 43: 1-(2,5-dichloro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic Acid

(191) ##STR00104##

(192) Example 43 was prepared in analogy to the procedure described for the preparation of Example 5 by using 3-bromo-2,5-dichloro-xanthen-9-one (intermediate 14) as the starting material instead of 3-bromo-5-fluoro-xanthen-9-one (intermediate 3) in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 7.70-8.10 (m, 3H), 7.33 (m, 1H), 6.60 (m, 1H), 3.80-3.91 (m, J=5.0 Hz, 1H), 3.68-3.77 (m, J=8.3 Hz, 1H), 3.61 (d, J=4.5 Hz, 2H), 2.89 (m, 1H), 1.99-2.24 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 378.0.

Example 44: 1-(5-chloro-8-cyano-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic Acid

(193) ##STR00105##

(194) Example 44 was prepared in analogy to the procedure described for the preparation of Example 5 by using 6-bromo-4-chloro-9-oxo-xanthene-1-carbonitrile (intermediate 15) as the starting material instead of 3-bromo-5-fluoro-xanthen-9-one (intermediate 3) in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 8.10-8.05 (m, 1H), 7.94-7.85 (m, 2H), 6.81-6.77 (m, 1H), 6.50-6.48 (d, J=9.6 Hz, 1H), 3.64-3.59 (m, 2H), 3.50-3.46 (m, 2H), 3.35-3.27 (m, 1H), 2.33-2.19 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 369.0.

Example 45: 6-fluoro-3-pyrrolidin-1-yl-chromeno[3,2-c]pyridin-10-one

(195) ##STR00106##

(196) Example 45 was prepared in analogy to the procedure described for the preparation of Example 1 by using 2-chloro-9-fluoro-chromeno[2,3-b]pyridin-5-one (intermediate 17) as the starting material instead of 3-bromo-5-chloro-xanthen-9-one (intermediate 1) in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 8.90 (s, 1H), 7.91-7.89 (d, J=8.0 Hz, 1H), 7.80-7.75 (m, 1H), 7.43-7.39 (m, 1H), 6.44 (s, 1H), 3.59 (m, 4H), 1.99 (m, 4H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 285.1.

Example 46: 1-(5-chloro-9-oxo-xanthen-3-yl)-N,N-dimethyl-pyrrolidine-3-carboxamide

(197) ##STR00107##

(198) To a solution of 1-(5-chloro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid (Example 3, 50 mg, 0.145 mmol) in DMF (5 mL) was added dimethylamine hydrochloride (17.8 mg, 218 mol), HATU (83 mg, 0.218 mmol) and N,N-diisopropylethylamine (56.4 mg, 0.465 mmol) at 25 C. Then the mixture was stirred at room temperature for 1 hour. The resulting mixture was poured into water (30 mL) and extracted with EtOAc (50 mL) for three times. The combined organic phase was washed with brine, dried over anhydrous Na.sub.2SO.sub.4, and concentrated under reduced pressure. The residue was purified by preparative HPLC to give 1-(5-chloro-9-oxo-xanthen-3-yl)-N,N-dimethyl-pyrrolidine-3-carboxamide as a solid (28.0 mg, 51.9%). .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 8.08 (dd, J=8.0, 1.5 Hz, 1H), 7.87-8.02 (m, 2H), 7.41 (t, J=7.9 Hz, 1H), 6.78 (dd, J=9.0, 2.3 Hz, 1H), 6.53 (d, J=2.0 Hz, 1H), 3.45-3.74 (m, 5H), 3.11 (s, 3H), 2.87 (s, 3H), 2.20-2.32 (m, 1H), 2.01-2.17 (m, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 371.1.

Example 47: 3-(2,6-diazaspiro[3.4]octan-6-yl)-5-fluoro-xanthen-9-one

(199) ##STR00108##

Step 1: Preparation of Tert-Butyl 7-(5-fluoro-9-oxo-xanthen-3-yl)-2,7-diazaspiro[3.4]octane-2-carboxylate

(200) ##STR00109##

(201) To a mixture of 3-bromo-5-fluoro-xanthen-9-one (0.1 g, 0.341 mmol) in NMP (2 mL) was added tert-butyl 2,6-diazaspiro[3.4]octane-2-carboxylate (86.9 mg, 0.341 mmol, vendor: PharmaBlock (Nanjing) R&D Co. Ltd, CAS #: 885270-84-8, Cat. #: as PB00717) and K.sub.3PO.sub.4 (0.145 g, 0.682 mmol) at 25 C. Then the mixture was stirred at 90 C. for 16 hours. The resulting mixture was poured into water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4, and concentrated under reduced pressure. The residue was purified by column chromatography on silica gel (elution with PE:EtOAc=20:1 to 1:1) to give tert-butyl 7-(5-fluoro-9-oxo-xanthen-3-yl)-2,7-diazaspiro[3.4]octane-2-carboxylate (50.0 mg, 34.5%), MS obsd. (ESI.sup.+) [(M+H).sup.+]: 425.1.

Step 2: Preparation of 3-(2,6-diazaspiro[3.4]octan-6-yl)-5-fluoro-xanthen-9-one

(202) ##STR00110##

(203) Tert-butyl 7-(5-fluoro-9-oxo-xanthen-3-yl)-2,7-diazaspiro[3.4]octane-2-carboxylate (50 mg, 118 mol) was dissolved in TFA/DCM (1:1) (5 mL) at 0 C. The reaction mixture was warmed to room temperature and stirred for 1 hour. The resulting mixture was concentrated under reduced pressure. The residue was purified by preparative HPLC to give 3-(2,6-diazaspiro[3.4]octan-6-yl)-5-fluoro-xanthen-9-one (20 mg, 39%) as a solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 8.35 (br s, 1H), 7.98 (d, J=8.8 Hz, 1H), 7.87-7.94 (m, 1H), 7.75 (ddd, J=11.0, 8.0, 1.5 Hz, 1H), 7.39 (td, J=8.0, 4.5 Hz, 1H), 6.57 (dd, J=8.8, 2.0 Hz, 1H), 6.46 (d, J=2.0 Hz, 1H), 3.92-4.13 (m, 4H), 3.06 (br t, J=6.9 Hz, 2H), 3.01-3.12 (m, 2H), 2.13 (br t, J=7.0 Hz, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 325.1.

Example 48: 3-(2,7-diazaspiro[4.4]nonan-2-yl)-5-fluoro-xanthen-9-one

(204) ##STR00111##

Step 1: Preparation of Tert-Butyl 7-(5-fluoro-9-oxo-xanthen-3-yl)-2,7-diazaspiro[4.4]nonane-2-carboxylate

(205) ##STR00112##

(206) To a mixture of 3-bromo-5-fluoro-xanthen-9-one (0.1 g, 0.341 mmol) in NMP (2 mL) was added tert-butyl 2,7-diazaspiro[4.4]nonane-2-carboxylate (116 mg, 0.512 mmol, vendor: Accela ChemBio Inc., CAS #: 236406-49-8, Cat. #: as SY009380) and K.sub.3PO.sub.4 (0.145 g, 0.682 mmol) at 25 C. Then the mixture was stirred at 90 C. for 16 hours. The resulting mixture was poured into water (30 mL) and extracted with EtOAc (50 mL) three times. The combined organic phase was washed with brine, dried over anhydrous Na.sub.2SO.sub.4, and concentrated under reduced pressure. The residue was purified by column chromatography on silica gel (elution with: PE:EtOAc=20:1 to 1:1) to give tert-butyl 7-(5-fluoro-9-oxo-xanthen-3-yl)-2,7-diazaspiro[4.4]nonane-2-carboxylate (55.0 mg, 36.8%), MS obsd. (ESI.sup.+) [(M+H).sup.+]: 439.1.

Step 2: Preparation of 3-(2,7-diazaspiro[4.4]nonan-2-yl)-5-fluoro-xanthen-9-one

(207) ##STR00113##

(208) Tert-butyl 7-(5-fluoro-9-oxo-xanthen-3-yl)-2,7-diazaspiro[4.4]nonane-2-carboxylate (50.0 mg, 0.114 mol) was dissolved in TFA/DCM (1:1) (5 mL) at 0 C. The reaction mixture was warmed to room temperature and stirred at room temperature for 1 hour. The resulting mixture was concentrated under reduced pressure The residue was purified by preparative HPLC to give 3-(2,7-diazaspiro[4.4]nonan-2-yl)-5-fluoro-xanthen-9-one (27 mg, 52%) as a solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 8.35 (s, 1H), 7.99 (d, J=8.8 Hz, 1H), 7.92 (d, J=8.0 Hz, 1H), 7.75 (ddd, J=11.0, 8.0, 1.5 Hz, 1H), 7.39 (td, J=8.0, 4.6 Hz, 1H), 6.73 (dd, J=9.0, 2.3 Hz, 1H), 6.54 (d, J=2.0 Hz, 1H), 3.44-3.57 (m, 4H), 3.35-3.43 (m, 2H), 3.16 (br t, J=7.2 Hz, 2H), 1.97-2.13 (m, 2H), 1.83-1.93 ppm (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 338.9.

Example 49: 3-(1,4-diazepan-1-yl)-5-fluoro-xanthen-9-one

(209) ##STR00114##

Step 1: Preparation of Tert-Butyl 4-(5-fluoro-9-oxo-xanthen-3-yl)-1,4-diazepane-1-carboxylate

(210) ##STR00115##

(211) To a mixture of 3-bromo-5-fluoro-xanthen-9-one (0.1 g, 0.341 mmol) in NMP (2 mL) was added tert-butyl 1,4-diazepane-1-carboxylate (0.137 g, 0.682 mmol, vendor Accela ChemBio Inc., CAS #: 112275-50-0, Cat.#: as SY004264) and K.sub.3PO.sub.4 (0.145 g, 0.682 mmol) at 25 C. Then the mixture was stirred at 90 C. for 16 hours. The resulting mixture was poured into water (30 mL) and extracted with EtOAc (50 mL) for three times. The combined organic phase was washed with brine, dried over anhydrous Na.sub.2SO.sub.4, and concentrated under reduced pressure. The residue was purified by column chromatography on silica gel (elution with PE:EtOAc=20:1 to 1:1) to give tert-butyl 4-(5-fluoro-9-oxo-xanthen-3-yl)-1,4-diazepane-1-carboxylate (141.0 mg, 100%), MS obsd. (ESI.sup.+) [(M+H).sup.+]: 413.0.

Step 2: Preparation of 3-(1,4-diazepan-1-yl)-5-fluoro-xanthen-9-one

(212) ##STR00116##

(213) Tert-butyl 4-(5-fluoro-9-oxo-xanthen-3-yl)-1,4-diazepane-1-carboxylate (141.0 mg, 0.342 mmol) was dissolved in TFA/DCM (1:1) (5 mL) at 0 C. The reaction mixture was warmed to room temperature and stirred for 1 hour, the resulting mixture was concentrated under reduced pressure. The residue was purified by preparative HPLC to give 3-(1,4-diazepan-1-yl)-5-fluoro-xanthen-9-one (9 mg, 6.2%) as a solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 8.73 (br s, 1H), 8.02 (d, J=9.0 Hz, 1H), 7.94 (d, J=8.0 Hz, 1H), 7.78 (ddd, J=11.1, 8.1, 1.4 Hz, 1H), 7.41 (td, J=8.0, 4.5 Hz, 1H), 7.04 (dd, J=9.2, 2.4 Hz, 1H), 6.93 (d, J=2.3 Hz, 1H), 3.85-3.93 (m, 2H), 3.70 (t, J=6.0 Hz, 2H), 3.18 (br s, 2H), 2.53 (br d, J=1.8 Hz, 2H), 2.05-2.15 ppm (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 312.9.

Example 50: 3-[(3S)-3-aminopyrrolidin-1-yl]-5-fluoro-xanthen-9-one

(214) ##STR00117##

Step 1: Preparation of Tert-Butyl N-[(3S)-1-(5-fluoro-9-oxo-xanthen-3-yl)pyrrolidin-3-yl]carbamate

(215) ##STR00118##

(216) To a mixture of 3-bromo-5-fluoro-xanthen-9-one (0.1 g, 0.342 mmol) in NMP (2 mL) was added K.sub.3PO.sub.4 (108.9 mg, 0.514 mmol) and tert-butyl N-[(3S)-pyrrolidin-3-yl]carbamate (95.6 mg, 0.514 mmol) at 25 C., After being stirred at 90 C. for 16 hours, the resulting mixture was poured into water (50 mL) and extracted with EtOAc (200 mL). The organic phase was dried over anhydrous Na.sub.2SO.sub.4 and concentrated under reduced pressure. The residue was purified by column chromatography on silica gel (elution with PE:EtOAc=20:1 to 1:1) to give the tert-butyl N-[(3S)-1-(5-fluoro-9-oxo-xanthen-3-yl)pyrrolidin-3-yl]carbamate (0.09 g, 66.2%) as a yellow solid, MS obsd. (ESI.sup.+) [(M+H).sup.+]: 399.2.

Step 2: Preparation of 3-[(3S)-3-aminopyrrolidin-1-yl]-5-fluoro-xanthen-9-one

(217) ##STR00119##

(218) A solution of tert-butyl N-[(3S)-1-(5-fluoro-9-oxo-xanthen-3-yl)pyrrolidin-3-yl]carbamate (0.09 g, 0.226 mmol) in hydrogen chloride solution (4M in EtOAc, 3.0 mL) was stirred at 25 C. for 16 hours. Then resulted suspension was filtered and the solid was washed with EtOAc (10 mL) twice. The solid was then collected to give 3-[(3S)-3-aminopyrrolidin-1-yl]-5-fluoro-xanthen-9-one (35.0 mg, 46.1%) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 8.45 (s, 2H), 8.02-7.99 (d, J=8.8 Hz, 1H), 7.93-7.91 (d, J=8.0 Hz, 1H), 7.78-7.73 (t, 1H), 7.41-7.39 (t, 1H), 6.79-6.76 (m, 1H), 6.61-6.61 (d, J=2.0 Hz, 1H), 4.01 (s, 1H), 3.74-3.71 (m, 1H), 3.66-3.64 (m, 1H), 3.55-3.52 (m, 2H), 2.38-2.35 (m, 1H), 2.21-2.18 (m, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 299.2.

Example 51: 3-[(3R)-3-aminopyrrolidin-1-yl]-5-fluoro-xanthen-9-one

(219) ##STR00120##

Step 1: Preparation of Tert-Butyl N-[(3R)-1-(5-fluoro-9-oxo-xanthen-3-yl)pyrrolidin-3-yl]carbamate

(220) ##STR00121##

(221) To a mixture of 3-bromo-5-fluoro-xanthen-9-one (300.0 mg, 1.02 mmol) in NMP (10 mL) was added K.sub.3PO.sub.4 (326.0 mg, 1.54 mmol) and tert-butyl N-[(3R)-pyrrolidin-3-yl]carbamate (229.0 mg, 1.23 mmol) at 25 C. Then the mixture was stirred at 100 C. for 16 hours. The resulting mixture was poured into water (20 mL) and extracted with EtOAc (40 mL) three times. The combined organic phase was dried over anhydrous Na.sub.2SO.sub.4 and concentrated under reduced pressure. The residue was purified by column chromatography on silica gel (elution with PE:EtOAc=1:1) to afford tert-butyl N-[(3R)-1-(5-fluoro-9-oxo-xanthen-3-yl)pyrrolidin-3-yl]carbamate (282.0 mg, 69.15%) as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 399.2.

Step 2: Preparation of 3-[(3R)-3-aminopyrrolidin-1-yl]-5-fluoro-xanthen-9-one

(222) ##STR00122##

(223) To a solution of tert-butyl N-[(3R)-1-(5-fluoro-9-oxo-xanthen-3-yl)pyrrolidin-3-yl]carbamate (270.0 mg, 0.678 mmol) in DCM (15.0 mL) was added hydrogen chloride solution (4M in EtOAc, 4 mL) dropwise at 0 C. After being stirred at 20 C. for 15 hours, the reaction mixture was concentrated under reduce pressure to afford 3-[(3R)-3-aminopyrrolidin-1-yl]-5-fluoro-xanthen-9-one (45.0 mg, 19.8%) as a brown solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 8.11 (d, J=9.2 Hz, 1H), 8.01 (d, J=8.0 Hz, 1H), 7.64-7.59 (m, 1H), 7.35 (dt, J=4.4, 8.0 Hz, 1H), 6.84 (dd, J=2.3, 9.0 Hz, 1H), 6.66 (d, J=2.1 Hz, 1H), 4.15 (br. s., 1H), 3.85 (dd, J=6.2, 11.5 Hz, 1H), 3.87-3.73 (m, 1H), 3.63-3.59 (m, 2H), 2.60-2.55 (m, 1H), 2.28 (tdd, J=4.2, 8.4, 13.0 Hz, 1H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 299.0.

Example 52: 1-(5-fluorospiro[tetrahydrofuran-2,9-xanthene]-3-yl)pyrrolidine

(224) ##STR00123##

(225) To a cooled solution of 3-chloropropan-1-ol (80.1 mg, 0.85 mmol) in anhydrous THF (5 mL) was added isopropylmagnesium chloride solution (0.5 M in THF, 0.8 mL, 0.4 mmol) dropwise at 30 C. After the addition was complete, the reaction mixture was stirred at 30 C. for 30 mins. Then the resulting mixture was added dropwise into a cooled solution of 5-fluoro-3-pyrrolidin-1-yl-xanthen-9-one (120 mg, 0.4 mol) in THF at 30 C. After the addition was complete, the resulting mixture was stirred at room temperature for 2 hours, then diluted with a saturated NH.sub.4Cl solution (15 mL) and extracted by EtOAc (20 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4, and concentrated under reduce pressure. The residue was purified by preparative HPLC to give 1-(5-fluorospiro[tetrahydrofuran-2,9-xanthene]-3-yl)pyrrolidine (2.0 mg, 1.2%) as a white solid. .sup.1H NMR (CD.sub.3Cl, 400 MHz): ppm 8.09 (br d, J=9.3 Hz, 1H), 7.98-8.06 (m, 1H), 7.18-7.26 (m, 1H), 6.91 (br d, J=9.0 Hz, 1H), 6.65 (br dd, J=8.9, 2.4 Hz, 1H), 6.50 (br d, J=2.3 Hz, 1H), 3.76 (br t, J=6.5 Hz, 2H), 3.37-3.51 (m, 2H), 1.94-2.17 (m, 5H), 1.31-1.40 ppm (m, 5H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 325.9.

Example 53: 1-(5-chloro-8-hydroxy-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic Acid

(226) ##STR00124##

(227) Example 53 was prepared according to Scheme 8.

(228) ##STR00125##

Step 1: Preparation of Methyl 1-(5-chloro-8-methoxy-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylate

(229) ##STR00126##

(230) To a mixture of 6-bromo-4-chloro-1-methoxy-xanthen-9-one (0.3 g, 0.915 mmol) in DMSO (8.0 mL) was added methyl pyrrolidine-3-carboxylate (0.23 g, 1.372 mmol) and DBU (0.34 g, 1.732 mmol) at 25 C. Then the mixture was stirred at 90 C. for 16 hours. The resulting solution was poured into water (100 mL) and extracted with EtOAc (150 mL) three times. The organic phase was dried over anhydrous Na.sub.2SO.sub.4 and concentrated under reduced pressure to give the crude of methyl 1-(5-chloro-8-methoxy-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylate (0.35 g, 15% purity) as a light yellow solid which was used in the next step without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 388.1.

Step 2: Preparation of 1-(5-chloro-8-hydroxy-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic Acid

(231) ##STR00127##

(232) To a mixture of methyl 1-(5-chloro-8-methoxy-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylate (0.23 g, crude, prepared above) and DCM (8 mL) was added BBr.sub.3 (0.74 g, 2.95 mmol) at room temperature and the mixture was then stirred at room temperature for 16 hours. The mixture was then concentrated under reduced pressure and the residue was purified by preparative HPLC to give 1-(5-chloro-8-hydroxy-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid (0.07 g, 21.5% over 2 steps) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): 13.239 (s, 1H), 7.927-7.904 (d, J=9.2 Hz, 1H), 7.754-7.732 (d, J=8.8 Hz, 1H), 6.786-6.748 (m, 2H), 6.488 (s, 1H), 3.659-3.609 (m, 2H), 3.501-3.485 (m, 2H), 3.274-3.257 (m, 1H), 2.269-2.211 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 360.1.

Example 54: 1-(5-chloro-9-methyl-9H-xanthen-3-yl)pyrrolidine

(233) ##STR00128##

Step 1: Preparation of 1-(5-chloro-9-methylene-xanthen-3-yl)pyrrolidine

(234) ##STR00129##

(235) To a cooled solution of 5-chloro-3-pyrrolidin-1-yl-xanthen-9-one (460 mg, 1.53 mmol) in THF (3 mL) was added methyllithium (1M in hexane, 1.84 mL, 1.84 mmol) dropwise at 78 C. After the addition was complete, the reaction mixture was warmed to room temperature and stirred for 3 hours. The reaction was then quenched by NH.sub.4Cl solution (3 mL) and the resulting mixture was extracted by EtOAc (10 mL) three times. The combined organic layer was concentrated under reduced pressure to give a crude product of 1-(5-chloro-9-methylene-xanthen-3-yl)pyrrolidine (300 mg, 65.6%), which was used in the next step without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 298.1

Step 2: Preparation of 1-(5-chloro-9-methyl-9H-xanthen-3-yl)pyrrolidine

(236) ##STR00130##

(237) To a solution of 1-(5-chloro-9-methylene-xanthen-3-yl)pyrrolidine (120 mg, 403 mol) in EtOAc (5 mL) was added Pd/C (20 mg). The resulting mixture was hydrogenated under H.sub.2 atmosphere at room temperature overnight. After the reaction was complete, the mixture was filtered through silica gel pad and the filtrate was concentrated under reduced pressure. The residue was purified by preparative HPLC to give 1-(5-chloro-9-methyl-9H-xanthen-3-yl)pyrrolidine (5 mg, 4%) as a white solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 7.37 (dd, J=8.0, 1.3 Hz, 1H), 7.31 (d, J=7.5 Hz, 1H), 7.14 (d, J=8.3 Hz, 1H), 7.04-7.11 (m, 1H), 6.38 (dd, J=8.4, 2.4 Hz, 1H), 6.22 (d, J=2.5 Hz, 1H), 4.07 (q, J=6.9 Hz, 1H), 3.24 (br t, J=6.7 Hz, 4H), 1.90-1.99 (m, 4H), 1.36 ppm (d, J=7.0 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 300.0.

Example 55: 1-(5-chloro-9H-xanthen-3-yl)pyrrolidine

(238) ##STR00131##

(239) To a solution of 5-chloro-3-pyrrolidin-1-yl-xanthen-9-one (800 mg, 2.67 mmol) in THF (10 mL) was added BH.sub.3.Me.sub.2S (2M in THF, 10.7 mL, 21.4 mmol), the mixture was then stirred at 60 C. for 12 hours. After the reaction was complete, the mixture was then concentrated under reduced pressure and the residue was purified by column chromatography on silica gel (elution with PE:EtOAc=10:1 to 1:2) to give 1-(5-chloro-9H-xanthen-3-yl)pyrrolidine (650 mg, 81%) as a white solid. 1H NMR (400 MHz, CDCl3): ppm 7.23-7.28 (m, 1H), 6.89-7.11 (m, 3H), 6.30-6.43 (m, 2H), 3.93-4.03 (m, 2H), 3.31 (s, 4H), 1.97-2.08 (m, 4H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 287.4.

Example 56: 1-(2,4,5-trichloro-9H-xanthen-3-yl)pyrrolidine

(240) ##STR00132##

(241) To a solution of 1-(5-chloro-9H-xanthen-3-yl)pyrrolidine (20 mg, 70 mol) in DCM (3 mL) was added NCS (27.9 mg, 210 mol). After being stirred at room temperature for 2 hours, the resulting mixture was concentrated under reduced pressure and the residue was purified by column chromatography on silica gel (elution with PE:EtOAc=10:1 to 1:2) to give 1-(2,4,5-trichloro-9H-xanthen-3-yl)pyrrolidine (15 mg, 60.4%) as a solid. .sup.1H NMR (400 MHz, CDCl.sub.3): ppm 7.30-7.34 (m, 1H), 7.14 (m, 1H), 7.07-7.11 (m, 1H), 7.01 (s, 1H), 4.04 (s, 2H), 3.35 (t, J=6.40 Hz, 4H), 2.00-2.06 (m, 4H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 356.2.

Example 57: 1-[5-chloro-9-(oxetan-3-yl)-9H-xanthen-3-yl]pyrrolidine

(242) ##STR00133##

(243) To a solution of 1-(5-chloro-9H-xanthen-3-yl)pyrrolidine (70 mg, 245 mol) and NaH (60% in mineral oil) (100 mg, 2.5 mmol) in a mixed solvent of THF (2 mL) and DMSO (2 mL) was added 3-bromooxetane (268 mg, 1.96 mmol), the mixture was then stirred at 65 C. for 48 hours. The reaction was quenched with a saturated aqueous NaCl solution (20 mL) and the resulting mixture was extracted by EtOAc (30 mL) three times. The combined organic layer was concentrated under reduced pressure and the residue was purified by preparative HPLC to give 1-[5-chloro-9-(oxetan-3-yl)-9H-xanthen-3-yl]pyrrolidine (8.4 mg, 9.3%) as a white solid. .sup.1H NMR (400 MHz, CDCl.sub.3): ppm 7.32 (d, J=8.03 Hz, 1H), 7.12 (d, J=7.53 Hz, 1H), 7.06 (d, J=8.28 Hz, 1H), 6.99 (s, 1H), 6.45 (s, 1H), 6.33-6.39 (m, 1H), 4.63-4.71 (m, 2H), 4.54 (q, J=7.53 Hz, 2H), 4.10 (d, J=9.03 Hz, 1H), 3.27-3.36 (m, 4H), 3.17 (dd, J=7.53, 15.81 Hz, 1H), 2.00-2.08 (m, 4H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 342.1.

Example 58: [(2-chloro-3-fluoro-phenyl)-(5-chloro-3-pyrrolidin-1-yl-9H-xanthen-9-yl)methyl]acetate

(244) ##STR00134##

(245) To a cooled solution of 1-(5-chloro-9H-xanthen-3-yl)pyrrolidine (50 mg, 175 mol) in THF (15 mL) was added n-BuLi (2.4 M in heptane, 1.1 mL, 2.64 mmol) dropwise at 78 C. while keeping the temperature below 60 C. After the reaction mixture was stirred at 78 C. for 15 minutes, to the solution was added 2-chloro-3-fluorobenzaldehyde (277 mg, 1.75 mmol, dissolved in 1 mL THF) and the resulting reaction mixture was stirred at 78 C. for another 2 hours. Then to the reaction mixture was further added acetic anhydride (2.6 g, 175 mol) and TEA (3.5 g, 175 mol). The resulting mixture was stirred further at room temperature for 12 hours, then washed with brine, dried over anhydrous Na.sub.2SO.sub.4, and concentrated under reduced pressure. The residue was purified by column chromatography on silica gel (elution with PE:EtOAc=100:1 to 2:1) to give [(2-chloro-3-fluoro-phenyl)-(5-chloro-3-pyrrolidin-1-yl-9H-xanthen-9-yl)methyl]acetate (4.0 mg, 4%) as a white powder. .sup.1H NMR (400 MHz, DMSO-d.sub.6): ppm 7.43 (dd, J=1.51, 7.78 Hz, 1H), 7.34-7.40 (m, 1H), 7.27-7.34 (m, 1H), 6.90-7.05 (m, 2H), 6.72-6.89 (m, 2H), 6.22-6.33 (m, 2H), 6.04-6.08 (m, 1H), 4.47 (dd, J=5.40, 10.67 Hz, 1H), 3.23 (m, 4H), 1.92-2.00 (m, 7H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 486.1.

Example 59: 5-chloro-3-pyrrolidin-1-yl-9-(trifluoromethyl)xanthen-9-ol

(246) ##STR00135##

(247) To a solution of 5-chloro-3-pyrrolidin-1-yl-xanthen-9-one (100 mg, 334 mol) in THF (2 mL) was added trimethyl(trifluoromethyl)silane (285 mg, 2 mmol), TBAF (1 M in THF, 3.34 mL, 3.34 mmol), the mixture was then stirred at room temperature for 48 hours. The reaction mixture was then concentrated under reduced pressure and the residue was purified by preparative HPLC to give 5-chloro-3-pyrrolidin-1-yl-9-(trifluoromethyl)xanthen-9-ol (7.8 mg, 6.2%) as a white powder. .sup.1H NMR (400 MHz, CDCl.sub.3): ppm 7.84-7.90 (m, 1H), 7.67-7.73 (m, 1H), 7.42-7.47 (m, 1H), 7.11 (s, 1H), 6.44-6.49 (m, 1H), 6.38-6.42 (m, 1H), 3.33-3.38 (m, 4H), 1.99-2.07 (m, 4H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 370.0.

Example 60: 1-[5-chloro-9-methoxy-9-(trifluoromethyl)xanthen-3-yl]pyrrolidine

(248) ##STR00136##

(249) To a solution of 5-chloro-3-pyrrolidin-1-yl-9-(trifluoromethyl)xanthen-9-ol (50 mg, 135 mol) and DMAP (120 mg, 984 mol) in DCM (5 mL) was added trifluoroacetic anhydride (120 mg, 426 mol). The resulting mixture was stirred at room temperature for 20 hours and then to the reaction was added MeOH (10 mL). The mixture was stirred at room temperature for another 30 min and then concentrated under reduced pressure. The residue was purified by column chromatography on silica gel (elution with PE:EtOAc=100:1 to 2:1) to give 1-[5-chloro-9-methoxy-9-(trifluoromethyl)xanthen-3-yl]pyrrolidine (20 mg, 32.8%) as an oil. .sup.1H NMR (400 MHz, CDCl.sub.3): ppm 7.59-7.65 (m, 1H), 7.50-7.54 (m, 1H), 7.44-7.48 (m, 1H), 7.15 (s, 1H), 6.50-6.55 (m, 1H), 6.43-6.46 (m, 1H), 3.38 (br t, J=6.65 Hz, 4H), 3.10 (s, 3H), 2.06 (td, J=3.26, 6.53 Hz, 4H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 384.0.

Example 61: 1-[5-chloro-9-(trifluoromethyl)-9H-xanthen-3-yl]pyrrolidine

(250) ##STR00137##

(251) To a solution of 5-chloro-3-pyrrolidin-1-yl-9-(trifluoromethyl)xanthen-9-ol (50 mg, 135 mol) in DCM (5 mL) was added triethylsilane (300 mg, 412 L, 2.58 mmol) and BF.sub.3.OEt.sub.2 (280 mg, 250 L, 1.97 mmol), the resulting mixture was then stirred at room temperature overnight. After the reaction was complete, the mixture was concentrated under reduced pressure and the residue was purified by preparative HPLC to give 1-[5-chloro-9-(trifluoromethyl)-9H-xanthen-3-yl]pyrrolidine (6.0 mg, 11.9%) as a white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6): ppm 7.59 (dd, J=1.38, 7.91 Hz, 1H), 7.44 (s, 1H), 7.18-7.28 (m, 2H), 6.44-6.51 (m, 1H), 6.34 (d, J=2.51 Hz, 1H), 5.15 (br d, J=9.03 Hz, 1H), 3.28 (br t, J=6.53 Hz, 4H), 1.97 (td, J=3.39, 6.27 Hz, 4H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 354.1.

Example 62: 1-(5-fluoro-9H-xanthen-3-yl)pyrrolidine

(252) ##STR00138##

(253) To a solution of 5-fluoro-3-pyrrolidin-1-yl-xanthen-9-one (700 mg, 2.1 mmol) in THF (10 mL) was added BH.sub.3.Me.sub.2S (2M in THF, 5 mL, 10.0 mmol), the mixture was then stirred at 60 C. for 12 hours. After the reaction was complete, the mixture was then concentrated under reduced pressure and the residue was purified by column chromatography on silica gel (elution with PE:EtOAc=10:1 to 1:2) to give 1-(5-fluoro-9H-xanthen-3-yl)pyrrolidine (250 mg, 44.2%) as a white solid. .sup.1H NMR (400 MHz, CDCl3): ppm 6.87-7.06 (m, 4H), 6.37 (s, 2H), 3.98 (s, 2H), 3.29 (t, J=6.65 Hz, 4H), 2.02 (td, J=3.29, 6.71 Hz, 4H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 270.2.

Example 63: 9-fluoro-2-pyrrolidin-1-yl-chromeno[2,3-b]pyridin-5-one

(254) ##STR00139##

(255) Example 63 was prepared according to Scheme 9.

(256) ##STR00140##

Step 1: Preparation of 6-chloro-2-(2-fluorophenoxy)pyridine-3-carboxylic Acid

(257) ##STR00141##

(258) A mixture of 2,6-dichloropyridine-3-carboxylic acid (6.68 g, 31.8 mmol), 2-fluorophenol (3.0 g, 26.8 mmol), K.sub.2CO.sub.3 (7.4 g, 53.6 mmol) and Cu (10.2 g, 160.6 mmol) in dry DMF (60 mL) was stirred at 100 C. for 16 hours. The resulting mixture was then filtered and the filtrate was poured into water (500 mL) and adjusted to pH-5 with 2N HCl. The resulting mixture was extracted with EtOAc (300 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated under reduced pressure to give the crude product of 6-chloro-2-(2-fluorophenoxy)pyridine-3-carboxylic acid (crude, 7.0 g, 76.8% purity), which was used in the next step without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 268.1

Step 2: 9-fluoro-2-hydroxy-chromeno[2,3-b]pyridin-5-one

(259) ##STR00142##

(260) A mixture of 6-chloro-2-(2-fluorophenoxy)pyridine-3-carboxylic acid (1.5 g, 5.6 mmol, crude prepared above) in concentrated H.sub.2SO.sub.4 (20.0 mL) was stirred at 90 C. for 16 hours. The resulting mixture was poured into ice (100 g) and stirred for 15 minutes to yield a white suspension. The resulting suspension was filtered and the solid was dried in vacuo to afford 9-fluoro-2-hydroxy-chromeno[2,3-b]pyridin-5-one (0.8 g, 61.5%) as a pale solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 231.9.

Step 3: (9-fluoro-5-oxo-chromeno[2,3-b]pyridin-2-yl) Trifluoromethanesulfonate

(261) ##STR00143##

(262) To a mixture of 9-fluoro-2-hydroxy-chromeno[2,3-b]pyridin-5-one (180.0 mg, 0.779 mmol) in DCM (10 mL) was added TEA (197.0 mg, 1.95 mmol) and trifluoromethanesulfonic anhydride (330.0 mg, 1.17 mmol) at 0 C. The mixture was stirred at room temperature for 2 hours. Then the reaction was quenched with water (20 mL) and the resulting mixture was extracted with DCM (20 mL) three times. The combined organic layer was dried over anhydrous Na.sub.2SO.sub.4 and concentrated under reduce pressure to afford the crude of (9-fluoro-5-oxo-chromeno[2,3-b]pyridin-2-yl) trifluoromethanesulfonate (207.0 mg, 73.20%) as a pale-white solid, which was used in the next step without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 364.0.

Step 4: Preparation of 9-fluoro-2-pyrrolidin-1-yl-chromeno[2,3-b]pyridin-5-one

(263) ##STR00144##

(264) A mixture of (9-fluoro-5-oxo-chromeno[2,3-b]pyridin-2-yl) trifluoromethanesulfonate (200.0 mg, 0.551 mmol) in pyrrolidine (10.0 mL) was stirred at 60 C. for 15 hours. Then the mixture was concentrated under reduced pressure and the residue was purified by preparative HPLC to give 9-fluoro-2-pyrrolidin-1-yl-chromeno[2,3-b]pyridin-5-one (35.0 mg, 22.36%) as a light yellow solid. .sup.1H NMR (400 MHz, CDCl.sub.3): ppm 8.36 (d, J=8.8 Hz, 1H), 8.06-8.04 (m, 1H), 7.47 (ddd, J=1.5, 8.2, 10.1 Hz, 1H), 7.33-7.28 (m, 1H), 6.50 (d, J=8.8 Hz, 1H), 3.75-3.90 (m, 2H), 3.48-3.59 (m, 2H), 1.97-2.10 (m, 4H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 285.0.

Example 64: 9-chloro-2-pyrrolidin-1-yl-chromeno[2,3-b]pyridin-5-one

(265) ##STR00145##

(266) 9-chloro-2-pyrrolidin-1-yl-chromeno[2,3-b]pyridin-5-one was prepared in analogy to the procedure described for the preparation of Example 63 by using 2-chlorophenol as the starting material instead of 2-fluorophenol in Step 1. .sup.1H NMR (400 MHz, MeOD-d.sub.4): ppm 8.29-8.27 (d, J=8.8 Hz, 1H), 8.15-8.13 (d, J=8.0 Hz, 1H), 7.89-7.87 (t, 1H), 7.43-7.39 (t, 1H), 6.71-6.69 (d, J=8.8 Hz, 1H), 3.77 (m, 2H), 3.57 (m, 2H), 2.14-2.09 (m, 4H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 301.1.

Example 65: 5-chloro-3-[3-(morpholine-4-carbonyl)pyrrolidin-1-yl]xanthen-9-one

(267) ##STR00146##

(268) To a solution of 1-(5-chloro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid (Example 3, 0.50 g, 0.145 mmol) in DMF (2 mL) was added morpholine (12.7 mg, 0.145 mmol), HATU (55.3 g, 0.145 mmol) and N,N-diisopropylethylamine (18.8 mg, 0.145 mmol) at 25 C. After being stirred at room temperature for 1 hour, the resulting mixture was poured into water (30 mL) and extracted with EtOAc (50 mL) for three times. The combined organic phase was washed with brine, dried over anhydrous Na.sub.2SO.sub.4, and concentrated under reduced pressure. The residue was purified by Preparative HPLC to give 5-chloro-3-[3-(morpholine-4-carbonyl)pyrrolidin-1-yl]xanthen-9-one as a solid (13.0 mg, 21.6%). .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 8.07-8.11 (m, 1H), 7.93-7.99 (m, 2H), 7.38-7.44 (m, 1H), 6.76-6.82 (m, 1H), 6.54 (d, J=2.26 Hz, 1H), 3.53-3.74 (m, 8H), 3.44-3.52 (m, 5H), 2.11-2.28 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 413.1.

Example 66: 1-(5-chloro-8-fluoro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic Acid

(269) ##STR00147##

(270) Example 66 was prepared according to Scheme 10.

(271) ##STR00148##

Step 1: Preparation of 4-bromo-2-(2-chloro-5-fluoro-phenoxy)benzonitrile

(272) ##STR00149##

(273) To a solution of 4-bromo-2-fluoro-benzonitrile (4.9 g, 24.7 mmol), 2-chloro-5-fluoro-phenol (3.0 g, 2.6 mmol) in DMF (50 mL) was added K.sub.2CO.sub.3 (1.7 g, 12.0 mmol), Cu powder (7.9 g, 123.3 mmol) at 25 C. and the mixture was then stirred at 120 C. for 16 hours. The reaction mixture was cooled to 20 C. and poured into water (100 mL). The resulting mixture was adjusted to pH=4-5 by addition of 1N HCl dropwise and then extracted by EtOAc (250 mL) twice. The combined organic layer was washed with brine (100 mL), dried over anhydrous Na.sub.2SO.sub.4 and concentrated under reduced pressure to give the crude of 4-bromo-2-(2-chloro-5-fluoro-phenoxy)benzonitrile (5.0 g, 65.3% purity) as a yellow solid, which was used in the next step directly without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 357.9.

Step 2: Preparation of 1-[3-(2-chloro-5-fluoro-phenoxy)-4-cyano-phenyl]pyrrolidine-3-carboxylic Acid

(274) ##STR00150##

(275) To a solution of 4-bromo-2-(2-chloro-5-fluoro-phenoxy)benzonitrile (2.5 g, 7.6 mmol, prepared above) in DMF (20 mL) was added methyl pyrrolidine-3-carboxylate (1.5 g, 11.5 mmol) and K.sub.2CO.sub.3 (3.1 g, 22.8 mmol), then the mixture was stirred at 110 C. for 12 hours. The reaction mixture was then diluted by water (50 mL) and the resulting suspension was filtered. The filter cake was collected and purified by preparative HPLC to give 1-[3-(2-chloro-5-fluoro-phenoxy)-4-cyano-phenyl]pyrrolidine-3-carboxylic acid (0.5 g, 18.2%) as a yellow solid. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 361.0.

Step 3: Preparation of 1-(5-chloro-8-fluoro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic Acid

(276) ##STR00151##

(277) A solution of 1-[3-(2-chloro-5-fluoro-phenoxy)-4-cyano-phenyl]pyrrolidine-3-carboxylic acid (150 mg, 0.41 mmol) in polyphosphoric acid (2 mL) was stirred at 150 C. for 2 hours under N.sub.2 atmosphere. The reaction mixture was cooled to room temperature and diluted with water (10 mL). The resulting suspension was filtered and the filter cake was purified by preparative HPLC to give 1-(5-chloro-8-fluoro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid (20 mg, 13.3%) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 12.64 (s, 1H), 7.91-7.83 (m, 2H), 7.19-7.16 (m, 1H), 6.69-6.66 (m, 1H), 6.38 (s, 1H), 3.60-3.56 (m, 2H), 3.55-3.44 (m, 2H), 3.26-3.24 (m, 1H), 2.25-2.19 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 362.0.

Example 67: 1-[5-chloro-9-oxo-8-(trifluoromethyl)xanthen-3-yl]pyrrolidine-3-carboxylic Acid

(278) ##STR00152##

(279) Example 67 was prepared in analogy to the procedure described for the preparation of Example 5 by using 6-bromo-4-chloro-1-(trifluoromethyl)xanthen-9-one (intermediate 18) as the starting material instead of 3-bromo-5-fluoro-xanthen-9-one (intermediate 3) in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 12.66 (s, 1H), 8.12-8.10 (d, J=8.4 Hz, 1H), 7.96-7.93 (d, J=8.8 Hz, 1H), 7.81-7.79 (d, J=8.4, 1H), 6.82-6.79 (d, J=8.8, 1H), 6.52 (s, 1H), 3.67-3.64 (m, 2H), 3.63-3.61 (m, 2H), 3.29-3.27 (m, 1H), 2.28-2.20 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 412.0.

Example 68: 2-chloro-5-fluoro-3-pyrrolidin-1-yl-xanthen-9-one

(280) ##STR00153##

(281) Example 68 was prepared in analogy to the procedure described for the preparation of Example 1 by using 3-bromo-2-chloro-5-fluoro-xanthen-9-one (intermediate 19) as the starting material instead of 3-bromo-5-chloro-xanthen-9-one (intermediate 1) in Step 1. .sup.1H NMR (CDCl.sub.3, 400 MHz): ppm 8.09 (s, 1H), 7.97 (d, J=8.0 Hz, 1H), 7.38-7.33 (m, 1H), 7.20-7.16 (m, 1H), 6.60 (s, 1H), 3.59 (t, J=6.4 Hz, 4H), 1.96-1.92 (m, 4H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 318.0.

Example 69: (3R)-1-(5,8-dichloro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic Acid

(282) ##STR00154##

(283) Example 69 was prepared in analogy to the procedure described for the preparation of Example 5 by using 6-bromo-1,4-dichloro-xanthen-9-one (intermediate 10) and methyl (3R)-pyrrolidine-3-carboxylate as the starting materials instead of 3-bromo-5-fluoro-xanthen-9-one (intermediate 3) and methyl pyrrolidine-3-carboxylate in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 7.97-7.79 (m, 2H), 7.34-7.32 (d, J=8.0 Hz, 1H), 6.66-6.64 (d, J=8.0 Hz, 1H), 6.29 (s, 1H), 3.48-3.16 (m, 4H), 2.99-2.89 (m, 1H), 2.20-2.14 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 377.8.

Example 70: 1-(5,7-dichloro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic Acid

(284) ##STR00155##

(285) Example 70 was prepared according to Scheme 11.

(286) ##STR00156##

Step 1: Preparation of Methyl 4-bromo-2-(2,4-dichlorophenoxy)benzoate

(287) ##STR00157##

(288) A mixture of methyl 4-bromo-2-fluoro-benzoate (3.0 g, 12.9 mmol), 2,4-dichlorophenol (2.1 g, 12.9 mmol), K.sub.2CO.sub.3 (3.6 g, 25.7 mmol) and Cu (4.9 g, 77.2 mmol) in dry DMF (20 mL) was stirred at 100 C. for 16 hours. The resulting mixture was then filtered and the filtrate was partitioned between EtOAc (300 mL) and water (300 mL). The organic layer was separated and the aqueous phase was extracted with EtOAc (300 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated under reduced pressure to give methyl 4-bromo-2-(2,4-dichlorophenoxy)benzoate (crude, 4.5 g) as a yellow oil, which was used in the next step without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 376.9.

Step 2: Preparation of 4-bromo-2-(2,4-dichlorophenoxy)benzoic Acid

(289) ##STR00158##

(290) A mixture of methyl 4-bromo-2-(2,4-dichlorophenoxy)benzoate (4.5 g, 12.0 mmol, crude prepared above), NaOH (1.4 g, 35.9 mmol) in a mixed solvent of methanol (100 mL) and water (20 mL) was stirred at 60 C. for 4 hours. The resulting mixture was adjusted to pH=4 with concentrated HCl to yield a suspension. The solid was collected by filtration and dried under reduced pressure to give 4-bromo-2-(2,4-dichlorophenoxy)benzoic acid (crude, 2.4 g) as a white solid, which was used in the next step without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 362.9.

Step 3: Preparation of 6-bromo-2,4-dichloro-xanthen-9-one

(291) ##STR00159##

(292) A mixture of 4-bromo-2-(2,4-dichlorophenoxy)benzoic acid (2.4 g, 6.7 mmol, crude prepared above) and H.sub.2SO.sub.4 (50.0 mL) was stirred at 100 C. for 16 hours. The mixture was poured into ice (100 g) and extracted with EtOAc (400 mL) three times. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated under reduced pressure to give 6-bromo-2,4-dichloro-xanthen-9-one (1.5 g, crude) as a white solid, which was used in the next step without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 342.8.

Step 4: Preparation of Methyl 1-(5,7-dichloro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylate

(293) ##STR00160##

(294) A mixture of 6-bromo-2,4-dichloro-xanthen-9-one (0.5 g, 1.4 mmol, crude prepared above), methyl pyrrolidine-3-carboxylate hydrochloride (0.24 g, 1.4 mmol), 1,8-diazabicyclo[5.4.0]undec-7-ene (0.73 g, 2.9 mmol) in DMSO (10 mL) was stirred at 100 C. for hours. The mixture was cooled and partitioned between ethyl acetate (150 mL) and water (80 mL). The organic phase was separated and the aqueous phase was extracted with EtOAc (150 mL) twice. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated under reduced pressure to give the crude of methyl 1-(5,7-dichloro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylate (0.45 g) as a brown oil, which was used in the next step without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 392.0.

Step 5: Preparation of 1-(5,7-dichloro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic Acid

(295) ##STR00161##

(296) A mixture of methyl 1-(5,7-dichloro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylate (0.45 g, 1.1 mmol, crude, prepared above), lithium hydroxide monohydrate (0.14 g, 3.44 mmol) in a mixed solvent of THF (2 mL), MeOH (2 mL) and water (0.5 mL) was stirred at 50 C. for 3 hours. The resulting mixture was adjusted to pH around 4 with 2N HCl and then extracted with EtOAc (25 mL). The organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated under reduced pressure to give the crude of 1-(5,7-dichloro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid, which was purified by preparative HPLC to give 1-(5,7-dichloro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic acid (57.0 mg, 13.7%) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 12.64 (s, 1H), 8.09 (s, 1H), 8.09 (s, 1H), 7.92-7.90 (d, J=9.2 Hz, 1H), 6.74-6.72 (d, J=9.2 Hz, 1H), 6.47 (s, 1H), 3.64-3.59 (m, 2H), 3.48-3.46 (m, 2H), 3.46-3.34 (m, 1H), 2.28-2.08 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 378.0.

Example 71: 1-(5-chloro-7-fluoro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic Acid

(297) ##STR00162##

(298) Example 71 was prepared in analogy to the procedure described for the preparation of Example 70 by using 2-chloro-4-fluoro-phenol as the starting materials instead of 2-chloro-4-fluoro-phenol in Step 1. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 8.03 (dd, J=8.2, 3.1 Hz, 1H), 7.95 (d, J=8.8 Hz, 1H), 7.77 (dd, J=8.3, 3.0 Hz, 1H), 6.79 (dd, J=9.0, 2.0 Hz, 1H), 6.52 (d, J=1.8 Hz, 1H), 3.60-3.69 (m, 2H), 3.46-3.49 (m, 2H), 3.22-3.33 (m, 1H), 2.19-2.30 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 362.0.

Example 72: (3S)-1-(5-chloro-9-oxo-thioxanthen-3-yl)pyrrolidine-3-carboxylic Acid

(299) ##STR00163##

(300) Example 72 was prepared in analogy to the procedure described for the preparation of Example 4 by using 3-bromo-5-chloro-thioxanthen-9-one (compound 6c) instead of 3-bromo-5-chloro-xanthen-9-one (intermediate 1). .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 12.60 (br s, 1H), 8.31-8.54 (m, 1H), 8.14-8.30 (m, 1H), 7.83-7.97 (m, 1H), 7.43-7.65 (m, 1H), 6.76-6.97 (m, 2H), 3.55-3.68 (m, 2H), 3.40-3.53 (m, 2H), 3.21-3.29 (m, 1H), 2.15-2.32 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 359.8.

Example 73: (3R)-1-(5-chloro-9-oxo-thioxanthen-3-yl)pyrrolidine-3-carboxylic Acid

(301) ##STR00164##

(302) Example 73 was prepared in analogy to the procedure described for the preparation of Example 3 by using 3-bromo-5-chloro-thioxanthen-9-one (compound 6c) instead of 3-bromo-5-chloro-xanthen-9-one (intermediate 1). .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 12.60 (br s, 1H), 8.31-8.54 (m, 1H), 8.14-8.30 (m, 1H), 7.83-7.97 (m, 1H), 7.43-7.65 (m, 1H), 6.76-6.97 (m, 2H), 3.55-3.68 (m, 2H), 3.40-3.53 (m, 2H), 3.21-3.29 (m, 1H), 2.15-2.32 (m, 2H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 359.8.

Example 74: (3R)-1-(5-chloro-2-methyl-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylic Acid

(303) ##STR00165##

(304) Example 74 was prepared in analogy to the procedure described for the preparation of Example 3 by using 3-bromo-5-chloro-2-methyl-xanthen-9-one (intermediate 4) as the starting materials instead of 3-bromo-5-chloro-xanthen-9-one (intermediate 1). .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 8.10-8.08 (m, 1H), 7.96-7.94 (m, 1H), 7.79 (m, 1H), 7.39-7.43 (m, 1H), 6.65-6.67 (m, 1H), 3.72-3.74 (m, 2H), 3.57-3.61 (m, 2H), 3.16-3.20 (m, 1H), 2.14-2.30 (m, 2H), 1.35 (s, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 358.1.

Example 75: 1-(5-chloro-9-methyl-9H-xanthen-3-yl)pyrrolidine-3-carboxylic Acid

(305) ##STR00166##

(306) Example 75 was prepared according to Scheme 12.

(307) ##STR00167##

Step 1: Preparation of Tert-Butyl 1-(5-chloro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylate

(308) ##STR00168##

(309) A mixture of 3-bromo-5-chloro-xanthen-9-one (intermediate 1, 309 mg, 1.0 mmol), tert-butyl pyrrolidine-3-carboxylate (256 mg, 1.5 mmol), K.sub.3PO.sub.4 (0.14 g, 0.650 mmol) (424 mg, 2.0 mmol) in DMF (10 mL) was stirred at 100 C. for 10 hours. The mixture was cooled and partitioned between ethyl acetate (100 mL) and water (50 mL). The organic phase was separated out and the aqueous phase was extracted with EtOAc (100 mL) twice. The combined organic layer was washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated under reduced pressure to give the crude of tert-butyl 1-(5-chloro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylate (300 mg) as a yellow solid, which was used in the next step without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 400.1.

Step 2: Preparation of Tert-Butyl 1-(5-chloro-9-methylene-xanthen-3-yl)pyrrolidine-3-carboxylate

(310) ##STR00169##

(311) To a cooled solution of tert-butyl 1-(5-chloro-9-oxo-xanthen-3-yl)pyrrolidine-3-carboxylate (300 mg, 0.75 mmol, crude prepared above) in THF (4 mL) was added methyllithium (1M in hexane, 1.5 mL, 1.5 mmol) dropwise at 78 C. After the addition was complete, the reaction mixture was warmed to room temperature and stirred at for 3 hours. The reaction was then quenched by NH.sub.4Cl solution (3 mL) and the resulting mixture was extracted by EtOAc (10 mL) three times. The combined organic layer was concentrated under reduced pressure to give a crude product of tert-butyl 1-(5-chloro-9-methylene-xanthen-3-yl)pyrrolidine-3-carboxylate (290 mg, 97.5%), which was used in the next step without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 398.1

Step 3: Preparation of Tert-Butyl 1-(5-chloro-9-methyl-9H-xanthen-3-yl)pyrrolidine-3-carboxylate

(312) ##STR00170##

(313) To a solution of tert-butyl 1-(5-chloro-9-methylene-xanthen-3-yl)pyrrolidine-3-carboxylate (200 mg, 0.5 mmol) in MeOH (5 mL) was added Pd/C (20 mg). The resulting mixture was hydrogenated under H.sub.2 atmosphere at room temperature overnight. After the reaction was complete, the reaction was filtered through silica gel pad and the filtrate was concentrated under reduced pressure to give the crude of tert-butyl 1-(5-chloro-9-methyl-9H-xanthen-3-yl)pyrrolidine-3-carboxylate (200 mg), which was used in the next step without further purification. MS obsd. (ESI.sup.+) [(M+H).sup.+]: 400.1.

Step 5: Preparation of 1-(5-chloro-9-methyl-9H-xanthen-3-yl)pyrrolidine-3-carboxylic Acid

(314) ##STR00171##

(315) The suspension of tert-butyl 1-(5-chloro-9-methyl-9H-xanthen-3-yl)pyrrolidine-3-carboxylate (200 mg) in concentrated hydrochloric acid (5 mL) was stirred under reflux for 2 hours. After the reaction was complete, the mixture was concentrated under reduced pressure. The residue was purified by preparative HPLC to give 1-(5-chloro-9-methyl-9H-xanthen-3-yl)pyrrolidine-3-carboxylic acid (11.0 mg, 6.4%) as a yellow solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): ppm 7.36 (dd, J=7.8, 1.5 Hz, 1H), 7.31 (dd, J=7.9, 1.1 Hz, 1H), 7.14 (d, J=8.3 Hz, 1H), 7.07 (t, J=7.8 Hz, 1H), 6.39 (dd, J=8.4, 2.3 Hz, 1H), 6.23 (d, J=2.4 Hz, 1H), 4.07 (q, J=7.0 Hz, 1H), 3.38-3.54 (m, 2H), 3.24-3.37 (m, 2H), 3.11-3.23 (m, 1H), 2.08-2.29 (m, 2H), 1.35 (d, J=6.8 Hz, 3H). MS obsd. (ESI.sup.+) [(M+H).sup.+]: 344.1.

Reference Compound: 5,8-dihydroxy-3-methoxy-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)tetrahydropyran-2-yl]oxy-xanthen-9-one (Swertianolin)

(316) ##STR00172##

(317) Swertianolin disclosed in CN104370871 (A) was used as the reference compound.

BIOLOGICAL EXAMPLES

Example 76: HepDES19 Primary Screen Assay

(318) The assay was employed to primarily screen for novel cccDNA inhibitors. HepDES19 is an engineered cell line which contains a 1.1 unit length HBV genome, and pgRNA transcription from the transgene is controlled by Tetracycline (Tet). In the absence of Tet, pgRNA transcription will be induced, but HBV e antigen (HBeAg) could not be produced from this pgRNA due to the fact that the very short leader sequence before the HBeAg start codondisrupted the start codon. Only after cccDNA is formed, the missing leader sequence and start codon mutation would be restored from the 3-terminal redundancy of pgRNA, and then HBeAg could be synthesized. Therefore, HBeAg could be used as a surrogate marker for cccDNA (Zhou, T. et al., Antiviral Res(2006), 72(2), 116-124; Guo, H. et al., J. Virol (2007), 81(22), 12472-12484).

(319) HepDES19 cells were seeded at 210.sup.6 cells per T150 flask and cultured with the culture medium (Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12 (DMEM:F12, Gibco Cat. 11320-82), 10% Fetal Bovine Serum (FBS, Clontech Cat. 631101), 0.1 mM Non-Essential Amino Acids Solution (NEAA, Gibco Cat. 11140-050), 50 g/mL Penicillin-Streptomycin (PS, Invitrogen Cat. 15140-163), 500 g/mL Geneticin (G418, Invitrogen Cat. 10131-027) containing 3 g/mL Tet (Sigma, Cat. 87128) for 5 days. Cells were then seeded at 410.sup.6 cells per T150 in the same culture medium as described above in the absence of Tet for 8 days. Cells were then harvested and frozen at density of 210.sup.6 cells per mL. For compound testing, the frozen cells were thawed and seeded into 96-well plates at a density of 610.sup.4 cells per well. At 24 hrs after seeding, half log serial dilutions of compounds made with Dimethyl sulfoxide (DMSO, Sigma, Cat. D2650) were further diluted with the same culture medium as described above before they were added to the cells to reach desired final compound concentrations and 1% DMSO concentration. Plates were then incubated at 37 C. for another 5 days before measurement of HBeAg level and cell viability. Extracellular HBeAg level were measured with enzyme-linked immunosorbent assay (ELISA) kit (Shanghai Kehua Diagnostic Medical Products Co., Ltd). Cell viability was assessed using Cell Counting Kit-8 (Donjindo, Cat. CK04-20). IC.sub.50 values were derived from the dose-response curve using 4 parameter logistic curve fit method.

(320) The compounds of the present invention were tested for their capacity to inhibit extracellular HBeAg level as described herein. The compounds of this invention were found to have IC.sub.50 below 50 M. Particular compounds of formula I were found to have IC.sub.50 below 5.0 M. Results of HepDES19 primary screen assay are given in Table 1.

(321) TABLE-US-00001 TABLE 1 Activity data in HepDES19 primary screen assay Example No. IC.sub.50 (M) Swertianolin >100 1 0.23 2 2.18 3 1.24 4 2.18 5 3.33 6 4.94 7 3.56 8 7.53 9 0.98 10 1.13 11 1.17 12 2.88 13 5.49 14 5.79 15 7.39 16 11.2 17 12.7 18 16.6 19 27.0 20 46.6 21 0.27 22 0.74 23 0.83 24 1.05 25 1.52 26 2.36 27 1.95 28 1.86 29 2.13 30 2.63 31 2.71 32 2.72 33 4.06 34 6.15 35 16.7 36 11.5 37 13.4 38 16.1 39 1.08 40 1.31 41 4.04 42 1.17 43 1.11 44 1.10 45 0.51 46 4.30 47 4.77 48 5.48 49 7.56 50 3.12 51 4.85 52 14.5 53 3.43 54 1.60 55 1.11 56 6.28 57 7.33 58 11.7 59 19.2 60 22.2 61 31.0 62 3.99 63 19.2 64 35.0 65 3.89 66 1.91 67 0.39 68 1.18 69 0.96 70 5.9 71 13 72 3.6 73 2.6 74 2.6 75 10.1

Example 77: cccDNA Southern Blot Assay

(322) HepDES19 cells were seeded at 410.sup.6 cells per T150 in the culture medium (Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12 (DMEM:F12, Gibco Cat. 11320-82), 10% Fetal Bovine Serum (FBS, Clontech Cat. 631101), 0.1 mM Non-Essential Amino Acids Solution (NEAA, Gibco Cat. 11140-050), 50 g/mL Penicillin-Streptomycin (PS, Invitrogen Cat. 15140-163), 500 g/mL Geneticin (G418, Invitrogen Cat. 10131-027) in the absence of Tet for 8 days. These cells were seeded at the density of 110.sup.6 cells per well in 6-well plate. At 24 hrs after seeding, serial dilutions of compounds made with DMSO (Sigma, Cat. D2650) were further diluted with the same culture medium as described above before they were added to the cells to reach desired final compound concentrations and 1% DMSO concentration. After 5 days' compound treatment, the cells growing in one well from 6-well plate were re-suspended with 500 L re-suspension buffer (50 mM tris[hydroxymethyl]aminomethane pH 7.5), 10 mM ethylenediaminetetraacetic acid (EDTA), 50 g/mL RNase A (Qiagen, Cat. 158922). 500 L of 1.2% sodium dodecyl sulfate (SDS) was then added into the re-suspended cells to lyse the cells. After 15 minutes' incubation, 700 L precipitation buffer (3M cesium chloride, 1M potassium acetate, 0.67M acetic acid) was added and the lysate was incubated at 4 C. for 2 h. The lysate was centrifuged at 15000 revolutions per minute (RPM) at 4 C. for 15 minutes. The supernatant was collected and loaded onto Qiagen miniprep columns (QIAprep spin Mini prep kit, Cat. No. 27016). After centrifugation for 1 minute at 15000 RPM, the column was washed once with 750 L wash buffer PE from QIAprep spin Mini prep kit. 80 L of double distilled water was loaded to the columns to elute Hirt DNA.

(323) Hirt DNA of each sample was loaded into 1.2% lx tris-acetate electrophoresis (TAE) agarose gel and separated at 90 voltages for 3 hours. The gel was then treated in 50 mM NaAcHAc, pH4.2 for 30 min at room temperature (RT), and then denatured by soaking in denaturation buffer (0.5 M sodium hydroxide, 1.5 M sodium chloride) at RT for 30-45 min. The gel was then treated with neutralization buffer (1M tris[hydroxymethyl]aminomethane pH7.4 and 1.5M NaCl) at RT for 30 to 45 min.

(324) The gel was transferred onto a pre-wet Nylon membrane (GE life science, Hybond N+) by capillary transfer method overnight, followed by UV crosslinking. The membrane was transferred into a hybridization tube, then rinsed with double distilled water at 60 C. for 5 mins. 10 mL of hybridization buffer (Lab kits, China) was added, the resulting sample was rotated in hybridization oven at 60 C. for 1 hour. Digoxigenin (DIG)-labelled HBV probe (SEQ ID NO: 1) was denatured at 95 C. for 10 minutes, and then 7 L of denatured probe was added to the hybridization tube, which was rotated in hybridization oven at 60 C. overnight.

(325) On the second day, the membrane was washed according to the procedure of DIG wash and block buffer set kit (Roche, Cat. 11 585 762 001), and then incubated with 50 mL antibody solution (Antibody anti-Digoxigenin-AP Fab fragment (Roche Cat. 11093274910) diluted in fresh 1 blocking buffer at 1:10,000) for 1 hour. The membrane was washed with 50 mL washing buffer (1 Maleic buffer with 0.3% Tween-20) for 15 minutes twice, and equilibrated with 20 mL detection buffer (0.1M tris[hydroxymethyl]aminomethane pH9.5, 0.1M sodium chloride) for 5 minutes. CDP-Star substrate (Roche, Cat. 12041677001) was added to the membrane for 5 minutes, and then the membrane was scanned by Bio-Rad Visualize Image System (Biorad, ChemiDoc-MP, Serial No. 731BR00916).

(326) Results of cccDNA Southern Blot assay are given in FIGS. 1-6. The results indicate that the compounds of this invention dose-dependently reduced cccDNA level in HepDES19 cells.

Example 78: Cryopreserved Primary Human Hepatocytes (PHH) Assay

(327) Cryopreserved PHH (BioreclamationIVT, Lot YJM) was thawed at 37 C. and gently transferred into pre-warmed InVitroGRO HT medium (BioreclamationIVT, Cat. S03317). The mixture was centrifuged at 70 relative centrifugal force (RCF) for 3 minutes at RT, and the supernatant was discarded. Pre-warmed InVitroGRO CP medium (BioreclamationIVT, Cat # S03316) was added to the cell pellet to gently re-suspend cells. The cells were seeded at the density of 5.810.sup.4 cells per well to collagen I coated 96-well plate (Gibco, Cat. A1142803) with the InVitroGRO CP medium. All plates were incubated at 37 C. with 5% CO.sub.2 and 85% humidity.

(328) At 20 hours after plating, the medium was changed to PHH culture medium (Dulbecco's Modified Eagle Medium (DMEM)/F12 (1:1) (Gibco, Cat. 11320-033), 10% fetal bovine serum (Gibco Cat. 10099141), 100 U/mL penicillin, 100 g/mL streptomycin (Gibco, Cat. 151401-122), 5 ng/mL human epidermal growth factor (Invitrogen Cat. PHG0311L), 20 ng/mL dexamethasone (Sigma, Cat. D4902) and 250 ng/mL human recombinant insulin (Gibco, Cat. 12585-014)). And the cells were incubated at 37 C. with 5% CO.sub.2 and 85% humidity for 4 hours. The medium was then changed to pre-warmed PHH culture medium containing 4% polyethylene glycol (PEG) MW8000 (Sigma, Cat. P1458-50ML) and 1% DMSO (Sigma, Cat. D2650). 5.810.sup.6 genomic equivalents of HBV were added into the medium.

(329) At 24 hours post-infection, the cells were gently washed with PBS and refreshed with PHH culture medium supplemented with 1% DMSO, and 0.25 mg/mL Matrix gel (Corning, Cat. 356237) at 200 L per well. All plates were immediately placed in at 37 C. CO.sub.2 incubator.

(330) 24 hours later, serial dilutions of compounds made with DMSO were further diluted with the same culture medium (PHH culture medium supplemented with 1% DMSO and 0.25 mg/mL Matrix gel as described above) before they were added to the cells to reach desired final compound concentrations and 1% DMSO concentration. The medium containing the compounds were refreshed every three days.

(331) At 9 days post-compound treatment, extracellular HBsAg level were measured with Chemiluminescence Immuno Assay (CLIA) kit (Autobio, HBsAg Quantitative CLIA). Extracellular HBV DNA was extracted by MagNA Pure 96 system (Roche) and then determined by quantitative PCR with the following primers and probe: HBV-Forward Primer (SEQ ID NO:2): AAGAAAAACCCCGCCTGTAA (5 to 3); HBV-Reverse Primer (SEQ ID NO:3): CCTGTTCTGACTACTGCCTCTCC(5 to 3); HBV-Probe: 5+tetramethylrhodamine+SEQ ID NO:4+black hole quencher 2-3, wherein SEQ ID NO:4 is CCTGATGTGATGTTCTCCATGTTCAGC.

(332) HBsAg IC.sub.50 and HBV DNA IC.sub.50 values were derived from the dose-response curve using 4 parameter logistic curve fit method. Results of Cryopreserved PHH assay are given in Table 2 and Table 3.

(333) TABLE-US-00002 TABLE 2 HBsAg IC.sub.50 data in Cryopreserved PHH assay HBsAg IC.sub.50 Example No. (M) Swertianolin >100 2 1.33 3 1.64 4 1.58 5 17.8 6 5.06 26 1.17 39 3.18 40 1.69 41 8.08 42 7.74 43 8.22 44 12.4 53 8.12 66 8.48 67 1.29

(334) TABLE-US-00003 TABLE 3 HBV DNA IC.sub.50 in Cryopreserved PHH assay Example No. IC.sub.50 (M) 2 2.30 3 1.61 4 1.93 5 9.62

(335) The features disclosed in the foregoing description, or the following claims, expressed in their specific forms or in terms of a means for performing the disclosed function, or a method or process for attaining the disclosed result, as appropriate, may, separately, or in any combination of such features, be utilized for realizing the invention in diverse forms thereof.

(336) The foregoing invention has been described in some detail by way of illustration and example, for purposes of clarity and understanding. It will be obvious to one of skill in the art that changes and modifications may be practiced within the scope of the appended claims. Therefore, it is to be understood that the above description is intended to be illustrative and not restrictive. The scope of the invention should, therefore, be determined not with reference to the above description, but should instead be determined with reference to the following appended claims, along with the full scope of equivalents to which such claims are entitled.

(337) The patents, published applications, and scientific literature referred to herein establish the knowledge of those skilled in the art and are hereby incorporated by reference in their entirety to the same extent as if each was specifically and individually indicated to be incorporated by reference. Any conflict between any reference cited herein and the specific teachings of this specifications shall be resolved in favor of the latter. Likewise, any conflict between an art-understood definition of a word or phrase and a definition of the word or phrase as specifically taught in this specification shall be resolved in favor of the latter.